Neochromine S5 improves contact hypersensitivity through a selective effect on activated T lymphocytes

Article abstract of DOI:10.1016/j.bcp.2014.08.032

Strategy on activated T cells is an effective treatment for T cell mediated diseases. By using a synthesized chromone derivative, we examined its effects on the activated T cells. This compound, (Z)-1,3-dihydroxy-9-methyl-13H-benzo[b]chromeno[3,2-f][1,4]oxazepin-13-one (neochromine S5), exhibited immunosuppressive activity in vitro and in vivo. Interestingly, neochromine S5 selectively inhibited proliferation and induced apoptosis in T lymphocytes activated by concanavalin A (Con A) in a dose-dependent manner but not in nave T lymphocytes, distinct from quercetin. This compound triggered mitochondrial apoptotic pathway including cleavage of caspase 3, caspase 9 and PARP, downregulation of bcl-2 and release of cytochrome c in activated T cells, but did not affect ER stress or Fas signals. In addition, neochromine S5 downregulated the expression of CD25 and CD69 and the production of inflammatory cytokines, including TNFα, IFNγ and IL-2, improved ear swelling in mice with contact hypersensitivity, reduced CD4⁺ T cells infiltration, and increased apoptosis of isolated T lymphocytes from peripheral lymph nodes. Moreover, neochromine S5 showed no effect on the weight of mice and their immune organs, while dexamethasone caused a significant weight loss. Taken together, our results suggest that neochromine S5 exerts a unique anti-inflammatory activity mainly through a selective effect on activated T cells, which is different from the current immunosuppressant, dexamethasone.

Full text of DOI:10.1016/j.bcp.2014.08.032

Biochemical Pharmacology 92 (2014) 358–368
Contents lists available at ScienceDirect
Biochemical Pharmacology
journal homepage: www.elsevier.com/locate/biochempharm
Neochromine S5 improves contact hypersensitivity through a selective
effect on activated T lymphocytes
Zhe Gao a, Yuxiang Ma a, Dan Zhao b, Xiong Zhang a, Hang Zhou a, Hailiang Liu a, Yang Zhou a,
b
a,
a,
Xuefeng Wu a, Yan Shen a, Yang Sun a, , Jianxin Li , Xudong Wu , Qiang Xu
*
*
*
a State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, 22 Hankou Road, Nanjing 210093, China
b State Key Lab of Analytical Chemistry for Life Science, School of Chemistry and Chemical Engineering, Nanjing University, Nanjing 210093, China
A R T I C L E I N F O
A B S T R A C T
Article history:
Strategy on activated T cells is an effective treatment for T cell mediated diseases. By using a
synthesized chromone derivative, we examined its effects on the activated T cells. This compound,
(Z)-1,3-dihydroxy-9-methyl-13H-benzo[b]chromeno[3,2-f][1,4]oxazepin-13-one (neochromine S5),
exhibited immunosuppressive activity in vitro and in vivo. Interestingly, neochromine S5 selectively
inhibited proliferation and induced apoptosis in T lymphocytes activated by concanavalin A (Con A) in
a dose-dependent manner but not in na¨ıve T lymphocytes, distinct from quercetin. This compound
triggered mitochondrial apoptotic pathway including cleavage of caspase 3, caspase 9 and PARP,
downregulation of bcl-2 and release of cytochrome c in activated T cells, but did not affect ER stress or
Fas signals. In addition, neochromine S5 downregulated the expression of CD25 and CD69 and the
Received 2 July 2014
Accepted 25 August 2014
Available online 11 September 2014
Keywords:
Neochromine S5
Activated T lymphocytes
Mitochondrial apoptosis
Contact hypersensitivity
production of inflammatory cytokines, including TNFa, IFNg and IL-2, improved ear swelling in mice
with contact hypersensitivity, reduced CD4+ T cells infiltration, and increased apoptosis of isolated T
lymphocytes from peripheral lymph nodes. Moreover, neochromine S5 showed no effect on the weight
of mice and their immune organs, while dexamethasone caused a significant weight loss. Taken
together, our results suggest that neochromine S5 exerts a unique anti-inflammatory activity mainly
through a selective effect on activated T cells, which is different from the current immunosuppressant,
dexamethasone.
ß 2014 Elsevier Inc. All rights reserved.
1. Introduction
several cell surface markers such as CD25 and CD69, and
produce specific cytokines such as TNFa, IFNg, IL-2, and so on.
During immune response, T lymphocytes will be activated and
develop effector functions that help to kill the pathogens.
However, the effector functions are also harmful to healthy
tissue. To limit the damage, the host will evolve some
mechanisms to shut down immune responses, including causing
cell inactivation and inducing apoptosis of activated cells [1–
3]. As to the mechanisms that participate in the progress of
apoptosis, there include the direct activation of caspase cascade
(mitochondrial pathway) [4], the activation of the Fas death
receptor/Fas ligand (FasL) complex (death receptors) [5,6], and
the ER stress-mediated pathway [7]. The activated T cells express
In addition, a number of studies have illustrated that the
increased expression of CD25, CD69 and production of inflam-
matory cytokines correlates with autoimmune and inflammatory
diseases [8–11]. By means of such mechanisms, the apoptosis
induction in such as activated T cells as well as the inhibition on
inflammatory cytokines or T cell activation has been used as an
effective strategy in the drug discovery for various immune
diseases [12,13].
However, there is still lack of drugs selectively targeting the
effector population such as activated T cells to avoid the injury of
irrelevant cells. In previous studies, we have reported that several
herbal extracts showed a selective inhibition on activated T
lymphocytes [12–14]. These are quite different from the common-
ly used immunosuppressants, which have severe side effects
primarily owing to their poor selectivity, including glucocorticoids,
cyclophosphamide and even cyclosporine A [15–17].
*
Corresponding authors. Tel.:+86 25 83597620; fax: +86 25 83597620.
E-mail addresses: sunyangnju@163.com (Y. Sun), xudongwu@nju.edu.cn
(X. Wu), molpharm@163.com, qiangxu@nju.edu.cn (Q. Xu).
http://dx.doi.org/10.1016/j.bcp.2014.08.032
0006-2952/ß 2014 Elsevier Inc. All rights reserved.

Z. Gao et al. / Biochemical Pharmacology 92 (2014) 358–368
359
In the present study, we studied their effect on activated and
non-activated T cells and found that (Z)-1,3-dihydroxy-9-methyl-
13H-benzo[b]chromeno[3,2-f][1,4]oxazepin-13-oneF (neochro-
mine S5), a synthesized chromone derivative, inhibited the
proliferation and increased apoptosis of activated T cells, but
had little effect on non-activated cells. In contact hypersensitivity,
neochromine S5 prevented ear swelling and inhibited CD4+ T cells
infiltration. Such selective effect of neochromine S5 was further
159.30, 161.14, 164.81, 167.89, 179.46; HRMS-ESI (m/z): calcd for
C
17H12NO5 [M+H]+: 310.0715 found: 310.0709.
confirmed in
a murine model of T cell-mediated contact
hypersensitivity.
2. Materials and methods
2.1. Synthesis of neochromine S5
All reagents and solvents for the synthesis of neochromine S5
were commercially available and used without further purifica-
tion. Melting points were determined on a Taike X-4 digital
micromelting point apparatus and uncorrected. 1H and 13C NMR
spectra were taken on a Bruker DPX-300 spectrometer, using TMS
Reagents and conditions: (a) BnCl, K2CO3, HMPA, 90 8C, 3 h; (b)
POCl3, DMF, 0 8C to rt, 12 h; (c) (i) o-aminophenol, p-TsOH, toluene,
80 8C, 3 h; (ii) DDQ, xylene, 130 8C, 3 h; (d) BBr3, CH2Cl2, ꢀ78 8C to
room temperature, 8 h.
as an internal standard (chemical shifts in
d
). ESI-HR-MS were
2.2. Animals and cells
obtained on Esquire 4000 mass spectrometer.
To a solution of 1-(2,4,6-trihydroxyphenyl)ethanone (1) (60 g,
0.36 mol) in HMPA (300 mL) was added K2CO3 (148 g, 1.07 mol)
and BnCl (86.3 mL, 0.75 mol), and the suspension was stirred at
90 8C for 3 h. The solid was filtered, and the filtrate was poured into
ice-water. The pH of the solution was adjusted to 2 by adding
diluted hydrochloric acid. The resulting solid was filtered and
recrystallized in CH2Cl2/MeOH to give 1-(2,4-bis(benzyloxy)-6-
hydroxyphenyl)ethanone (2). Yield: 75%; 1H NMR (CDCl3,
Female BALB/c mice (6–8 weeks of age, 18–22 g) were obtained
from the Experimental Animal Center of Yangzhou University
(Yangzhou, Jiangsu, China). They were maintained with free access
to pellet food and water in plastic cages at 21 ꢁ 2 8C and kept on a
12 h light–dark cycle. Animal welfare and experiments were carried
out strictly in accordance with the Guide for the Care and Use of
Laboratory Animals (Ministry of Science and Technology of China,
2006) and the related ethical regulations of our university. All efforts
were made to minimize animals’ suffering and to reduce the number
of animals used. Jurkat cell was purchased from the Shanghai
Institute of Cell Biology (Shanghai, China).
300 MHz) d: 2.56 (3H, s) 5.06 (4H, s), 6.11 (1H, s), 6.17 (1H, s),
7.41 (10H, m), 14.04 (1H, s).
To a solution of 2 (15.0 g, 43 mmol) in DMF (100 mL) was added
POCl3 (19.5 mL, 213 mmol) dropwise at 0 8C and the solution was
stirred at room temperature for 12 h. The reaction mixture was
poured into ice water, and resulting solid was dissolved in
CH2Cl2. The organic layer was washed with brine, dried over
anhydrous Na2SO4 and concentrated in vacuo. The residue was
purified through chromatography eluting with CH2Cl2/EtOAc (25/
1) to give 5,7-bis(benzyloxy)-4-oxo-4H-chromene-3-carbalde-
hyde (3). Yield: 70%; 1H NMR (CDCl3, 300 MHz)
d: 5.11 (2H, s),
5.22 (2H, s), 6.56 (1H, d, J = 2.1 Hz), 6.58 (1H, d, J = 2.1 Hz), 7.42 (8H,
m), 7.59 (2H, d, J = 7.5 Hz), 8.32 (1H, s), 10.38 (1H, s); ESI-MS m/z:
387 [M+H]+.
To a solution of 3 (386 mg, 1 mmol) in toluene (10 mL) was
added o-aminophenol (1 mmol) and pTSA (cat. amount), and the
reaction mixture was stirred at 80 8C for 3 h and concentrated in
vacuo. The residue was dispersed in xylene (10 mL) and DDQ
(271 mg, 1.2 mmol) was added. The suspension was stirred at
130 8C for 3 h. The reaction mixture was cooled and poured into
cold petroleum ether. The resulting solid was filtered and purified
through chromatography to yield 1,3-bis(benzyloxy)-9-methyl-
13H-benzo[b]chromeno[3,2-f][1,4]oxazepin-13-one (4).
2.3. Reagents and antibodies
CFSE cell proliferation kit was from Thermo Fisher Scientific Inc.
(Waltham, MA). Annexin V-FITC/propidiumiodide (AV/PI) assay kit
for flow cytometry was from Jingmei Biotech Co., Ltd. (Shenzhen,
China). Cyclosporin A (CsA), thapsigargin (TG), concanavalin A (Con
A), dimethylsulfoxide (DMSO), 3-(4, 5-dimethylthylthiazol-2-yl)-
2, 5-diphenyl-tetrazolium bromide (MTT), 2,4,6-trinitrobenzene-
sulphonic acid (TNBS) and quercetin were obtained from Sigma (St.
Louis, MO). Picryl chloride (PCl) was obtained from Nacalai Tesque
Inc. (Kyoto, Japan). Mouse anti-CD25-APC, mouse anti-CD69-FITC,
mouse anti-CD44-FITC, mouse anti-CD62L-PE and mouse anti-
CD4-FITC were from ebioscience Inc. (San Diego, CA). Mitochon-
drial membrane potential (DCm) assay kit with JC-1 was from
Beyotime Institute of Biotechnology (Shanghai, China). Terminal
deoxynucleotidyl transferase-mediated dUTP nick end-labeling
(TUNEL) Kit was from Calbiochem (La Jolla, CA). TNFa, IFNg, and IL-
2 ELISA kits were from Dakewe Biotech Co., Ltd. (Beijing, China).
Dexamethasone (DEX) was from Xianju Pharmaceutical Co., Ltd.
(Zhejiang, China). Fetal bovine serum (FBS) and RPMI 1640 medium
were purchased from Thermo Fisher Scientific Inc. (Waltham, MA).
PCl was obtained from Nacalai Tesque Inc. (Kyoto, Japan).
Glycylglycin and all other chemicals were obtained from Nanjing
Sunshine Biotechnology Co., Ltd. (Nanjing, China). The antibodies
To a solution compound 4 (0.5 mmol) in anhydrous CH2Cl2 at
ꢀ78 8C was added a solution of BBr3 in CH2Cl2 (1.1 mL, 1 M), and
the suspension was stirred at room temperature for 8 h. The
reaction was quenched by the addition of water (1 mL), and the
resulting solid was filtered, washed with water and recrystallized
in acetone/CH2Cl2 to afford (Z)-1,3-dihydroxy-9-methyl-13H-
benzo[b]chromeno[3,2-f][1,4]oxazepin-13-one (5), which was
named as neochromine S5. Yield: 52% (3 steps); mp 289–291 8C;
used in this study were as follows: anti-a-tubulin, anti-GADD153,
anti-p-PERK (Santa Cruz Biotechnology, Santa Cruz, CA), anti-XBP-
1, anti-PARP, anti-cleaved caspase 3, anti-cleaved caspase 9, anti-
Bad, anti-Bcl-2 and anti-COX-IV (Cell Signaling Technology,
Boston, MA), anti-cytochrome c (BD Pharmigen, San Diego, CA),
peroxidase-labeled anti-mouse and anti-rabbit antibody (KPL,
Gaithersburg, MD).
1H NMR (C5D5N, 300 MHz)
7.15 (1H, d, J = 7.7 Hz), 7.55 (1H, d, J = 7.7 Hz), 7.70 (1H, s), 9.04 (1H,
s), 13.34 (1H, br); 13C NMR (C5D5N, 75 MHz)
: 22.41, 96.68,
102.35, 106.61, 111.83, 113.90, 121.60, 128.10, 135.94, 143.43,
d: 2.34 (3H, s), 6.69 (1H, s), 6.76 (1H, s),
d

360
Z. Gao et al. / Biochemical Pharmacology 92 (2014) 358–368
2.4. T cell purification and culture
mixture including 1 mg of total RNA, oligo (dT) 18 primers and
M-MLV reverse transcriptase. PCR primer sequences were as
follows:
-actin, forward 50-CAACGAGCGGTTCCGATG and reverse
50-GCCACAGGATTCCATACCCA; Tnf , forward 50-TTCTGTCTACT-
GAACTTCGGGGTGATCGGTCC and reverse 50–GTATGAGATAGCAA-
ATCGGCTGACGGTGTGGG; Ifn
forward 50-ATGAACGCTACA-
CACTGCATC and reverse 50-CCATCCTTTTGCCAGTTCCTC; Il-2,
forward 50-CTACAGCGGAAGCACAGC and reverse 50-TCCTCA-
GAAAGTCCACCA. Real-time PCR was performed as described
previously [18]. Briefly, the cDNA samples were performed with
Bio-Rad CFX Connect real-time system using IQ SYBR Green
supermix (Bio-Rad Laboratories, Inc., Hercules, CA), and threshold
cycle numbers were obtained using Bio-Rad CFX Manager
software. Conditions for amplification were 1 cycle of 94 8C for
5 min followed by 40 cycles of 94 8C for 30 s, 60 8C for 30 s, and
72 8C for 45 s.
T cells were isolated from lymph nodes and spleen of BALB/c
mice and purified using Dynal1 mouse T cell Negative Isolation Kit
(Thermo Fisher Scientific Inc., Waltham, MA) via standard
procedure, and the purity was higher than 97%. All cells were
cultured in RPMI 1640 medium supplemented with 10% FBS,
b
a
g
,
100 U/ml penicillin, and 100
mg/ml streptomycin at 37 8C in a 5%
(v/v) humidified CO2 incubator.
2.5. Cell activation and proliferation
T cells isolated from BALB/c mice were stimulated by Con A
(5
mg/ml)for24 h, as activated Tcells, andthosewithoutConA were
indicated as non-activated T cells or na¨ıve T cells. Anti-CD25-APC
andanti-CD69-FITCwereusedtotestthelevelofTcellsactivationby
flow cytometric analysis. Proliferation of T cells was detected
according to standard procedures using CFSE cell proliferation kit.
2.11. Cytokine analysis by ELISA assay
2.6. MTT assay
TNFa, IFNg, and IL-2 in the supernatant were measured with
ELISA kit, according to the manufacturer’s instruction.
Purified mouse T cells were cultured in 96-well plates in RPMI
1640 medium (0.2 ml). After stimulated with Con A, the cells were
treated with or without neochromine S5 for 24 h, then the cell
2.12. PCl-induced contact hypersensitivity
viability was assessed by MTT assay. MTT (4 mg/ml in PBS, 20
per well) was added to each well. After 4 h of additional incubation,
remove the culture media, 200 l DMSO was added to dissolve the
m
l
The PCl-induced contact hypersensitivity was measured
according to the method described by Fei et al. [19]. BALB/c mice
were sensitized by applying 100 ml of 1% PCl in ethanol on the
m
crystals. The absorption values at 570 nm were determined.
abdomen. Neochromine S5 (3 or 10 mg/kg) and DEX (5 mg/kg)
were orally administered for 6 days after sensitization. Control
animals with contact hypersensitivity were given water instead of
2.7. Cell apoptosis assay
drugs. After 5 days, they were challenged with 30
ml of 1% PCl in
Cell apoptosis was determined using Annexin V/PI staining, JC-1
staining and TUNEL assay. For Annexin V/PI staining, cells were
incubated with Annexin V-FITC and PI for 20 min at room
temperature in dark, and then tested through flow cytometric
analysis. For JC-1 staining, cells were detected according to
standard procedures using mitochondrial membrane potential
olive oil on the right ear. 24 h later, the left and right ears thickness
were measured with an engineer’s micrometer (Mitutoyo Co.,
Tokyo, Japan). Ear swelling was worked out according to the
difference between the right and left ears in thickness. The mice
spleen index and thymus index were calculated as follows:
(
DCm) assay kit with JC-1 and samples were analyzed by flow
spleen weightðmgÞ
Spleen index ¼
ꢂ 10
cytometer. For TUNEL assay, the cells were detected according to
standard procedures using TUNEL Kit and samples were analyzed
by flow cytometer.
body weightðgÞ
thymus weightðmgÞ
body weightðgÞ
Thymus index ¼
ꢂ 10
2.8. T cell subsets analysis
Central memory T cells (CD44hiCD62Lhi) and na¨ıve T cells
(CD44loCD62Lhi) were distinguished with anti-CD44 and anti-
CD62L staining and analyzed by flow cytometer.
lymph node weightðmgÞ
body weightðgÞ
Lymph node index ¼
ꢂ 10
2.9. Western blotting
2.13. Hapten-specific T cell proliferation
Cells were harvested and lysed with RIPA buffer for 30 min on
ice. The protein concentration was determined with the BCA protein
assay kit (Thermo Fisher Scientific Inc., Waltham, MA). An equal
amount of protein was subjected to electrophoresis on 10% SDS–
PAGE and transferred by electroblotting onto a polyvinylidene
fluoride membrane (Millipore Corp., Bedford, MA). After blocking
with 5% non-fat milk for 1 h at room temperature, the membrane
was incubated with primary antibody overnight at 4 8C, and then
incubated with secondary antibody for 1.5 h at room temperature.
Detection was performed using a 20ꢂ LumiGLO Reagent and 20ꢂ
Peroxide kit (Cell Signaling Technology, Boston, MA).
The detection procedure was performed as described previous-
ly [19]. Splenocytes, isolated from BALB/c mice 5 days after PCl
sensitization, were treated with 1.0 mM TNBS (water-soluble
analog of PCl) and 25 mg/ml mitomycin C, then incubated at 37 8C
for 30 min. After being washed 3 times in HBSS (containing 0.6%
glycylglycin), the cells were used as stimulator cells (trinitrophe-
nylated splenocytes). Meanwhile, lymphocytes were obtained
from the above described sensitized mice after the adherent cells
were removed, and used as responder cells. The 4 ꢂ 105 stimulator
cells and 2 ꢂ105 responder cells were co-cultured for 72 h. Then
cell proliferation was examined by MTT assay. The stimulation
index (SI) was calculated as follows:
2.10. Real-time PCR
ODstimulated cells
Total RNA was extracted from the cells with trizol reagent.
Stimulation index ¼
ꢂ 10
ODnonstimulated cells
The cDNA synthesis reaction was performed in
a reaction

Z. Gao et al. / Biochemical Pharmacology 92 (2014) 358–368
361
2.14. Statistical analysis
3. Results
Results were expressed as means ꢁ SEM of three independent
experiments with each experiment including triplicate sets in vitro,
or of eight animals per group in vivo. Student’s t test was used to test
the difference between two groups. One-way ANOVA and post hoc
tests were applied when there were more than two groups in the
independent variable. p < 0.05 was considered to be significant.
3.1. Neochromine S5 inhibited proliferation and induced apoptosis in
Con A-activated T cells
The chemical structure and the 1H NMR spectrum of
neochromine S5 was shown in Fig. 1A. T cells from BALB/c mice
were activated with Con A (5
mg/ml) and subsequently incubated
Fig. 1. Effects of neochromine S5 on proliferation and apoptosis of Con A-activated T cells. (A) The chemical structural formula and the 1H NMR spectrum of neochromine S5.
(B) T lymphocytes isolated from BALB/c mice were labeled with CFSE, and then incubated with Con A and various concentrations of neochromine S5 for 72 h. The proliferation
rate was examined by flow cytometry. (C) T lymphocytes from BALB/c mice were incubated with Con A for 24 h, and were treated with various concentrations of neochromine
S5 for the subsequent 24 h. (D) T lymphocytes from BALB/c mice were treated with various concentrations of neochromine S5 for 24 h without activation. In C and D, cells
were co-stained with Annexin V/PI to determine apoptosis by flow cytometry. Data (B–D) shown here are one of three independent experiments. Values are shown as
mean ꢁ SEM of three independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001 vs controls.

362
Z. Gao et al. / Biochemical Pharmacology 92 (2014) 358–368
Fig. 2. Effects of neochromine S5 on mitochondrial apoptotic pathway in Con A-activated T cells. T lymphocytes from BALB/c mice were activated with Con A and incubated
with neochromine S5 as mentioned above. (A) DCm was measured by JC-1 staining. (B) Protein levels of PARP, Cleaved caspase 3, Cleaved caspase 9, Bad and Bcl-2 were
analyzed by western blotting. (D) Cytochrome c of mitochondria and cytoplasm was detected by western blotting. Data shown here are one of three independent
experiments. (C, E) Relative band intensity was determined via Image J software. Values are means ꢁ SEM of three independent experiments. *p < 0.05, **p < 0.01,
***p < 0.001 vs controls.

Z. Gao et al. / Biochemical Pharmacology 92 (2014) 358–368
363
with various concentrations of neochromine S5 (10, 30 and
100 M). Then, the proliferation rate was examined by CFSE
increased PARP cleavage, Bad expression, caspase 3 and caspase
9 activation and reduced Bcl-2 expression (Fig. 2B and C). In
addition, neochromine S5 significantly induced a release of
cytochrome c from mitochondria to cytosol in a dose-dependent
manner (Fig. 2D and E).
Then, we assayed the intrinsic ER stress and the death receptor-
mediated pathway. p-PERK, GADD153 and XBP-1 expressions were
analyzed by western blotting, which are the major molecules
involved in ER-stress (Fig. 3A). As the result, neochromine S5 had
no effect on p-PERK, GADD153 and XBP-1 whereas TG (as a positive
control) increased ER stress significantly. To test the death
receptors pathway, Jurkat cells and FADDꢀ/ꢀ Jurkat cells were
m
staining. Neochromine S5 dose-dependently inhibited the prolif-
eration of Con A-activated T cells (Fig. 1B). In addition, Annexin V/
PI staining indicated that neochromine S5 induced apoptosis in
activated but not non-activated T cells (Fig. 1C and D). Quercetin
was used as a positive control, which induced apoptosis both in
activated and non-activated T cells.
3.2. Neochromine S5 triggered mitochondrial apoptotic pathway but
not ER stress or Fas-dependent signals in Con A-activated T cells
To investigate the molecular mechanism of neochromine S5
on apoptosis of activated T cells, we determined effects of
neochromine S5 on mitochondrial signals. T cells from BALB/c
mice were stimulated with Con A and incubated with various
activated by PHA (0.5
concentrations of neochromine S5 (10, 30 and 100
m
g/ml) and incubated with various
M) or
m
quercetin. Apoptosis was confirmed by TUNEL assay (Fig. 3B).
The apoptotic rate induced by quercetin was greatly decreased in
FADDꢀ/ꢀ Jurkat cells as compared with that in wild type Jurkat
cells. However, neochromine S5 induced apoptosis at the same rate
in both wild type and FADDꢀ/ꢀ Jurkat cells.
concentrations of neochromine S5 (10, 30 and 100
mM). JC-1
staining was used to determine the DCm. Neochromine S5
caused collapsing of the DCm in activated T cells (Fig. 2A) and
Fig. 3. Effects of neochromine S5 on ER stress and death receptor signals in Con A-activated T cells. (A) T lymphocytes from BALB/c mice were treated as above. Protein levels of
GADD153, p-PERK and XBP-1 were analyzed by western blotting as shown in the left panel, and relative band intensity was indicated in the right panel. Values are
means ꢁ SEM of three independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001 vs controls. (B) Jurkat and FADDꢀ/ꢀ Jurkat cells were activated with PHA for 24 h, treated with
neochromine S5 for another 24 h, and then stained with dUTP-FITC by flow cytometry assay. Data shown here are one of three independent experiments.

364
Z. Gao et al. / Biochemical Pharmacology 92 (2014) 358–368
Fig. 4. Effects of neochromine S5 on cell surface CD25 and CD69 expressions in Con A-activated T cells. T lymphocytes were incubated with Con A and neochromine S5 as
mentioned above, and surface (A) CD25 and (B) CD69 expression was analyzed by flow cytometry. Data shown here are one of three independent experiments. Values are
means ꢁ SEM of three independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001 vs controls.
3.3. Neochromine S5 inhibited CD25 and CD69 expression and
prevented the cytokines prolife in Con A-activated T cells
PCl-induced contact hypersensitivity, oral administration of neo-
chromine S5 inhibited ear swelling significantly (Fig. 6A). In this
case, the body weight and immune organ index were not influenced
by the neochromine S5 treatment, while DEX, the positive control,
greatly caused weight loss and reduced the weights of thymus,
lymph node and spleen (Fig. 6B). As the improvement of the
hypersensitivity, histopathologic injuries, severe inflammatory cell
infiltration, vascular congestion, and moderate edema in the dermis
and subcutaneous tissue were mainly lowered by neochromine S5
treatment, where 10 mg/kg of neochromine S5 showed an
improvement to a similar extent with 5 mg/kg of DEX (Fig. 6C).
Neochromine S5 also dose-dependently prevented infiltration of
CD4+ T cells into ear (Fig. 6D) and increased the percentages of
apoptotic T cells (Fig. 6E). In addition, neochromine S5 decreased the
percentages of central memory T cells but not na¨ıve T cells (Fig. 6F).
CD25 and CD69 have been served as markers of activated T
lymphocytes [20]. They can be triggered by several agents
interacting with the T cell receptor (TCR)/CD3 complex [21]. The
surface expressions of CD25 and CD69 were up-regulated in Con A-
activated T cells, and were down-regulated by neochromine S5
treatment in a dose-dependent manner (Fig. 4A and B). CsA, a well-
known immunosuppressant, was used as a positive control, which
also showed a significant inhibitory effect on both CD25 and CD69
expressions.
Furthermore, neochromine S5 dose-dependently inhibited the
expression of pro-inflammatory cytokines, TNFa, IFNg and IL-2, in
activated T cells in both protein and mRNA levels (Fig. 5A and B).
3.4. Neochromine S5 ameliorated ear swelling, prevented CD4+ T cells
infiltration, and induced apoptosis of T lymphocytes in mice with
contact hypersensitivity
3.5. Neochromine S5 inhibited CD69 and inflammatory cytokine
expression in hapten-specifically activated T cells isolated from PCl-
sensitized mice
Contact hypersensitivity as an animal model of T cell mediated
allergic contact dermatitis has been studied extensively. In
To confirm the effect of neochromine S5 on the activated T cells,
we did an ex vivo experiment, where T cells were isolated from

Z. Gao et al. / Biochemical Pharmacology 92 (2014) 358–368
365
Fig. 5. Effect of neochromine S5 on inflammatory cytokines in Con A-activated T lymphocytes. T lymphocytes isolated from BALB/c mice were treated with Con A and
neochromine S5 as above. (A) The content of Inflammatory cytokines in supernatant was measured by ELISA. (B) The mRNA expression was detected with real-time PCR. Data
are shown as means ꢁ SEM of three independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001 vs controls.
PCl-sensitized mice and triggered with hapten TNBS or trinitro-
phenylated splenocytes. As the results, the treatment of neochro-
mine S5 concentration-dependently reduced CD69 expression in
activated T lymphocytes after 12 h (Fig. 7A), and mRNA expres-
sions of Tnfa, Ifng and Il-2 after 6 h (Fig. 7B). Furthermore, the
hapten-specific T cell proliferation was dose-dependently de-
creased after 72 h treatment of neochromine S5 (Fig. 7C).
neochromine S5, a synthesized chromone derivative, to examine
its effective properties against activated T cells. The results
indicated that, compared with CsA and DEX, neochromine S5
showed high immunosuppressive activity through a selective
targeting on activated T cells with low side effects in vitro and in
vivo.
Firstly, we found that neochromine S5 suppressed proliferation
and induced apoptosis in Con A-activated T cells in a concentra-
tion-dependent manner using MTT, CFSE and Annexin V/PI assay
(Fig. 1B and C). It should be noted that neochromine S5 had little
4. Discussion
Activated T cell is the potential target for treatment of
autoimmune diseases and we have focused our researches on
finding compounds with immunosuppressive effect selectively on
activated T cells [12–14,19,22–24]. In this study, we chose
effect on non-activated T cells at the work concentrations
mentioned above (Fig. 1D). In comparison, the chromone
compound quercetin also inhibited the proliferation of activated
T cells and caused apoptosis of both activated and non-activated

366
Z. Gao et al. / Biochemical Pharmacology 92 (2014) 358–368
Fig. 6. Effect of neochromine S5 on PCl-induced contact hypersensitivity in mice. Mice were sensitized by PCl on the abdomen and drugs were given orally at different dosages
per day after the first sensitization. After 5 days treatment, mice were challenged with PCl on the right ear. 24 h later, the left and right ears thickness were measured with an
engineer’s micrometer and tissues were harvested. (A) Ear swelling. (B) Body weight, thymus index, lymph node index and spleen index. (C) Representative photographs of
HE-stained ear sections and histological score. (D) Immunofluorescence of CD4+ T cells in ear sections labeled with mouse anti-CD4-FITC and DAPI. Cell number was counted
using image J software and showed in the right. (E) T lymphocytes were isolated from peripheral lymph nodes at the end of the experiments, and stained with Annexin V/PI for
flow cytometry assay. (F) T lymphocytes were isolated from peripheral lymph nodes at the end of the experiments, and stained with anti-CD44/anti-CD62L for flow cytometry
assay. The column charts about percentage of apoptosis T cells, naı¨ve T cells, and central memory T cells were shown in the right. Values are means ꢁ SEM of eight animals per
group. *p < 0.05, **p < 0.01, ***p < 0.001 vs controls.
T cells (Fig. 1). These findings suggest that neochromine S5 may
have a unique mechanism underlying its selective effect on
activated T cells.
These results indicated neither Fas-dependent pathway nor ER
stress-mediated pathway was involved in neochromine S5 induced
apoptosis. Therefore, the activation of intrinsic mitochondrial
pathway is predominantly involved in the effect of neochromine S5
against activated T cells.
Additionally, CD25, CD69 and inflammatory cytokines are
closely correlated with development of autoimmune diseases [8–
11]. Besides of the inducing apoptosis in activated T cells,
neochromine S5 also showed inhibition on cell surface markers
and inflammatory cytokines production (Figs. 4 and 5).
Contact hypersensitivity, an animal model of allergic contact
dermatitis, is recognized as a classical example of T cell-mediated
delayed type immune response to cutaneous sensitization and
subsequent challenge with haptens [26–29]. The pathogenesis of
contact hypersensitivity can be characterized as delayed-type
hypersensitivity (DTH) which is typically used for evaluation of in
vivo immunocompetency since it entirely depends on effects of T
cells. In the model, naı¨ve T cells were primed and differentiate into
central memory T cells and effector T cells when the antigen-
presenting cells present antigenic peptides to them [30]. Specific
for, T cells in inflammatory ears were TE, and regional lymph nodes
To understand the effect of neochromine S5 on apoptotic
processes of activated T cells, we further found the collapsing of
DCm (Fig. 2A), increases in PARP cleavage, Bad expression, caspase
3 and caspase 9 activation and reduction in Bcl-2 expression in the
neochromine S5-treated activated T cells (Fig. 2B and C). In
addition, a significantly increased release of cytochrome c from
mitochondria to cytosol was also observed dose-dependently
(Fig. 2D and E). These results indicate that neochromine S5 induced
apoptosis of activated T cells through a mitochondrial pathway.
Intrinsic mitochondria-dependent pathway, extrinsic death
receptor-dependent pathway and the intrinsic ER stress-mediated
pathway work together to regulate the function of T lymphocytes
[7]. Although Fas ligand (FasL), and Fas-mediated signaling play a
role in the induction of lymphocyte apoptosis [25], neochromine
S5 was still capable of inducing apoptosis in activated FADDꢀ/ꢀ
Jurkat cells which had deficiency in the Fas pathway. Besides
neochromine S5 failed to induce the expression of ER stress-related
proteins PERK, XBP-1 and GADD153 in activated T cells (Fig. 3).

Z. Gao et al. / Biochemical Pharmacology 92 (2014) 358–368
367
Fig. 7. Effects of neochromine S5 on activation and proliferation of hapten-specifically activated T cells ex vivo. T cells isolated from mice after 5-day sensitization were
triggered with TNBS (1.0 mM) in the presence of neochromine S5. (A) After incubation for 12 h, CD69 expression was determined with flow cytometry. Data shown here are
one of three independent experiments. (B) T cells were harvested for mRNA detection with real-time PCR at 6 h after incubation. (C) Splenocytes isolated from PCl-sensitized
mice after removing the adherent cells were co-cultured with trinitrophenylated splenocytes in the presence of neochromine S5 for 72 h at 37 8C. The cell proliferation was
assessed by MTT. For other details, see the Section 2. Data are shown as means ꢁ SEM of three independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001 vs controls.
were na¨ıve T cells and central memory T cells [31]. In our
experiments, oral administration of neochromine S5 significantly
inhibited the ear swelling in response to PCl, prevented infiltration
of CD4+ T cells (effector T cells) in the edematous sections, induced
T lymphocytes apoptosis, decreased the percentage of central
memory T cells in draining lymph nodes, and showed no effect in
na¨ıve T cells (Fig. 6). Neochromine S5 also greatly blocked the
proliferation of hapten-specifically activated T cells (Fig. 7), which
were usually seen in the skin challenged by the relevant haptens
[32–34]. However, neochromine S5 had no influence on the
migration of T cells (data was not shown here). Thus, neochromine
S5 maybe induced apoptosis of central memory T cells and effector
T cells to suppressed contact hypersensitivity in mice.
Inflammatory factors released from macrophages also contrib-
ute to the response in contact hypersensitivity, so we examined
effect of neochromine S5 in macrophages. And results showed
neochromine S5 had low inhibition on IL-1b and IL-6 levels in LPS-
primed bone marrow–derived macrophage (BMDM) (data was not
shown).
It was noteworthy that neochromine S5 did not induce body
weight loss and immune organ atrophy, perhaps due to
neochromine S5 showing no effects on na¨ıve T lymphocytes.
However, DEX-treated mice were greatly sacrificed with these side
effects in contact hypersensitivity. These results revealed that
neochromine S5 had potential for the treatment of T cell-mediated
disorders because of its high selectivity and low toxicity.
In conclusion, neochromine S5 inhibited proliferation and
increased apoptosis of activated T cells, and it was efficacious in T
cell-mediated DTH. Unlike the classic immunosuppressants, CsA
and DEX, as well as a flavone compound quercetin, neochromine S5
showed low toxicity owing to its selectivity on activated T cells, not
na¨ıve T cells. Therefore, this compound might provide a lead
compound from new chromone derivatives for developing novel
immunosuppressants distinct from the present approaches.
Conflict of interest
Q. Xu and X. Wu are currently exploring the commercial
implications of these findings and there is no conflict of interest.
Acknowledgements
This work was supported by National Natural Science
Foundation of China (nos. 81273569, 81273528, 91229109,
91313303 and 31370900), Natural Science Foundation of Jiangsu
Province, China (grant nos. BK2012726 and BK20131282), and
Scientific Research Foundation of Graduate School of Nanjing
University (no. 2012CL07). The FADDꢀ/ꢀ Jurkat cell was a gift from
professor Zichun Hua (School of Life Sciences, Nanjing University).
(1) Study conception and design: Q. Xu, X. Wu; (2) acquisition,
analysis and/or interpretation of data: Z. Gao, Y. Ma, H. Zhou,
D. Zhao, X. Zhang, H. Liu.; (3) drafting/revision of the work for
intellectual content and context: Y. Shen, X. Wu, Y. Sun and J. Li;
(4) final approval and overall responsibility for the published
work: Q. Xu, X. Wu.
Appendix A. Supplementary data
Supplementary data associated with this article can be found, in
the online version, at http://dx.doi.org/10.1016/j.bcp.2014.08.032.
References
[1] Strasser A, Pellegrini M. T-lymphocyte death during shutdown of an immune
response. Trends Immunol 2004;25:610–5.
[2] Panneerselvam P, Singh LP, Selvarajan V, Chng WJ, Ng SB, Tan NS, et al. T-cell
death following immune activation is mediated by mitochondria-localized
SARM. Cell Death Differ 2013;20:478–89.
[3] Vergani D, Choudhuri K, Bogdanos DP, Mieli-Vergani G. Pathogenesis of
autoimmune hepatitis. Clin Liver Dis 2002;6:727–37.

368
Z. Gao et al. / Biochemical Pharmacology 92 (2014) 358–368
[19] Fei M, Wu X, Xu Q. Astilbin inhibits contact hypersensitivity through negative
[4] Granado-Serrano AB, Martin MA, Bravo L, Goya L, Ramos S. Quercetin induces
apoptosis via caspase activation, regulation of Bcl-2, and inhibition of PI-3-
kinase/Akt and ERK pathways in a human hepatoma cell line (HepG2). J Nutr
2006;136:2715–21.
cytokine regulation distinct from cyclosporin A.
2005;116:1350–6.
[20] Morris JC, Waldmann TA. Advances in interleukin 2 receptor targeted treat-
ment. Ann Rheum Dis 2000;59(Suppl. 1):i109–14.
[21] Zhou J, Stanners J, Kabouridis P, Han H, Tsoukas CD. Inhibition of TCR/CD3-
mediated signaling by a mutant of the hematopoietically expressed G16 GTP-
binding protein. Eur J Immunol 1998;28:1645–55.
[22] Wu XF, Xu R, Ouyang ZJ, Qian C, Shen Y, Wu XD, et al. Beauvericin ameliorates
experimental colitis by inhibiting activated T cells via downregulation of the
PI3K/Akt signaling pathway. PLoS ONE 2013;8:e83013.
J Allergy Clin Immunol
[5] Lewis-Wambi JS, Jordan VC. Estrogen regulation of apoptosis: how can one
hormone stimulate and inhibit? Breast Cancer Res 2009;11:206.
[6] Song RX, Mor G, Naftolin F, McPherson RA, Song J, Zhang Z, et al. Effect of long-
term estrogen deprivation on apoptotic responses of breast cancer cells to
17beta-estradiol. J Natl Cancer Inst 2001;93:1714–23.
[7] Opferman JT, Korsmeyer SJ. Apoptosis in the development and maintenance of
the immune system. Nat Immunol 2003;4:410–5.
[8] Marzio R, Mauel J, Betz-Corradin S. CD69 and regulation of the immune
function. Immunopharmacol Immunotoxicol 1999;21:565–82.
[9] Gleisner MA, Reyes P, Alfaro J, Solanes P, Simon V, Crisostomo N, et al. Dendritic
and stromal cells from the spleen of lupic mice present phenotypic and
functional abnormalities. Mol Immunol 2013;54:423–34.
[10] Streitz M, Fuhrmann S, Thomas D, Cheek E, Nomura L, Maecker H, et al. The
phenotypic distribution and functional profile of tuberculin-specific CD4 T-
cells characterizes different stages of TB infection. Cytometry B: Clin Cytom
2012;82:360–8.
[23] Wu X, Fan J, Ouyang Z, Ning R, Guo W, Shen Y, et al. Tupistra chinensis extract
attenuates murine fulminant hepatitis with multiple targets against activated
T lymphocytes. J Pharm Pharmacol 2014;66:453–65.
[24] Guo W, Liu W, Hong S, Liu H, Qian C, Shen Y, et al. Mitochondria-dependent
apoptosis of con A-activated T lymphocytes induced by asiatic acid for pre-
venting murine fulminant hepatitis. PLoS ONE 2012;7:e46018.
[25] Watanabe-Fukunaga R, Brannan CI, Copeland NG, Jenkins NA, Nagata S.
Lymphoproliferation disorder in mice explained by defects in Fas antigen
that mediates apoptosis. Nature 1992;356:314–7.
[11] Barnaba V, Benvenuto R, Buttinelli C, Salvetti M, Toma L, Fiori P. Phenotypic
and functional characterization of cloned T-lymphocytes from cerebrospinal
fluid of patients with multiple sclerosis. Riv Neurol 1990;60:183–5.
[12] Shen Y, Luo Q, Xu H, Gong F, Zhou X, Sun Y, et al. Mitochondria-dependent
apoptosis of activated T lymphocytes induced by astin C, a plant cyclopeptide,
for preventing murine experimental colitis. Biochem Pharmacol 2011;82:
260–8.
[26] Eisen HN, Orris L, Belman S. Elicitation of delayed allergic skin reactions with
haptens; the dependence of elicitation on hapten combination with protein. J
Exp Med 1952;95:473–87.
[27] Flax MH, Caulfield JB. Cellular and vascular components of allergic contact
dermatitis. Am J Pathol 1963;43:1031–53.
[28] Kaplan DH, Igyarto BZ, Gaspari AA. Early immune events in the induction of
allergic contact dermatitis. Nat Rev Immunol 2012;12:114–24.
[13] Sun Y, Qin Y, Gong FY, Wu XF, Hua ZC, Chen T, et al. Selective triggering of
apoptosis of concanavalin A-activated T cells by fraxinellone for the treatment
of T-cell-dependent hepatitis in mice. Biochem Pharmacol 2009;77:1717–24.
[14] Feng LL, Wu XF, Liu HL, Guo WJ, Luo Q, Tao FF, et al. Vaticaffinol, a resveratrol
tetramer, exerts more preferable immunosuppressive activity than its pre-
cursor in vitro and in vivo through multiple aspects against activated T
lymphocytes. Toxicol Appl Pharmacol 2013;267:167–73.
[15] Hackstein H, Thomson AW. Dendritic cells: emerging pharmacological targets
of immunosuppressive drugs. Nat Rev Immunol 2004;4:24–34.
[16] Halloran PF. Immunosuppressive drugs for kidney transplantation. N Engl J
Med 2004;351:2715–29.
[17] Kahan BD. Individuality: the barrier to optimal immunosuppression. Nat Rev
Immunol 2003;3:831–8.
[18] Wang L, Shen Y, Song R, Sun Y, Xu J, Xu Q. An anticancer effect of curcumin
mediated by down-regulating phosphatase of regenerating liver-3 expression
on highly metastatic melanoma cells. Mol Pharmacol 2009;76:1238–45.
[29] Kimber I, Maxwell G, Gilmour N, Dearman RJ, Friedmann PS, Martin SF. Allergic
contact dermatitis: a commentary on the relationship between T lymphocytes
and skin sensitising potency. Toxicology 2012;291:18–24.
[30] Riemann H, Schwarz T, Grabbe S. Pathomechanisms of the elicitation phase of
allergic contact dermatitis. J Dtsch Dermatol Ges 2003;1:613–9.
[31] Ueyama A, Imura K, Kasai-Yamamoto E, Tai N, Nagira M, Shichijo M, et al. Kv1.3
blockers ameliorate allergic contact dermatitis by preferentially suppressing
effector memory T cells in a rat model. Clin Exp Dermatol 2013;38:897–903.
[32] Yamamoto H, Nonaka M, Katz DH. Suppression of hapten-specific delayed-
type hypersensitivity responses in mice by idiotype-specific suppressor T cells
after administration of anti-idiotypic antibodies. J Exp Med 1979;150:818–29.
[33] Cavani A, Albanesi C, Traidl C, Sebastiani S, Girolomoni G. Effector and
regulatory T cells in allergic contact dermatitis. Trends Immunol 2001;22:
118–20.
[34] Grabbe S, Schwarz T. Immunoregulatory mechanisms involved in elicitation of
allergic contact hypersensitivity. Immunol Today 1998;19:37–44.