Discovery and optimization of 1,3,4-trisubstituted-pyrazolone derivatives as novel, potent, and nonsteroidal farnesoid X receptor (FXR) selective antagonists

Article abstract of DOI:10.1021/jm3002718

LBVS of 12480 in-house compounds, followed by HTRF assay, resulted in one nonsteroidal compound (11) with antagonistic activity against FXR (69.01 ± 11.75 μM). On the basis of 11, 26 new derivatives (12a-z) were designed and synthesized accordingly. Five

Full text of DOI:10.1021/jm3002718

Article
pubs.acs.org/jmc
Discovery and Optimization of 1,3,4-Trisubstituted-pyrazolone
Derivatives as Novel, Potent, and Nonsteroidal Farnesoid X Receptor
(FXR) Selective Antagonists
Huang Huang,†,∥ Ying Yu,†,∥ Zhenting Gao,† Yong Zhang,§ Chenjing Li,‡ Xing Xu,‡ Hui Jin,†
Wenzhong Yan,† Ruoqun Ma,† Jin Zhu,† Xu Shen,†,‡ Hualiang Jiang,†,‡ Lili Chen,*,‡ and Jian Li*,†
†Shanghai Key Laboratory of New Drug Design, School of Pharmacy, East China University of Science and Technology, 130 Mei
Long Road, Shanghai 200237, China
‡State Key Laboratory of Drug Research, Shanghai Institute of Materia Medica, Chinese Academy of Sciences, 555 Zu Chong Zhi
Road, Shanghai 201203, China
§Department of Biochemistry, Zunyi Medical College, 201 Dalian Road, Zunyi, Guizhou 563003, China
S
* Supporting Information
ABSTRACT: LBVS of 12480 in-house compounds, followed by HTRF assay, resulted in one nonsteroidal compound (11) with
antagonistic activity against FXR (69.01 11.75 μM). On the basis of 11, 26 new derivatives (12a−z) were designed and
synthesized accordingly. Five derivatives (12f−g, 12p, 12u, and 12y) showed better antagonistic activities against FXR than
compound 11. Remarkably, the most potent derivative, 12u (8.96 3.62 μM), showed antagonistic capability approximately 10
times and 8-fold higher than that of the control (GS) and the starting compound 11, respectively. 12u was further confirmed to
have high binding affinity with FXRαLBD, FXR specificity over six other nuclear receptors, and potent antagonistic activity
against FXR in two cell testing platforms. 12u strongly suppressed the regulating effects of CDCA on FXR target genes. The
therapeutic potential of 12u was identified by lowering the contents of triglyceride and cholesterol in human hepatoma HepG2
cells and in the cholesterol-fed C57BL/6 mices.
hepatocyte into the bile via upregulation of bile salt export
pump (BSEP),7 a hepatic bile acid export pumps.
1. INTRODUCTION
The farnesoid-X-receptor (FXR, NR1H4), a ligand-dependent
transcription factor, is a member of metabolic nuclear receptors
(NRs) superfamily, highly expressed in liver, intestine, kidney,
and other cholesterol-rich tissues such as adrenal glands.1,2
Cholesterol metabolism end-products, bile acids (BAs), are the
major endogenous ligands for FXR, and as an intracellular BA
sensor, FXR is the master regulator for bile acid homeostasis.3
BA-activated FXR mediates hepatoprotection from excess BAs
by preventing synthesis and uptake and promoting excretion of
BAs: (1) reducing BA synthesis via indirect downregulation of
liver-specific cholesterol 7α-hydroxylase (Cyp7A1),4 a rate-
limiting enzyme of the bile acid biosynthetic pathway,5 (2)
reducing the import of BAs from the plasma compartment into
the hepatocyte via suppression of Na+-dependent taurocholate
cotransporting polypeptide (NTCP),6 a hepatic BA import
pumps, and (3) increasing the export of BAs out of the
Apart from its critical role in maintaining bile acid
homeostasis, FXR also controls cholesterol, lipid, and glucose
metabolism8,9 and has significant effects on vasculature as
well.10 Furthermore, the roles of FXR have been extended into
various other nonmetabolic areas, including liver regeneration11
and tumorigenesis.12,13 The results of a growing number of
studies suggest that FXR represents an attractive pharmaco-
logical target.9,14−17 However, it is obvious that therapeutically
targeting FXR (especially activation) leads to complex
responses, some FXR agonists have been found to cause a
slight reduction in high-density lipoprotein (HDL) and
increased levels of low-density lipoprotein (LDL) in animals
Received: February 27, 2012
Published: August 3, 2012
© 2012 American Chemical Society
7037
dx.doi.org/10.1021/jm3002718 | J. Med. Chem. 2012, 55, 7037−7053

Journal of Medicinal Chemistry
Article
Figure 1. All structures of FXR antagonists reported in literature.
and patients with diabetes and liver steatosis, which might limit
FXR agonists development.18 It would therefore be desirable to
develop FXR antagonists that are selective over other NRs (e.g.,
FXR over liver-X-receptor (LXR)), and we are curious that
FXR modulators with such characteristics might have more
significant clinical value.
12y) were found to show better antagonistic activities against
FXR than the starting compound 11. In several molecular and
cellular assays, the most potent derivative 12u was identified
consistently as a potent and selective FXR antagonist.
Furthermore the therapeutic potential of compound 12u was
illustrated by lowering the contents of triglyceride and
cholesterol in human hepatoma HepG2 cells (10 μM) and in
the cholesterol-fed C57BL/6 mices (oral doses of 50 and 100
mg/kg). Altogether, these data demonstrate that compound
12u may be a good lead for discovering potential therapeutic
drugs for hypercholesterolemia and also be an effective
chemical biology tool for the study of FXR-related biological
processes and disease.
Given the importance of FXR in regulation of numerous
biological processes and related disease development, signifi-
cant efforts have focused on discovering FXR ligands after
deorphanization of FXR in 1999.1 However, survey of the
existing FXR ligands reveals that most of the reports deal with
FXR agonists and few FXR antagonists have been described so
far. FXR antagonists reported have very limited structural
diversity and are mainly derived from steroidal scaffold (Figure
1, Z-guggulsterone (GS, 1),19 CDRI/80−574 (2),20 sulfated
sterol (3),21 lithocholic acid (4),22 scalarane sesterterpene
(5),23 and stigmasterol acetate (6)24), and there are only three
classes of nonsteroidal scaffold up to now (Figure 1, AGN 34
(7),25 troglitazone (8),26 substituted-isoxazole derivatives (9−
10)27). Therefore, clearly seeking potent, structurally novel,
nonsteroidal FXR antagonists represents an important direction
in the field.
Virtual screening is a well-established tool to identify new
lead structures from compound libraries. As the starting point
of our efforts on discovering new potential FXR ligands, an in-
house library of 12480 compounds was screened using ligand-
based virtual screening (LBVS). One nonsteroidal compound
(11) was identified as an FXR antagonist in homogeneous
time-resolved fluorescence assay (HTRF) and selected as the
starting point for further structural optimization. Totally, 26
derivatives have been designed, synthesized, and tested with
biological assay. Finally, five derivatives (12f−g, 12p, 12u and
2. MATERIALS AND METHODS
2.1. Computation. 2.1.1. Virtual Screening. Before the
virtual screening, we searched for known FXR modulators
before July 2008 from Thomson Pharma (http://www.
thomson-pharma.com/) database and collected 11 FXR
modulators, including nine agonists and two antagonists
(Supporting Information, Table 1S). Moreover, we selected
one more FXR antagonist previously identified in our lab (not
published yet). To take advantage of the 12 known modulators,
we chose to use ligand-based virtual screening (LBVS) strategy.
Schrodinger phase28 Shape, a ligand-based 3D shape screening
tool, was used to screen an in-house compound library (12480
compounds, Figure 2). The 3D structures of the query
compounds (12 known modulators) and library compounds
were prepared using Schrodinger LigPrep, where the
protonation state were assigned with Epik under pH 7. The
3D structures of the library compounds were further calculated
by ConfGen Standard Fast mode, with the option “Minimize
7038
dx.doi.org/10.1021/jm3002718 | J. Med. Chem. 2012, 55, 7037−7053

Journal of Medicinal Chemistry
Article
when binding model prediction of compound 12u was made in
2012 (Supporting Information, Table 2S).
2.2. Chemistry. Compound 11 (Figure 3) featuring a 4-
arylidenepyrazolone framework was obtained from the in-house
Figure 3. Structure and three chemical modification regions of
compound 11.
Figure 2. Schematic representation of the virtual screening approach
adopted.
compound library by virtual screening and selected for
designing new FXR antagonists. We have previously developed
a simple, rapid, and efficient one-pot protocol for the
preparation of the 4-arylidenepyrazolone derivatives by
solvent-free microwave-assisted reaction.29 Furthermore, the
versatility of this methodology is suitable for 1,3,4-trisubsti-
tuted-pyrazolone library synthesis from commercially available
starting materials. With the aid of the predicted interactions
between 11 and the FXR active site (see section 3.5. Binding
Models), considering the 1,3,4-substitution patterns accessi-
bility of compound 11, we started from keeping the common
moiety (pyrazolone framework), and modified three regions of
this molecule to get some structure−activity relationship (SAR)
information and improve antagonistic activity: (A) replacing
the 3′-carbonyl substituted phenyl in region A with different
electronic and hydrophobic substituted phenyls (12a−b, 12h,
and 12j−z) to determine if the hydrogen bond interaction
between residue Arg331 and carbonyl substituent (see Figure
12A,B) is necessary for ligand−receptor interaction, (B)
changing the methyl group in region B with bulky phenyl
(12u) and isopropyl (12v) groups, respectively, to explore if
enough spatial volume within the binding pocket of the
receptor around the methyl group of compound 11 is available
to accommodate large chemical moieties (see Figure 12C,D),
and (C) examples of variations in region C include different
substitutions on the phenyl portions (12a, 12c−g, 12i, 12u−v,
and 12x−z), changing the phenyl into heterocycle (12w) and
naphthalenyl (12t), changing the hydrogen atom into methyl
(12x), and changing ene linker into diene linker (12i). We
hope to determine if 4-arylidene moiety can be extended to
capture more interactions and the type of 4-arylidene moiety
would affect antagonistic activity (Figure 3).
On the basis of the above design, compounds 11, 12a−g, and
12j−y were synthesized through the route outlined in Scheme
1 by employing our previous method.29 Various β-ketoesters,
hydrazines, and aldehydes or ketones were placed in a domestic
microwave oven and irradiated at a power of 420 W for 10 min
to afford target products in good to excellent yields.
Scheme 2 depicts the sequence of reactions that led to the
preparation of compounds 12h−i using 3-hydrazinylbenzoic
acid 15a as the starting material. Refluxing 15a in ethanol
catalyzed with conc H2SO4 afforded compound 16, which was
condensed with ethyl acetoacetate to afford pyrazolone 17.
Compounds 12h and 18 were prepared by condensing 17 with
aldehydes 13a and cinnamaldehyde, repectively, under
the output conformers” enabled, and finally, 290412 structures
were generated (about 25 conformers for each library
compound). Three key options for phase Shape were modified
from default based on our experience: (1) “Volume scoring”
was set to “Pharmacophore Types” (this enables the screen to
find structural diverse hits with similar pharmacophore
features), (2) “Similarity normalization” was set to “Query
structure” (this option forces the similarity score to be
calculated as the ratio between the overlap volume and the
query structure volume), and (3) “Filter out conformers with
similarity below” was set to “0.6”. The screen yielded 25609
conformers with similarity score higher than 0.6.
The 25609 conformers were further refiltered by three
criteria. First, we removed conformers with relative potential
energy more than 6.5 kcal/mol to eliminate hit with high strain
energy. Second, we calculated the ratio between the molecular
volume of the query and library structures and arbitrarily chose
the range of 0.8−1.2 as a filter so that library compounds with
similar molecular volume to the query compound were kept.
After applying above two filters, only 14001 hit conformers
were kept. Because each library compound has multiple
conformers, only the conformer with highest similarity score
was kept, and this further filtered the hits to a total of 6246.
Third, we analyzed the distribution of similarity score by
plotting a 2D graph of similarity score and rank order
(Supporting Information, Figure 1S). In Supporting Informa-
tion Figure 1S, we noticed a turning point of the curve
(similarity score = 0.766), corresponding to the no. 78 hit
compound, and the similarity score of other compounds after
no. 78 decreases slowly. This means that the bioassay workload
will be dramatically increased if similarity score was set to be
less than 0.766. So we arbitrarily selected the top 78 conformers
(compounds) for bioassay.
2.1.2. Binding Prediction of Compound 11 and 12u. To
address the flexibility of FXR binding pocket while predicting
ligand−FXR interaction, we included all available crystal
structures in the docking model ensemble. Moreover, global
strain energy of binding pose was used as a filter to remove
unrealistic docking poses (The details see Supporting
Information, page S3). Finally, we selected the top scoring
pose from the ensemble docking. Only six crystal structures
were available when binding model prediction of compound 11
was made in early 2009, but 24 crystal structures were available
7039
dx.doi.org/10.1021/jm3002718 | J. Med. Chem. 2012, 55, 7037−7053

Journal of Medicinal Chemistry
Article
a
Scheme 1
a
Reagents and conditions: (a) MWI, 420 w, 10 min.
a
Scheme 2
a
Reagents and conditions: (a) EtOH, concd H2SO4, reflux, overnight; (b) AcOH, ethyl acetoacetate, reflux, 4 h; (c) 13a, 130 °C, 30 min; (d)
cinnamaldehyde, 130 °C, 30 min; (e) EtOH:THF:H2O = 3:3:1, LiOH, rt 8 h.
Knoevenagel reaction condition. Compound 12i was obtained
by hydrolysis of 18 using LiOH at room temperature.
Compound 12z was prepared from compound 12c by
selective esterification with 2-bromopropane (Scheme 3). All
chemical structures of compounds 11 and 12a−z were listed in
Table 1.
with Superdex 75 (Amersham Pharmacia Biotech). The
purified proteins were dialysized against the suitable buffers
and immediately stored at −80 °C for later use. GST-tagged
FXRαLBD was used in HTRF, and FXRαLBD was used in
fluorescence quenching assay.
2.3.2. HTRF Assay. HTRF assay was carried out as previously
described with some modifications.19 Biotinylated SRC1
peptide (5′-biotin-CPSSHSSLTERHKILHRLLQEGSPS-
CONH2) was synthesized by Shanghai Shengong Biotechonol-
ogy (Shanghai, China). The experiment was performed by
incubating 10 nM GST-FXRαLBD, 0.83 nM anti-GST-(Eu) K,
100 nM biotin-SRC,1 and 41.75 nM SA/XL665 in assay buffer
(50 mM Hepes, pH7.0, 125 mM KF, pH7.0, 0.125% CHAPS,
0.05% dry milk) in the presence of test compounds or
coincubating with chenodeoxycholic acid (CDCA) for 30 min
at room temperature. Data were collected using a SpectraMax
M5 microplate reader (Molecular Devices, Sunnyvale, CA) and
calculated using the equation 1000 × (668 nm/620 nm).
2.3.3. Fluorescence Quenching Assay. Fluorescence spectra
were measured according to the previously published
approach.30 Briefly, FXRαLBD protein was purified using Ni-
NTA resin and ion exchange chromatography after the removal
of His-tag with thrombin (Sigma). Purified FXRαLBD protein
was incubated with different concentrations of the test
compound at 4 °C for 1 h. Protein quenching was monitored
using a HITACHI fluorescence spectrophotometer (F-4500,
HITACHI) at 25 °C with 5 nm of excitation and 5 nm of
emission slit-width. The excitation wavelength was 280 nm and
a
Scheme 3
a
Reagents and conditions: (a) (i) DMF, K2CO3, reflux 30 min; (ii)
Me2CHBr, 60 °C, 8 h.
2.3. Biological Assay. 2.3.1. Protein Expression and
Purification. The coding region of human FXRαLBD (residues
238−473) was cloned into the vector pGEX 6P-1(Amersham)
or pET-15b (Invitrogen). Escherichia coli BL21 (DE3) cells
(Promega) were transformed with the above plasmids and
cultivated at 37 °C in LB medium. The culture was induced
with 0.2 mM IPTG and incubated at 20 °C for 6 h. GST-tagged
FXRαLBD or His-tagged FXRαLBD was purified with
Glutathione-Sepharose 4B resin (GE Healthcare) or Ni-NTA
resin (Qiagen), respectively. The proteins were further purified
7040
dx.doi.org/10.1021/jm3002718 | J. Med. Chem. 2012, 55, 7037−7053

Journal of Medicinal Chemistry
Article
Table 1. Chemical Structures of Compounds 11, 12a−z, and Their Activities Based on HTRF
7041
dx.doi.org/10.1021/jm3002718 | J. Med. Chem. 2012, 55, 7037−7053

Journal of Medicinal Chemistry
Article
Table 1. continued
a
Control assays were performed with CDCA (FXRα agonist) or CDCA plus GS (FXRα antagonist). EC50 of CDCA and IC50 of GS were
determined with the values of 12.5 and 89.36 μM, respectively. Values are presented as the means SE of three independent experiments.
the emission spectra were measured between 300 and 400 nm.
The binding affinity (KD) of test compound to FXRαLBD
protein was fitted as the previously reported method.30
2.3.4. Differential Scanning Calorimetry (DSC) Assay. DSC
experiments were performed using a Microcal VP-Capillary
DSC instrument (Microcal, Amherst, MA). FXRαLBD protein
was dialyzed to equilibrium against 20 mM Tris-HCl, 50 mM
NaCl, pH 8.0, and the dialysis reservoir was served as the
reference buffer. Two mg/mL FXRαLBD protein with
dimethyl sulfoxide (DMSO) or the compound was used as
the sample. Temperatures from 10 to 110 °C were scanned at a
rate of 90 °C/h. The data were analyzed with ORIGIN software
(Microcal).
2.3.5. Luciferase Reporter Assay. Mammalian one-hybrid
and transactivation experiment were performed as previously
described method.31 HEK293T cells were cultured in 24-well
plate. In mammalian one-hybrid assay, ligand-binding domain
of different nuclear receptor was fused to Gal4 DNA binding
domain. The fusion construct and UAS-luciferase reporter
vector were transiently into the cells. In the transactivation
experiment, HEK293T cells were transiently transfected with
pcDNA3.1-FXRα, pcDNA3.1-retinoid-X-receptor α (RXRα),
pGL3- FXR response element(FXRE)-Luc, and Renilla
luciferase vector pRL-SV40. After 6 h, the transfection mixture
was replenished with fresh medium containing the test
compounds. Luciferase activities were determined using a
Dual-Luciferase Assay System (Promega, USA) strictly
according to the manufacturer’s instructions.
2.3.6. Quantitative Real-Time Polymerase Chain Reaction
(RT-PCR) Analysis. Quantization of the expression level of FXR
target genes was performed by quantitative RT-PCR. HepG2
cells were cultured in 6-well plate and incubated with different
concentrations of test compounds for 24 h. Total RNA was
isolated with TRIzol reagent (TaKaRa, Japan). Complementary
cDNA was synthesized according to the protocol of
PrimeScriptTM RT reagent Kit (TaKaRa, Japan). Real-time
PCR was carried out using SYBR Green Real-time PCR master
mix (TaKaRa, Japan) using DNA Engine Opticon 2 System
(Bio-Rad Laboratories, USA). Sequences of all the primers are
listed in Table 2. The relative objective mRNA levels were
7042
dx.doi.org/10.1021/jm3002718 | J. Med. Chem. 2012, 55, 7037−7053

Journal of Medicinal Chemistry
Article
Table 2. The Sequences of All the Primers in Quantitative RT-PCR Analysis
a
a
genes
SHP
forward primer
reverse primer
CACTGGGTGCTGTGTGAAGT
GAGAAGGCAAACGGGTGAAC
ACTTCCCTGGCCTATTTGACC
CAGGCGTGCTACTCATTTTTGG
CATGTACGTTGCTATCCAGGC
TAGGGCGAAAGAAGAGGTCCC
GCACAACACCTTATGGTATGACA
GGCATGGACGGGTACATCTT
AACCCACAACGTGTTCCATTT
CTCCTTAATGTCACGCACGAT
CYP7A1
SREBP1-c
BSEP
β-actin
a
All are Homo sapiens primers.
Figure 4. GS (A) and compound 12u (B) inhibit the effect of CDCA by HTRF method.
calculated as a ratio to those of β-actin, respectively. Data was
determined in triplicate experiments.
2.3.9. Statistical Analysis. All the experiments were
performed at least three times. Results were presented as
mean standard error (SE). Differences between groups were
analyzed for statistical significance using Student’s t test. P
values of 0.001, 0.01, and 0.05 were considered statistically
significant.
2.3.7. Determination of Triglyceride and Cholesterol
Contents. HepG2 cells cultured in 6-well plates were starved
overnight with the fresh DMEM without FBS and then treated
with vehicle (DMSO) or tested compound for another 24 h
with DMEM without FBS. Finally, cells were lysed in RIPA
buffer (25 mM Tris-HCl, pH 7.6, 150 mM NaCl, 1% NP-40,
1% sodium deoxycholate, 0.1% SDS) (Thermo Scientific, USA)
for 30 min and sonicated on ice. The suspension was
centrifuged for 30 min at 12000 rpm at 4 °C. The middle
clear layers were used to further determine the content of the
total protein, triglyceride, and cholesterol. Total protein was
determined using BCA (bicinchoninic acid) Protein Assay
Reagent Kit (Thermo Scientific, USA). Triglyceride and total
cholesterol contents were measured by use of the kits (Nanjing
Jiancheng Bioengineering Institute, Nanjing, China).
3. RESULTS AND DISCUSSION
3.1. Identification of the Lead Compound 11 by
Virtual Screening. Targeting the 3D structure of 12 query
compounds (nine agonists and three antagonists), we searched
the in-house compound library by using Schrodinger phase
(LBVS). The final list consists of 78 candidates for biological
assay. To quickly identify the active compound, we first
investigated the agonistic or antagonistic (hits plus CDCA)
activities of these 78 compounds against FXR using HTRF-
based assay. One hit (compound 11, Figure 3) ranked as no. 57
from the LBVS candidates was found to be FXR antagonist
2.3.8. Pharmacological Studies. All procedures performed
on animals were conducted in strict accordance with the ethical
guidelines of Animal Care and Use Committee (Shanghai
Institute of Materia Medica, Chinese Academy of Sciences).
The pharmacological studies of compound 12u were carried
out according to the previous reported method.19 Male 8−12-
week-old C57BL/6 mice (Shanghai SLAC Laboratory Animal
Co. Ltd.) were randomly divided into five groups with nine
animals per group. Animals in the control group were fed a
ground-chow diet (Shanghai SLAC Laboratory Animal Co.
Ltd.), and the other four groups were fed a ground-chow diet
containing 2% content of cholesterol (Shanghai SLAC
Laboratory Animal Co. Ltd.). GS (100 mg/kg) and compound
12u (50 and 100 mg/kg) were resuspended in 0.5% CMC-Na
and administered to animals by oral gavage. Control and vehicle
animals received the same amount of 0.5% CMC-Na. At the
end of 10-day treatment, animals were sacrificed after an
overnight fast. Blood and liver samples were collected for
further determining the cholesterol and triglyceride levels.
(IC50 = 69.0
11.8 μM, Table 1). Compound 11 is most
similar to the antagonist previously identified in our lab
(unpublished data), with a similarity score of 0.768. Compound
11 is larger than our in-house identified antagonist, and the
molecular volume ratio between two compounds is 1.12
(Supporting Information, Figure 2S).
3.2. Derivatives Design and Synthesis. Totally, 27
compounds (11 and 12a−z) were designed and synthesized,
and their chemical structures are shown in Table 1. These
compounds were synthesized through the routes outlined in
Schemes 1−3, and the details for synthetic procedures and
structural characterizations are described in the Experimental
Section. All compounds (11 and 12a−z) were confirmed ≥95%
purity (Supporting Information, Table 3S).
3.3. Biological Activities. 3.3.1. Agonistic and Antago-
nistic Activities of Derivatives 12a−z. For the primary assay,
the percent agonistic and antagonistic activities of the
derivatives 12a−z at 40 μM were measured using HTRF-
based FXR coactivator association assay. The results are
7043
dx.doi.org/10.1021/jm3002718 | J. Med. Chem. 2012, 55, 7037−7053

Journal of Medicinal Chemistry
Article
Figure 5. Agonistic and antagonistic activities of 5 compounds (12f−g, 12p, 12u, and 12y) in the transactivation assay. HEK-293T cells were
transiently transfected with pcDNA3.1-FXRα, pcDNA3.1-RXRα, pGL3-FXRE, and pRL-SV40 plasmids. Cells were treated with varied
concentrations of compounds in the absence or presence of CDCA (20 μM) for 18 h. FXRα antagonist GS was used as a control. Values are
presented as the means
SE of three independent experiments. (A) ### P < 0.001, *P < 0.05, **P < 0.01, and ***P < 0.001 vs DMSO,
respectively. (B) ### P < 0.001 vs DMSO; *P < 0.05, **P < 0.01, and ***P < 0.001 vs 20 μM CDCA.
Figure 6. Compound 12u physically binds to FXRαLBD. (A) Fluorescence spectra of different concentrartions of 12u and FXRαLBD (solid line).
The fluorecence spectra of 50 μM 12u was shown as the dashed line. (B) Thermal stabilities of FXRαLBD and the complex of FXRαLBD/12u. The
concentration of FXRαLBD was 2 mg/mL (C12u/CFXRαLBD = 5/1).
summarized in Table 1. Of the synthetic derivatives tested,
almost all derivatives have no agonistic activities (expressed as
agonistic rate at 40 μM < 10%), only two derivatives (12j−k,
Table 1) show little agonistic activities. Encouragingly, five
derivatives (eg., 12f−g, 12p, 12u, and 12y) displayed good
antagonistic activities against FXR (expressed as antagonistic
rate at 40 μM ≥ 40%), indicating that these are good candidate
antagonists of FXR. Therefore, we determined their IC50 values,
which are, respectively, 39.16 5.44, 33.83 4.77, 82.20
12.20, 8.96 3.62, and 9.93 1.14 μM (Table 1). GS was used
as the positive antagonist. As indicated in Figure 4A,B, GS
(IC50 = 89.36 μM, Figure 4A) and the most potent compound
12u (Figure 4B) dose-dependently inhibited the effect of
CDCA induced the interaction between FXR and the
coactivator SRC-1.
7044
dx.doi.org/10.1021/jm3002718 | J. Med. Chem. 2012, 55, 7037−7053

Journal of Medicinal Chemistry
Article
Figure 7. The antagonistic activities of compound 12u by the mammalian one-hybrid (A−B) and transactivation experiment (C−D). Values are
presented as the means SE of three independent experiments. ##P < 0.01 and ###P < 0.001 vs DMSO; *P < 0.05 and ***P < 0.001 vs 20 μM
CDCA.
As we have known, FXRα have to form FXRα:RXRα
heterodimer with RXRα and then bind to their response
element FXRE to regulate the downstream genes expression.
We thus further evaluated the effects of five antagonists against
FXR using transactivation assay. As indicated in Figure 5A,B, 20
μM CDCA induced about 2.6-fold increase of luciferase
activity, which was completely abolished by the treatment of
50 μM GS, indicating the reliability of our platform. Of all five
antagonists, none of these compounds appear to be an FXR
agonist in the transactivation assay (Figure 5A), however,
compound 12u could cause a significant inhibition of FXR
transactivation induced by CDCA in a dose-dependent manner
and completely reverse the effect exerted by CDCA on FXR
transactivation at a concentration of 40 μM (Figure 5B, ***P <
0.001 vs CDCA alone).
3.3.2. Compound 12u Physically Binds to FXRαLBD. The
luciferase assay indicated that compound 12u exhibited strong
antagonistic activity on FXR transcription. We thus tested the
binding affinity of compound 12u to FXR with two methods.
First, we determined the physical interaction between
compound 12u and FXRαLBD by fluorescence quenching
analysis. As shown in Figure 6A, FXRαLBD displayed maximal
fluorescence at 337 nm, whereas compound 12u itself had no
fluorescence at this wavelength. When 1 μM FXRαLBD was
incubated with increasing amounts of compound 12u, the
fluorescence intensity was quenched in a dose-dependent
manner. Their association constant (KD= 23.13 μM) were fitted
according to the previous method.30 In addition, we performed
the differential scanning calorimetry assay to determine the
thermodynamic stability of FXRαLBD in the presence or
absence of compound 12u, DSC curves were shown in Figure
6B. When compound 12u was incubated with FXRαLBD
protein, the Tm value increased from 57.33 to 58.74 °C. This
result thereby suggested that compound 12u as FXR ligand
could bind to FXRαLBD and also increase the thermal stability
of FXRαLBD protein.
3.3.3. Compound 12u Inhibits the Effect of CDCA. To
further determine the cellular effects of compound 12u as the
FXR antagonist, we performed the mammalian one-hybrid and
transactivation assay, respectively. In the mammalian one-
hybrid assay, HEK-293T cells were transiently cotransfected
with pCMX-Gal4DBD-FXRαLBD fusion vector, UAS-TK-Luc
reporter, and Renilla luciferase vector pRL-SV40. The trans-
fected cells were then incubated with vehicle, compound 12u,
for 18 h with or without 20 μM CDCA. As shown in Figures
7A,B, 20 μM CDCA stimulated about 3-fold increase of
luciferase activity, which was completely abolished by the
treatment of 60 μM compound 12u, while the similar
antagonistic activity was also detected in transactivation assay
(Figures 7C,D). The IC50 values were 25.61 and 29.57 μM in
both testing platforms, respectively, which is in good
accordance to the binding affinity between compound 12u
and FXRαLBD in molecular level (Section 3.3.2).
3.3.4. Compound 12u is a FXR Selective Antagonist. To
further investigate the specificity of compound 12u, we thus
tested the interactions of compound 12u and other nuclear
receptors including RXRα, LXRα, GR, PR, PPARδ, and PPARγ
according to the published method (Figure 8).32 The results
showed that compound 12u (20 μM) had no agonistic (12u
alone) or antagonistic (12u plus the corresponding agonists)
effects on RXRα (A), LXRα (B), GR (C), PR (D), PPARδ (E),
but it exhibited weak PPARγ-agonistic activity (<15.2%) (F).
These results suggested, to a certain extent, that compound 12u
might be a selective antagonist of FXR.
3.3.5. Compound 12u iInhibits Transcription of FXR
Downstream Genes. To gain further insights into the
antagonistic activity of compound 12u, we then investigated
the downstream genes of FXR by RT-PCR method. The cells
7045
dx.doi.org/10.1021/jm3002718 | J. Med. Chem. 2012, 55, 7037−7053

Journal of Medicinal Chemistry
Article
Figure 8. Specificity of compound 12u was performed by the mammalian one-hybrid assay. HEK-293T cells were transiently cotransfected with the
fusion plasmid of Gal4 DBD-NR-LBD, including RXRα (A), LXRα (B), GR (C), PR (D), PPARδ (E), and PPARγ (F) in combination with the
UAS-TK-Luc reporter. RXRα agonist 9cRA (RA, 0.1 μM), LXRα agonist TO901317 (TO90, 0.5 μM), GR agonist dexamethasone (Dex, 50 nM),
PR agonist progesterone (Prog, 100 nM), PPARδ agonist GW1516 (GW1516, 10 μM), and PPARγ agonist rosiglitazone (ROS, 10 μM) were as the
positive controls. Values are presented as the means SE of three independent experiments. *P < 0.05 vs agonist; #P < 0.05 and ###P < 0.001 vs
DMSO.
cultured in 6-well plates were treated with DMSO and different
concentrations of compound 12u in the presence or absence of
CDCA. After a 24 h treatment, cells were collected for RT-PCR
analysis. As indicated in Figure 9, CDCA could inhibit the
expression of canonical FXR target gene Cyp7A1 (A) but
induce the expression of small heterodimer partner (SHP) (B),
BSEP (C), and sterol regulatory element-binding protein 1c
(SREBP1c) (D). Interestingly, compound 12u strongly sup-
pressed the effect of CDCA. Altogether, these data thus
indicate that we have identified compound 12u as a potent and
selective FXR antagonist.
3.3.6. Compound 12u Efficiently Lowers Triglyceride and
Cholesterol Contents. As reported, FXR antagonist GS could
decrease hepatic cholesterol levels in the cholesterol-fed wild-
type animals.19 To investigate whether compound 12u also
influences lipid metabolism, we tested its lipid-lowering
activities in human hepatoma HepG2 cells. HepG2 cells in a
6-well plate were treated with DMSO, GS, or different
concentrations of compound 12u for 24 h and then the level
of the lipids was determined. As shown in Figure 10, 10 μM
compound 12u decreased the contents of triglyceride (35.2%,
A) and cholesterol (27.1%, B) dose-dependently, with a similar
potency to that of 40 μM GS (TG, 39.8%; TC, 25.2%). These
results are in good accordance to effects on the expression of
genes of compound 12u (Section 3.3.5). Compound 12u could
downregulate SREPB1c expression induced by CDCA in
HepG2 cells (Figure 9D). SREPB1c was a master gene
regulator that increases liver expression or activity of many
genes involved in fatty acids and trygleride synthesis such as
acetyl-CoA carboxylase (ACC), acetyl-CoA synthetase
(AceCS), and fatty acid synthase (FAS).33 Inhibition of
SREPB-1c by compound 12u might be responsible for the
lowering triglyceride effect in HepG2 cells (Figure 10A).
Considering Cyp7A1’s critical role in accelerating cholesterol
degradation, the upregulated expression of Cyp7A1 induced by
7046
dx.doi.org/10.1021/jm3002718 | J. Med. Chem. 2012, 55, 7037−7053

Journal of Medicinal Chemistry
Article
Figure 9. Compound 12u inhibits transcription of FXR downstream genes. HepG2 cells cultured in 6-well plate were treated with DMSO and
different concentrations of compound 12u with or without 100 μM CDCA for 24 h. The treated cells were collected for RT-PCR analysis. The
mRNA levels of Cyp7A1 (A), SHP (B), BSEP (C), and SREBP1c (D). Their relative changes were normalized to β-actin level. Values are presented
as the means SE of three independent experiments. #P < 0.05, ##P < 0.01, and ###P < 0.001 vs DMSO; *P < 0.05, **P < 0.01, and ***P < 0.001
vs 100 μM CDCA.
Figure 10. Compound 12u efficiently decreases triglyceride (A) and cholesterol (B) contents dose-dependently. HepG2 cells were starved in serum-
free medium overnight and treated with different doses of compound 12u or 40 μM GS as the positive control for 24 h before the experiments. ##P
< 0.01 and ###P < 0.001 vs DMSO; *P < 0.05, **P < 0.01, and ***P < 0.001 vs DMSO.
compound 12u (Figure 9A) could be a reason why the content
of cholesterol in HepG2 cells were lowered (Figure 10B).
Similarly, an in vivo pharmacological evaluation also showed
that compound 12u could effectively lower serum and hepatic
triglyceride and total cholesterol in the cholesterol-fed C57BL/
6 mices (Figure 11). Compound 12u significantly decreased the
levels of serum triglycerides dose-dependently with the
reduction of 48.4 and 60.3% at dosages of 50 and 100 mg/
kg, respectively, compared with the vehicle mices (Figure 11A).
Meanwhile, compound 12u could also reduce serum total
cholesterol concentration with the reduction from 12.7 to
17.2%, respectively (Figure 11B). However, GS decreased the
levels of serum triglycerides (53.7%, Figure 11A) and increased
serum total cholesterol (6.4%, Figure 11B) at a dose of 100
mg/kg, and this result was in agreement with that reported in
recent literature.34 We also determined hepatic TG and TC in
compound 12u-treated mices. Compared with vehicle mices,
compound 12u largely reduce the contents of triglyceride and
total cholesterol (43.5 to 69.7% and 33.5 to 47.5%,
respectively) dose-dependently at doses of 50 and 100 mg/
kg, respectively (Figure 11C,D). However, GS decreased the
contents of triglyceride (45.1%) and total cholesterol (26.3%)
(Figures 11C,D) at the dose of 100 mg/kg. On the basis of the
above results, we concluded that compound 12u had more
beneficial effects on lowering the contents of serum and hepatic
triglycerides and total cholesterol than the naturally occurring
7047
dx.doi.org/10.1021/jm3002718 | J. Med. Chem. 2012, 55, 7037−7053

Journal of Medicinal Chemistry
Article
Figure 11. Compound 12u effectively lowers serum and hepatic triglyceride (A, C) and total cholesterol (B, D) dose-dependently in the cholesterol-
fed C57BL/6 mices. Animals were randomly divided into five groups. Animals in the control group were fed a ground-chow diet, and the other four
groups were fed a ground-chow diet containing 2% content of cholesterol. GS (100 mg/kg) and compound 12u (50 and 100 mg/kg) were
resuspended in 0.5% CMC-Na and administered to animals by oral gavage. Control animals and vehicle animals were all received the same amount
of 0.5% CMC-Na. ###P < 0.001 vs control; *P < 0.05, **P < 0.01 and ***P < 0.001 vs vehicle.
FXR antagonist GS. Because of its potency and attractive
selectivity profiles, compound 12u was evaluated in the in vivo
rat PK model. Unfortunately, compound 12u was low aqueous
solubility and suffered from poor PK profiles with <5% oral
bioavailability in rat (Supporting Information, Tables 4S−5S).
We will concentrate our efforts to investigate alternative
derivative scaffolds for better PK profiles in future work.
3.4. SAR. The SAR analysis of a set of 27 compounds
provided important insights of the essential structural require-
ments for effective FXR antagonists. An analysis of the data
shown in Table 1 reveals some noteworthy observations of the
SAR for compounds 11 and 12a−z: (1) when only R4 was
changed, replacement of the 3′-carbonyl substituent on the
phenyl ring with other substituents substantially decreased the
antagonistic activities of derivatives (1 vs 12b or 12h or 12j−s);
(2) when only R1 was changed, 4′-O-substitutions on the
phenyl ring substantially impacted the antagonistic activities of
derivatives, generally, bulky substituents (12f−g vs 11 or 12c−
e) are beneficial, (3) introduction of a more double-bond
between R1 and pyrazolone can be tolerated (11 vs 12i), (4)
aryl substituents at 3-position (R3) of the pyrazolone
framework substantially increased potency (12u vs 11 or
12v), while, in this case, R4-substitution (12u) was not 3′-
carbonyl substituted phenyl ring (see the above (1)) and R1-
substitution (12u) does not contain 4′-O-bulky substitutions
on the phenyl ring (see the above (2)). Taken together, the
SAR are mixed. A subtle interplay between steric/hydrophobic
effects of R1/R3 substituent and polarity/hydrogen-bonding
capability of R4 substituent seemed to be critical for high
potency. Compounds 12u represented seemingly the best
combination, leading to ∼8-fold potency improvement
compared to the lead compound 11.
3.5. Binding Models. To understand the structural basis
for the above SAR, we scrutinized the binding poses of hit
compound 11 and the most potent derivative 12u by means of
molecular docking. The top ranking poses of compounds 11
and 12u were predicted by the docking model generated from
chain A of 3DCT35 and 3RUU,36 respectively. Figure 12 shows
the predicted binding poses of 11 (Figure 12A,B) and 12u
(Figure 12C,D) in FXR ligand binding site. For the compound
11, 3′-carbonyl substituent on the phenyl ring (region A, Figure
3) forms two strong hydrogen bonds with Arg331 of helix 5
(Figure 12A,B), which is observed for several FXR ligands such
as GW4064. Other atoms of compound 11 contribute to
interactions only by shape complementary and hydrophobic
interaction. A large spatial volume within FXR active site
around the ethoxyl group of compound 11 (R1 in Table1) was
available to accommodate large chemical moieties (Figure
12A). The molecular binding model of 11 was in good
agreement with the above SARs (1−3). It is notable that
compound 11 had no interaction with the AF2 helix, which is
considered essential to FXR activation. This might be a reason
that compound 11 acts as an FXR antagonist. For compound
12u, The R3 of 12u (phenyl, Table 1) was too large to be
accommodated in the binding site of FXR around the methyl
group of compound 11 (Figure 12A), hence the pyrazolone
framework shifts to the left and takes a different orientation
compared to compound 11, and the nitro group of 12u is
7048
dx.doi.org/10.1021/jm3002718 | J. Med. Chem. 2012, 55, 7037−7053

Journal of Medicinal Chemistry
Article
Figure 12. Two-dimensional (2D) and three-dimensional (3D) interaction schemes of predicted binding poses of 11 (A−B) and 12u (C−D) in
FXR active site. The figures were prepared using PyMol (A,C) and Schrodinger Maestro (B,D). In the 2D diagram, magentas dash line with arrow
denotes hydrogen bond between ligand and side chain atoms of protein residue, while the green line with arrow denotes the T-shaped π−π
interaction from the ligand to the side chain aromatic ring of protein residue. Hydrogen bonds are shown as dotted lines in the 3D views. Critical
residues of the binding pocket are labeled in 2D and 3D views.
devoid of hydrogen bond interactions with Arg331 of helix 5
(Figure 12C,D). In recompense for this hydrogen bond loss,
the 4′-hydroxy of arylidene moiety (region C, Figure 3) formed
one new hydrogen bond with side chain hydroxy of Thr288. In
addition, two pairs of T-shaped π−π interactions exist between
two phenyl rings of 12u (R3 and R4, Table 1) and two aromatic
residues (Phe329 and His294, respectively) (Figure 12D), the
additional interaction was regarded as one of the key factors
leading to ∼8-fold potency improvement of 12u compared to
11. The binding model of 12u powerfully supports the above
SAR (4). It is also worth noting that some AF2 helix residues
(Phe461, Leu465, and Trp469) are involved in the hydro-
phobic interaction with 12u (Figure 12D). On the basis of the
fact that both 11 and 12u are FXR antagonists, and the
observation that known FXR agonists (including CDCA)
typically have interaction to both helix 5 (hydrogen bond) and
AF2 helix (hydrophobic interaction), it may be hypothesized
that the lack of synergetic interactions to both helix 5 and AF2
helix results in antagonistic effect of FXR ligand.
4. CONCLUSION
In summary, we have discovered a new kind of nonsteroidal,
selective FXR antagonists by using LBVS approach in
conjunction with chemical synthesis and bioassay. On the
basis of the structure of lead compound 11, totally, 26 new
derivatives have been synthesized and tested with HTRF-based
FXR coactivator association assay. Finally, five derivatives
(12f−g, 12p, 12u, and 12y) were found to show better
antagonistic activities against FXR than compound 11.
Remarkably, the most potent derivative 12u showed antago-
nistic capability approximately 10 times and 8 times higher than
that of the control GS and prototype compound 11,
respectively. The preliminary SARs were obtained, which
show changes of substituents on the 1 (R4), 3 (R3), and 4 (R1)
7049
dx.doi.org/10.1021/jm3002718 | J. Med. Chem. 2012, 55, 7037−7053

Journal of Medicinal Chemistry
Article
2H), 8.51 (d, 2H). EI-MS m/z 262 (M+, 100%). HRMS (EI) m/z
calcd C17H14N2O (M+) 262.1106, found 262.1107.
-positions of pyrazolone moiety, have very important influence
on antagonistic activity, and appropriate structural optimiza-
tions on the above regions can substantially improve potency.
In several molecular and cellular assays, the derivative 12u
(60 μM) was further confirmed to have high binding affinity
with FXRαLBD and could result in 100% inhibition of FXR
transactivation induced by 20 μM CDCA. Interestingly, the
antagonistic activity of compound 12u was also observed for
FXR specificity over a number of nuclear receptors including
RXRα, LXRα, GR, PR, and PPARδ, which was in good
agreement with the antagonistic activity of compound 12u
against FXR by strongly reversing the regulating effects of
CDCA on FXR target genes (Cyp7A1, SHP, BSEP, and
SREBP1c). Further, the therapeutic potential of compound 12u
(10 μM) was identified by lowering the contents of triglyceride
and total cholesterol in human hepatoma HepG2 cells, with a
similar potency to that of 40 μM GS. The pharmacological
results in vivo also showed that compound 12u had more
beneficial effects on lowering the contents of serum and hepatic
triglycerides and total cholesterol than FXR natural antagonist
GS. Altogether, these data demonstrate that compound 12u
may be a good lead for discovering potential therapeutic drugs
for hypercholesterolemia. Considering only a few nonsteroidal,
selective FXR antagonists reported so far, compound 12u can
be an effective chemical biology tool for the study of FXR
mechanism in the diseases. Further structural optimization of
the representative compound 12u is in progress in our
laboratory.
5.1.3. (Z)-4-(4-Ethoxy-3-methoxybenzylidene)-3-methyl-1-phe-
nyl-1H-pyrazol-5(4H)-one (12b). 12b was obtained in the same
manner described in the preparation of 11 from ethyl acetoacetate,
phenylhydrazine, and 3-methoxy-4-ethoxy-benzaldehyde. Yield 63%;
1
mp 134−139 °C. H NMR (400 MHz, CDCl3): δ 1.54 (t, 3H), 2.36
(s, 3H), 4.05 (s, 3H), 4.23 (q, 2H), 6.95 (d, 1H), 7.19 (t, 1H), 7.32 (s,
1H), 7.42 (t, 2H), 7.72 (d, 1H), 7.97 (d, 2H), 8.98 (s, 1H). EI-MS m/
z 336 (M+, 100%). HRMS (EI) m/z calcd C20H20N2O3 (M+)
336.1474, found 336.1475.
5.1.4. (Z)-3-(4-(4-Hydroxy-3-methoxybenzylidene)-3-methyl-5-
oxo-4,5-dihydro-1H-pyrazol-1-yl)benzoic Acid (12c). 12c was
obtained in the same manner described in the preparation of 11
from ethyl acetoacetate, 3-hydrazinylbenzoic acid, and 4-hydroxy- 3-
1
methoxybenzaldehyde. Yield 68%; mp 255−257 °C. H NMR (400
MHz, DMSO): δ 2.33 (s, 3H), 3.90 (s, 3H), 6.96 (d, 1H), 7.56 (t,
1H), 7.70 (s, 1H), 7.75 (d, 1H), 8.04 (d, 1H), 8.21 (d, 1H), 8.53 (s,
1H), 8.76 (s, 1H). EI-MS m/z 352 (M+, 100%). HRMS (EI) m/z
calcd C19H16N2O5 (M+) 352.1059, found 352.1057.
5.1.5. (Z)-3-(4-(3,4-Dihydroxybenzylidene)-3-methyl-5-oxo-4,5-
dihydro-1H-pyrazol-1-yl)benzoic Acid (12d). 12d was obtained in
the same manner described in the preparation of 11 from ethyl
acetoacetate, 3-hydrazinylbenzoic acid, and 3,4-dihydroxy benzalde-
1
hyde. Yield 73%; mp 278−280 °C. H NMR (400 MHz, DMSO): δ
2.34 (s, 3H), 6.93 (d, 1H), 7.57 (t, 1H), 7.65 (s, 1H), 7.76 (d, 1H),
7.92 (d, 1H), 8.18 (d, 1H), 8.52 (s, 1H), 8.63 (s, 1H), 10.45(s,1H). EI-
MS m/z 338 (M+, 100%). HRMS (EI) m/z calcd C18H14N2O5 (M+)
338.0903, found 338.0782.
5.1.6. (Z)-3-(4-(4-Isopropoxy-3-methoxybenzylidene)-3-methyl-5-
oxo-4,5-dihydro-1H-pyrazol-1-yl)benzoic Acid (12e). 12e was
obtained in the same manner described in the preparation of 11
from ethyl acetoacetate, 3-hydrazinylbenzoic acid, and 4-iso propoxy-
1
3-methoxybenzaldehyde. Yield 76%; mp 206−208 °C. H NMR (400
5. EXPERIMENTAL SECTION
MHz, DMSO): δ 1.33 (s, 6H), 2.36 (s, 3H), 3.87 (s, 3H), 4.83 (m,
1H), 7,21 (d, 1H), 7.57 (t,1H), 7.76 (d, 1H), 7.79 (s, 1H), 8.15 (d,
1H), 8.22 (d, 1H), 8.53 (s, 1H), 8.75 (s, 1H). EI-MS m/z 394 (M+,
100%). HRMS (EI) m/z calcd C22H22N2O5 (M+) 394.1529, found
394.1528.
5.1. General. The reagents (chemicals) were purchased from
Lancaster, Alfa Aesar, Acros, and Shanghai Chemical Reagent Co. and
used without further purification. Analytical thin-layer chromatography
(TLC) was HSGF 254 (150−200 μm thickness; Yantai Huiyou Co.,
China). Yields were not optimized. Melting points were measured in
capillary tube on a SGW X-4 melting point apparatus without
correction. Nuclear magnetic resonance (NMR) spectroscopy was
performed on a Bruker AMX-400 NMR (IS as TMS). Chemical shifts
were reported in parts per million (ppm, δ) downfield from
tetramethylsilane. Proton coupling patterns were described as singlet
(s), doublet (d), triplet (t), quartet (q), multiplet (m), and broad (br).
Low- and high-resolution mass spectra (LRMS and HRMS) were
given with electric ionization (EI) produced by a Finnigan MAT-95.
Microwave experiments were carried out in a domestic microwave
oven (Midea MM721AAU-PW). Compounds 11 and 12a−z were
confirmed 95% purity (Supporting Information, Table 3S). The details
for purity analyses of compounds 11 and 12a−z are described in the
Supporting Information.
5.1.1. (Z)-3-(4-(4-Ethoxy-3-methoxybenzylidene)-3-methyl-5-
oxo-4,5-dihydro-1H-pyrazol-1-yl)benzoic Acid (11). A one-neck 50
mL flask containing 3-methoxy-4-ethoxy-benzaldehyde (13a, 54 mg,
0.3 mmol), ethyl acetoacetate (14a, 58.5 mg, 0.45 mmol), and 3-
hydrazinylbenzoic acid (15a, 45.6 mg, 0.3 mmol) was placed in a
domestic microwave oven and irradiated at a power of 420 W for 10
min. The solid obtained after cooling was triturated with ethyl acetate
and collected by suction filtration to afford product 11 (112 mg, yield
98%) as an orange solid; mp 276−278 °C. 1H NMR (400 MHz,
DMSO): δ 1.38 (t, 3H), 2.34 (s, 3H), 3.88 (s, 3H), 4.17 (q, 2H), 7.16
(d, 1H), 7.56 (t, 1H), 7.77 (s, 2H), 8.12 (d, 1H), 8.21 (d, 1H), 8.51 (s,
1H), 8.75 (s, 1H), 13.05 (s, 1H). EI-MS m/z 380 (M+, 100%). HRMS
(EI) m/z calcd C21H20N2O5 (M+) 380.1372, found 380.1371.
5.1.2. (Z)-4-Benzylidene-3-methyl-1-phenyl-1H-pyrazolidinyl-
5(4H)-ketone (12a). 12a was obtained in the same manner described
in the preparation of 11 from ethyl acetoacetate, phenylhydrazine, and
benzaldehyde. Yield 47%; mp 103−107 °C. 1H NMR (400 MHz,
CDCl3): δ 2.38 (s, 3H), 7.20 (t, 1H), 7.41−7.54 (m, 6H), 7.97 (d,
5.1.7. (Z)-3-(4-(3-Methoxy-4-(pentyloxy)benzylidene)-3-methyl-5-
oxo-4,5-dihydro-1H-pyrazol-1-yl)benzoic Acid (12f). 12f was ob-
tained in the same manner described in the preparation of 11 from
ethyl acetoacetate, 3-hydrazinylbenzoic acid, and 3-methoxy- 4-
(pentyloxy)benzaldehyde. Yield 83%; mp 224−226 °C. 1H NMR
(400 MHz, DMSO): δ 0.91 (t, 3H), 1.32−1.43 (m, 4H), 1.77 (m,
2H), 2.35 (s, 3H), 3.88 (s, 3H), 4.11 (t, 2H), 7.18 (d,1H), 7.57 (t,
1H), 7.77 (d, 2H), 8.13 (d, 1H), 8.22 (d, 1H), 8.52 (s, 1H), 8.77 (s,
1H). EI-MS m/z 422 (M+, 100%). HRMS (EI) m/z calcd C24H26N2O5
(M+) 422.1842, found 422.1840.
5.1.8. (Z)-3-(4-(4-(Benzyloxy)-3-methoxybenzylidene)-3-methyl-
5-oxo-4,5-dihydro-1H-pyrazol-1-yl)benzoic Acid (12g). 12g was
obtained in the same manner described in the preparation of 11
from ethyl acetoacetate, 3-hydrazinylbenzoic acid, and 4-(benzyloxy)-
1
3-methoxybenzaldehyde. Yield 84%; mp 249−252 °C. H NMR (400
MHz, DMSO): δ 2.35 (s, 3H), 3.89 (s, 3H), 5.26 (s, 2H), 7.28−7.50
(m, 7H), 7.57 (t, 1H), 7.77 (d, 2H), 8.14 (d, 1H), 8.22 (d, 1H), 8.52
(s, 1H), 8.77 (s, 1H). EI-MS m/z 442 (M+, 100%). HRMS (EI) m/z
calcd C26H22N2O5 (M+) 442.1529, found 442.1530.
5.1.9. (Z)-4-(4-Ethoxy-3-methoxybenzylidene)-3-methyl-1-(3-ni-
trophenyl)- pyrazol-5(4H)-one (12j). 12j was obtained in the same
manner described in the preparation of 11 from ethyl acetoacetate, (3-
nitrophenyl)hydrazine, and 3-methoxy-4-ethoxy-benzaldehyde. Yield
1
83%; mp 212−213 °C. H NMR (400 MHz, CDCl3): δ 1.55 (t, 3H),
2.38 (s, 3H), 4.07 (s, 3H), 4.27 (q, 2H), 6.98 (d, 1H), 7.37 (s, 1H),
7.59 (t, 1H), 7.75 (d, 1H), 8.03 (d, 1H), 8.47 (d, 1H), 8.93 (d, 2H).
EI-MS m/z 381 (M+, 100%). HRMS (EI) m/z calcd C20H19N3O5
(M+) 381.1325, found 381.1321.
5.1.10. (Z)-4-(4-Ethoxy-3-methoxybenzylidene)-3-methyl-1-(4-ni-
trophenyl)-1H-pyrazol-5(4H)-one (12k). 12k was obtained in the
same manner described in the preparation of 11 from ethyl
acetoacetate, (4-nitrophenyl)hydrazine, and 3-methoxy-4-ethoxy-ben-
7050
dx.doi.org/10.1021/jm3002718 | J. Med. Chem. 2012, 55, 7037−7053

Journal of Medicinal Chemistry
Article
zaldehyde. Yield 78%; mp 213−215 °C. 1H NMR (400 MHz, CDCl3):
δ 1.55 (t, 3H), 2.38 (s, 3H), 4.06 (s, 3H), 4.25 (q, 2H), 6.97 (d, 1H),
7.37 (s, 1H), 7.73 (d, 1H), 8.29 (s, 4H), 8.90 (s, 1H). EI-MS m/z 381
(M+, 100%). HRMS (EI) m/z calcd C20H19N3O5 (M+) 381.1325,
found 381.1323.
5.1.11. (Z)-4-(4-Ethoxy-3-methoxybenzylidene)-3-methyl-1-(3-
(trifluoromethyl)phenyl)-1H-pyrazol-5(4H)-one (12l). 12l was ob-
tained in the same manner described in the preparation of 11 from
ethyl acetoacetate, (3-(trifluoromethyl)phenyl)hydrazine, and 3-
methoxy-4-ethoxy-benzaldehyde. Yield 67%; mp 147−151 °C. 1H
NMR (400 MHz, CDCl3): δ 1.54 (t, 3H), 2.37 (s, 3H), 4.06 (s, 3H),
4.24 (q, 2H), 6.97 (d, 1H), 7.35 (s, 1H), 7.42 (d, 1H), 7.53 (t, 1H),
7.75 (d, 1H), 8.28 (d, 1H), 8.31 (s, 1H), 8.91 (s, 1H). EI-MS m/z 404
(M+, 100%). HRMS (EI) m/z calcd C21H19F3N2O3 (M+) 404.1348,
found 404.1349.
5.1.12. (Z)-4-(4-Ethoxy-3-methoxybenzylidene)-3-methyl-1-(4-
(trifluoromethyl)phenyl)-1H-pyrazol-5(4H)-one (12m). 12m was
obtained in the same manner described in the preparation of 11
from ethyl acetoacetate, (4-(trifluoromethyl)phenyl)hydrazine, and 3-
methoxy-4-ethoxy-benzaldehyde. Yield 53%; mp 144−147 °C. 1H
NMR (400 MHz, CDCl3): δ 1.54 (t, 3H), 2.37 (s, 3H), 4.05 (s, 3H),
4.25 (q, 2H), 6.96 (d, 1H), 7.35 (s, 1H), 7.66 (d, 2H), 7.72 (d, 1H),
8.18 (d, 2H), 8.93 (s, 1H). EI-MS m/z 404 (M+, 100%). HRMS (EI)
m/z calcd C21H19F3N2O3 (M+) 404.1348, found 404.1349.
5.1.13. (Z)-1-(3,5-Bis(trifluoromethyl)phenyl)-4-(4-ethoxy-3-me-
thoxybenzylidene)-3-methyl-1H-pyrazol-5(4H)-one (12n). 12n was
obtained in the same manner described in the preparation of 11 from
ethyl acetoacetate, (3,5-bis(trifluoromethyl)phenyl) hydrazine, and 3-
methoxy-4-ethoxy-benzaldehyde. Yield 54%; mp 198−200 °C. 1H
NMR (400 MHz, CDCl3): δ 1.54 (t, 3H), 2.38 (s, 3H), 4.07 (s, 3H),
4.25 (q, 2H), 6.98 (d, 1H), 7.37 (s, 1H), 7.65 (s, 1H), 7.77 (d, 1H),
8.61 (s, 2H), 8.84 (s, 1H). EI-MS m/z 472 (M+, 100%). HRMS (EI)
m/z calcd C22H18F6N2O3 (M+) 472.1222, found 472.1223.
5.1.14. (Z)-4-(4-Ethoxy-3-methoxybenzylidene)-1-(2-fluorophen-
yl)-3-methyl-1H-pyrazol-5(4H)-one (12o). 12o was obtained in the
same manner described in the preparation of 11 from ethyl
acetoacetate, (2-fluorophenyl)hydrazine, and 3-methoxy-4-ethoxy-
benzaldehyde. Yield 51%; mp 153−155 °C. 1H NMR (400 MHz,
CDCl3): δ 1.52 (t, 3H), 2.34 (s, 3H), 4.00 (s, 3H), 4.22 (q, 2H), 6.93
(d, 1H), 7.22 (q, 2H), 7.32 (t, 1H), 7.36 (s, 1H), 7.52 (t, 1H), 7.67 (d,
1H). EI-MS m/z 354 (M+, 100%). HRMS (EI) m/z calcd
C20H19FN2O3 (M+) 354.1380, found 354.1377.
5.1.15. (Z)-4-(4-Ethoxy-3-methoxybenzylidene)-3-methyl-1-per-
fluorophenyl-1H-pyrazol-5(4H)-one (12p). 12p was obtained in the
same manner described in the preparation of 11 from ethyl
acetoacetate, (perfluorophenyl)hydrazine, and 3-methoxy-4-ethoxy-
benzaldehyde. Yield 60%; mp 169−171 °C. 1H NMR (400 MHz,
CDCl3): δ 1.53 (t, 3H), 2.35 (s, 3H), 4.00 (s, 3H), 4.23 (q, 2H), 6.95
(d, 1H), 7.41 (s, 1H), 7.63 (d, 1H), 8.96 (s, 1H). EI-MS m/z 426 (M+,
100%). HRMS (EI) m/z calcd C20H15F5N2O3 (M+) 426.1003, found
426.1002.
the same manner described in the preparation of 11 from ethyl
acetoacetate, (4-isopropylphenyl)hydrazine, and 3-methoxy-4-ethoxy-
benzaldehyde. Yield 63%; mp 129−131 °C. 1H NMR (400 MHz,
CDCl3): δ 1.26 (d, 6H), 1.53 (t, 3H), 2.34 (s, 3H), 2.93 (m, 1H),4.04
(s, 3H), 4.22 (q, 2H), 6.94 (d, 1H), 7.30 (d, 2H), 7.70 (d, 1H), 7.83
(d, 2H), 9.01 (s, 1H). EI-MS m/z 378 (M+, 100%). HRMS (EI) m/z
calcd C23H26N2O3 (M+) 378.1943, found 378.1942.
5.1.19. (Z)-4-((4-Methoxynaphthalen-1-yl)methylene)-3-methyl-
1-(3-nitrophenyl)-1H-pyrazol-5(4H)-one (12t). 12t was obtained in
the same manner described in the preparation of 11 from ethyl
acetoacetate, (3-nitrophenyl)hydrazine, and 4-methoxy-1- naphthalde-
1
hyde. Yield 70%; mp 236−237 °C. H NMR (400 MHz, CDCl3): δ
2.51 (s, 3H), 4.16 (s, 3H), 7.05 (d, 1H), 7.57 (t, 1H), 7.72 (t, 1H),
8.02 (q, 2H), 8.15 (d, 1H), 8.33 (s, 1H), 8.41 (d, 1H), 8.48 (d, 1H),
8.96 (t, 1H), 9.40 (d, 1H). EI-MS m/z 387 (M+, 100%). HRMS (EI)
m/z calcd C22H17N3O4 (M+) 387.1219, found 387.1212.
5.1.20. (Z)-4-(4-Hydroxy-3-methoxybenzylidene)-1-(3-nitrophen-
yl)-3-phenyl-1H-pyrazol-5(4H)-one (12u). 12u was obtained in the
same manner described in the preparation of 11 from ethyl 3-oxo-3-
phenylpropanoate, (3-nitrophenyl)hydrazine, and 4-hydroxy-3-me-
thoxybenzaldehyde. Yield 61%; mp 199−202 °C. 1H NMR (400
MHz, CDCl3): δ 4.14 (s, 3H), 6.38 (s, 1H), 7.03 (d, 1H), 7.53 (d,
1H), 7.56 (m, 4H), 7.69 (d, 1H), 7.71 (d, 1H), 8.07 (d, 1H), 8.54 (d,
1H), 9.06 (s, 1H), 9.15 (s, 1H). EI-MS m/z 415 (M+, 100%). HRMS
(EI) m/z calcd C23H17N3O5 (M+) 415.1168, found 415.1159.
5.1.21. (Z)-4-(4-Hydroxy-3-methoxybenzylidene)-3-isopropyl-1-
(3-nitrophenyl)-1H-pyrazol-5(4H)-one (12v). 12v was obtained in
the same manner described in the preparation of 11 from ethyl 4-
methyl-3-oxopentanoate, (3-nitrophenyl)hydrazine, and 3-methoxy
benzaldehyde. Yield 67%; mp 200−201 °C. 1H NMR (400 MHz,
CDCl3): δ 1.42 (s, 3H), 1.43 (s, 3H), 3.14 (m, 1H), 4.11 (s, 3H), 6.36
(s, 1H), 7.04 (d, 1H), 7.43 (s, 1H), 7.55 (d, 1H), 7.59 (t, 1H), 8.03 (d,
1H), 8.48 (d, 1H), 8.96 (t, 1H), 9.17 (s, 1H). EI-MS m/z 381.1 (M+,
100%). HRMS (EI) m/z calcd C20H19N3O5 (M+) 381.1325, found
381.1315.
5.1.22. (Z)-3-Methyl-4-((5-methylthiophen-2-yl)methylene)-1-(3-
nitrophenyl)-1H-pyrazol-5(4H)-one (12w). 12w was obtained in the
same manner described in the preparation of 11 from ethyl
acetoacetate, (3-nitrophenyl)hydrazine, and 5-methylthiophene- 2-
carbaldehyde. Yield 53%; mp 199−201 °C. 1H NMR (400 MHz,
CDCl3): δ 2.39 (s, 1H), 2.67 (s, 3H), 7.00 (s, 1H), 7.58 (t, 2H), 7.85
(s, 1H), 8.02 (d, 1H), 8.53 (d, 1H), 8.92 (s, 1H). EI-MS m/z 327 (M+,
100%). HRMS (EI) m/z calcd C16H13N3O3S (M+) 327.0678, found
327.0675.
5.1.23. (Z)-4-(1-(4-Chlorophenyl)ethyliden-1-yl)-3-methyl-1-(4-ni-
trophenyl)-1H-pyrazol-5(4H)-one (12x). 12x was obtained in the
same manner described in the preparation of 11 from ethyl
acetoacetate, (4-nitrophenyl)hydrazine, and 1-(4-chlorophenyl)-
ethanone. Yield 50%; mp 193−196 °C. 1H NMR (400 MHz,
DMSO): δ 1.69 (s, 3H), 2.88 (s, 3H), 7.24 (d, 2H), 7.51 (d, 2H), 8.28
(m, 4H). EI-MS m/z 355 (M+, 100%). HRMS (EI) m/z calcd
C18H14ClN3O3 (M+) 355.0742, found 355.0719.
5.1.16. (Z)-1-(3,4-Dichlorophenyl)-4-(4-ethoxy-3-methoxybenzyli-
dene)-3-methyl-1H-pyrazol-5(4H)-one (12q). 12q was obtained in
the same manner described in the preparation of 11 from ethyl
acetoacetate, (3,4-dichlorophenyl)hydrazine, and 3-methoxy-4-
5.1.24. (Z)-4-(4-Bromobenzylidene)-3-methyl-1-phenyl-1H-pyra-
zol-5(4H)-one (12y). 12y was obtained in the same manner described
in the preparation of 11 from ethyl acetoacetate, phenylhydrazine, and
1
ethoxy-benzaldehyde. Yield 86%; mp 164−166 °C. H NMR (400
MHz, CDCl3): δ 1.53 (t, 3H), 2.34 (s, 3H), 4.05 (s, 3H), 4.23 (q, 2H),
6.95 (d, 1H), 7.32 (s, 1H), 7.44 (s, 1H), 7.71 (d, 1H), 7.94 (d, 1H),
8.21 (s, 1H), 8.90 (s, 1H). EI-MS m/z 404 (M+, 100%). HRMS (EI)
m/z calcd C20H18Cl2N2O3 (M+) 404.0694, found 404.0695.
1
4-bromobenzaldehyde. Yield 53%; mp 117−120 °C. H NMR (400
MHz, CDCl3): δ 2.36 (s, 3H), 7.21 (t, 1H), 7.32 (s, 1H), 7.43 (t, 2H),
7.65 (d, 2H), 7.95 (d, 2H), 8.39 (d, 2H). EI-MS m/z 340 (M+, 100%).
HRMS (EI) m/z calcd C17H13BrN2O (M+) 340.0211, found 340.0212.
5.1.25. Ethyl 3-Hydrazinylbenzoate (16). A mixture of 3-hydrazino
benzoic acid (0.5 g, 3.3 mmol) and concd H2SO4 (0.5 mL) in ethanol
(10 mL) was refluxed for 12 h, and most of solvent was evaporated,
filtered, washed, and dried to afford 15 (0.38 g, 64%).
5.1.17. (Z)-1-(3,5-Dichlorophenyl)-4-(4-ethoxy-3-methoxybenzyli-
dene)-3-methyl-1H-pyrazol-5(4H)-one (12r). 12r was obtained in the
same manner described in the preparation of 11 from ethyl
acetoacetate, (3,5-dichlorophenyl)hydrazine, and 3-methoxy-4-
1
ethoxy-benzaldehyde. Yield 73%; mp 182−185 °C. H NMR (400
5.1.26. Ethyl 3-(3-Methyl-5-oxo-4,5-dihydro-1H-pyrazol-1-yl)-
benzoate (17). A mixture of 16 (0.36 g, 2 mmol) and ethyl
acetoacetate (0.26 g, 2 mmol) in acetic acid (10 mL) was heated to
reflux for 4 h, poured into H2O (50 mL), and extracted with EtOAc.
The combined organic layer was washed, dried, filtered, and
condensed. The residue was purified by flash chromatography on
MHz, CDCl3): δ 1.54 (t, 3H), 2.35 (s, 3H), 4.06 (s, 3H), 4.23 (q, 2H),
6.96 (d, 1H), 7.15 (s, 1H), 7.33 (s, 1H), 7.72 (d, 1H), 8.04 (s, 2H),
8.89 (s, 1H). EI-MS m/z 404 (M+, 100%). HRMS (EI) m/z calcd
C20H18Cl2N2O3 (M+) 404.0694, found 404.0697.
5.1.18. (Z)-4-(4-Ethoxy-3-methoxybenzylidene)-1-(4-isopropyl-
phenyl)-3-methyl-1H-pyrazol-5(4H)-one (12s). 12s was obtained in
7051
dx.doi.org/10.1021/jm3002718 | J. Med. Chem. 2012, 55, 7037−7053

Journal of Medicinal Chemistry
Article
silica gel, eluted with a mixture of EtOAc/petroleum ether (1:4, v/v),
to afford 17 (0.27 g, 77%) as a white solid.
Author Contributions
∥These authors contributed equally to this work.
5.1.27. Ethyl (Z)-3-(4-(4-Ethoxy-3-methoxybenzylidene)-3-meth-
yl-5-oxo-4,5-dihydro-1H-pyrazol-1-yl)benzoate (12h). A mixture of
3-methoxy-4-ethoxy-benzaldehyde (0.18 g, 1 mmol) and 17 (0.25 g, 1
mmol) in ethanol (10 mL) was heated to reflux for 5 h, and most of
solvent was evaporated. The residue was purified by flash
chromatography on silica gel, eluted with a mixture of EtOAc/
petroleum ether (1:10, v/v), to afford 12h (0.21 g, 52%) as a yellow
solid; mp 117−121 °C. 1H NMR (400 MHz, DMSO): δ 1.44 (t, 3H),
1.56 (t, 3H), 2.39 (s, 3H), 4.07 (s, 3H), 4,25 (q, 2H), 4.43 (q, 2H),
6.98 (d, 1H), 7.36 (s, 1H), 7.51 (t, 1H), 7.75 (dd, 1H), 7.89 (d, 1H),
8.26 (d, 1H), 8.62 (t, 1H), 8.99 (d, 1H). EI-MS m/z 408 (M+, 100%).
HRMS (EI) m/z calcd C23H24N2O5 (M+) 408.1685, found 408.1682.
5.1.28. Ethyl (Z)-3-(4-((E)-3-Phenylallylidene)-3-methyl-5-oxo-4,5-
dihydro-1H-pyrazol-1-yl)benzoate (18). 18 was obtained in the same
manner described in the preparation of 12h from cinnamaldehyde and
Notes
The authors declare no competing financial interest.
ACKNOWLEDGMENTS
■
We gratefully acknowledge the financial supports from the
National Natural Science Foundation of China (grants
20902022, 81173105, 30890044), National S&T Major Project,
China (grants 2011ZX09102-005-02, 2009ZX09103-646), the
Shanghai Committee of Science and Technology (grant
11DZ2260600), the 111 Project (grant B07023), Foundation
of Chinese Academy of Sciences (grant KSCX2-EW-Q-3), and
the Fundamental Research Funds for the Central Universities.
1
17; mp 150−152 °C. H NMR (400 MHz, CDCl3): δ 1.45 (t, 3H),
2.34 (s, 3H), 4.43 (q, 2H), 7.26 (d, 1H), 7.44−7.52 (m, 4H), 7.70 (dd,
2H), 7.89 (d, 2H), 8.25 (d, 1H), 8.59−8.65 (m, 2H). EI-MS m/z 360
(M+, 100%). HRMS (EI) m/z calcd C22H20N2O3 (M+) 360.1474,
found 360.1448.
ABBREVIATIONS USED
■
FXR, farnesoid-X-receptor; NR1H4, nuclear receptor subfamily
1 group H member 4; NRs, nuclear receptors; BAs, bile acids;
Cyp7A1, liver-specific cholesterol 7α-hydroxylase; NTCP, Na+-
dependent taurocholate cotransporting polypeptide; BSEP, bile
salt export pump; HDL, high-density lipoprotein; LDL, low-
density lipoprotein; LXR, liver-X-receptor; GS, Z-guggulster-
one; HTRF, homogeneous time-resolved fluorescence assay;
LBVS, ligand-based virtual screening; PDB, Protein Data Bank;
LB, Luria−Bertani; GST, glutathione S-transferase; CDCA,
chenodeoxycholic acid; DSC, differential scanning calorimetry;
RXR, retinoid-X-receptor; FXRE, FXR response element; RT-
PCR, real-time polymerase chain reaction; BCA, bicinchoninic
acid; ACC, acetyl-CoA carboxylase; AceCS, acetyl-CoA
synthetase; FAS, fatty acid synthase; SHP, small heterodimer
partner; SREBP1c, sterol regulatory element-binding protein
1c; LRMS, low-resolution mass spectra; EI, electric ionization
5.1.29. (Z)-3-(4-((E)-3-Phenylallylidene)-3-methyl-5-oxo-4,5-dihy-
dro-1H-pyrazol-1-yl)benzoic Acid (12i). A mixture of 18 (180 mg, 0.5
mmol) and LiOH (24 mg, 1 mmol) in THF/methanol/H2O (3:1:1, v/
v/v, 20 mL) was stirred at room temperature for 12 h. The resulting
solution was acidified to pH 3 using 1 N HCl. The product was
extracted, dried, filtered, concentrated, and purified by flash
chromatography using EtOAc/petroleum ether (2:1, v/v), to afford
1
12i; mp 232−237 °C. H NMR (400 MHz, CDCl3): δ 2.34 (s, 3H),
7.33 (d, 1H), 7.44 (d, 2H), 7.54 (m, 3H), 7.70 (d, 2H), 8.31 (d, 1H),
8.61 (d, 1H), 8.65 (d, 1H), 8.72 (t, 1H). EI-MS m/z 332 (M+, 100%).
HRMS (EI) m/z calcd C20H16N2O3 (M+) 332.1161, found 332.1153.
5.1.30. Isopropyl (Z)-3-(4-(4-Hydroxy-3-methoxybenzylidene)-3-
methyl-5-oxo-4,5- dihydro-1H-pyrazol-1-yl)benzoate (12z). 12c
(100 mg, 0.284 mmol) and dried potassium carbonate (59 mg, 0.43
mmol) were dissolved in anhydrous DMF (20 mL), refluxed for 30
min, followed by addition of 2-bromopropane (59 mg, 0.34 mmol),
and the reaction was stirred overnight at 60 °C. The reaction mixture
was washed with brine and purified by flash chromatography (EtOAc/
petroleum ether = 1:4, v/v) on silica gel to afford 12z (65 mg, 65%) as
a yellow solid; mp 129−133 °C. 1H NMR (400 MHz, CDCl3): δ 1.40
(s, 3H), 1.42 (s, 3H), 2.39 (s, 3H), 4.10 (s, 3H), 5.30 (m, 1H), 7.04
(d, 1H), 7.36 (s, 1H), 7.52 (q, 2H), 7.88 (d, 1H), 8.23 (d, 1H), 8.60
(s, 1H), 9.24 (s, 1H). EI-MS m/z 394 (M+, 100%). HRMS (EI) m/z
calcd C22H22N2O5 (M+) 394.1529, found 394.1523.
REFERENCES
■
(1) Parks, D. J.; Blanchard, S. G.; Bledsoe, R. K.; Chandra, G.;
Consler, T. G.; Kliewer, S. A.; Stimmel, J. B.; Willson, T. M.; Zavacki,
A. M.; Moore, D. D.; Lehmann, J. M. Bile acids: natural ligands for an
orphan nuclear receptor. Science 1999, 284, 1365−1368.
(2) Makishima, M.; Okamoto, A. Y.; Repa, J. J.; Tu, H.; Learned, R.
M.; Luk, A.; Hull, M. V.; Lustig, K. D.; Mangelsdorf, D. J.; Shan, B.
Identification of a nuclear receptor for bile acids. Science 1999, 284,
1362−1365.
ASSOCIATED CONTENT
* Supporting Information
■
S
(3) Cariou, B.; Staels, B. FXR: a promising target for the metabolic
syndrome? Trends Pharmacol. Sci. 2007, 28, 236−243.
Known FXR modulators used in LBVS, distribution of
similarity score from LBVS, binding prediction of compounds
11 and 12u, shape comparison of compound 11 and the
matched query antagonist, HPLC reports for the purity check
of the compounds 11 and 12a−z, and pharmacokinetic
measurements of compound 12u in rat. This material is
available free of charge via the Internet at http://pubs.acs.org.
(4) Chiang, J. Y.; Kimmel, R.; Weinberger, C.; Stroup, D. Farnesoid
X receptor responds to bile acids and represses cholesterol 7alpha-
hydroxylase gene (CYP7A1) transcription. J. Biol. Chem. 2000, 275,
10918−10924.
(5) Myant, N. B.; Mitropoulos, K. A. Cholesterol 7a-hydroxylase. J.
Lipid Res. 1977, 18, 135−153.
(6) Denson, L. A.; Sturm, E.; Echevarria, W.; Zimmerman, T. L.;
Makishima, M.; Mangelsdorf, D. J.; Karpen, S. J. The orphan nuclear
receptor, shp, mediates bile acid-induced inhibition of the rat bile acid
transporter, ntcp. Gastroenterology 2001, 121, 140−147.
(7) Ananthanarayanan, M.; Balasubramanian, N.; Makishima, M.;
Mangelsdorf, D. J.; Suchy, F. J. Human bile salt export pump promoter
is transactivated by the farnesoid X receptor/bile acid receptor. J. Biol.
Chem. 2001, 276, 28857−28865.
AUTHOR INFORMATION
Corresponding Author
■
*For L.C.: phone, +86-21-50806918; E-mail, lilichen@mail.
shcnc.ac.cn; address, State Key Laboratory of Drug Research
Shanghai Institute of Materia Medica, Chinese Academy of
Sciences, 555 Zu Chong Zhi Road, Shanghai 201203, China.
For J.L.: phone, +86-21-64252584; fax, +86-21-64252584; E-
mail, jianli@ecust.edu.cn; address, Department of Pharmaceut-
ical Sciences School of Pharmacy, East China University of
Science and Technology, 130 Mei Long Road, Shanghai
200237, China.
(8) Wang, Y. D.; Chen, W. D.; Moore, D. D.; Huang, W. FXR: a
metabolic regulator and cell protector. FXR: a metabolic regulator and
cell protector. Cell Res. 2008, 18, 1087−1095.
(9) Fiorucci, S.; Mencarelli, A.; Palladino, G.; Cipriani, S. Bile-acid
activated receptors: targeting TGR5 and farnesoid-X-receptor in lipid
and glucose disorders. Trends Pharmacol. Sci. 2009, 30, 570−580.
7052
dx.doi.org/10.1021/jm3002718 | J. Med. Chem. 2012, 55, 7037−7053

Journal of Medicinal Chemistry
Article
(10) Bishop-Bailey, D.; Walsh, D. T.; Warner, T. D. Expression and
activation of the farnesoid X receptor in the vasculature. Proc. Natl.
Acad. Sci. U.S.A. 2004, 101, 3668−3673.
(11) Huang, W.; Ma, K.; Zhang, J.; Qatanani, M.; Cuvillier, J.; Liu, J.;
Dong, B.; Huang, X.; Moore, D. D. Nuclear receptor-dependent bile
acid signaling is required for normal liver regeneration. Science 2006,
312, 233−236.
(12) Yang, F.; Huang, X.; Yi, T.; Yen, Y.; Moore, D. D.; Huang, W.
Spontaneous development of liver tumors in the absence of the bile
acid receptor farnesoid X receptor. Cancer Res. 2007, 67, 863−867.
(13) Modica, S.; Murzilli, S.; Salvatore, L.; Schmidt, D. R.; Moschetta,
A. Nuclear bile acid receptor FXR protects against intestinal
tumorigenesis. Cancer Res. 2008, 68, 9589−9594.
(14) Fiorucci, S.; Mencarelli, A.; Distrutti, E.; Palladino, G.; Cipriani,
S. Targeting farnesoid-X-receptor: from medicinal chemistry to disease
treatment. Curr. Med. Chem. 2010, 17, 139−159.
(15) Fiorucci, S.; Cipriani, S.; Baldelli, F.; Mencarelli, A. Bile acid
activated receptors in the treatment of dyslipidemia and related
disorders. Prog. Lipid Res. 2010, 49, 171−185.
(16) Fiorucci, S.; Baldelli, F. Farnesoid X receptor agonists in biliary
tract disease. Curr. Opin. Gastroenterol. 2009, 25, 252−259.
(17) Fiorucci, S.; Rizzo, G.; Donini, A.; Distrutti, E.; Santucci, L.
Targeting farnesoid X receptor for liver and metabolic disorders.
Trends Mol. Med. 2007, 13, 298−309.
(18) Fiorucci, S.; Cipriani, S.; Mencarelli, A.; Baldelli, F.; Bifulco, G.;
Zampella, A. Farnesoid X Receptor Agonist for the Treatment of Liver
and Metabolic Disorders: Focus on 6-Ethyl-CDCA. Mini-Rev. Med.
Chem. 2011, 11, 753−762.
(30) Shen, X.; Tomoo, K.; Uchiyama, S.; Kobayashi, Y.; Ishida, T.
Structural and thermodynamic behavior of eukaryotic initiation factor
4E in supramolecular formation with 4E-binding protein 1 and mRNA
cap analogue, studied by spectroscopic methods. Chem. Pharm. Bull.
2001, 49, 1299−1303.
(31) Zhang, H.; Zhou, R.; Li, L.; Chen, J.; Chen, L.; Li, C.; Ding, H.;
Yu, L.; Hu, L.; Jiang, H.; Shen, X. Danthron functions as an RXR
antagonist by stabilizing the receptor’s tetramers. J. Biol. Chem. 2010,
286, 1868−1875.
(32) Renga, B.; Mencarelli, A.; D’Amore, C.; Cipriani, S.; D’Auria, M.
V.; Sepe, V.; Chini, M. G.; Monti, M. C.; Bifulco, G.; Zampella, A.;
Fiorucci, S. Discovery that theonellasterol a marine sponge sterol is a
highly selective FXR antagonist that protects against liver injury in
cholestasis. PLoS One 2012, 7, e30443.
(33) Pellicciari, R.; Costantino, G.; Fiorucci, S. Farnesoid X
Receptor: From Structure to Potential Clinical Applications. J. Med.
Chem. 2005, 48, 5383−5403.
(34) Szapary, P. O.; Wolfe, M. L.; Bloedon, L. T.; Cucchiara, A. J.;
DerMarderosian, A. H.; Cirigliano, M. D.; Rader, D. J. Guggulipid for
the treatment of hypercholesterolemia: a randomized controlled trial.
JAMA, J. Am. Med. Assoc. 2003, 290, 765−772.
(35) Akwabi-Ameyaw, A.; Bass, J. Y.; Caldwell, R. D.; Caravella, J. A.;
Chen, L.; Creech, K. L.; Deaton, D. N.; Jones, S. A.; Kaldor, I.; Liu, Y.;
Madauss, K. P.; Marr, H. B.; McFadyen, R. B.; Miller, A. B.; Iii, F. N.;
Parks, D. J.; Spearing, P. K.; Todd, D.; Williams, S. P.; Wisely, G. B.
Conformationally constrained farnesoid X receptor (FXR) agonists:
naphthoic acid-based analogs of GW 4064. Bioorg. Med. Chem. Lett.
2008, 18, 4339−4343.
(36) Akwabi-Ameyaw, A.; Caravella, J. A.; Chen, L.; Creech, K. L.;
Deaton, D. N.; Madauss, K. P.; Marr, H. B.; Miller, A. B.; Navas, F.;
Parks, D. J.; Spearing, P. K.; Todd, D.; Williams, S. P.; Wisely, G. B.
Conformationally constrained farnesoid X receptor (FXR) agonists:
alternative replacements of the stilbene. Bioorg. Med. Chem. Lett. 2011,
21, 6154−6160.
(19) Urizar, N. L.; Liverman, A. B.; Dodds, D. T.; Silva, F. V.;
Ordentlich, P.; Yan, Y.; Gonzalez, F. J.; Heyman, R. A.; Mangelsdorf,
D. J.; Moore, D. D. A natural product that lowers cholesterol as an
antagonist ligand for FXR. Science 2002, 296, 1703−1706.
(20) Verma, A. K.; Khemaria, P.; Gupta, J.; Singh, D. P.; Joshi, B. S.;
Roy, R.; Mishra, A. K.; Pratap, R. Bio-transformation of FXR
antagonist CDRI 80/574. ARKIVOC 2010, 9, 1−11.
(21) Sepe, V.; Bifulco, G.; Renga, B.; D’Amore, C.; Fiorucci, S.;
Zampella, A. Discovery of sulfated sterols from marine invertebrates as
a new class of marine natural antagonists of farnesoid-X-receptor. J.
Med. Chem. 2011, 54, 1314−1320.
(22) Yu, J.; Lo, J. L.; Huang, L.; Zhao, A.; Metzger, E.; Adams, A.;
Meinke, P. T.; Wright, S. D.; Cui, J. Lithocholic acid decreases
expression of bile salt export pump through farnesoid X receptor
antagonist activity. J. Biol. Chem. 2002, 277, 31441−31447.
(23) Nam, S. J.; Ko, H.; Shin, M.; Ham, J.; Chin, J.; Kim, Y.; Kim, H.;
Shin, K.; Choi, H.; Kang, H. Farnesoid X-activated receptor
antagonists from a marine sponge Spongia sp. Bioorg. Med. Chem.
Lett. 2006, 16, 5398−5402.
(24) Carter, B. A.; Taylor, O. A.; Prendergast, D. R.; Zimmerman, T.
L.; Von Furstenberg, R.; Moore, D. D.; Karpen, S. J. Stigmasterol, a
soy lipid-derived phytosterol, is an antagonist of the bile acid nuclear
receptor FXR. Pediatr. Res. 2007, 62, 301−306.
(25) Dussault, I.; Beard, R.; Lin, M.; Hollister, K.; Chen, J.; Xiao, J.
H.; Chandraratna, R.; Forman, B. M. Identification of gene-selective
modulators of the bile acid receptor FXR. J. Biol. Chem. 2003, 278,
7027−7033.
(26) Kaimal, R.; Song, X.; Yan, B.; King, R.; Deng, R. Differential
modulation of farnesoid X receptor signaling pathway by the
thiazolidinediones. J. Pharmacol. Exp. Ther. 2009, 330, 125−134.
(27) Kainuma, M.; Makishima, M.; Hashimoto, Y.; Miyachi, H.
Design, synthesis, and evaluation of non-steroidal farnesoid X receptor
(FXR) antagonist. Bioorg. Med. Chem. 2007, 15, 2587−2600.
(28) Sastry, G. M.; Dixon, S. L.; Sherman, W. Rapid shape-based
ligand alignment and virtual screening method based on atom/feature-
pair similarities and volume overlap scoring. J. Chem. Inf. Model. 2011,
51, 2455−66.
(29) Ma, R.; Zhu, J.; Liu, J.; Chen, L.; Shen, X.; Jiang., H.; Li, J.
Microwave-assisted one-pot synthesis of pyrazolone derivatives under
solvent-free conditions. Molecules 2010, 15, 3593−3601.
7053
dx.doi.org/10.1021/jm3002718 | J. Med. Chem. 2012, 55, 7037−7053