In vivo evaluation of two tissue transglutaminase PET tracers in an orthotopic tumour xenograft model

Article abstract of DOI:10.1186/s13550-018-0388-2

Background: The protein cross-linking enzyme tissue transglutaminase (TG2; EC 2.3.2.13) is associated with the pathogenesis of various diseases, including cancer. Recently, the synthesis and initial evaluation of two high-potential radiolabelled irreversible TG2 inhibitors were reported by us. In the present study, these two compounds were evaluated further in a breast cancer (MDA-MB-231) tumour xenograft model for imaging active tissue transglutaminase in vivo. Results: The metabolic stability of [¹¹C]1 and [¹⁸F]2 in SCID mice was comparable to the previously reported stability in Wistar rats. Quantitative real-time polymerase chain reaction analysis on MDA-MB-231 cells and isolated tumours showed a high level of TG2 expression with very low expression of other transglutaminases. PET imaging showed low tumour uptake of [¹¹C]1 (approx. 0.5 percentage of the injected dose per gram (%ID/g) at 40–60?min p.i.) and with relatively fast washout. Tumour uptake for [¹⁸F]2 was steadily increasing over time (approx. 1.7 %ID/g at 40–60?min p.i.). Pretreatment of the animals with the TG2 inhibitor ERW1041E resulted in lower tumour activity concentrations, and this inhibitory effect was enhanced using unlabelled 2. Conclusions: Whereas the TG2 targeting potential of [¹¹C]1 in this model seems inadequate, targeting of TG2 using [¹⁸F]2 was achieved. As such, [¹⁸F]2 could be used in future studies to clarify the role of active tissue transglutaminase in disease.

Full text of DOI:10.1186/s13550-018-0388-2

van der Wildt et al. EJNMMI Research (2018) 8:39
https://doi.org/10.1186/s13550-018-0388-2
ORIGINAL RESEARCH
Open Access
In vivo evaluation of two tissue
transglutaminase PET tracers in an
orthotopic tumour xenograft model
Berend van der Wildt1,2* , Micha M. M. Wilhelmus2, Wissam Beaino1, Esther J. M. Kooijman1, Robert C. Schuit1,
John G. J. M. Bol2, John J. P. Breve2, Ralf Pasternack3, Adriaan A. Lammertsma1, Albert D. Windhorst1
and Benjamin Drukarch2
Abstract
Background: The protein cross-linking enzyme tissue transglutaminase (TG2; EC 2.3.2.13) is associated with the
pathogenesis of various diseases, including cancer. Recently, the synthesis and initial evaluation of two high-potential
radiolabelled irreversible TG2 inhibitors were reported by us. In the present study, these two compounds were evaluated
further in a breast cancer (MDA-MB-231) tumour xenograft model for imaging active tissue transglutaminase in vivo.
Results: The metabolic stability of [11C]1 and [18F]2 in SCID mice was comparable to the previously reported stability in
Wistar rats. Quantitative real-time polymerase chain reaction analysis on MDA-MB-231 cells and isolated tumours showed
a high level of TG2 expression with very low expression of other transglutaminases. PET imaging showed low tumour
uptake of [11C]1 (approx. 0.5 percentage of the injected dose per gram (%ID/g) at 40–60 min p.i.) and with relatively fast
washout. Tumour uptake for [18F]2 was steadily increasing over time (approx. 1.7 %ID/g at 40–60 min p.i.). Pretreatment
of the animals with the TG2 inhibitor ERW1041E resulted in lower tumour activity concentrations, and this inhibitory
effect was enhanced using unlabelled 2.
Conclusions: Whereas the TG2 targeting potential of [11C]1 in this model seems inadequate, targeting of TG2 using [18F]2
was achieved. As such, [18F]2 could be used in future studies to clarify the role of active tissue transglutaminase in disease.
Keywords: Transglutaminase type 2, Tissue transglutaminase, Positron emission tomography, MDA-MB-231
Background
conformation, which is associated with high-calcium and
Transglutaminases comprise a family of enzymes respon- low-guanosine diphosphate/guanosine triphosphate (GDP/
sible for the calcium-dependent intra- and intermolecular GTP) concentrations, the active site cysteine residue is ex-
cross-linking of proteins between the side chains of glutam- posed and transamidation can be expected [5]. In the
ine and lysine residues, forming an epsilon-(gamma-gluta- closed conformation, two consecutive C-terminal β-barrels
minyl)-lysine bond [1]. Tissue transglutaminase (TG2) is sterically limit transamidation activity [4]. Second, the
ubiquitously expressed and, under physiological conditions, redox state of TG2 determines its catalytic activity, since a
plays a role in, e.g. apoptosis, cell differentiation and cell Cys370-Cys371 disulphide bridge, despite locking TG2 in
migration [2, 3]. The cross-linking activity of this enzyme is its open conformation, hampers transamidation [6]. Finally,
tightly regulated by various mechanisms. First, TG2 exists cross-linking activity of TG2 is regulated by formation of
in two distinct conformations, referred to as closed and ternary protein complexes on the cell surface with extracel-
open conformations, respectively [4, 5]. Only in the open lular matrix proteins, such as fibronectin and membrane-
bound integrins [7]. Clearly, this multitude of regulatory
* Correspondence: bwildt@stanford.edu
mechanisms poses a challenge for assessing TG2 cross-
linking activity in vivo. Often changes in TG2 expression
levels or immunohistochemical detection of epsilon-
(gamma-glutaminyl)-lysine bonds are used as ex vivo
1Department of Radiology & Nuclear Medicine, VU University Medical Center,
De Boelelaan 1085, 1081HV Amsterdam, The Netherlands
2Department of Anatomy & Neurosciences, VU University Medical Center,
Amsterdam, The Netherlands
Full list of author information is available at the end of the article
© The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0
International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and
reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to
the Creative Commons license, and indicate if changes were made.

van der Wildt et al. EJNMMI Research (2018) 8:39
Page 2 of 13
biomarkers of TG2 activity. Alternatively, transglutami- Methods
nase mediated incorporation of systemically administered Cell culture
biotin-labelled amine substrates can be detected immuno- MDA-MB-231 human breast cancer cells were purchased
histochemically after sacrificing the test animal [8, 9]. from American Type Culture Collection (Rockville, MD,
TG2 is strongly associated with the pathogenesis of USA). Cells were cultured at 37 °C, 5% CO2 in Dulbecco’s
cancer, celiac disease, and fibrotic and neurodegenerative modified Eagle medium with 4.5 g/L glucose (Lonza, Basel,
diseases [10–15], in which its role is assumed to be re- Switzerland) with HEPES supplemented with L-glutamine
lated to its cross-linking activity. The fact that TG2 and fetal calf serum (5%).
knock-out mice are phenotypically healthy in a stress-
free environment has further boosted TG2 as a potential Xenograft model
target for therapeutic intervention [16]. Nowadays, a Severe combined immunodeficient (SCID) female mice
wide array of TG2 inhibitors has been developed [17]. (6–8 weeks, 20 to 25 g, Charles River, Wilmington, MA,
Nevertheless, further development of potent inhibitors USA) were housed in sterile cages under standard condi-
towards clinical studies, for example by evaluation in tions (24 °C, 60% relative humidity, 12-h light/dark cy-
animal models, has been limited. The availability of a cles) and provided with water and food ad libitum.
validated TG2 PET tracer is likely to stimulate in vivo MDA-MB-231
cells
(1 × 106)
were
injected
research of potent TG2 inhibitors, because it will allow orthotopically in the fat pad of the second thoracic
monitoring of target engagement in vivo by novel TG2 mammary glands (bilateral) [21]. Tumour dimensions
inhibitors [18]. As a result, a deeper understanding of were measured using a Vernier calliper, and tumour
TG2 biology in various diseases might be obtained.
volume was calculated using the formula (x2 y)/2 (x and
Recently, carbon-11 and fluorine-18 labelled small mol- y being the width and length, respectively) for an
ecule TG2 PET tracers have been developed by our group ellipsoid. At 8 weeks after MDA-MB-231 cell injection,
[19, 20]. [11C]1 (Fig. 1, IC50 53 nM) was selected out of tumours reached the target size of 200 mm3. This study
three carbon-11 labelled TG2 inhibitors based on its su- was performed according to national regulations and
perior metabolic stability [19]. In addition, [18F]2, a was approved by the Animal Experimentation Ethics
peptidic TG2 inhibitor (Fig. 1, IC50 104 nM), was Committee of the VU University Medical Center.
developed [20]. Despite being completely metabolised in
vivo after just 15 min post injection, imaging with [18F]2 QPCR analysis
was suggested as also the formed radiometabolite was Total messenger ribonucleic acid (mRNA) was isolated from
previously shown to be an equipotent inhibitor of TG2 MDA-MB-231 tumour cells or tumour tissue using Trizol
(IC50 45 nM) [20]. Both selected compounds, [11C]1 and Reagent (Invitrogen, Carlsbad, CA, USA) according to the
[18F]2, were able to discriminate between active and manufacturer’s instructions. RNA was reverse-transcribed
inactive tissue transglutaminase in vitro and demonstrated into complementary deoxyribonucleic acid (cDNA) using
specific and selective binding to MDA-MB-231 tumour the High-Capacity cDNA Reverse Transcription kit (Applied
sections, as assessed by in vitro autoradiography experi- Biosystems, Foster City, Ca, USA) using 0.5 μg oligo-dT
ments. However, in vitro autoradiography assays do not primers according to the manufacturer’s instructions. For
necessarily reflect in vivo biology. Therefore, the aim of the subsequent quantitative real-time polymerase chain re-
the present study was to determine whether these new action (qPCR), the Power SYBR Green Master Mix (Applied
tracers are able to target TG2 also in vivo. To this end, Biosystems) was used. Primers were purchased from Euro-
compounds [18F]1 and [18F]2 were evaluated in a mouse gentec (Maastricht, Netherlands), and qPCR was performed
MDA-MB-231 tumour xenograft model.
in MicroAmp Optical 96-well Reaction Plates (Applied
Fig. 1 Chemical structures and IC50 values of the TG2 inhibitors [11C]1, [18F]2, together with that of its in vivo formed metabolite [18F]M1 [19, 20].
The position of the carbon-11 label in [11C]1 is depicted by an asterisk

van der Wildt et al. EJNMMI Research (2018) 8:39
Page 3 of 13
Biosystems) on a StepOnePlus Real-Time PCR system analytical HPLC analysis by co-injection of radiolabelled
(Applied Biosystems). The reaction mixture (20 μL) was and unlabelled 2 using a Phenomenex Luna Phenyl-hexyl
composed of 1 × Power SYBR Green buffer (Applied Bio- column (5 μm, 250 mm × 4.6 mm) with H2O/MeCN/TFA,
systems), 3.75 pmol of each primer (see Table 1 for primer 60:40:0.1 (v/v/v) as eluent, with a flow rate of 1 mL/min, Rt
details), and 12.5 ng cDNA. The thermal cycling condi- 28 min.
tions were an initial 10 min at 95 °C followed by 50 cycles
of 15 s at 95 °C and 1 min at 60 °C. The specificity of the Metabolite analysis
reaction was checked by means of melt curve analysis. Healthy female SCID mice (20–25 g, Harlan, Horst, The
Relative expression levels of the target genes were deter- Netherlands) were injected in the tail vein with [11C]1 or
mined by LinRegPCR software (version 2014.3; website: [18F]2 (20 MBq) under isoflurane anaesthesia (2% in O2
http://www.hfrc.nl) using the following equation N0 = Nq/ at 1 L · min−1). Mice were sacrificed at 15 and 45 min
(E^Cq) (N0 = target quantity, Nq = fluorescence threshold post injection (n = 3 for each time-point) by cervical dis-
value, E = mean PCR efficiency per amplicon, Cq = thresh- location. Blood (~ 0.5–1 mL) was withdrawn by heart
old cycle) [22], after which the value was normalised to puncture, collected in a heparin-coated tube and centri-
the expression level of the reference gene glyceraldehyde- fuged at 5000 RPM to separate plasma from blood cells.
3-phosphate-dehydrogenase (GAPDH) using the following Solid phase extraction (SPE) cartridges (tC18, Waters,
formula (No,
interest/No, GAPDH). Results are Milford, MA, USA) were preconditioned by washing
gene of
expressed as gene expression relative to GAPDH stand- with methanol (MeOH, 6 mL) and H2O (two times
ard deviation (n = 4 for both tumour cells and tumour tis- 6 mL). Plasma (~ 0.2 mL) was mixed with 0.15 M HCl
sue measurements).
(0.2 mL) and loaded on the tC18 cartridge. The polar
fraction was obtained by elution of the cartridge with
H2O (3 mL), the non-polar fraction by subsequent elu-
tion with MeOH (1.5 mL) and H2O (0.5 mL). Both frac-
tions were counted for radioactivity in a gamma
Radiotracer synthesis
(S)-N-(6-(4-(6-methylpyridin-2-yl)piperazin-1-yl)-6-oxo-5-(2-
phenylacetamido)hexyl)[11C]acrylamide ([11C]1)
[11C]1 was synthesised as previously described (Scheme 1) counter. The percentage of intact tracer in the non-
[19] and was obtained in 20–28% decay corrected (d.c) polar fraction was determined by online and offline
yield based on [11C]CO with a molar activity of 144
HPLC analysis (Gemini C18 column (5 μm, 10 mm ×
22 GBq · μmol−1 and a radiochemical purity > 99% (n = 4). 250 mm, Phenomenex, Torrance, CA, USA) with
The identity of the product was confirmed by analytical eluent MeCN (A) and 0.1% TFA acid in H2O (B) as
high-performance liquid chromatography (HPLC) analysis eluent according to the following schemes; For [11C]1:
by co-injection of radiolabelled and unlabelled 1 using a 0 min, 70% B at 0.25 mL · min−1; 0.5 min, 70% B at
Phenomenex Luna Phenyl-hexyl column (5 μm, 250 mm ×
3.5 mL · min−1; 9.0 min, 10% B at 3.5 mL · min−1;
4.6 mm) with H2O/acetonitrile (MeCN), 7:3 (v/v) as eluent, 12.0 min, 10% B at 3.5 mL · min−1; 12.5 min, 70% B
with a flow rate of 1 mL/min, retention time (Rt) 9.0 min.
at 3.5 mL · min−1; 14.5 min, 70% B at 3.5 mL · min−1
and 15 min, 70% B at 0.25 mL · min−1 or for [18F]2:
0 min, 80% B at 0.25 mL · min−1; 0.5 min, 80% B at
3 mL · min−1; 6.0 min, 30% B at 3 mL · min−1; 12.0 min,
30% B at 3 mL · min−1; 12.5 min, 80% B at 3.0 mL · min−1;
14.5 min, 80% B at 3.0 mL · min−1; 15.0 min, 80% B
(S)-methyl 2-((S)-1-((7S,10S,E)-7-(4-diazo-3-oxobutyl)-1-(4-
[18F]fluorophenyl)-10-isopropyl-5,8-dioxo-3-oxa-2,6,9-
triazaundec-1-en-11-oyl)pyrrolidine-2-carboxamido)-4-
methylpentanoate ([18F]2)
[18F]2 was synthesised as previously described (Scheme 2) at 0.25 mL · min−1 (Rt = 11.5 min). Offline HPLC
[20] and was obtained in 3–4% d.c. yield, calculated at the analysis was performed when the online HPLC
time of the start of the synthesis, with a molar activity of analysis yielded a low signal to noise ratio. For offline
111 28 GBq · μmol−1 and a radiochemical purity > 98% analysis, HPLC fractions (30 s per fraction) were
(n = 4). The identity of the product was confirmed by collected and counted for radioactivity (WIZARD
Table 1 Primer sequences used for qPCR analysis
Gene
NCBI reference sequence
NM_002046.3
Forward (5′→3′)
Reverse (3′→5′)
Amplicon size (base pairs)
GAPDH
TGM1
TGM2
TGM3
TGM5
F13A1
TCAAGGGCATCCTGGGCTAC
CAATGTCTCAGGCCACGTC
AGAGGAGCGGCAGGAGTATG
AACCTGAAGATCGACGTGC
TCCTGGTGAACAAGATCATC
TCCGCAGAGGGCAGTCTTTC
CGTCAAAGGTGGAGGAGTGG
CCAGTAACGTGAGGGAGAGG
AGGATCCCATCTTCAAACTGC
CAGTTGCTTGGTGCCACTC
GTATGGAGAGTGGCTGGTTC
CCTGTGGGTAGCGACCAATGA
81
NM_000359.2
95
NM_004613.2
111
93
NM_003245.3
NM_201631.3
90
NM_000129.3
105

van der Wildt et al. EJNMMI Research (2018) 8:39
Page 4 of 13
Scheme 1 Radiosynthesis of [11C]1. Reagents and conditions: (i) [11C]CO, vinyl iodide, Pd2(dba)3, PPh3, tetrahydrofuran (THF), 5 min, 100 °C
2480 Compugamma, PerkinElmer, Waltham, MA, (Concorde, Ontario, Canada). The Jasco system consisted of
USA). The counting results were plotted to generate two pumps (X-LC 3180PU), a degasser (X-LC 3080DG), a
the corresponding HPLC chromatograms. Data were mixer (X-LC 3080MX), a column oven (X-LC 3080CO),
expressed as percentage of intact tracer, polar metabolites, and databoxes LV 2080-03 and LC-Net II/ACD. A Kinetex
and non-polar metabolites standard deviation.
C18 column (1.7 u, 100 A, 100 × 2.10 mm, Phenomenex,
Torrance, CA, USA) at 25 °C was used for chromatographic
separation with eluent MeCN (A) and 0.1% formic acid in
Metabolite characterisation
To healthy SCID mice (n = 2) 10 MBq [18F]2 diluted with H2O (B) according to the following scheme: 0 min, 90% B at
50 μg (2.5 mg · kg−1) of unlabelled 2 was administered, 0.5 mL · min−1; 3 min, 10% B at 0.5 mL · min−1; 5 min, 10%
corresponding to a molar activity of 0.14 GBq · μmol−1. At B at 0.5 mL · min−1; 5.5 min 90% B at 0.5 mL · min−1.
30 min post injection, animals were sacrificed under Capillary potential was set at 5.5 kV, source temperature at
isoflurane anaesthesia (2% in O2 at 1 L · min−1) by cervical 100 °C, and desolvation temperature at 750 °C. MRM Q1
dislocation. Blood (~ 1 mL) was collected by heart puncture. and Q3 set at 696.2–418.0 m/z for detection of compound 2
Blood plasma was separated using a SPE procedure as and 682.1–626.3 m/z for detection of M1.
described in the “Metabolite analysis” section (vide supra).
The non-polar fraction was analysed by HPLC and Liquid Chemical synthesis
chromatography–tandem mass spectrometry (LC-MS/MS)
General
in multiple reaction monitoring (MRM) mode. LC-MS/MS All reagents were obtained from commercial sources
analysis was performed on a Jasco system (Easton, PA, (Sigma Aldrich, St. Louis, USA). Solvents were obtained
USA) with an AB Sciex QTRAP 5500 mass spectrometer from Biosolve (Valkenswaard, the Netherlands) and used
Scheme 2 Radiosynthesis of [18F]2. Reagents and conditions: (i) K2CO3, [18F/K222], DMF, 15 min, 100 °C; (ii) (S)-4-(2-(aminooxy)acetamido)-5-(((S)-1-
((S)-2-(((S)-1-methoxy-4-methyl-1-oxopentan-2-yl)carbamoyl)pyrrolidin-1-yl)-3-methyl-1-oxobutan-2-yl)amino)-5-oxopentanoic acid, trifluoroacetic
acid (TFA), N,N-dimethylformamide (DMF)/THF, 30 min, 50 °C; (iii) isobutylchloride, N-methylmorpholine, DMF/THF, 5 min, − 10 °C, then CH2N2
(0.5 M in Et2O), 30 min, − 10 °C to rt

van der Wildt et al. EJNMMI Research (2018) 8:39
Page 5 of 13
as received unless stated otherwise. Dichloromethane
(S)-(3-Bromo-4,5-dihydroisoxazol-5-yl)methanamine (4)
(DCM) and DMF were dried over activated 3 Å molecu- A solution of 50% glyoxylic acid (15.0 mL, 135 mmol)
lar sieves. THF was first distilled from LiAlH4 and then and hydroxylamine hydrochloride (9.40 g, 135 mmol) in
stored on activated 3 Å molecular sieves. Reaction monitor- H2O (50 mL) was stirred for 2 h at room temperature
ing by thin-layer chromatography was performed on pre- (rt). Sodium bicarbonate was added (22.7 g, 270 mmol),
coated silica 60 F254 aluminium plates (Merck, Darmstadt, and the resulting solution was cooled on ice. Bromine
Germany). Spots were visualised by UV light or ninhydrin. was added dropwise (9.00 mL, 176 mmol), and the
Evaporation of solvents was performed under reduced pres- resulting solution was stirred overnight at rt. The mix-
sure at 40 °C using a rotary evaporator. Flash column chro- ture was extracted with DCM (three times 100 mL). The
matography was performed manually on Silica gel 60 Å combined organic fractions were dried on Na2SO4, fil-
(Merck, Darmstadt, Germany). Nuclear magnetic resonance tered and carefully concentrated in vacuo to afford
(NMR) spectroscopy was performed using a Bruker (Biller- dibromoformaldoxime 3 as a white solid (14.1 g, 52%),
1
ica, MA, USA) Avance 250 (250.13 MHz for H and 62. which was immediately used as such in the subsequent
90 MHz for 13C) or an Avance 500 (500.23 MHz for 1H and reaction. To a solution of allylamine hydrochloride (7.0 g,
125.78 MHz for 13C) with chemical shifts (δ) reported in 75 mmol) in H2O (100 mL) was added dibromoformal-
parts per million (ppm) relative to the solvent (chloroform doxime 3 (10 g, 49 mmol). To this solution was added
(CDCl3), 1H 7.26 ppm, 13C 77.16 ppm). Electrospray dropwise a solution of KHCO3 (6.0 g, 60 mmol) in H2O
ionisation-high resolution mass spectrometry (ESI-HRMS) (50 mL) over a 3-h period while stirring vigorously at rt.
was carried out using a Bruker microTOF-Q instrument in The resulting solution was stirred for another 3 h prior to
positive ion mode (capillary potential of 4500 V).
dilution with saturated NaHCO3 (100 mL). After extrac-
tion with DCM (three times 100 mL), the combined or-
ganic fractions were dried on Na2SO4 and concentrated in
vacuo. Flash column chromatography (DCM/MeOH, 9:1
(v/v)) afforded racemic (3-bromo-4,5-dihydroisoxazol-5-
yl) methanamine as a yellow oil (5.1 g, 58%). Enantiomeric
enrichment was performed as follows: to a solution of ra-
(S)-methyl 2-((S)-1-((7S,10S)-7-(4-diazo-3-oxobutyl)-1-(4-
fluorophenyl)-10-isopropyl-5,8-dioxo-3-oxa-2,6,9-
triazaundec-1-en-11-oyl)pyrrolidine-2-carboxamido)-4-
methylpentanoate (2)
The synthesis of unlabelled 2 was performed as pub- cemic (3-bromo-4,5-dihydroisoxazol-5-yl) methanamine
lished elsewhere [20]. (2.3 g, 12.9 mmol) and L-mandelic acid (1.0 g, 6.4 mmol)
Synthesis of ERW1041E was performed according to in hot MeOH was added dropwise hot isopropanol. The
published procedures (Scheme 3) [9]. Analytical character- solution was allowed to cool to rt and left for 16 h. The
izations were in accordance with reported values [9, 23].
solids were filtered off and recrystallization was performed
Scheme 3 Synthesis of ERW1041E. Reagents and conditions: (i) hydroxylamine hydrochloride, H2O, 2 h, room temperature (rt), then NaHCO3, Br2,
16 h, 0 °C to rt, 52%; (ii) allylamine hydrochloride, KHCO3, H2O, 3 h, rt, 50%; (iii) LiBH4, ethanol/THF, 2 h, − 80 °C, then CDI, MeCN, 2 h, rt, 78%; (iv)
proline methyl ester hydrochloride, DiPEA, DCM/DMF, 16 h, rt, 60%; (v) NaOH, dioxane/MeOH/H2O, 2 h, rt, 89%; (vi) amine 4, EDC, HOBt,
N-methylmorpholine, DMF, 2 h, rt, 96%

van der Wildt et al. EJNMMI Research (2018) 8:39
Page 6 of 13
out of a hot MeOH/isopropanol mixture until white crys- 127.96, 127.73, 127.00, 64.89, 64.78, 59.31, 58.92, 52.40,
talline needles were formed. After filtration, the needles 52.32, 47.10, 46.57, 31.01, 29.96, 24.40 and 23.57; ESI-
were dissolved in saturated NaHCO3 and the solution was HRMS: calculated for C17H18N2O4: 314.1267, found:
extracted with DCM (three times 20 mL). After drying on 315.1348; 337.1158 [M + H]+, [M + Na]+.
Na2SO4, filtration and concentration in vacuo, product 4
was obtained as a colourless oil 1.0 g, 87%). 1H NMR
((Quinolin-3-ylmethoxy)carbonyl)-L-proline (7)
(500 MHz, CDCl3): δ 4.74 (m, 1H), 3.25 (dd, 1H, J = 17.4, A solution of compound 6 (1.00 g, 3.18 mmol) in Tesser’s
10.7 Hz), 3.08 (dd, 1H, J = 17.0, 7.8 Hz), 3.01 (dd, 1H, base (dioxane/MeOH/4 M NaOH, 6:4:2 (v/v/v) 10 mL)
J = 13.5, 3.8 Hz) and 2.58 (dd, 1H, J = 13.5, 5.7 Hz); 13C was stirred for 2 h at rt prior to acidification to pH 4 with
NMR (125 MHz, CDCl3): δ 137.52, 83.11, 44.99 and 1 M HCl. The solution was extracted with DCM (six times
43.85; ESI-HRMS calculated for C4H7BrN2O: 177.9742, 20 mL). The combined organic fractions were dried on
found: 178.9811 [M + H]+.
Na2SO4, filtered and concentrated in vacuo, obtaining
compound 7 as a white solid (0.85 g, 89%). 1H NMR
(500 MHz, CDCl3, mixture of rotamers): δ 11.32 (br s,
Quinolin-3-ylmethyl 1H-imidazole-1-carboxylate (5)
A solution of quinolone-3-carbaldehyde (2.50 g, 15.9 mmol) 1H), 8.93 (s, 1H), 8.27 (s, 1H), 7.83–7.67 (m, 2H), 7.56–7.
in ethanol/THF (20 mL) was cooled to − 80 °C prior to the 41 (m, 2H), 5.56 (d, 1H, J = 13 Hz), 5.09 (d, 1H, J = 12.
addition of LiBH4 (0.34 g, 16 mmol). After stirring for 2 h, 6 Hz), 4.47–4.38 (m, 1H), 3.68–3.61 (m, 1H), 3.56–3.47
the mixture was quenched with 1 M HCl (100 mL) and (m, 1H), 2.32–2.10 (m, 2H) and 2.01–1.85 (m, 2H); 13C
allowed to reach rt. The resulting solution was diluted with NMR (500 MHz, CDCl3, mixture of rotamers): δ 175.58,
saturated NaHCO3 (100 mL) and extracted ethyl acetate 175.25, 154.97, 154.21, 149.16, 148.74, 144.34, 138.05, 137.
(EtOAc) (three times 50 mL). The collected EtOAc frac- 38, 130.75, 130.70, 130.04, 128.07, 127.98, 127.89, 127.70,
tions were dried on Na2SO4, filtered and concentrated in 127.61, 127.32, 125.98, 64.53, 64.19, 59.78, 59.45, 47.18,
vacuo to obtain quinolyn-3-ylmethanol as yellow oil. 46.72, 31.03, 29.88, 24.40 and 23.71; ESI-HRMS: calcu-
Quinolyn-3-ylmethanol (2.40 g, 15.1 mmol) was dissolved lated for C16H16N2O4: 300.1110, found: 301.1189; 323.
in MeCN (10 mL) and carbonyldiimidazole (4.90 g, 30. 1006 [M + H]+, [M + Na]+.
2 mmol) was added to this solution. After stirring for 2 h
at rt, the white precipitate was filtered and carefully washed Quinolin-3-ylmethyl (S)-2-((((S)-3-bromo-4,5-
with ice-cold acetonitrile (10 mL) obtaining compound 5 dihydroisoxazol-5-yl)methyl)carbamoyl)pyrrolidine-1-
as a white solid (2.98 g, 78%). 1H NMR (250 MHz, CDCl3): carboxylate (ERW1041E)
δ 9.01 (d, 1H, J = 2.2 Hz), 8.27 (d, 1H, J = 2.1 Hz), 8. A solution of carboxylic acid 7 (0.40 g, 1.3 mmol), amine
17–8.13 (m, 2H), 7.88 (dd, 1H, J = 8.1, 1.2 Hz), 7.79 4 (0.24 g, 1.3 mmol), 1-ethyl-3-(3-dimethylaminopropyl)
(m, 1H), 7.61 (m, 1H), 7.44 (m, 1H), 7.07 (dd, 1H, J = 1.8, carbodiimide (EDC, 0.28 g, 1.5 mmol), hydroxybenzo-
0.9 Hz) and 5.62 (s, 2H); 13C NMR (125 MHz, CDCl3): triazole (HOBt, 0.20 mg, 1.3 mmol) and N-methylmor-
δ 150.72, 148.65, 148.41, 137.25, 136.89, 131.01, 130.63, pholine (0.15 mL, 1.3 mmol) in DMF (5 mL) was stirred
129.53, 128.14, 127.55, 127.53, 126.87, 117.24 and 67.61.
for 2 h. The solution was concentrated in vacuo, and the
residue was purified by flash column chromatography
(DCM/MeOH, 25:1 (v/v)), obtaining the product as
colourless solid (0.59 g, 96%). 1H NMR (500 MHz,
2-Methyl 1-(quinolin-3-ylmethyl) (S)-pyrrolidine-1,2-
dicarboxylate (6)
To a solution of L-proline methyl ester hydrochloride (1. CDCl3, mixture of rotamers): δ 8.85 (m, 1H), 8.09 (m,
3 g, 7.9 mmol) and DiPEA (1.4 mL, 7.9 mmol) in DCM/ 2H), 7.78 (m, 1H), 7.67 (m, 1H), 7.52 (m, 1H), 7.07–6.91
DMF (1:1 (v/v), 10 mL) was added compound 5 (2.0 g, (m, 1H), 5.35–5.21 (m, 2H), 4.75–4.54 (m, 1H), 4.29 (m,
7.9 mmol) in DCM (5 mL) and the solution was stirred 1H), 3.65–3.35 (m, 4H), 3.18–2.80 (m, 2H) and 2.12–
at rt. for 16 h. After concentrating in vacuo, the residue 1.83 (m, 4H); 13C NMR (125 MHz, CDCl3, mixture
was dissolved in EtOAc and purified by flash column of rotamers): δ 173.19, 172.72, 155.32, 154.49, 150.63,
chromatography (hexane/EtOAc 3:2) obtaining com- 147.72, 138.00, 137.44, 135.56, 129.77, 129.22, 129.10,
pound 6 as a colourless oil (1.50 g, 60%). 1H NMR 127.91, 127.55, 126.94, 80.49, 80.21, 65.07, 64.89, 60.86,
(250 MHz, CDCl3, mixture of rotamers): δ 8.93 and 8.87 60.63, 47.55, 47.05, 43.80, 43.62, 41.78, 41.23, 31.47, 29.59,
(2× d, 1H, J = 2.2 Hz), 8.11 (dt, 1H, J = 12.1, 1.4 Hz), 7. 24.51 and 23.59; ESI-HRMS: calculated for
84–7.79 (m, 1H), 7.75–7.66 (m, 1H), 7.58–7.51 (m, 1H), C20H21BrN4O4: 460.0746, found: 461.0805, 483.0620
5.41–5.20 (m, 2H), 4.37 (dt, 1H, J = 8.9, 3.8 Hz), 3.73–3. [M + H]+, [M + Na]+.
45 (m, 5H) and 2.27–1.85 (m, 5H); 13C NMR (500 MHz,
CDCl3, mixture of rotamers): δ 173.21, 173.05, 154.66, PET imaging
154.04, 150.82, 150.61, 147.92, 147.88, 135.53, 135.26, Dynamic PET imaging was performed using dedicated
129.77, 129.74, 129.73, 129.52, 129.48, 129.35, 128.00, small animal NanoPET/CT and NanoPET/MR scanners

van der Wildt et al. EJNMMI Research (2018) 8:39
Page 7 of 13
(Mediso Ltd., Hungary, Budapest) [24, 25] with identical were dried and fixed with acetone (100%) for 10 min,
PET components. Mice (n = 4 per group) were anaesthe- dried at rt and subsequently rehydrated using TBS (three
tized with 4 and 2% isoflurane in 1 L · min−1 oxygen for times 5 min). Endogenous peroxidase activity was blocked
induction and maintenance, respectively. Mice were with 0.3% H2O2 and 0.1% NaN3 in TBS for 15 min and
positioned on the scanner bed, and the respiratory rate was then washed with TBS (three times 5 min). After blocking
monitored for the duration of the scan, adjusting with 3% bovine serum albumin (BSA) in TBS with 0.5%
anaesthesia when required. A dynamic PET scan was TritonX-100 (TBS-T) for 20 min, incubation with poly-
acquired
immediately
after
intravenous
(i.v.) clonal goat anti-guinea pig TG2 antibody (Upstate, Merck
administration (tail vein) of 5 MBq [11C]1 or [18F]2. For Millipore, Billerica, MA, USA) in TBS-T with 3% BSA
blocking experiments, mice were injected subcutaneously was performed overnight at 4 °C (dilution 1:4000). A nega-
with ERW1041E (50 mg · kg−1) dissolved in 20% tive control experiment was performed by omitting the
dimethylsulfoxide in 0.9% saline, 30 min prior to the primary antibody (results not shown). Sections were then
tracer injection. An additional blocking experiment was washed with TBS (three times 5 min) prior to incubation
performed by co-administration of compound 2 (50 μg, with biotinylated donkey anti-goat secondary antibody
75 nmol) and [18F]2, which corresponded with a molar (Jackson ImmunoResearch Laboratories Inc., West Grove,
activity of 0.07 GBq · μmol−1. PET scans were acquired in PA, USA, dilution 1:400) for 2 h at rt. Excess antibody was
list mode and rebinned into the following frame sequence: removed by washing with TBS (three times 5 min), and
4 × 5, 4 × 10, 2 × 30, 3 × 60, 2 × 300, 1 × 600, 1 × 900 and sections were incubated for 1 h with horseradish peroxid-
1 × 1200 s. In addition, a static [18F]2-fluoro-2-deoxy-D- ase avidin-biotin complex. After sequential washing with
glucose ([18F]FDG) scan was acquired for 30 min TBS (two times 5 min) and Tris-HCl (5 min), peroxidase-
immediately after [18F]FDG administration (10 MBq, tail mediated [1,1′-biphenyl]-3,3′,4,4′-tetraamine (DAB) oxi-
vein). At least a 24-h time interval between [18F]FDG dation was used for visualising TG2. Colouring was moni-
scans and [11C]1 or [18F]2 scans was maintained. tored ad oculos. After colouring was satisfactory, sections
Reconstruction was performed with a fully 3-dimensional were washed sequentially with Tris-HCl (two times 5 min)
(3D) reconstruction algorithm using four iterations and and water (5 min). Dehydration was carried out by se-
six subsets, resulting in an isotropic 0.4-mm voxel dimen- quential dipping in ethanol (70, 90, 96, 100 and 100%) and
sion. Images were analysed using the freely available xylene, and sections were mounted with coverslips using
AMIDE-software version 1.0.4 (retrieved from https:// Entellan. Microscopy images were obtained using a Leica
sourceforge.net/projects/amide/files/amide/1.0.4). Regions DN5000B microscope (Leica Microsystems, IL, USA).
of interest (ROIs) were drawn around the tumour tissue
and leg muscle. Results are expressed as percentage Histochemical staining
injected dose per gram (%ID/g). Error bars indicate stand- Histochemical staining of active TG2 was performed as
ard deviation. After PET scanning experiments, animals described previously [19]. MDA-MB-231 tumour sec-
were sacrificed by cervical dislocation, tumours were iso- tions (10 μm) were pre-incubated in 100 mM Tris-HCl
lated, and stored at − 80 °C until further use.
buffer (pH 7.4), 5 mM CaCl2, 1 mM dithiothreitol
(DTT) rt (20 min). As negative control, the selective
TG2 inhibitor Z006 was added to this solution at a final
Haematoxylin and eosin staining
MDA-MB-231 tumour sections (10 μm) were dried and concentration of 100 μM (results not shown). Next, sec-
fixed with acetone (100%) for 10 min and subsequently tions were incubated in 100 mM Tris-HCl buffer (pH 7.4),
dried at rt. Sections were then rehydrated in Tris buff- 5 mM CaCl2, 1 mM DTT and the TG2 amine donor sub-
ered saline (TBS; two times 5 min) and demiwater strate 5-(biotinamido)pentylamine (BAP; 0.05 mM) at
(5 min) and stained with Mayer’s haematoxylin solution 37 °C for 30 min. After a short wash with TBS and
(3 min) followed by rinsing with tap water (5 min). The water, the sections were dried at rt. Then, the sections
sections were stained with 1% eosin Y solution (10–30 s) were fixed with acetone for 10 min followed by washing
followed by dehydrating by sequential dipping in ethanol with Tris buffered saline (TBS). Sections were blocked
(70, 90, 96, 100 and 100%) and xylene. Sections were with 0.1% NaN3 and 0.3% H2O2 in TBS for 15 min,
then mounted with coverslips using Entellan. Micros- washed with TBS (three times 5 min) and incubated for
copy images were obtained using a Leica DN5000B 1 h with horseradish peroxidase avidin-biotin complex.
microscope (Leica Microsystems, IL, USA).
After washing (two times 5 min TBS, then 5 min Tris-
HCl), peroxidase was developed by addition of DAB
and colouring was monitored ad oculos. Nuclear stain-
Immunohistochemical staining
Immunohistochemical staining of TG2 was performed ing using haematoxylin was performed. Sections were
as described previously with minor modifications [19]. washed with Tris-HCl and water, dehydrated by se-
Fresh frozen MDA-MB-231 tumour sections (10 μm) quential dipping in ethanol (70, 90, 96, 100 and 100%)

van der Wildt et al. EJNMMI Research (2018) 8:39
Page 8 of 13
and xylene, and mounted with coverslips using Entel-
lan. Microscopy images were obtained using a Leica
DN5000B microscope (Leica Microsystems, IL, USA).
Autoradiography
Autoradiography was performed essentially as described
previously [20]. MDA-MB-231 tumour sections (10 μm)
were washed three times with 50 mM Tris-HCl buffer
(pH 7.4) for 5 min. Sections were dried under a gen-
tle air flow before incubation for 30 min with [18F]2
(0.1 MBq · mL−1) in 5 mM Tris-HCl, pH 7.4, 5 mM
CaCl2, 1 mM DTT. As a negative control inhibitor 1 was
added to this incubation solution at 100 μM (results not
shown). Washing was performed using 5 mM Tris-HCl
(three times) followed by dipping in ice cold water. After
drying in an air stream, tumour sections were exposed to
a phosphorimaging screen (GE Healthcare, Buckingham-
shire, UK) for 15 min and developed on a Typhoon FLA
7000 phosphor imager (GE Healthcare, Buckinghamshire,
UK). Visualisation of binding was performed using Image-
QuantTL v8.1.0.0 (GE Healthcare, Buckinghamshire, UK).
Fig. 2 Transglutaminase mRNA expression in MDA-MB-231 tumour cells
and in MDA-MB-231 tumour tissue. Results are expressed as relative values
to GAPDH mRNA expression standard deviation (n = 4;
**p < 0.005; ***p < 0.0005)
Statistical analysis
Where relevant, statistical analysis was performed using
either a one-tailed paired Student’s t test or a two-tailed
paired Student’s t test with a confidence interval of 95%.
PET scanning
Representative images (0–30 min for [18F]FDG scans
and last time-frame, 40–60 min, for [11C]1 and [18F]2)
and time-activity curves (TAC) of 60 min scans using
[11C]1 and [18F]2 under both baseline and blocking
conditions (n = 4 per group) are depicted in Fig. 4a, b,
respectively. The [18F]FDG scans revealed rather low
uptake in the centres of the tumours, indicating mainly
Results
mRNA expression of various human transglutaminases in
MDA-MB-231 cells and tumour xenograft tissue
The expression of various tumour-related transglutami-
nases was determined by means of qPCR on both in vitro
cultured MDA-MB-231 tumour cells and ex vivo MDA-
MB-231 tumour material obtained after tumour inoculation
in SCID mice. RNA expression levels of transglutaminase
types 1–3 and 5 and blood coagulation factor XIII (TG1,
TG2, TG3, TG5 and FXIII) were quantitatively determined
relative to GAPDH RNA expression (Fig. 2). In MDA-MB-
231 tumour cells as well as in tumour tissue, TG2 mRNA
was most abundant. Low levels of TG1 mRNA were ob-
served in both cells and tissue, whereas TG3 and TG5
mRNA were absent. FXIII mRNA was absent in cultured
MDA-MB-231 tumour cells, whereas in tumour tissue low
levels, relative to TG2 mRNA, were found.
Table 2 Plasma metabolite profile of [11C]1 and [18F]2 following
i.v. administration in healthy SCID mice and previously obtained
results following i.v. administration in healthy Wistar rats [19, 20]
[
11C]1
[
18F]2
Mouse
Rat
Mouse
Rat
15 min
Intact (%)
56 14
24 15
65
13
21
7
4
3
20
76
1
1
3
1
1
0
Non-polar (%)
Polar (%)
98
2
1
20
5
0.2
45 min
Intact (%)
24
28
47
1
8
7
29 11
3
2
2
1
0
0*
Metabolite analysis of [11C]1 and [18F]2 in SCID mice
In SCID mice, compound [11C]1 demonstrated moderate
metabolism, with 24% intact tracer after 45 min (Table 2).
Mainly polar metabolites were formed. [18F]2 was fully
metabolised to a single metabolite after 45 min. The
metabolite was identified by LC-MS/MS analysis as the
demethylated parent M1 (Fig. 3).
Non-polar (%)
Polar (%)
6
3
95
2
92 3*
3*
65 12
8
Following i.v. administration in healthy animals, anaesthetised using isoflurane,
blood plasma was obtained at 15 and 45 min. Blood plasma was separated
into a polar and non-polar fraction using a SPE method. Non polar fractions
were analysed on HPLC. Results are expressed as average percentage of total
blood plasma activity standard deviation (n = at least three per data point).
*Animals were sacrificed at 60 min post injection.

van der Wildt et al. EJNMMI Research (2018) 8:39
Page 9 of 13
Fig. 3 LC-MS/MS spectra following carrier added administration of [18F]2 to SCID mice. MRM mass transitions 696.2–418.0 m/z (corresponding to
2, red line) and 682.2–626.3 m/z (corresponding to M1, blue line). Left chromatogram: LC-MS/MS analysis of synthesised M1. Right chromatogram:
LC-MS/MS analysis of mouse plasma after administration of [18F]2. LC-MS/MS analysis indicated full conversion of 2 to M1
that the rims of the tumours were viable. Under baseline of the tumour, hinting at central necrosis. Immunohisto-
conditions, uptake of [11C]1 in the tumour at baseline chemical staining for TG2 expression (Fig. 5b) resulted
conditions showed a peak at 5–10 min after injection in a distribution pattern highly resembling the haema-
(Fig. 4a). Washout, however, was fast and activity toxylin/eosin staining, showing that TG2 is predomin-
concentrations were comparable to those in background antly expressed in the viable part of the tumours.
tissue (i.e. the muscle, right femur). Furthermore, Transglutaminase-mediated BAP incorporation (Fig. 5c)
blocking of TG2 by pretreatment with ERW1041E did and in vitro autoradiography employing [18F]2 (Fig. 5d),
not result in lower tumour activity levels, but rather both means of measuring the open (active) conformation
resulted in a counterintuitive significant increase in of transglutaminase, demonstrated a similar distribution
tumour activity, as well as in increased muscle activity pattern as observed with the anti-TG2 antibody and the
concentration. PET scanning using compound [18F]2 haematoxylin/eosin staining, i.e. incorporation of the sub-
showed a time-dependent accumulation in tumour tissue strate and inhibitor in the viable areas of tumour tissue.
up to 1.7 %ID/g at the 40–60 min time-frame, suggest-
ing irreversible tumour targeting. Background values Discussion
(the muscle, right femur) reached 0.8 %ID/g at this Transglutaminase mRNA expression in both MDA-MB-
time-point, which is significantly lower (p = 0.0004) and 231 tumour cells and xenograft tissue essentially was
did not display an increase in tissue activity over the limited to TG2 mRNA and exceeded other transglutami-
scanning period (Fig. 4b). Pretreatment of the animals nases by at least a factor ten. The detection of FXIII
with the TG2 inhibitor ERW1041E resulted in a decrease mRNA in tumour tissue, which is most likely derived
in activity accumulation in the tumour tissue to 1.4 from the blood component of the tumour tissue, does
%ID/g, although this difference was not statistically sig- not hamper the use of both [11C]1 and [18F]2 TG2 PET
nificant (p = 0.06). A drastic and significant decrease in tracers, as both compounds show no affinity for
tumour activity concentration, however, was observed activated FXIII [19, 20]. Consequently, these findings
when unlabelled 2 was co-administered, to approxi- imply that the MDA-MB-231 xenograft model is suitable
mately 1.0 %ID/g (p = 0.007).
for TG2 PET tracer evaluation.
Previously, metabolic stability of [11C]1 as well as [18F]2
was determined ex vivo in blood plasma of healthy Wistar
rats. This study, however, was performed in a xenograft
model in SCID mice, and therefore, the metabolic stability
TG2 expression in MDA-MB-231 tumour
tissue—immunohistochemistry and autoradiography on
tumour tissue
Following sacrifice of the animals, tumour sections were of both radiotracers was determined again in SCID mice
evaluated histochemically for TG2 expression and TG2 and results were compared with previously obtained rat
activity (representative sections of tumour tissues of data [19, 20]. Metabolism of both [11C]1 and [18F]2 in
three separate animals are shown in Fig. 5). In all tu- SCID mice highly resembled metabolism of these
mours, haematoxylin/eosin staining (Fig. 5a) demon- compounds in Wister rats. Conversion of [18F]2 to the
strated areas with low nuclei concentrations in the core demethylated analogue M1, still a potent TG2 inhibitor,

van der Wildt et al. EJNMMI Research (2018) 8:39
Page 10 of 13
Fig. 4 PET images and TACs of [11C]1 or [18F]2 in MDA-MB-231 tumour bearing SCID mice (n = 4 per group). Tumours are indicated with white
dotted ellipses, background tissue (muscle) is indicated with a red arrow. a Representative PET images of [18F]FDG scan and the last time-frame
(40–60 min) after administration of [11C]1 under baseline and blocking conditions, and TACs of tumour under baseline (blue line) and blocking
(red line) conditions and of background tissue under baseline (green line) and blocking (yellow line) conditions. b Representative PET images of
[
18F]FDG scan and the last time-frame (40–60 min) under baseline conditions, and after blocking (ERW1041E) and self-blocking with 2 after
administration of [18F]2, together with TACs of tumour under baseline (blue line) and blocking conditions (red and purple line), and of
background tissue under baseline (green line) conditions
followed the same pattern in both species, although in of determining selectivity of binding of TG2 radiotracers in
mice the conversion was less rapid. This difference is likely tumour tissue. ERW1041E was administered at 50 mg · kg−1,
a result of species-dependent esterase activity [26], and as it has been shown that this dose results in inhibition of
comparable differences between methylester hydrolysis in TG2 activity to background levels in a mouse model of
mice and rats have been reported elsewhere [27]. Import- pulmonary hypertension [9]. In addition, the maximum
antly, the peptidic backbone and the diazoketone function- TG2 inhibitory effect was observed 30 min after ERW1041E
ality in [18F]2, responsible for selective and irreversible administration [9].
binding, respectively, appear metabolically stable.
Compound [11C]1 showed poor tumour uptake and
To prevent the development of slow-growing and relatively fast washout from the tumour, which was
highly necrotic tumours, an orthotopic mouse model unexpected for an irreversibly binding radiotracer.
was used, in which tumour cells were inoculated in the Therefore, it is believed that the signal is indicative of
2nd thoracic mammary fat pad [21]. At this position perfusion rather than TG2 targeting. As both compound
minimal interference with surrounding organs such as 1 and ERW1041E inhibit TG2 by irreversibly binding to
liver and heart is expected, thus facilitating definition of the active site cysteine residue, a reduction in tumour
ROIs and PET data analysis. The use of the structurally uptake would be expected upon blocking with
unrelated TG2 inhibitor ERW1041E served as a means ERW1041E. The fact that both tumour and muscle

van der Wildt et al. EJNMMI Research (2018) 8:39
Page 11 of 13
assays is unknown as such experiments have not been
described [30].
In contrast to [11C]1, [18F]2 displayed higher tumour
uptake, which increased over time, indicating irreversible
binding of [18F]2 to the tumour tissue. Uptake decreased
after pretreating animals with ERW1041E, although the
difference was not statistically significant (p = 0.06). This
seemingly partial inhibition of TG2 might be due to the
limited TG2 inhibitory potency of ERW1041E (Ki: 11 μM
[23]) compared with compound 2, although previously it
has been shown that this compound was able to at least
partially inhibit intestinal TG2 in a mouse model [8] and
also in a mouse model of pulmonary hypertension to
baseline levels [9]. Alternatively, the chosen time-point for
pretreatment with ERW1041E (set at 30 min prior to
tracer administration) might not be optimal for full TG2
inhibition, although at this similar time-point a reduction
of TG2 activity by a factor of four in a pulmonary hyper-
tension model was observed [9]. The blocking effect when
co-administering unlabelled 2 and [18F]2 (p = 0.007),
implies that [18F]2 is useful for imaging of local TG2
activity in vivo by indicating specific binding of [18F]2.
However, to establish the selectivity of this uptake, more
studies are required.
Analysis of tumour sections showed that TG2 was
expressed mainly in the more viable rim of the tumours
and less in the necrotic core of the tumours. This de-
creased tumour viability in the core of the tumours is in
close accordance with [18F]FDG findings, which
generally displayed higher uptake in the outer tumour
areas. Because %ID/g was determined by drawing an
area over the full tumour volume, areas inside the
tumour that contain no tissue transglutaminase
potentially underestimate the actual potential of
Fig. 5 Immunohistochemistry and autoradiography on
representative MDA-MB-231 tumour sections (adjacent) obtained
from three representative tumours used in this study. a
Haematoxylin/eosin staining; b immunohistochemical detection
of TG2; c TG2 mediated incorporation of BAP; d autoradiography
using [18F]2. Scale bars: 1 mm
activity concentrations increased as a result of ERW1041E [18F]2 towards TG2 targeting. As PET images using
pretreatment suggests to us a decreased clearance of [18F]2 depicted higher activity concentrations in the
[11C]1 or its derived radioactive metabolites from the outer area of the tumour, for future research, it might
blood, although no further experiments were performed prove beneficial to perform such an imaging study at
to support this claim. Despite the promising results that an earlier time-point in tumour development, poten-
were previously obtained by in vitro autoradiography, tially limiting tumour necrosis and thus increasing
where high specific and selective binding of [11C]1 to signal to noise ratios.
MDA-MD-231 tumour sections was observed [19], [11C]1
Although previously relatively high tissue transgluta-
is not effective as a TG2 PET tracer in vivo. It is unlikely minase expression levels in MDA-MB-231 tumour cell
that this apparent ineffectiveness is a result of in vivo lysates were observed [10], and both TG2 expression
metabolism of [11C]1 over the time-course of these ex- and activity were further confirmed in xenografted
periments, as metabolism is moderate. Potentially, MDA-MB-231 tumour tissue by means of immunohisto-
large differences between in vitro TG2 inhibitory po- chemistry and in vitro autoradiography [19, 20], it is un-
tency and inhibition in actual biological systems could known to what extent TG2 shows transamidation
explain the inability of this compound to image active activity in a biological setting such as the present MDA-
TG2 in vivo. Different classes of acryl amide based MB-231 tumour model. Obviously, only in the open
TG2 inhibitors, although highly potent against isolated TG2 conformation, active site-directed PET tracers can
TG2, have shown a reduction in inhibitory potency in be successfully applied for TG2 imaging [5, 18]. There-
cell or cell lysate assays [28, 29]. The inhibitory po- fore, it is expected that primarily extracellular TG2,
tency of compound 1 in similar cell or cell lysate which is more likely to be in an open conformation due

van der Wildt et al. EJNMMI Research (2018) 8:39
Page 12 of 13
to high extracellular calcium concentrations, will be ac-
cessible for such tracers [18]. Previous in vitro studies
have demonstrated that TG2 is highly expressed on the
plasma membrane of MDA-MB-231 tumour cells [31].
Furthermore, pharmacological inhibition of TG2 on MDA-
MB-231 cells using cell-impermeable small molecule in-
hibitors or antibodies resulted in decreased cell migration
[31, 32] and decreased invasiveness [33], which are both
hallmarks of cancer [34]. Based on these findings, it is ex-
pected that the accumulation of activity in the tumour
using [18F]2 is due to targeting of extracellular TG2.
Evidence suggests that extracellular TG2 plays a role in
tumour progression by means of its transamidation
activity, and therefore, the MDA-MB-231 tumour model
appears suitable for evaluation of TG2 PET tracers in vivo,
which is supported by the imaging results using [18F]2.
Together, the in vivo targeting of TG2 PET tracers is
evaluated for the first time and the results suggest that
[18F]2 could be used in future research, for example for
evaluation of target engagement of other TG2 inhibitors.
Ethics approval and consent to participate
Not applicable
Competing interests
R.P. is a shareholder and an employee of Zedira GmbH, a biotech company
specialised in transglutaminases.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in
published maps and institutional affiliations.
Author details
1Department of Radiology & Nuclear Medicine, VU University Medical Center,
De Boelelaan 1085, 1081HV Amsterdam, The Netherlands. 2Department of
Anatomy & Neurosciences, VU University Medical Center, Amsterdam, The
Netherlands. 3Zedira GmbH, Darmstadt, Germany.
Received: 28 February 2018 Accepted: 16 April 2018
References
1. Greenberg CS, Birckbichler PJ, Rice RH. Transglutaminases: multifunctional
cross-linking enzymes that stabilize tissues. FASEB J. 1991;5:3071–7.
2. Gundemir S, Colak G, Tucholski J, et al. Transglutaminase 2: a molecular
Swiss army knife. Biochim Biophys Acta Mol Cell Res. 1823;2012:406–19.
3. Fesus L, Szondy Z. Transglutaminase 2 in the balance of cell death and
survival. FEBS Lett. 2005;579:3297–302.
4. Liu S, Cerione RA, Clardy J. Structural basis for the guanine nucleotide-
binding activity of tissue transglutaminase and its regulation of
transamidation activity. PNAS. 2002;99:2743–7.
5. Pinkas DM, Strop P, Brunger AT, et al. Transglutaminase 2 undergoes a large
conformational change upon activation. PLoS Biol. 2007;5:2788–96.
6. Stamnaes J, Pinkas DM, Fleckenstein B, et al. Redox regulation of
transglutaminase 2 activity. J Biol Chem. 2010;285:25402–9.
7. Akimov SS, Krylov D, Fleischman LF, et al. Tissue transglutaminase is an integrin-
binding adhesion coreceptor for fibronectin. J Cell Biol. 2000;148:825–38.
8. Dafik L, Albertelli M, Stamnaes J, et al. Activation and inhibition of
transglutaminase 2 in mice. PLoS One. 2012;7:e30642.
Conclusions
TG2 PET tracers [11C]1 and [18F]2 were evaluated in an
MB-MDA-231 breast cancer mouse model. Whereas the
TG2 targeting potential of [11C]1 in this model seemed
inadequate, [18F]2 showed signs of TG2 targeting, as
tumour activity concentrations were steadily increasing
over time and could be blocked with TG2 inhibitors.
Abbreviations
9. DiRaimondo TR, Klöck C, Warburton R, et al. Elevated transglutaminase 2
activity is associated with hypoxia-induced experimental pulmonary
hypertension in mice. ACS Chem Biol. 2013;9:266–75.
10. Mehta K, Fok J, Miller FR, et al. Prognostic significance of tissue
transglutaminase in drug resistant and metastatic breast cancer. Clin
Cancer Res. 2004;10:8068–76.
11. Brown KD. Transglutaminase 2 and NF-κB: an odd couple that shapes breast
cancer phenotype. Breast Cancer Res Treat. 2013;137:329–36.
12. Klöck C, DiRaimondo TR, Khosla C. Role of transglutaminase 2 in celiac
disease pathogenesis. Semin Immunopathol. 2012;34:513–22.
13. Olsen KC, Sapinoro RE, Kottmann RM, et al. Transglutaminase 2 and its role
in pulmonary fibrosis. Am J Respir Crit Care Med. 2011;184:699–707.
14. Johnson TS, Griffin M, Thomas GL, et al. The role of transglutaminase in
the rat subtotal nephrectomy model of renal fibrosis. J Clin Invest.
1997;99:2950–60.
15. Wilhelmus MMM, van Dam A, Drukarch B. Tissue transglutaminase: a novel
pharmacological target in preventing toxic protein aggregation in
neurodegenerative diseases. Eur J Pharmacol. 2008;585:464–72.
16. De Laurenzi V, Melino G. Gene disruption of tissue transglutaminase. Mol
Cell Biol. 2001;21:148–55.
BAP: 5-(Biotinamido)-pentylamine; cDNA: Complementary deoxyribonucleic
acid; DAB: 3,3-Diaminobenzidine; DTT: Dithiothreitol; FDG: 2-Fluoro-2-deoxy-
D-glucose; FXIII: Blood Coagulation Factor XIII; GAPDH: Glyceraldehyde-3-
phosphate-dehydrogenase; GDP: Guanosine diphosphate; GTP: Guanosine
triphosphate; HPLC: High-performance liquid chromatography; LC-MS/
MS: Liquid chromatography–tandem mass spectrometry; MRM: Multiple
reaction monitoring; p.i.: Post injection; PBS: Phosphate buffered saline;
PET: Positron emission tomography; qPCR: Quantitative polymerase chain
reaction; SPE: Solid phase extraction; TBS: Tris buffered saline;
TG: Transglutaminase
Acknowledgements
Dr. Carla. F.M. Molthoff, Mariska Verlaan, and Ricardo Vos are kindly
acknowledged for their assistance during animal handling and PET
scanning sessions. Cyclotron BV Amsterdam is kindly acknowledged for
providing carbon-11 and fluorine-18.
Funding
This research was funded by the AJ Coops Foundation.
17. Keillor JW, Apperley KYP, Akbar A. Inhibitors of tissue transglutaminase.
Trends Pharmacol Sci. 2015;36:32–40.
Availability of data and materials
Please contact author for data requests.
18. Van der Wildt B, Lammertsma AA, Drukarch B, et al. Strategies towards in
vivo imaging of active transglutaminase type 2 using positron emission
tomography. Amino Acids. 2016; https://doi.org/10.1007/s00726-016-2288-y.
19. Van der Wildt B, Wilhelmus MMM, Bijkerk J, et al. Development of carbon-11
labeled acryl amides for selective PET imaging of active tissue
transglutaminase. Nucl Med Biol. 2016;43:232–42.
20. Van der Wildt B, Wilhelmus MMM, Kooijman EJM, et al. Development of
fluorine-18 labelled peptidic PET tracers for imaging active tissue
transglutaminase. Nucl Med Biol. 2017;44:90–104.
Authors’ contributions
BvdW, BD, ADW, MW and RP designed the experiments. BvdW performed the
chemical synthesis and radiosynthesis. EK, WB and ADW performed the animal
experiments. JJB and JGJMB performed the qPCR and histochemistry
experiments. RS performed the LC-MS/MS measurements. All authors analysed
the data. BvdW wrote the manuscript. BD, ADW and AL supervised the project.
All authors proofread the manuscript. All authors read and approved the final
manuscript.
21. Price JE, Polyzos A, Zhang RD, et al. Tumorigenicity and metastasis of human
breast carcinoma cell lines in nude mice. Cancer Res. 1990;50:717–21.

van der Wildt et al. EJNMMI Research (2018) 8:39
Page 13 of 13
22. Ruijter JM, Ramakers C, Hoogaars WM, et al. Amplification efficiency:
linking baseline and bias in the analysis of quantitative PCR data.
Nucleic Acids Res. 2009;37:e45.
23. Watts RE, Siegel M, Khosla C. Structure-activity relationship analysis of the
selective inhibition of transglutaminase 2 by dihydroisoxazoles. J Med
Chem. 2006;49:7493–501.
24. Szanda I, Mackewn J, Patay G, et al. National electrical manufacturers
association NU-4 performance evaluation of the PET component of the
NanoPET/CT preclinical PET/CT scanner. J Nucl Med. 2011;52:1741–7.
25. Nagy K, Tóth M, Major P, et al. Performance evaluation of the small-animal
nanoScan PET/MRI system. J Nucl Med. 2013;54:1825–32.
26. Bahar FG, Ohura K, Ogihara T. Species difference of esterase expression and
hydrolase activity in plasma. J Pharmacol Sci. 2012;101:3979–88.
27. Slobbe P, Poot AJ, Haumann R, et al. Two anti-angiogenic TKI-PET tracers,
[
11C]axitinib and [11C]nintedanib: radiosynthesis, in vivo metabolism and
initial biodistribution studies in rodents. Nucl Med Biol. 2016;43:612–24.
28. Prime ME, Andersen OA, Barker JJ, et al. Discovery and structure−activity
relationship of potent and selective covalent inhibitors of transglutaminase
2 for Huntington’s disease. J Med Chem. 2012;55:1021–46.
29. Badarau E, Wang Z, Rathbone DL, et al. Development of potent and
selective tissue transglutaminase inhibitors: their effect on TG2 function and
application in pathological conditions. Chem Biol. 2015;22:1347–61.
30. Wityak J, Prime ME, Brookfield FA, et al. SAR development of lysine-based
irreversible inhibitors of transglutaminase 2 for Huntington's disease. ACS
Med Chem Lett. 2012;3:1024–8.
31. Antonyak MA, Li B, Regan AD, et al. Tissue transglutaminase is an essential
participant in the epidermal growth factor-stimulated signaling pathway
leading to cancer cell migration and invasion. J Biol Chem. 2009;284:17914–25.
32. Wang Z, Griffin M. The role of TG2 in regulating S100A4-mediated
mammary tumour cell migration. PLoS One. 2013;8:e57017.
33. Mangala LS, Fok JY, Zorrilla-Calancha IR, et al. Tissue transglutaminase
expression promotes cell attachment, invasion and survival in breast cancer
cells. Oncogene. 2007;26:2459–70.
34. Hanahan D, Weinberg RA. The hallmarks of cancer. Cell. 2000;100:57–70.