Biosynthesis of Benzylic Derivatives in the Fermentation Broth of the Edible Mushroom, Ischnoderma resinosum

Article abstract of DOI:10.1021/acs.jafc.9b07218

Employing isotope incubation studies, the biosynthetic pathway leading to a series of benzylic derivatives was elucidated in the fermentation broth of the edible mushroom Ischnoderma resinosum (P. Karst). Twenty-six hydroxy- and methoxy- benzylic derivatives were screened by gas chromatography-mass spectrometry (GC-MS) of which 13 were detected in the culture media. Results from the isotope incubation studies showed the transformation of both benzyl alcohol and benzoic acid into benzaldehyde. Benzaldehyde was then converted into 4-methoxybenzaldehyde via hydroxylation and subsequent methylation of the 4-C position. The resulting 4-methoxybenzaldehyde was then hydroxylated in the 3-C position followed by methylation into 3,4-dimethoxybenzaldehyde. Based on these findings, a novel metabolic scheme for the biosynthesis of benzylic derivatives in I. resinosum was proposed. The knowledge of the biosynthetic pathway was utilized to produce 4-hydroxy-3-methoxybenzaldehyde (vanillin) from 4-hydroxy-3-methoxybenzoic acid (vanillic acid). This is the first report to elucidate the biosynthetic pathway of benzyl derivatives and production of vanillin from I. resinosum.

Full text of DOI:10.1021/acs.jafc.9b07218

pubs.acs.org/JAFC
Article
Biosynthesis of Benzylic Derivatives in the Fermentation Broth of
the Edible Mushroom, Ischnoderma resinosum
Purni C. K. Wickramasinghe and John P. Munafo, Jr.*
Cite This: https://dx.doi.org/10.1021/acs.jafc.9b07218
Read Online
Metrics & More
Article Recommendations
ACCESS
ABSTRACT: Employing isotope incubation studies, the biosynthetic pathway leading to a series of benzylic derivatives was
elucidated in the fermentation broth of the edible mushroom Ischnoderma resinosum (P. Karst). Twenty-six hydroxy- and methoxy-
benzylic derivatives were screened by gas chromatography−mass spectrometry (GC−MS) of which 13 were detected in the culture
media. Results from the isotope incubation studies showed the transformation of both benzyl alcohol and benzoic acid into
benzaldehyde. Benzaldehyde was then converted into 4-methoxybenzaldehyde via hydroxylation and subsequent methylation of the
4-C position. The resulting 4-methoxybenzaldehyde was then hydroxylated in the 3-C position followed by methylation into
3,4-dimethoxybenzaldehyde. Based on these findings, a novel metabolic scheme for the biosynthesis of benzylic derivatives in I.
resinosum was proposed. The knowledge of the biosynthetic pathway was utilized to produce 4-hydroxy-3-methoxybenzaldehyde
(vanillin) from 4-hydroxy-3-methoxybenzoic acid (vanillic acid). This is the first report to elucidate the biosynthetic pathway of
benzyl derivatives and production of vanillin from I. resinosum.
KEYWORDS: I. resinosum, biosynthesis, benzaldehyde, 4-methoxybenzaldehyde, 3,4-dimethoxybenzaldehyde, vanillin
fungus, belongs to the order Polyporales and family
Ischnodermataceae (Ju
lich).13 Ischnoderma resinosum is capa-
INTRODUCTION
■
̈
The demand for natural flavor compounds has grown in recent
years due to increased consumer preference for products of
natural origin. Although plants were considered the major
source of flavor compounds historically, the difficult and
expensive nature of isolation, as well as low yields, make
natural flavor production from plants a less sustainable option
than microbial fermentation. These circumstances have led to
the utilization of fungi, such as white-rot basidiomycetes, as a
viable alternative for biotechnological production of natural
flavor compounds.1,2 Natural flavor compounds are defined as
compounds obtained from living cells, including food-grade
microorganisms and their enzymes according to United States
and European legislature.3,4 For example, synthetic 4-hydroxy-
3-methoxybenzaldehyde (vanillin) is primarily used in the food
and flavor industry due to the high cost of natural vanillin
production.5 However, in recent years, the consumer demand
for naturally derived ingredients has stimulated the search for
alternative means of natural vanillin production.6−10 An
alternative source to produce natural vanillin is white-rot
fungi. For example, Phanerochaete chrysosporium can convert
ferulic acid to vanillin that can be marketed as “natural vanillin”
due to its definition in the United States and European
legislature.3,4,11,12
ble of fermenting natural substrates, such as L-phenylalanine or
tyrosine, to produce a wide variety of flavor compounds.14,15
Benzylic derivatives including benzaldehyde, 4-methoxyben-
zaldehyde, and 3,4-dimethoxybenzaldehyde were previously
reported in the I. resinosum fermentation broth with a
distinctively pleasant “candy-like” odor in our laboratory.16
Fungal benzylic derivatives are enzyme-dependent and
species-specific.6,17−19 For example, peroxidase enzymes,
including lignin peroxidase (LiP) and manganese peroxidase
(MnP), have been identified in a wide variety of fungi,
including I. benzoinum.20 These enzymes are involved in the
biosynthesis of hydroxylated benzylic derivatives.19 Further-
more, enzymes that oxidize aryl alcohols, including benzyl,
4-methoxybenzyl, and 3,4-dimethoxybenzyl alcohols, to their
corresponding aldehydes such as aryl-alcohol oxidase (AAO)
and laccase have been characterized in fungi.21,22 Other
intracellular dehydrogenase enzymes such as aryl-aldehyde
dehydrogenase (AADD) and aryl-alcohol dehydrogenase
(AAD), which reduce aromatic acids to aldehydes and
aromatic aldehydes to alcohols, have also been identified in
fungi such as Pleurotus eryngii.23,24
While biosynthetic pathways for the production of benzylic
derivatives in other basidiomycetes have been investigated in
Fungi are a source of compounds with food, flavor, and
pharmaceutical applications. Examples of compounds with
commercial applications include benzyl alcohol and benzalde-
hyde from Bjerkundera adusta, Ischnoderma benzoinum,
Dichomitus squalens, Polyporus tuberaster as well as 4-
methoxybenzyl compounds from Bjerkundera and Pleurotus
spp.2,6,11 Ischnoderma resinosum (P. Karst), a ligninolytic
Received: November 14, 2019
Revised: January 21, 2020
Accepted: January 23, 2020
https://dx.doi.org/10.1021/acs.jafc.9b07218
J. Agric. Food Chem. XXXX, XXX, XXX−XXX
© XXXX American Chemical Society
A

Journal of Agricultural and Food Chemistry
pubs.acs.org/JAFC
Article
the past, there have been no studies determining the
biosynthetic pathway for the benzylic derivative production
in I. resinosum.25,26 Therefore, the aim of this study was to
elucidate the biosynthetic pathway to produce benzaldehyde,
4-methoxybenzaldehyde, and 3,4-dimethoxybenzaldehyde in a
fermentation broth. In addition, this study also aimed to utilize
the knowledge of the biosynthetic pathway in production of
natural benzylic derivatives, using production of commercially
valuable natural vanillin as one example. Accordingly, the
objectives were to; (1) cultivate the fungus in liquid broth and
incubate the fermentations with isotopically labeled precursors,
(2) elucidate the biosynthetic pathway using labeled isotope
studies coupled with gas chromatography−mass spectrometry
(GC−MS), and (3) utilize the knowledge of the biosynthetic
pathway to produce natural vanillin via fermentation.
Table 1. List of Putative Precursor and Intermediate
Compounds Produced in Fungal Fermentations and Their
Linear Retention Indices
c
RI
a
b
no.
compound
FFAP
DB-5
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
anisole*
1275
1569
1829
1973
1982
2256
2397
2405
2552
2613
2679
2694
2751
2755
2758
2768
2839
2849
2868
2894
2984
3085
3158
3442
3497
3657
921
960
1078
988
benzaldehyde*
benzyl alcohol*
phenol*
4-methoxybenzaldehyde*
4-methoxybenzyl alcohol*
3,4-dimethoxybenzaldehyde*
benzoic acid*
4-hydroxy-3-methoxybenzaldehyde
3,4-dimethoxybenzyl alcohol*
3-hydroxybenzaldehyde
4-hydroxy-3-methoxybenzyl alcohol
4-methoxybenzoic acid*
3,4-dihydroxybenzaldehyde
3-hydroxy-4-methoxybenzaldehyde*
3-hydroxy-4-methoxybenzyl alcohol
4-hydroxybenzaldehyde*
4-hydroxybenzyl alcohol
3-hydroxybenzyl alcohol
1254
1282
1479
1168
1400
1500
1371
1450
1225
2487
1455
1463
1362
1345
1349
1590
2363
1591
2340
2523
2179
2374
MATERIALS AND METHODS
■
Microorganism. The strain, UT-PW019, used in a previous study,
was isolated from a mature basidiocarp. Internal transcribed spacer
(ITS) sequencing results and phenotypical characteristics led to the
identification of UT-PW019 as I. resinosum.16 The fungal isolate was
decontaminated using 10% bleach solution for 10 min and sterile
deionized water for 15 min. Upon decontamination, the specimen was
cultured on Petri dishes containing potato dextrose agar (PDA)
(Himedia, India).16 Fermentations were maintained at 25 °C in a
MIR-254 cooled incubator (Panasonic Healthcare Co., Ltd., Japan).
Species confirmation for UT-PW019 was conducted via internal
transcribed spacer (ITS) sequencing with primers, ITS 4 (5′-
TCCTCCGCTTATTGATATGC) and ITS 5 (5′-GGAAG-
TAAAAGTCGTAACAAGG) as described previously.16,19 Fungal
isolates were cryopreserved at −80 °C in potato dextrose broth
(PDB) (Himedia, India), supplemented with glycerol (10%, v/v) as
frozen agar plugs using a Mr. Frosty freezing container (Thermo
Fisher Scientific, Fair Lawn, NJ) for future use. The ITS sequence was
deposited in the national center for biotechnology information
(NCBI) database under the GenBank accession number, MN633306.
Medium and Culture Conditions. Erlenmeyer flasks containing
PDB (85 mL) were inoculated with 7-day-old mycelia grown on PDA
homogenized in 100 mL of sterile deionized water (1 mL).
Fermentations were maintained aerobically at 25 °C and 120 rpm
on an advanced digital shaker (VWR, Radnor, PA).
3-hydroxy-4-methoxybenzoic acid
3,4-dihydroxybenzyl alcohol
3,4-dimethoxybenzoic acid*
3-hydroxybenzoic acid
3,4-dihydroxybenzoic acid
4-hydroxy-3-methoxybenzoic acid
4-hydroxybenzoic acid
a
Compounds numbered per retention time on FFAP column.
b
Identified by comparing retention indices on FFAP and DB-5
c
columns. Linear retention index (RI). *Indicates compound was
detected in fungal fermentations.
Scientific (Fair Lawn, NJ). A mixture of n-alkanes C9−C18 was
obtained from Phenomenex (Torrance, CA), and individual n-alkanes
C19−C26 as well as a mixture of n-alkanes C21−C40 were purchased
from Millipore Sigma (St. Louis, MO).
Reference Compounds. Reference standards 1−26 (Table 1)
purchased from Sigma-Aldrich (St. Louis, MO) were used to identify
putative precursor and intermediate compounds involved in the
biosynthesis of benzylic derivatives in fungal fermentations. Each
compound was identified using mass spectra of authentic reference
standards as well as retention indices (RI) on both FFAP and DB-5
columns. A mixture of n-alkanes (C9−C40) was analyzed using GC−
MS to obtain retention time for each hydrocarbon to calculate linear
retention indices.
Isotope Incubation Studies. Two fungal fermentation broth
cultures (75 g) were incubated with 1 mL of isotopically labeled and
unlabeled precursor compounds (1000 ppm) prepared in diethyl
ether at 25 °C and 120 rpm for a designated number of additional
days on an advanced digital shaker (VWR, Radnor, PA). The isotope
used, culture age at addition/isotope incubation time is as follows:
(2H5)-2, 1/5 days; (2H5)-2, 1/12 days; (2H5)-3, 1/5 days; (2H5)-3, 1/
12 days; (2H3)-5, 7/17 days; (2H6)-7, 7/14 days; (2H5)-8, 1/5 days;
(2H5)-8, 1/12 days; and (2H3)-25, 7/14 days. The fermentation broth
without the biomass from each incubation was then sequentially
extracted with freshly distilled diethyl ether (150 mL) on an
autoshaker (VWR) at ambient temperature for 10 min. Upon
extraction, the fermentations were centrifuged using a Sorvall RC5B
plus refrigerated centrifuge (Marshall Scientific, Hampton, NH)
operated at 2489 × g for 5 min and supernatants were collected.
Organic layers were isolated using a separatory funnel. The final
extracts were subjected to high vacuum distillation using solvent
assisted flavor evaporation (SAFE) maintained at 10−3 Pa, as
described previously.16 Briefly, each sample was gradually released
into the temperature-controlled evaporation flask (41 °C) until
completion. Upon completion, the distillate was thawed at room
temperature and dried over anhydrous sodium sulfate. Final samples
were then concentrated to ∼2 mL using a Vigreux column (50 × 1
cm2) and to 200 μL under a gentle stream of nitrogen as described
previously.16 High vacuum distillates were analyzed using GC−MS.
Isotopically Labeled Compounds. (2H5)-2, (2H5)-3, (2H3)-5,
(2H5)-8, and (2H3)-25 were purchased from C/D/N isotopes
(Quebec, Canada), and (2H6)-7 was purchased from aromaLAB
(Planegg, Germany). Positions of isotopic labels are as shown in
Figures 1, 3−6. Isotopically labeled compounds were dissolved in 5
mL volumetric flasks containing freshly distilled diethyl ether.
Compounds 2, 3, 8, and 25 were dissolved at known concentrations,
whereas compounds 5 and 7 were quantitated using isotopically
unmodified compounds as reference standards. The ions used for
each compound were as follows (unlabeled/labeled standard): 2, m/z
105/110; 3, m/z 79/84; 5, m/z 135/138; 7, m/z 166/172; 8, m/z
105/110; 25, m/z 151/154.
Solvents and Other Chemicals. Chromatographic-grade diethyl
ether and pentane were obtained from Honeywell Burdick & Jackson
(Muskegon, MI) and Millipore Sigma (St. Louis, MO), respectively.
Solvents were distilled in-house using a 250 mL CG-1233 series
distillation head from Chemglass Life Sciences (Vineland, NJ) prior
to use. Anhydrous sodium sulfate was purchased from Fisher
B
https://dx.doi.org/10.1021/acs.jafc.9b07218
J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Journal of Agricultural and Food Chemistry
pubs.acs.org/JAFC
Article
Figure 1. EI-MS spectra of (a) unlabeled and (b) labeled benzaldehyde produced when fermentations were incubated with (2H5)-benzyl alcohol.
Table 2. List of Isotopically Labeled Precursor Compounds, Corresponding Isotopically Labeled Products and Major Ions
Present in Their Electron Ionization-Mass Spectra (EI-MS) Identified after Incubation Studies
a
b
c
d
e
no.
2
labeled precursor
labeled product
2H5-benzyl alcohol
unlabeled ion
labeled ion
2H5 -2
108
121
135
166
105
105
135
166
138
151
166
168
105
135
166
151
154
113
125
139
169
110
110
139
169
141
154
169
174
110
139
169
154
157
2H4-4-hydroxybenzaldehyde
2H4-4-methoxybenzaldehyde
2H3-3,4-dimethoxybenzaldehyde
2H5-benzaldehyde
3
5
2H5 -3
2H5-benzoic acid
2H4-4-methoxybenzaldehyde
2H3-3,4-dimethoxybenzaldehyde
2H3-4-methoxybenzyl alcohol
2H3-3-hydroxy-4-methoxybenzaldehyde
2H3-3,4-dimethoxybenzaldehyde
2H6-3,4-dimethoxybenzyl alcohol
2H5-benzaldehyde
2H4-4-methoxybenzaldehyde
2H3-3,4-dimethoxybenzaldehyde
2H3-4-hydroxy-3-methoxybenzaldehyde
2H3 -5
7
8
2H6 -7
2H5 -8
25
2H3 -25
2H3-4-hydroxy-3-methoxybenzyl alcohol
a
b
c
Compounds numbered per retention indices on FFAP column. Isotopically labeled precursor compounds used. Isotopically labeled products
d
e
detected upon incubation. Major ion detected in the EI-MS spectra of the unlabeled product. Major ion detected in the EI-MS spectra of the
labeled product after incubation studies.
Each incubation experiment was performed in at least triplicate.
Incubation studies with each isotopically labeled compound were
designed based on a 30-day time course study evaluating the
production of benzaldehyde, 4-methoxybenzaldehyde, and 3,4-
dimethoxybenzaldeyde and conducted as described previously.16
Gas Chromatography−Mass Spectrometry (GC−MS). An
Agilent gas chromatograph (7820A series) coupled with an Agilent
mass spectrometer detector (5977B) was used for GC−MS analysis.
A Zebron ZB-FFAP GC capillary column from Phenomenex and a
HP-5MS capillary column from Agilent Technologies (both, 30 m ×
0.25 mm o.d. × 0.25 μm film thickness) were used for separations.
On-column injections of concentrated high-vacuum distillates (1 μL)
were made using an autosampler equipped with a 5 μL syringe at an
initial oven temperature of 35 °C. Helium gas at a constant flow rate
of 1 mL/min was used as the carrier gas. After the sample was
injected, oven temperature was increased to 60 °C at a 60 °C/min
C
https://dx.doi.org/10.1021/acs.jafc.9b07218
J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Journal of Agricultural and Food Chemistry
pubs.acs.org/JAFC
Article
rate, then ramped-up to 250 °C at a 6 °C/min rate, and held for 5
min. The MS was operated in electron impact (EI) ionization mode at
70 eV with a scan range of m/z 50−350. The MS source and MS
quadrupole were maintained at 230 and 150 °C, respectively.
RESULTS AND DISCUSSION
■
Identification of Benzylic Precursors and Intermedi-
ates. Prior to investigating the biosynthetic pathway, 26
potential precursors and intermediate compounds prepared in
diethyl ether (10 ppm) were subjected to GC−MS. These
compounds were used as analytical standards to screen for
metabolites involved in the biosynthetic pathway.16 Out of the
26 reference standards, 13 compounds including 1, 2, 3, 4, 5, 6,
7, 8, 10, 13, 15, 17, and 22 were identified in the
fermentations.
Figure 3. Conversions including, isotopically labeled (a) benzyl
alcohol to benzaldehyde, and vice versa, (b) benzoic acid to
benzaldehyde and benzyl alcohol, (c) benzyl alcohol, benzoic acid,
and benzaldehyde to 4-methoxybenzaldehyde and 3,4-dimethoxyben-
zaldehyde, and (d) benzaldehyde to the transient intermediate 4-
hydroxybenzaldehyde were observed.
Isotope Incubation Studies. Isotope incubation studies
conducted using putative benzylic derivative precursors (2H5)-
2, (2H5)-3, (2H3)-5, (2H6)-7, (2H5)-8, and (2H3)-25 led to the
identification of isotopically labeled intermediate compounds
involved in the biosynthetic pathway (Table 2).
previously reported to be able to produce benzaldehyde de
novo6,16 (Figures 1 and 2).
Additionally, results from the 12-day old incubations with
(2H5)-benzyl alcohol revealed the presence of isotopically
labeled 4-methoxybenzaldehyde and 3,4-dimethoxybenzalde-
hyde, suggesting that benzyl alcohol is a precursor of these
downstream benzylic derivatives (Figure 3).
(2H5)-Benzyl Alcohol. Isotopically labeled benzaldehyde
was detected in the 5-day old incubations with (2H5)-benzyl
alcohol. Findings suggested that benzyl alcohol is a precursor
to benzaldehyde (Figures 1−3). Aryl-alcohol oxidase (AAO)
(2H5)-Benzoic Acid. Isotopically labeled benzaldehyde and
benzyl alcohol were identified when the incubations with
(2H5)-benzoic acid were analyzed after 5 days. These findings
suggested that benzoic acid is a precursor for both
benzaldehyde and benzyl alcohol (Figure 3). A previous
study showed that intracellular dehydrogenases, such as aryl-
aldehyde dehydrogenase (AADD), reduced aromatic acids to
their corresponding aldehydes in another fungus, P. eryngii.22,24
Furthermore, the presence of isotopically labeled benzyl
alcohol also suggested that benzaldehyde is then reduced to
its corresponding alcohol as observed in P. eryngii, potentially
using aryl-alcohol dehydrogenase (AAD).21 Isotopically
labeled 4-methoxybenzaldehyde and 3,4-dimethoxybenzalde-
hyde were also detected when incubations were extended to 12
days. These results support benzoic acid is a precursor of
downstream benzylic derivatives (Figure 3).
(2H5)-Benzaldehyde. The analysis of the incubations with
(2H5)-benzaldehyde after 5 days led to the detection of
isotopically labeled benzyl alcohol and 4-hydroxybenzaldehyde
(Figure 3). The presence of labeled benzyl alcohol when
incubated with the respective aldehyde suggested the possible
presence of a mechanism involving the joint activity of AAO
and AAD, converting alcohol into aldehyde and vice versa as
previously reported.25 In addition, isotopically labeled
4-hydroxybenzaldehyde was identified in the high vacuum
distillate. A previous study reported that fungi produced an
enzymatic complex involved in lignin biodegradation including
lignin peroxidase (LiP).25 This enzyme has been identified to
be responsible for the biosynthesis of hydroxylated aldehydes
including 4-hydroxybenzaldehyde from benzaldehyde as an
intermediate in the biosynthetic pathway, in a wide variety of
white-rot fungi, potentially including I. resinosum.20
Figure 2. Extracted ion chromatograms of (a) unlabeled and (b)
labeled benzaldehyde produced when incubated with (2H3)-benzyl
alcohol.
has been reported to convert benzyl alcohol into benzaldehyde
via oxidation.21 The high-vacuum distillates prepared from the
incubations with unlabeled benzyl alcohol were used as a
control to ensure that the fungal growth was not inhibited due
to the carrier or the elevated compound concentrations.
Furthermore, the incubation with the unlabeled benzyl alcohol
also served as a control to evaluate the production of
isotopically labeled intermediates in the experimental in-
cubations with labeled benzyl alcohol. However, it is worth
noting that incubations with unlabeled benzyl alcohol still
produced unlabeled benzaldehyde, as I. resinosum has
Interestingly, 4-hydroxybenzaldehyde was not observed in
incubations analyzed after 12 days, indicating that
4-hydroxybenzaldehyde is more likely an intermediate in
production of 4-methoxybenzaldehyde and downstream
benzylic derivatives. To the best of our knowledge, this is
D
https://dx.doi.org/10.1021/acs.jafc.9b07218
J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Journal of Agricultural and Food Chemistry
pubs.acs.org/JAFC
Article
the first study to report the presence of 4-hydroxybenzalde-
hyde in I. resinosum fermentations, though 4-hydroxybenzalde-
hyde has been previously identified as an intermediate in the L-
phenylalanine degradation pathway of Bjerkandera adusta.25
While both 4-hydroxybenzyl alcohol and 4-hydroxybenzoic
acid were also identified in B. adusta fermentations, they were
not detected during the current study.25 These results
suggested that 4-hydroxybenzaldehyde gets methylated to
4-methoxybenzaldehyde due to the potential activity of 4-O-
methyltransferase as reported previously.27 Studies have shown
that 4-C methylation of hydroxyl groups is important, as free-
hydroxyl phenolic compounds are known to inhibit LiP
activity.28 Therefore, O-methyltransferases, such as 4-O-
methyltransferase, are known to accelerate lignin degradation
in white-rot fungi by converting the inhibitory groups into less
toxic methoxylated phenols.28 Both isotopically labeled 4-
methoxybenzaldehyde and 3,4-dimethoxybenzaldehyde were
identified in extended incubations after 12 days, indicating that
benzaldehyde is a precursor to downstream benzylic
derivatives.
methoxy substituent at the 2-C or 4-C position.29 3-O-
methyltransferase was also shown to be induced later than 4-O-
methyltransferase in the fungal growth cycle.27
Isotopically labeled 3,4-dimethoxybenzaldehyde was also
detected in the incubations. While enzymatic conversion of 4-
methoxybenzaldehyde into 3,4-dimethoxybenzaldehyde has
been reported previously, intermediaries involved in the
pathway have not been reported.25 This is the first study to
observe the conversion of 4-methoxybenzaldehyde into 3,4-
dimethoxybenzaldehyde via methylation of the intermediate 3-
hydroxy-4-methoxybenzaldehyde in I. resinosum.
(2H6)-3,4-Dimethoxybenzaldehyde. Isotopically labeled
3,4-dimethoxybenzyl alcohol was identified when incubations
with (2H6)-3,4-dimethoxybenzaldehyde were analyzed (Figure
5.). Intracellular AAD, known to reduce 3,4-dimethoxy-
(2H3)-4-Methoxybenzaldehyde. When the incubations
with (2H3)-4-methoxybenzaldehyde were analyzed, isotopically
labeled 4-methoxybenzyl alcohol, 4-methoxy-3-hydroxybenzal-
dehyde, and 3,4-dimethoxybenzaldehyde were identified
(Figure 4). The presence of labeled 4-methoxybenzyl alcohol
Figure 5. Isotopically labeled 3,4-dimethoxybenzaldehyde was
converted into 3,4-dimethoxybenzyl alcohol.
benzaldehyde to 3,4-dimethoxybenzyl alcohol using nicotina-
mide adenine dinucleotide phosphate (NADPH) as a cofactor,
was previously purified.20,21,24,30 Another report demonstrated
that AAD is able to reduce aryl aldehydes (benzyl-, 4-
methoxybenzyl-, and 3,4-dimethoxybenzyl- alcohols) into their
corresponding alcohols, similarly to current findings.31,32
Unlabeled 3,4-dimethoxybenzoic acid was identified in the
fermentations during precursor identification studies. While no
incubation studies with isotopically labeled 3,4-dimethoxyben-
zoic acid were performed, findings from previous studies
support that the AADD may convert 3,4-dimethoxybenzoic
acid into 3,4-dimethoxybenzaldehyde in the fermentations.25
(2H3)-4-Hydroxy-3-methoxybenzoic Acid (Vanillic
Acid). Fermentations did not appear to produce vanillin de
novo. However, 3-hydroxy-4-methoxybenzaldehyde (isovanil-
lin) was detected in the fermentations leading to the
conclusion that the fungus is able to add a hydroxyl group at
the 3-C position when the 4-C position is methoxylated and
not vice versa. One potential mechanism of vanillin production
in fungal fermentations includes methylation of the 3-C
hydroxyl group in 3,4-dihydroxybenzaldehyde, alcohol, or acid
via the activity of the metaspecific 3-O-methyltransferase.29
Another potential mechanism of vanillin production includes
the conversion of 3-hydroxybenzaldehyde, alcohol, or acid into
their corresponding dihydroxybenzyl derivative via hydrox-
ylation at the 4-C position followed by methylation at the 3-C
position.30 However, none of the potential precursors,
including 3,4-dihydroxybenzaldehyde, 3,4-dihydroxybenzyl
alcohol, 3,4-dihydroxybenzoic acid, 3-hydroxybenzaldehyde,
3-hydroxybenzyl alcohol, and 3-hydroxybenzoic acid, were
Figure 4. Isotopically labeled 4-methoxybenzaldehyde was converted
to 4-methoxybenzyl alcohol, 3-hydroxy-4-methoxybenzaldehyde, and
3,4-dimethoxybnzaldehyde.
suggested that AAD may convert 4-methoxybenzaldehyde into
4-methoxybenzyl alcohol. While no incubations with isotopi-
cally labeled 4-methoxybenzoic acid were conducted during
this study, unlabeled 4-methoxybenzoic acid was detected
during the initial screening of potential precursor and
intermediate compounds. The presence of unlabeled 4-
methoxybenzoic acid suggested that AADD may convert 4-
methoxybenzoic acid into 4-methoxybenzaldehyde similarly to
benzoic acid conversion to benzaldehyde.25
Isotopically labeled 3-hydroxy-4-methoxybenzaldehyde was
also identified. While no studies have previously identified 3-
hydroxy-4-methoxybenzaldehyde in I. resinosum, current
findings suggested that 3-hydroxy-4-methoxybenzaldehyde is
an intermediate in the conversion of 4-methoxybenzaldehyde
to 3,4-dimethoxybenzaldehyde. Harper et al. identified a 3-O-
methyltransferase, responsible for 3-O-methylation of 3-
hydroxy-4-methoxybenzoic acid by S-adenosylmethionine
(SAM) in P. chrysosporium.29 3-O-methyltransferase is
regiospecific, only methylating the 3-hydroxyl group of several
benzoic acids and aldehydes substituted with a hydroxy or a
E
https://dx.doi.org/10.1021/acs.jafc.9b07218
J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Journal of Agricultural and Food Chemistry
pubs.acs.org/JAFC
Article
detected during the precursor identification studies. Therefore,
we concluded that the fermentations are limited in vanillin
production due to the lack of precursor compounds in the
early stages of the biosynthetic pathway. No studies linking the
site-specific activity of LiP preferring the 4-C position over the
3-C position could be found in the literature.
The fungus’s ability to convert aromatic acids into their
corresponding aldehydes in combination with the successful
methylation of the 3-C hydroxyl group led to the evaluation of
vanillic acid to vanillin conversions in the fermentations. When
the incubation with (2H3)-4-hydroxy-3-methoxybenzoic acid
was analyzed, both isotopically labeled vanillin and vanillyl
alcohol were detected (Figure 6). A previous study reported
fermentation. This suggests that vanillin may be produced
through the co-cultivation of vanillic acid producing fungi with
I. resinousm. Studies are currently underway on co-cultivation,
growth dynamics, and production of benzylic derivatives
among different strains of I. resinosum and will be published
separately.
In conclusion, this is the first study to describe the
biosynthetic pathway for benzylic derivatives in I. resinosum
fermentation. Results from the study demonstrated conversion
of both benzyl alcohol and benzoic acid into benzaldehyde, as
well as benzaldehyde into 4-methoxybenzaldehyde via
hydroxylation and subsequent methylation at the 4-C position.
The resulting 4-methoxybenzaldehyde then transformed to
3,4-dimethoxybenzaldehyde via subsequent hydroxylation and
methylation at the 3-C position. Based on the available
literature, it is postulated that the benzylic derivatives may be
hydroxylated and/or methoxylated by intracellular enzymatic
activities of LiP, 4-O-methyltransferase, 3-O-methyltransferase,
AAD, AADD, and extracellular activities of AAO. However,
additional studies are required to support these hypotheses.
Based on isotope incubation studies, a novel biosynthetic
pathway for production of benzylic derivatives in I. resinosum
was proposed (Figure 7). The knowledge of the biosynthetic
pathway was utilized to produce vanillin from vanillic acid.
This study provides a foundation for future research
investigating the biosynthesis and potential applicability for
the commercial production of compounds with flavor and
pharmaceutical applications.
Figure 6. Isotopically labeled vanillic acid was converted to both
vanillin and vanillyl alcohol.
AUTHOR INFORMATION
Corresponding Author
that Pycnoporus cinnabarinus was able to successfully produce
natural vanillin from vanillic acid. The study utilized natural
vanillic acid produced by Aspergillus niger via the conversion of
ferulic acid, thereby creating a two-step bioreactor system to
produce natural vanillin.33 This current study demonstrates
natural vanillin production from I. resinosum via vanillic acid
■
John P. Munafo, Jr. − Department of Food Science, The
University of Tennessee, Knoxville, Tennessee 37996, United
States; orcid.org/0000-0003-4702-2955; Phone: 865-974-
7247; Email: jmunafo@utk.edu; Fax: 865-974-7332
Figure 7. Proposed biosynthetic pathway of major benzylic derivatives produced by I. resinosum. Compounds within brackets are putative
intermediates. Aryl-alcohol oxidases (AAO), aryl-alcohol dehydrogenase (AAD), aryl-aldehyde dehydrogenase (AADD), lignin peroxidase (LiP), 3-
O-methyltransferase (3OM), and 4-O-methyltransferase (4OM) are all potentially involved in the biosynthetic pathway.
F
https://dx.doi.org/10.1021/acs.jafc.9b07218
J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Journal of Agricultural and Food Chemistry
pubs.acs.org/JAFC
Article
(10) Cheetham, P. S. J. The use of biotransformations for the
production of flavors and fragrances. Trends Biotechnol. 1993, 35,
478−488.
(11) Patil, P. D.; Yadav, G. D. Comparative Studies of White-Rot
Fungal Strains (Trametes hirsuta MTCC-1171 and Phanerochaete
chrysosporium NCIM-1106) for Effective Degradation and Biocon-
version of Ferulic Acid. ACS Omega 2018, 3, 14858−14868.
(12) Rabenhorst, J.; Hopp, R. Process for the preparation of vanillin
and suitable microorganisms. U.S. Patent US6133003A2000.
(13) Justo, A.; Miettinen, O.; Floudas, D.; Ortiz Santana, B.;
Author
Purni C. K. Wickramasinghe − Department of Food Science,
The University of Tennessee, Knoxville, Tennessee 37996,
United States
Complete contact information is available at:
https://pubs.acs.org/10.1021/acs.jafc.9b07218
Notes
The authors declare no competing financial interest.
̈
̈
Sjokvist, E.; Lindner, D.; Nakasone, K.; Niemela, T.; Larsson, K.-H.;
Ryvarden, L.; Hibbett, D. S. A revised family-level classification of the
Polyporales (Basidiomycota). Fungal Biol. 2017, 121, 798−824.
(14) Hagedorn, S.; Kaphammer, B. Microbial biocatalysis in the
generation of flavor and fragrance chemicals. Annu. Rev. Microbiol.
1994, 48, 773−800.
ACKNOWLEDGMENTS
■
We gratefully acknowledge the assistance of Steve Roberts,
President of the Cumberland Mycological Society (CMS), in
providing the I. resinosum isolate used in this study. We would
also like to acknowledge Gwendolyn Casebeer from Asheville
Mushroom Club (AMC) for providing the photograph of the
fungal basidiocarp used in the table of the content graphic.
This work was supported by the USDA National Institute of
Food and Agriculture Hatch project #1016031.
(15) Janssens, L.; De Pooter, H. L.; Schamp, N. M.; Vandamme, E. J.
Production of flavours by microorganisms. Process Biochem. 1992, 27,
195−215.
(16) Wickramasinghe, P. C. K.; Munafo, J. P., Jr. Key Odorants from
the Fermentation Broth of the Edible Mushroom Ischnoderma
resinosum. J. Agric. Food Chem. 2019, 67, 2036−2042.
́
(17) Mester, T.; Swarts, H. J.; Romero Sole, S.; De Bont, J. A. M.;
Field, J. A. Stimulation of aryl metabolite production in the
basidiomycete Bjerkandera sp. strain BOS55 with biosynthetic
precursors and lignin degradation products. Appl. Environ. Microbiol.
1997, 63, 1987−1994.
ABBREVIATIONS USED
■
FFAP, free fatty acid phase; GC−MS, gas chromatography−
mass spectrometry; ITS, internal transcribed spacer; NCBI,
national center for biotechnology information; PCR, polymer-
ase chain reaction
́
(18) Gutierrez, A.; Caramelo, L.; Prieto, A.; Martinez, M. J.;
Martinez, A. T. Anisaldehyde production and aryl-alcohol oxidase and
dehydrogenase activities in ligninolytic fungi of the genus Pleurotus.
Appl. Environ. Microbiol. 1994, 60, 1783−1788.
NOMENCLATURE
■
(19) Kirk, T. K.; Farrell, R. Enzymatic “combustion”: the microbial
degradation of lignin. Annu. Rev. Microbiol. 1987, 41, 465−505.
L-phenylalanine, (2S)-2-amino-3-phenylpropanoic acid; tyro-
sine, (2)-2-amino-3-(4-hydroxyphenyl)propanoic acid; vanillic
acid, 3-methoxy-4-hydroxybenzoic acid; vanillyl alcohol, 3-
methoxy-4-hydroxybenzyl alcohol; vanillin, 3-methoxy-4-hy-
droxybenzaldehyde
́
(20) Pelaez, F.; Martínez, M. J.; Martínez, A. T. Screening of 68
species of basidiomycetes for enzymes involved in lignin degradation.
Mycol. Res. 1995, 99, 37−42.
(21) Muheim, A.; Waldner, R.; Leisola, M. S. A.; Fiechter, A. An
extracellular aryl-alcohol oxidase from the white-rot fungus
Bjerkandera adusta. Enzyme Microb. Technol. 1990, 12, 204−209.
REFERENCES
́
(22) Guillen, F.; Martinez, A. T.; Martinez, M. J.; Evans, C. S.
■
Hydrogen-peroxide-producing system of Pleurotus eryngii involving
the extracellular enzyme aryl-alcohol oxidase. Appl. Microbiol.
Biotechnol. 1994, 41, 465−470.
(1) Krings, U.; Berger, R. G. Biotechnological production of flavours
and fragrances. Appl. Microbiol. Biotechnol. 1998, 49, 1−8.
(2) Welsh, F. W.; Murray, W. D.; Williams, R. E.; Katz, I.
Microbiological and enzymatic production of flavour and fragrance
chemicals. Crit. Rev. Biotechnol. 1989, 9, 105−169.
(3) European Commission, Legislation L61; 31988R0602; Off. J.
Eur. Commun. L: Luxembourg, March 7, 1988, pp 61−65.
(4) Janssens, L.; De Pooter, H. L.; Schamp, N. M.; Vandamme, E. J.
Production of flavors by microorganisms. Process Biochem. 1992, 27,
195−215.
(5) Clark, G. S. Vanillin. Perfum. Flavor. 1990, 15, 45−54.
(6) Lapadatescu, C.; Feron, G.; Vergoignan, C.; Djian, A.; Durand,
A.; Bonnarme, P. Influence of cell immobilization on the production
of benzaldehyde and benzyl alcohol by the white-rot fungi Bjerkandera
adusta, Ischnoderma benzoinum and Dichomitus squalens. Appl.
Microbiol. Biotechnol. 1997, 47, 708−714.
(7) Zhu, J. C.; Chen, F.; Wang, L.; Niu, Y.; Chen, H.; Wang, H.;
Xiao, Z. Characterization of the key aroma volatile compounds in
cranberry (Vaccinium macrocarpon ait.) using gas chromatography−
olfactometry (gc-o) and odor activity value (OAV). J. Agric. Food
Chem. 2016, 64, 4990−4999.
́
(23) Guillen, F.; Evans, C. S. Anisaldehyde and veratraldehyde
acting as redox cycling agents for H2O2 production by Pleurotus
eryngii. Appl. Environ. Microbiol. 1994, 60, 2811−2817.
(24) Muheim, A.; Waldner, R.; Sanglard, D.; Reiser, J.; Schoemaker,
H. E.; Leisola, M. S. A. Purification and properties of an aryl-alcohol
dehydrogenase from the white-rot fungus Phanerochaete chrysospo-
rium. Eur. J. Biochem. 1991, 195, 369−375.
̀
́
́
(25) Lapadatescu, C.; Ginies, C.; Le Quere, J. L.; Bonnarme, P.
Novel scheme for biosynthesis of aryl metabolites from L-phenyl-
alanine in the fungus Bjerkandera adusta. Appl. Environ. Microbiol.
2000, 66, 1517−1522.
(26) White, T. J.; Bruns, T. D.; Lee, S. B.; Taylor, J. W.
Amplification and Direct Sequencing of Fungal Ribosomal RNA
Genes for Phylogenetics. In PCR − Protocols and Applications − A
Laboratory Manual; Academic Press: New York, 1990; pp 315−322.
(27) Coulter, C.; Kennedy, T.; McRoberts, W. C.; Harper, D. B.
Purification and properties of an S-adenosylmethionine 2,4-disub-
stituted phenol 0-methyltransferase from Phanerochaete chrysosporium.
Appl. Environ. Microbiol. 1993, 59, 706−711.
(28) Le Pham, T. M.; PhamYong, H. K. Discovery and
characterization of new O-methyltransferase from the genome of
the lignin-degrading fungus Phanerochaete chrysosporium for enhanced
lignin degradation. Enzyme Microb. Technol. 2016, 82, 66−73.
(29) Harper, D. B.; McRoberts, W. C.; Kennedy, J. T. Comparison
of the efficacies of chloromethane, methionine and S-adenosylme-
thionine as methyl precursors in the biosynthesis of veratryl alcohol
(8) Duarte, W. F.; Dias, D. R.; Oliveira, J. M.; Vilanova, M.; Teixeira,
J. A.; e Silva, J. B. A.; Schwan, R. F. Raspberry (Rubus idaeus L.) wine:
Yeast selection, sensory evaluation and instrumental analysis of
volatile and other compounds. Food Res. Int. 2010, 43, 2303−2314.
(9) Jensen, K. A., Jr; Evans, K. M. C.; Kirk, T. K.; Hammel, K. E.
Biosynthetic pathway for veratryl alcohol in the ligninolytic fungus
Phanerochaete chrysosporium. Appl. Environ. Microbiol. 1994, 60, 709−
714.
G
https://dx.doi.org/10.1021/acs.jafc.9b07218
J. Agric. Food Chem. XXXX, XXX, XXX−XXX

Journal of Agricultural and Food Chemistry
pubs.acs.org/JAFC
Article
and related compounds in Phanerochaete chrysosporium. Appl. Environ.
Microbiol. 1996, 62, 3366−3370.
(30) De Jong, E. D.; Field, J. A.; de Bont, J. A. M. Aryl alcohols in
the physiology of white-rot fungi. FEMS Microbiol. Rev. 1994, 13,
153−188.
(31) Jensen, K. A.; Evans, K. M. C.; Kirk, T. K.; Hammel, K. E.
Biosynthetic pathway for veratryl alcohol in the ligninolytic fungus
Phanerochaete chrysosporium. Appl. Environ. Microbiol. 1994, 60, 709−
714.
(32) Kawai, S.; Umezawa, T.; Higuchi, T. De novo synthesis of
veratryl alcohol by Coriolus versicolor. Wood Res. 1986, 73, 18−21.
(33) Lesage-Meessen, L.; Delattrea, M.; Haona, M.; Thibaultb, J. F.;
Ceccald, B. C.; Bruneriec; Asther, P. M. A two-step bioconversion
process for vanillin production from ferulic acid combining Aspergillus
niger and Pycnoporus cinnabarinus. J. Biotechnol. 1996, 50, 107−113.
H
https://dx.doi.org/10.1021/acs.jafc.9b07218
J. Agric. Food Chem. XXXX, XXX, XXX−XXX