Isoliquiritigenin Derivatives Inhibit RANKL-Induced Osteoclastogenesis by Regulating p38 and NF-κB Activation in RAW 264.7 Cells

Article abstract of DOI:10.3390/molecules25173908

Bone diseases may not be imminently life-threatening or a leading cause of death such as heart diseases or cancers. However, as aging population grows in almost every part of the world, they surely impose significant socioeconomic burden on the society, not to mention the patients and their families. Osteoporosis is the most common type of bone disease, which frequently develops in seniors, especially in postmenopausal women. Although currently several anti-osteoclastic drugs designed to suppress excessive osteoclast activation, a major cause of osteoporosis, are commercially available, accompanying adverse effects ranging from mild to severe have been reported as well. Natural products have become increasingly popular because of their effectiveness with fewer side effects. Isoliquiritigenin (ILG), a natural flavonoid from licorice, has been reported to suppress osteoclast differentiation and activation. In the present study, newly synthesized ILG derivatives were screened for their anti-osteoporotic activity as more potent substitute candidates to ILG. Out of the 12 ILG derivatives tested, two compounds demonstrated significantly improved bone loss in vitro by inhibiting both osteoclastogenesis and osteoclast activity. The results of the present study indicate that these compounds may serve as a potential drug for osteoporosis and warrant further studies to evaluate their in vivo efficacy.

Full text of DOI:10.3390/molecules25173908

molecules
Article
Isoliquiritigenin Derivatives Inhibit RANKL-Induced
Osteoclastogenesis by Regulating p38 and NF-κB
Activation in RAW 264.7 Cells
Seongtae Jeong 1,†, Seahyoung Lee 1,†, Kundo Kim 2, Yunmi Lee 2, Jiyun Lee 1, Sena Oh 1,
Jung-Won Choi 1, Sang Woo Kim 1 , Ki-Chul Hwang 1,* and Soyeon Lim 1,
*
1
Institute for Bio-Medical Convergence, College of Medicine, Catholic Kwandong University, Gangneung-si,
Gangwon-do 210-701, Korea; 91seongtae@gmail.com (S.J.); sam1017@ish.ac.kr (S.L.);
jylee12334@gmail.com (J.L.); bole1305@naver.com (S.O.); jungwonjian@gmail.com (J.-W.C.);
doctor7408@gmail.com (S.W.K.)
Department of Chemistry, Kwangwoon University, Seoul 01897, Korea; vmczl_@naver.com (K.K.);
ymlee@kw.ac.kr (Y.L.)
2
*
Correspondence: kchwang@cku.ac.kr (K.-C.H.); slim724@cku.ac.kr (S.L.);
Tel.: +82-32-290-2774 (K-C.H.); +82-32-290-2777 (S.L.)
†
Seongtae Jeong and Seahyoung Lee contributed equally to the work.
ꢀꢁꢂꢀꢃꢄꢅꢆꢇ
ꢀꢁꢂꢃꢄꢅꢆ
Received: 20 July 2020; Accepted: 25 August 2020; Published: 27 August 2020
Abstract: Bone diseases may not be imminently life-threatening or a leading cause of death such as
heart diseases or cancers. However, as aging population grows in almost every part of the world,
they surely impose significant socioeconomic burden on the society, not to mention the patients and
their families. Osteoporosis is the most common type of bone disease, which frequently develops in
seniors, especially in postmenopausal women. Although currently several anti-osteoclastic drugs
designed to suppress excessive osteoclast activation, a major cause of osteoporosis, are commercially
available, accompanying adverse effects ranging from mild to severe have been reported as well.
Natural products have become increasingly popular because of their effectiveness with fewer side
effects. Isoliquiritigenin (ILG), a natural flavonoid from licorice, has been reported to suppress
osteoclast differentiation and activation. In the present study, newly synthesized ILG derivatives
were screened for their anti-osteoporotic activity as more potent substitute candidates to ILG. Out
of the 12 ILG derivatives tested, two compounds demonstrated significantly improved bone loss
in vitro by inhibiting both osteoclastogenesis and osteoclast activity. The results of the present study
indicate that these compounds may serve as a potential drug for osteoporosis and warrant further
studies to evaluate their in vivo efficacy.
Keywords: isoliquiritigenin derivatives; robtein; RANKL; osteoclastogenesis
1. Introduction
The osteoclast derived from hematopoietic stem cells, a specialized multinucleated cell to resorb
bone, and the osteoblast derived from mesenchymal stem cells, a single nucleus cell to synthesize bone,
are the major cell types consisting in bones. Within the skeleton, these cells maintain the architecture
of bones and facilitate remodeling by secreting various signaling molecules, such as cytokines and
chemokines [1]. Therefore, an imbalance between osteoclast and osteoblast activity contributes to the
development of several bone diseases. For example, excessive osteoclast activation has been implicated
in the occurrence of osteoporosis, periprosthetic osteolysis, rheumatoid arthritis, and subchondral bone
destruction [
2]. In particular, osteoporosis is the most common type of bone disease due to osteoclast
activation worldwide, and it frequently develops in seniors, especially in postmenopausal women.
Molecules 2020, 25, 3908; doi:10.3390/molecules25173908
www.mdpi.com/journal/molecules

Molecules 2020, 25, 3908
2 of 15
Excessive amounts of reactive oxygen species or inflammatory cytokines are regarded as the main cause
of hyperactive osteoclast formation, and monocyte/macrophage colony-stimulating factor (M-CSF) and
receptor activator of nuclear factor kappa-B (NF-κB) ligand (RANKL) are known as the two essential
factors for the hyperactive osteoclast formation since 1990s [3,4]. M-CSF plays roles in proliferation and
survival of osteoclast precursors and RANKL functions in the differentiation of osteoclast precursors
into mature osteoclasts. RANKL, mainly expressed on osteoblasts, stromal cells, and T cells, is secreted
into the extracellular environment and directly binds to RANK expressed on osteoclast precursors
and mature osteoclasts [
signaling mediators, namely mitogen-activated protein kinases (MAPKs), nuclear factor-
and activator protein-1 (AP-1), by recruiting adaptor molecules such as TNFR-associated factors
(TRAFs) [ ]. AP-1 and NF- B then induce nuclear factor of activated T-cells cytoplasmic 1 (NFATc1)
transcription [ ]. In addition to RANK-mediated activation, it is known that immunoglobulin-like
receptors such as triggering receptor expressed in myeloid cells-2 (TREM-2) and osteoclast-associated
receptor (OSCAR) cooperate with RANK-mediated signaling to activate NFATc1 [ ]. Activated NFATc1
5,
6]. RANKL binding to RANK leads to the activation of downstream
κ
B (NF- B),
κ
7
κ
8
9
can increase the expression of osteoclast-specific genes such as tartrate-resistant acid phosphatase
(TRAP), β3-integrin, dendritic cell-specific transmembrane protein (DC-STAMP), cathepsin K (CTSK),
and calcitonin receptors (Calcr), that act on various stages of osteoclast development and activation [10].
Over 24 genes are known to be involved in the regulation of osteoclastogenesis and osteoclast
activation [11].
To date, various medications for osteoporosis have been developed and are available for
clinical treatment. Although agents such as estrogen, selective estrogen receptor modulator (SERM),
bisphosphates, and calcitonin, a major anti-resorptive drug, have made remarkable progress for both
prevention and treatment [12–15], severe adverse effects remain as a hurdle in clinical management of
osteoporosis. It has been reported that a long-term treatment of estrogen may increase cardiovascular
events and breast cancer risk in the Women’s Health Initiative (WHI) study [16]. A long-term use
of raloxifene, a kind of SERMs, and calcitonin was reported to increase the incidences of venous
thromboembolism and risk of cancer, respectively [17
,
18]. Furthermore, Bisphophonates, an effective
drug for osteoporosis [19
of the jaw (Figure 1).
,20], can also cause rare side-effects, such as femur fractures and osteonecrosis
Figure 1. Representative anti-osteoclastic drugs.
Although the number of new anti-resorptive drugs such as sclerostin inhibitors and cathepsin
K inhibitors is increasing, many patients are not taking them because of rare, but severe side effects.
Thus, it is necessary to develop alternatives with minimized adverse effects.
Natural products have become increasingly popular because of their effectiveness with fewer
side effects. Among them, isoliquiritigenin (ILG), a natural flavonoid from licorice, has been reported
to suppress osteoclast differentiation [21–23]. Additionally, the beneficial effects of ILG in various

Molecules 2020, 25, 3908
3 of 15
disease models such as diabetes, cancers, and obesity are due to its anti-oxidant, anti-inflammation,
or anti-proliferation/migration effect [24–26].
In the present study, 12 ILG derivatives were synthesized and screened for their activities against
osteoclast differentiation. Our in vitro data indicated that two compounds out of 12 that had been
tested showed potential therapeutic effects by in vitro experiments.
2. Results
2.1. ILG Derivatives Inhibit RANKL-Induced Osteoclast Differentiation
To investigate whether ILG derivatives can effectively inhibit osteoclast differentiation induced
by RANKL, ILG and its 12 derivatives were synthesized (Scheme 1, Table S1 and Supplementary
Materials). To induce osteoclastogenesis, RAW264.7 cells, commonly used as osteoclast precursors
derived from murine leukemia virus-induced tumor, were incubated with 40 ng/mL RANKL with or
without various concentration (0.1–10 µM) of ILG or 12 different ILG derivatives. RANKL-induced
osteoclast differentiation was evaluated by TRAP staining (Figure 2A and Figure S14), in which two
out of total 12 derivatives exhibited improved anti-osteoclastogenesis potential compared to that
of ILG (10
µ
M) (Figure 2B). Moreover, derivative three and ten significantly decreased the number
of TRAP+-osteoclast (nuclei
≥
3) compared to ILG in a dose-dependent manner (Figure 2C). For
RANKL-induced increase of TRAP mRNA expression, although all the derivatives tended to suppress
the increase of the RANKL-induced TRAP mRNA expression, it was not statistically significant,
except the derivative 10 (Figure 2D,E). The cell viability (Figure 3A) and cytotoxicity (Figure 3B) were
also investigated by cell viability assay and lactate dehydrogenase (LDH) activity assay, respectively.
Increasing concentrations (0, 1, 5, 10 µM) of the derivative 3 and 10 did not cause any significant
changes of viability or cytotoxicity. These results suggested that the derivative 3 and 10 may have a
better potential in inhibiting the RANKL-induced osteoclast differentiation than ILG.
Scheme 1. Synthesis of ILG and its 12 derivatives.

Molecules 2020, 25, 3908
4 of 15
Figure 2. Isoliquiritigenin (ILG) and ILG derivatives suppress RANKL-induced osteoclast differentiation
in RAW264.7 cells. RAW264.7 cells were treated with 40 ng/mL RANKL in the presence of ILG or ILG
derivatives for 4 days. ( ) RAW264.7 cells were treated with 1, 5, and 10 M of ILG or ILG derivatives.
The fixed cells were stained for TRAP and observed under a light microscope (40 ) to determine
TRAP positive cells. Scale bar = 400 m. ( ) Number of TRAP stained cells and ( ) TRAP-positive
multinuclear cells (3 or more nuclei) were counted as osteoclast cells. ( ) mRNA level of TRAP was
examined by RT-PCR. ( ) The RT-PCR results were normalized to GAPDH. * p < 0.05, ** p < 0.01 (n 3).
A
µ
×
µ
B
C
D
E
≥
Figure 3. ILG and ILG derivatives inhibit osteoclast differentiation without cell death. The cell viability
) and toxicity ( ) on RAW264.7 cells were assessed in presence of RANKL (40 ng/mL) with various
(
A
B
concentration (1, 5, and 10
(n ≥ 5).
µM) of ILG or ILG derivatives. Data are presented as the mean
±
SEM

Molecules 2020, 25, 3908
5 of 15
2.2. ILG Derivatives Impaired Bone Resorptive Activity of RANKL-Induced Osteoclasts
To further examine the anti-osteoclastogenic activity of ILG derivatives, expressions of
osteoclast-specific genes (Calcr, CTSK, and DC-STAMP), that are known to be predominantly expressed
in active osteoclasts, were investigated. For example, a collagenase CTSK is known to degrade bone
mineral and collagen matrices, and DC-STAMP plays a critical role for osteoclast cell fusion [10,27].
According to the data, ILG, the derivative 3, and 10, significantly suppressed the RANKL-induced
upregulation of mRNA expressions of these genes in a concentration-dependent manner (Figure 4). The
active osteoclasts show a resorption activity which can lead to pit formation characterized by clusters
of round excavation [28]. For the assessment of osteoclast functions, such as bone resorption, F-actin
ring formation and pit formation assays were performed [29]. RANKL-induced F-actin ring formation
was apparently suppressed by ILG, the derivative 3, and 10, and higher concentration (10
µM) showed
a more pronounced reduction of F-actin ring formation compared to lower concentration (5
µM) for all
three compounds (Figure 5A). Consistent with the results on F-actin ring formation, ILG, the derivative
3, and 10 also significantly suppressed the RANKL-induced osteoclast bone resorption (Figure 5B,C).
These data clearly demonstrated that ILG, as well as its derivatives 3 and 10, could significantly inhibit
the RANKL-induced bone resorbing function and osteoclast formation.
Figure 4. Inhibition effect of osteoclast specific genes by ILG and ILG derivatives. ILG and ILG
derivatives down-regulated gene expression of osteoclast specific genes such as (
A) Calcr, CTSK,
and DC-STAMP at mRNA levels of RAW264.7 cells. ( ) The RT-PCR results were normalized to
B–D
GAPDH about Calcr, CTSK, and DC-STAMP. Data are presented as the mean
determinations. * p < 0.05, ** p < 0.01, *** p < 0.001. (n ≥ 3).
±
SEM of more three

Molecules 2020, 25, 3908
6 of 15
Figure 5. ILG and ILG derivatives suppress RANKL-induced bone resorption and actin ring formation.
) Raw264.7 cells were stimulated with RANKL (40 ng/mL) in presence of ILG or ILG derivatives
(5 and 10 M) for 4 days. Cells were fixed and stained with phalloidin and DAPI to determine actin ring
formation of osteoclast. Scale bar = 100 m. ( ) RAW264.7 cells were seeded on CaP-coated plate
and stimulated with RANKL (100 ng/mL) to induce differentiation to osteoclast. The presence of ILG or
ILG derivatives (5 and 10 M) were treated in osteoclast and stimulated with RANKL (100 ng/mL)
for 6 days. ( ) Resorption pit areas were visualized by a light microscopy (100 ). Scale bar = 400 m.
(C) Resorption pit areas were measured. *** p < 0.001 (n ≥ 3).
(
A
µ
µ
B,C
µ
B
×
µ

Molecules 2020, 25, 3908
7 of 15
2.3. Combinational Treatment of ILG Derivatives Showed a Synergistic Effect on RANKL-Induced Osteoclast
Differentiation and Activation
To examine any possible synergistic effect of the derivative 3 and 10, the effect of combinational
treatment of the derivative 3 and 10 was evaluated. The results of TRAP staining assay indicated that the
combination of the derivative 3 and 10 was more effective than single individual treatment (Figure 6A,B),
without any significant cytotoxicity (Figure 6C). For the functional activity of combinational treatment,
the reduction of pit areas were similar to that of derivative 10 (5 µM) (Figure 6D).
Figure 6. The combination effect of ILG derivative 3 and 10 as osteoclast differentiation inhibitor.
RAW264.7 cells were treated with ILG, ILG, derivatives or combination of ILG derivative 3 and 10.
(
A
,
B
) RAW264.7 cells were stimulated with RANKL (40 ng/mL) and stained for TRAP. (
TRAP positive cells that stained for TRAP were counted and ( ) TRAP-positive cells (having more than
three nuclei) were counted as osteoclast. ( ) The cytotoxicity of ILG derivative 3 and 10 combination
for RAW264.7. ( ) Resorption pit areas by ILG combination compounds were measured. * p < 0.05,
A) Number of
B
C
D
** p < 0.01, *** p < 0.001. (n ≥ 3).
2.4. ILG Derivatives Suppressed RANKL-Induced Osteoclast Differentiation Signaling Pathways
To elucidate the mechanism with which ILG, the derivative 3, and the derivative 10 inhibit the
RANKL-induced osteoclast differentiation, their effects on MAPKs and NF-
well-known main signaling pathways for osteoclast differentiation and activation [30], were investigated.
According to the data, RANKL significantly induced phosphorylation of MAPKs (p38, ERK1/2, and JNK
and NF-κB. Among these signaling pathways, ILG, the derivative 3, and the derivative 10 selectively
attenuated the activation of p38 and NF- B (Figure 7). These data indicated that even a lower
κB signaling pathways,
)
κ
concentration of the derivative 3 or 10 can effectively inhibit osteoclast differentiation and activation
than ILG treatment by downregulating p38 and NF-κB pathways.

Molecules 2020, 25, 3908
8 of 15
Figure 7. The inhibition effect of phosphorylation of p38 and NF-
with ILG, ILG derivatives, or ILG combination (3 + 10) for 1 h and stimulated with RANKL (40 ng/mL
for 10 min. The levels of osteoclast specific protein such as ( ) ERK, JNK, and P38 and ( ) NF-
were detected by Western blotting and phosphorylation levels were normalized to respective total
levels in each case ( ). Results are representative of at least three more independent data. * p < 0.05,
** p < 0.01, *** p < 0.001.
κB. RAW264.7 cells were pretreated
)
A
B
κB
C–F
3. Discussion
ILG has been reported to inhibit RANKL-induced osteoclast differentiation [21]. In the present
study, we have synthesized 12 additional derivatives of ILG, which varied the number and positions
of amino, nitro, trifluoromethyl, methoxy, hydroxy and halogen substituents on the two phenyl rings,
and examined their possible effect on the RANKL-induced osteoclast differentiation. Our results
demonstrated that both ILG and its derivatives 3 and 10 showed effective inhibition against

Molecules 2020, 25, 3908
9 of 15
RANKL-induced osteoclast differentiation. These three compounds shared common regulatory
mechanism to control osteoclast differentiation (Figure 7), and they showed concentration-dependent
attenuation of the increases in the number of TRAP+-osteoclast (nuclei
≥
3), osteoclast-specific gene
expressions, and pit areas at the concentration of 10
µM. In general, a lower concentration of compound
can minimize the incidence of adverse drug effects [31]. Therefore, combinations of these compounds
with lower concentrations were tested for their effects on osteoclast differentiation to see if there
was any combination with possibly minimized adverse effect. According to the TRAP staining data
(Figure 6A), a combination of lower dose derivative 3 (1
protective effect than individual treatment with derivative 3 (5
other related data such as bone resorption, TRAP+-osteoclast (n
show a significant advantage of using combinatorial treatment. Although there still may exist an
optimized regiment for an effective combinatorial treatment, at this point, without any further evidence
to prove or disapprove such possibility, the ILG-derived derivative 10 is the most effective treatment
for preventing osteoclast differentiation and activation.
µ
M) and derivative 10 (5
M) or derivative 10 (5
3), and Western blotting failed to
µ
M) showed more
µ
µM). However,
≥
Derivative 10, known as robtein, belongs to a chalcone class previously called an anthochlor
pigment [32]. Unlike ILG, little has been known for the biological effects of robtein. However,
certain characteristics of robtein may be speculated as a chalcone family compound. Previous studies
have demonstrated that the chalcone and its derivatives possess anti-inflammatory, anti-oxidant,
and anti-cancer functions, suggesting a pharmacological potential of the chalcones [33–35]. Moreover,
another beneficial effect such as estrogenic effect of robtein as a chalcone compound can be speculated.
ILG, as a primary bioactive chalcone compound in licorice root, demonstrated estrogenic activity
both in vivo and in vitro. Maggiolini et al. showed that low levels of ILG had estrogenic and
anti-proliferative activities in breast cancer cells, and Mersereau et al. demonstrated that ILG is a
selective estrogen receptor beta agonist [36,37]. Butein, another member of chalcone family, was also
reported to modulate estrogen metabolism [38]. Therefore, although we did not experimentally cover
the subject in the present study, it is highly possible that ILG derivatives 3 and 10 also possess estrogenic
effect based on the reported characteristics of chalcones [39].
ILG itself has been continuously suggested as a dietary supplement or alternative therapeutic
agent for several cancers, and clinical studies have not reported any significant side effects to date [35].
Although ILG has been reported to have an anti-proliferative effect in cancer models at 25–50
according to our data, both the derivative 3 and 10 only caused insignificant reduction of cell viability
under 10 M (Figure 3), indicating that the lower concentration of robtein may be acceptable for
µM [35,40],
µ
biological effects without causing any significant adverse effect.
In the investigation of a compound for possible pharmacological effects, timing of treatment is
important. According to the previous study, ILG acts on the initial steps of RANKL-induced osteoclast
differentiation. To be specific, ILG showed inhibitory effect on osteoclast differentiation only when
co-treatment with RANKL, but it failed to reverse the F-actin ring formation by post-treatment [21].
Similar to such observation, ILG derivatives examined in the present study also showed a significant
inhibitory effect on the RANKL-induced osteoclast differentiation and activation when they were
applied prior to RANKL induction. Therefore, although additional study may be required to validate,
it can be speculated that ILG derivatives are useful as a preventive and/or protective therapeutic agent
rather than as a treatment option. In this sense, ILG derivatives can be a good candidate for a major
ingredient of dietary supplement or neoadjuvant agent targeting osteoporosis.
Lastly, there are some limitations of this study to be pointed out. In the present study, we performed
pit assays and analyzed cathepsin K expression to confirm the regulatory role of ILG derivatives
against osteoclast activation. However, calcium phosphate-coated plate which we used, represents
inorganic component of bones, not organic component such as collagen [41]. In addition, estimation of
expression levels of carbonic anhydrase II and V-ATPase, besides of cathepsin K would be better to
explain the regulatory role of ILG and its derivatives, because these two factors have essential roles in
bone resorption by increasing acid (H+) secretion [42,43].

Molecules 2020, 25, 3908
10 of 15
The present study is the first report to demonstrate that robtein, a derivative of ILG, has a potential
to be an effective anti-osteoclastic drug and calls for further in vitro studies to validate its therapeutic
efficacy as well as of its derivatives.
4. Materials and Methods
4.1. Synthesis
ILG and its 12 derivatives were prepared through Claisen–Schmidt condensation of acetophenones
with benzaldehydes, followed by deprotection under acidic conditions, and general methods are
described in Scheme 1.
4.2. Cell Lines
Mouse monocyte macrophage derived from Abelson murine leukemia virus-induced tumor,
Raw264.7 cell (TIB-71; ATCC, Manassas, VA, USA), was purchased from American Type Culture
Collection (ATCC). Raw264.7 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM)
(30-2002; ATCC) with 10% FBS (16000-044, Thermo Fisher Scientific, Waltham, MA, USA), 100 U/mL
penicillin (15140-122, Thermo Fisher Scientific), and 100 µg/mL streptomycin (15140-122; Thermo
Fisher Scientific). Raw264.7 cells were incubated at 37 ◦C in 5% CO2 humidified atmosphere. Raw264.7
cells were used between passage 5 and 20. For cell differentiation and drug treatment, Raw264.7 cells
were cultured in complete alpha modified minimal essential medium (
Fisher Scientific).
α-MEM) (11900-024, Thermo
4.3. Cell Viability and Toxicity
To detect cell viability and toxicity of the compounds, we conducted cell viability assay (EZ-cytox;
Dogenbio, Seoul, Korea) and lactate dehydrogenase (LDH) activity assay (LDH Cytotoxicity Detection
kit; TAKARA, Otsu, Japan) under the manufacturer’s protocols. Raw264.7 cells were seeded in 96-well
culture plate at the density of 2.5
×
103 cells per well and allowed to adhere for 24 h. Raw264.7 cells
M)
were treated with DMSO (vehicle), different concentration of ILG and ILG derivatives (1, 5, and 10
µ
in α µL
-MEM medium for 48 h at 37 ◦C in 5% CO2. At 48 h after treatment, to detect cell viability, 10
of EZ-cytox solution was added to all wells and incubated at 37 ◦C for 2 h. Absorbance of formazan
concentrations was measured at 450 nm using a microplate reader (Multiskan FC; Thermo Fisher
Scientific). To measure the cell toxicity of ILG and ILG derivatives, we collected cell supernatants after
treatment and centrifuged at 250 g for 10 min. Total of 100 µL of LDH reagent was added into 100 µL
×
of supernatants and incubated at room temperature for 30 min. The activity of LDH in the supernatant
was detected by microplate reader at a wavelength of 490 nm. The obtained absorbance values were
used to calculate percentage of vehicle.
4.4. TRAP Staining
The osteoclastogenesis was measured by quantifying a tartrate-resistant acid phosphatase (TRAP)
of osteoclast cells. We conducted TRAP staining assay by TRACP & ALP double-stain Kit (MK300;
TAKARA) following the manufacturer’s protocol. Briefly, Raw264.7 cells were seeded into 48-well
culture plate at density of 3
changed to complete differentiation alpha-MEM medium and pre-treated with different concentration
of DMSO, ILG, and ILG derivatives (1, 5, and 10 M) for 1 h. For osteoclast differentiation, we treated
×
103 cells per wells in a DMEM medium. After 24 h, DMEM medium was
µ
with 40 ng/mL of human recombinant RANKL (ALX-522-131; ENZO Life Science, Farmingdale, NY,
USA) for 4 days. The fresh medium, ILG, ILG derivatives, and RANKL were retreated every 2 days.
When an osteoclastogenesis was complete, the cell supernatants were removed, and cell were washed
with phosphate buffered saline (PBS) one time. Total of 120
cells for 5 min at room temperature. Then each well was washed three times using 2 mL of sterile
distilled water. Total of 120 L of substrate solution was added to all wells to detect TRAP and the
µL of fixation solution was used for fixing
µ

Molecules 2020, 25, 3908
11 of 15
plate was covered with parafilm to prevent the sample from drying. Next, the plate was incubated
at 37 ◦C for 45 min and then washed three times with sterile distilled water. The features of positive
TRAP cells were photographed using microscope (CKX41; Olympus, Tokyo, Japan) and digital camera
(eXcope T300; Olympus). The number of the positive TRAP cells that have three more nucleus was
measured by NIH ImageJ 1.52a software.
4.5. Reverse Transcription PCR
Raw264.7 cells were seeded in 6-well culture plate at density of 3
DMEM medium. After cells were attached, ILG and ILG derivatives were treated to cells for 1 h
before adding 40 ng/mL RANKL with -MEM medium. Cell was incubated for 4 days and ILG,
ILG derivatives, and RANKL were treated every 2 days. After 4 days of treatment, total RNAs
were isolated from Raw264.7 cells using 500 L of the TRIzol reagent (15596018; Thermo Fisher
Scientific) according to general protocol. The total RNA was measured by nanodrop MD2000
spectrophotometer (Biofuture, Britain, UK). Total of 1 g total RNA was synthesized by cDNA using
×
104 cells per wells in a
α
µ
µ
the Maxime RT PreMix Kit (25081; iNtRON Biotechnology, Korea) under the manufacturer’s protocol.
To compare the RNA expression, the cDNA was analyzed by reverse transcription (RT)-PCR using
EmeraldAmp® GT PCR Master Mix (RP310A; TAKARA. The RT-PCR was performed by PCR machine
(C1000 touch Therm◦al cycler; Bio-Rad, Hercules, Cal◦ifornia, USA) and under the following conditions:
◦
denaturation at 95 C for 20 sec, an◦nealing at 56 C for 30 s, and extension at 72 C for 30 s for
35 cycles and, final extension at 72 C for 5 min. All primer pairs were synthesized by Bioneer
(Daejeon, Korea). The specific primers used by RT-PCR reactions were designed as follows: TRAP
(forward: 50- CTCCTGCCTGTTCTCTTCCCA-30; reverse: 50- AAGAGAGAAAGTCAAGGGAGT
GGC-30), Calcitonin receptor (forward: 50- AGCTTGTTGGCACCTTTGTAT-30; reverse: 50-TTGC
CTATGCCAGGACCAAT-30), Cathepsin K (forward: 50-GCAGATGTTTGTGTTGGTCTCT-30;
reverse: 50-TGGTGGAAAGGTGTGACAGG0), DC-STAMP (forward: 50-TTGAACCGAGCTGCATT
CCT-30; reverse: 50-GCACTACCTTGGCCTTACCT-30), GAPDH (forward: 50-CAAGGTCATCCATG
GACAACTTTG-30; reverse: 50-GTCCACCACCCTGTTGCTGTAG-30). The GAPDH was used as the
internal control for normalization.
4.6. Bone Resorption Assay
The bone resorbing activity of the osteoclast cells was measured by Bone resorption assay kit
(CSR-BRA-48KIT; COSMOBIO, Tokyo, Japan). Raw264.7 cells were seeded onto calcium phosphate
(CaP)-coated 48-well culture plate at density of 5
37 ◦C and 5% CO2 in DMEM containing 10% FBS. Subsequently, DMSO, ILG, and ILG derivatives
(5 and 10 M/mL) were added into each well for 1 h before RANKL (100 ng/mL) treatment as an inducer
of osteoclast differentiation in phenol red-free -MEM containing 10% FBS. All reagents were retreated
×
103 cells per wells. Raw264.7 cells were cultured at
µ
α
every 2 days for 6 days. On day 6, the conditioned medium was discarded and 5% sodium hypochlorite
was treated into each well for 5 min to remove the cells. After the plate was washed with D.W. and
dried. The pit area, resorbed area by osteoclast cell, was captured using a digital camera (Olympus)
attached to microscope (Olympus). The pit areas were measured by NIH ImageJ 1.52a software.
4.7. Western Blot Analysis
Western blotting was used to analyze activations of extracellular signal-regulated kinase (ERK), p38
mitogen-activated protein kinase (MAPK), c-Jun N-terminal kinase (JNK), and nuclear factor-kappaB
(NF-
κ
B) using a phospho-specific antibody. The Raw264.7 cells were seeded (5 × 103 cells/well) into
6-well culture plate. After pre-treatment of ILG and ILG derivatives for 1 h, RANKL (40 ng/mL)
was added into the cells for 10 min. Subsequently, the cells were washed with cold PBS for
two times and harvested by RIPA lysis buffer (25 mM Tris pH 7.6, 150 mM NaCl, 1% NP-40,
1% sodium deoxycholate, 0.1% SDS) with protease inhibitor (sc-11697498001; Santa Cruz) and
phosphatase inhibitors (4906845001; Thermo Fisher Scientific). The lysate samples containing

Molecules 2020, 25, 3908
12 of 15
20 µg of protein were separated on a 12% sodium dodecyl sulfate (SDS)-polyacrylamide gel and
then transferred to immobilon-P PVDF membranes (IPVH00010; Merk Millipore, Burlington, MA,
USA). Membranes were blocked with 5% skim milk in Tris-buffered saline (TBS) containing 0.1%
Tween-20 (TBST) at room temperature for 1 h and incubated with primary antibodies against
phospho-ERK (7383; Cell Signaling), total ERK (9102; Cell Signaling, Danvers, MA, USA), phospho-p38
(9211; Cell Signaling), total p38 (9212; Cell Signaling), phospho-JNK (9251; Cell Signaling), total
JNK (9252; Cell Signaling), phospho-NF-kB (6956; Cell Signaling), total NF-kB (3039; Cell Signaling),
and anti-
BSA except anti-
β
-actin (sc-47778; Santa Cruz, Paso Robles, CA, USA). All antibodies were diluted 1:1000 in
β
-actin (dilution ratio = 1:5000) in BSA for overnight at 4 ◦C. Secondary antibodies
were anti-mouse (ADI-SAB-100J; ENZO) or anti-rabbit (ADI-SAB-300-J; ENZO), and used at 1:2000
dilution in 5% skim milk in TBST for 1 h at room temperature. The protein bands were visualized
with an enhanced chemiluminescence method (AbClon, Seoul, Korea) and quantified by ImageJ 1.52a
software. The expression levels of proteins were analyzed as the ratio of the densitometric measurement
of indicated proteins in cell lysate to the corresponding internal standard (β-actin).
4.8. Actin Ring Formation Assay
RAW264.7 cells were seeded at a density of 1
(SPL, Korea) and stimulated with RANKL (40 ng/mL) in the presence of various concentrations (5 and
10 M) of ILG and ILG derivatives. After 4 days of incubation, the medium was gently discarded,
×
104 cells/well onto 4-well cell culture slide
µ
and the cells were fixed using 4% paraformaldehyde for 10 min. The cells were washed with PBS for
two times. To permeabilize the cells, PBS containing 0.1% Triton X-100 was treated into the cells for
20 min. After washing with PBS three times, cells were blocked with 1% BSA in PBS for 30 min at
room temperature. The Cells were exposed to phalloidin (T7471, Invitrogen, Carlsbad, CA, USA) for
20 min at room temperature in the dark place and washed in PBS for three times. The nuclei of cells
were stained with diamidino-2-phenylindole (DAPI) (D21490; Thermo Fisher Scientific) in the dark
place for 3 min, and then washed tree times with PBS for 5 min. The images of F-actin ring formation
were taken using a LSM 700 laser scanning confocal microscope (Carl zeiss, Overkochen, Germany).
4.9. Statistical Analysis
The experiments were performed at least three times. The data obtained are expressed as the mean
±
standard error of the mean (SEM). Statistical analysis was performed by GraphPad Prism version 7.0
software (San Diego, CA, USA). One-way analysis of variance (ANOVA) was used to compare three
or more groups followed by a Bonferroni post hoc test and Student’s t test was used to compare two
groups. p-values of p < 0.05 were considered statistically significant.
5. Conclusions
In the present study, we investigated the effects of ILG and its derivatives on osteoclast
differentiation and activation. Our data indicated that derivative 10, robtein, is a potent inhibitor
of osteoclast differentiation and activation. This is the first report to demonstrate the anti-osteoclast
differentiation effect of robtein.
Supplementary Materials: The following are available online at http://www.mdpi.com/1420-3049/25/17/3908/s1.
Figure S1a: 1H NMR spectrum of the isoliquiritigenin (1), Figure S1b: 13C NMR spectrum of the isoliquiritigenin
(1), Figure S2a: 1H NMR spectrum of the compound 2, Figure S2b: 13C NMR spectrum of the compound 2,
Figure S8b: 13C NMR spectrum of the compound 8, Figure S9a: 1H NMR spectrum of the compound 9, Figure S9b:
1
13C NMR spectrum of the compound 9, Figure S10a: H NMR spectrum of the compound 10, Figure S10b: 13C
NMR spectrum of the compound 10, Figure S11a: 1H NMR spectrum of the compound 11, Figure S11b: 13C
NMR spectrum of the compound 11, Figure S12a: 1H NMR spectrum of the compound 12, Figure S12b: 13C
NMR spectrum of the compound 12, Figure S13a: 1H NMR spectrum of the compound 13, Figure S13b: 13C
NMR spectrum of the compound 13, Figure S14: ILG and ILG derivatives suppress RANKL-induced osteoclast
differentiation in RAW264.7 cells, Table S1: Isoliquiritigenin and 12 derivatives.

Molecules 2020, 25, 3908
13 of 15
Author Contributions: Conceptualization, S.L. (Soyeon Lim) and S.L. (Seahyoung Lee); methodology, Y.L. and
S.J.; software, S.J. and S.O.; validation, S.L. (Seahyoung Lee), S.O., J.-W.C., and S.W.K.; formal analysis, S.L.
(Soyeon Lim) and S.J.; investigation, S.J., K.K., and J.L.; resources, Y.L., S.L. (Soyeon Lim), and K.-C.H.; data
curation, S.L. (Soyeon Lim); writing—original draft preparation, S.J., Y.L., and S.L. (Soyeon Lim); writing—review
and editing, S.L. (Soyeon Lim) and S.L. (Seahyoung Lee); visualization, S.L. (Soyeon Lim); supervision, S.L.
(Soyeon Lim) and K.-C.H.; project administration, S.L. (Soyeon Lim); funding acquisition, S.L. (Soyeon Lim) and
K.-C.H. All authors have read and agreed to the published version of the manuscript.
Funding: This research was funded by the Ministry of Health & Welfare, Republic of Korea, grant number
HI18C0661 and Basic Science Research Program through the National Research Foundation of Korea (NRF), grant
number 2018R1A1A1A05078230.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
2.
3.
4.
5.
Han, Y.; You, X.; Xing, W.; Zhang, Z.; Zou, W. Paracrine and endocrine actions of bone-the functions of
secretory proteins from osteoblasts, osteocytes, and osteoclasts. Bone Res. 2018, 6, 16. [CrossRef]
Bi, H.; Chen, X.; Gao, S.; Yu, X.; Xiao, J.; Zhang, B.; Liu, X.; Dai, M. Key triggers of osteoclast-related diseases
and available strategies for targeted therapies: A review. Front. Med. 2017, 4, 234. [CrossRef]
Lee, N.K.; Choi, Y.G.; Baik, J.Y.; Han, S.Y.; Jeong, D.W.; Bae, Y.S.; Kim, N.; Lee, S.Y. A crucial role for reactive
oxygen species in RANKL-induced osteoclast differentiation. Blood 2005, 106, 852–859. [CrossRef]
Amarasekara, D.S.; Yun, H.; Kim, S.; Lee, N.; Kim, H.; Rho, J. Regulation of osteoclast differentiation by
cytokine networks. Immune Netw. 2018, 18, e8. [CrossRef]
Tanaka, S.; Takahashi, N.; Udagawa, N.; Tamura, T.; Akatsu, T.; Stanley, E.R.; Kurokawa, T.; Suda, T.
Macrophage colony-stimulating factor is indispensable for both proliferation and differentiation of osteoclast
progenitors. J. Clin. Investig. 1993, 91, 257–263. [CrossRef]
6.
7.
Lacey, D.L.; Timms, E.; Tan, H.L.; Kelley, M.J.; Dunstan, C.R.; Burgess, T.; Elliott, R.; Colombero, A.; Elliott, G.;
Scully, S.; et al. Osteoprotegerin ligand is a cytokine that regulates osteoclast differentiation and activation.
Cell 1998, 93, 165–176. [CrossRef]
Kobayashi, N.; Kadono, Y.; Naito, A.; Matsumoto, K.; Yamamoto, T.; Tanaka, S.; Inoue, J. Segregation of
TRAF6-mediated signaling pathways clarifies its role in osteoclastogenesis. EMBO J. 2001, 20, 1271–1280.
[CrossRef]
8.
9.
Abu-Amer, Y. NF-kappaB signaling and bone resorption. Osteoporos. Int. 2013, 24, 2377–2386. [CrossRef]
Cella, M.; Buonsanti, C.; Strader, C.; Kondo, T.; Salmaggi, A.; Colonna, M. Impaired differentiation of
osteoclasts in TREM-2-deficient individuals. J. Exp. Med. 2003, 198, 645–651. [CrossRef]
10. Boyle, W.J.; Simonet, W.S.; Lacey, D.L. Osteoclast differentiation and activation. Nature 2003, 423, 337–342.
[CrossRef]
11. McLean, W.; Olsen, B.R. Mouse models of abnormal skeletal development and homeostasis. Trends. Genet.
2001, 17, S38–S43. [CrossRef]
12. Stefanick, M.L. Estrogens and progestins: Background and history, trends in use, and guidelines and
regimens approved by the US Food and Drug Administration. Am. J. Med. 2005, 118, 64–73. [CrossRef]
13. Oseni, T.; Patel, R.; Pyle, J.; Jordan, V.C. Selective estrogen receptor modulators and phytoestrogens.
Planta Med. 2008, 74, 1656–1665. [CrossRef]
14. Miller, P.D. Non-vertebral fracture risk reduction with oral bisphosphonates: Challenges with interpreting
clinical trial data. Curr. Med. Res. Opin. 2008, 24, 107–119. [CrossRef]
15. Gruber, H.E.; Ivey, J.L.; Baylink, D.J.; Matthews, M.; Nelp, W.B.; Sisom, K.; Chesnut, C.H., III. Long-term
calcitonin therapy in postmenopausal osteoporosis. Metabolism 1984, 33, 295–303. [CrossRef]
16. Rossouw, J.E.; Anderson, G.L.; Prentice, R.L.; LaCroix, A.Z.; Kooperberg, C.; Stefanick, M.L.; Jackson, R.D.;
Beresford, S.A.; Howard, B.V.; Johnson, K.C.; et al. Risks and benefits of estrogen plus progestin in healthy
postmenopausal women: Principal results From the Women’s Health Initiative randomized controlled trial.
JAMA 2002, 288, 321–333. [CrossRef]
17. Ettinger, B.; Black, D.M.; Mitlak, B.H.; Knickerbocker, R.K.; Nickelsen, T.; Genant, H.K.; Christiansen, C.;
Delmas, P.D.; Zanchetta, J.R.; Stakkestad, J.; et al. Reduction of vertebral fracture risk in postmenopausal
women with osteoporosis treated with raloxifene: Results from a 3-year randomized clinical trial. Multiple
Outcomes of Raloxifene Evaluation (MORE) Investigators. JAMA 1999, 282, 637–645. [CrossRef]

Molecules 2020, 25, 3908
14 of 15
18. Chesnut, C.H., III; Silverman, S.; Andriano, K.; Genant, H.; Gimona, A.; Harris, S.; Kiel, D.; LeBoff, M.;
Maricic, M.; Miller, P.; et al. A randomized trial of nasal spray salmon calcitonin in postmenopausal women
with established osteoporosis: The prevent recurrence of osteoporotic fractures study. PROOF Study Group.
Am. J. Med. 2000, 109, 267–276. [CrossRef]
19. Shane, E.; Burr, D.; Abrahamsen, B.; Adler, R.A.; Brown, T.D.; Cheung, A.M.; Cosman, F.; Curtis, J.R.; Dell, R.;
Dempster, D.W.; et al. Atypical subtrochanteric and diaphyseal femoral fractures: Second report of a task
force of the American Society for Bone and Mineral Research. J. Bone. Miner. Res. 2014, 29, 1–23. [CrossRef]
20. Khosla, S.; Burr, D.; Cauley, J.; Dempster, D.W.; Ebeling, P.R.; Felsenberg, D.; Gagel, R.F.; Gilsanz, V.; Guise, T.;
Koka, S.; et al. Bisphosphonate-associated osteonecrosis of the jaw: Report of a task force of the American
Society for Bone and Mineral Research. J. Bone. Miner. Res. 2007, 22, 1479–1491. [CrossRef]
21. Zhu, L.; Wei, H.; Wu, Y.; Yang, S.; Xiao, L.; Zhang, J.; Peng, B. Licorice isoliquiritigenin suppresses
RANKL-induced osteoclastogenesis in vitro and prevents inflammatory bone loss in vivo. Int. J. Biochem.
Cell. Biol. 2012, 44, 1139–1152. [CrossRef]
22. Ji, B.; Zhang, Z.; Guo, W.; Ma, H.; Xu, B.; Mu, W.; Amat, A.; Cao, L. Isoliquiritigenin blunts osteoarthritis by
inhibition of bone resorption and angiogenesis in subchondral bone. Sci. Rep. 2018, 8, 1721. [CrossRef]
23. Carnovali, M.; Banfi, G.; Mariotti, M. Liquiritigenin reduces osteoclast activity in zebrafish model of
glucocorticoid-induced osteoporosis. J. Pharmacol. Sci. 2020, 143, 300–306. [CrossRef]
24. Yerra, V.G.; Kalvala, A.K.; Kumar, A. Isoliquiritigenin reduces oxidative damage and alleviates mitochondrial
impairment by SIRT1 activation in experimental diabetic neuropathy. J. Nutr. Biochem. 2017, 47, 41–52.
[CrossRef]
25. Wu, C.H.; Chen, H.Y.; Wang, C.W.; Shieh, T.M.; Huang, T.C.; Lin, L.C.; Wang, K.L.; Hsia, S.M. Isoliquiritigenin
induces apoptosis and autophagy and inhibits endometrial cancer growth in mice. Oncotarget 2016, 7,
73432–73447. [CrossRef]
26. Watanabe, Y.; Nagai, Y.; Honda, H.; Okamoto, N.; Yamamoto, S.; Hamashima, T.; Ishii, Y.; Tanaka, M.;
Suganami, T.; Sasahara, M.; et al. Isoliquiritigenin attenuates adipose tissue inflammation in vitro and
adipose tissue fibrosis through inhibition of innate immune responses in mice. Sci. Rep. 2016, 6, 23097.
[CrossRef]
27. Yagi, M.; Miyamoto, T.; Sawatani, Y.; Iwamoto, K.; Hosogane, N.; Fujita, N.; Morita, K.; Ninomiya, K.;
Suzuki, T.; Miyamoto, K.; et al. DC-STAMP is essential for cell-cell fusion in osteoclasts and foreign body
giant cells. J. Exp. Med. 2005, 202, 345–351. [CrossRef]
28. Soe, K.; Delaisse, J.M. Time-lapse reveals that osteoclasts can move across the bone surface while resorbing.
J. Cell. Sci. 2017, 130, 2026–2035. [CrossRef]
29. Chellaiah, M.A. Regulation of actin ring formation by rho GTPases in osteoclasts. J. Biol. Chem. 2005, 280,
32930–32943. [CrossRef]
30. Wada, T.; Nakashima, T.; Hiroshi, N.; Penninger, J.M. RANKL-RANK signaling in osteoclastogenesis and
bone disease. Trends. Mol. Med. 2006, 12, 17–25. [CrossRef]
31. McCormack, J.P.; Allan, G.M.; Virani, A.S. Is bigger better? An argument for very low starting doses. CMAJ
2011, 183, 65–69. [CrossRef]
32. Rowe, J.W. Natural Products of Woody Plants: Chemicals Extraneous to the Lignocellulosic Cell Wall; Springer:
Berlin, Germany; New York, NY, USA, 1989.
33. Shaik, A.; Bhandare, R.R.; Palleapati, K.; Nissankararao, S.; Kancharlapalli, V.; Shaik, S. Antimicrobial,
antioxidant, and anticancer activities of some novel isoxazole ring containing chalcone and dihydropyrazole
derivatives. Molecules 2020, 25, 1047. [CrossRef]
34. Razmi, A.; Zarghi, A.; Arfaee, S.; Naderi, N.; Faizi, M. Evaluation of anti-nociceptive and anti-inflammatory
activities of novel chalcone derivatives. Iran J. Pharm. Res. 2013, 12, 153–159.
35. Lin, P.H.; Chiang, Y.F.; Shieh, T.M.; Chen, H.Y.; Shih, C.K.; Wang, T.H.; Wang, K.L.; Huang, T.C.; Hong, Y.H.;
Li, S.C.; et al. Dietary compound isoliquiritigenin, an antioxidant from licorice, suppresses triple-negative
breast tumor growth via apoptotic death program activation in cell and xenograft animal models. Antioxidants
2020, 9, 228. [CrossRef]
36. Maggiolini, M.; Statti, G.; Vivacqua, A.; Gabriele, S.; Rago, V.; Loizzo, M.; Menichini, F.; Amdo, S. Estrogenic
and antiproliferative activities of isoliquiritigenin in MCF7 breast cancer cells. J. Steroid. Biochem. Mol. Biol.
2002, 82, 315–322. [CrossRef]

Molecules 2020, 25, 3908
15 of 15
37. Mersereau, J.E.; Levy, N.; Staub, R.E.; Baggett, S.; Zogovic, T.; Chow, S.; Ricke, W.A.; Tagliaferri, M.; Cohen, I.;
Bjeldanes, L.F.; et al. Liquiritigenin is a plant-derived highly selective estrogen receptor beta agonist. Mol. Cell.
Endocrinol. 2008, 283, 49–57. [CrossRef]
38. Mokbel, K. The evolving role of aromatase inhibitors in breast cancer. Int. J. Clin. Oncol. 2002, 7, 279–283.
[CrossRef]
39. Calliste, C.A.; Le Bail, J.C.; Trouillas, P.; Pouget, C.; Habrioux, G.; Chulia, A.J.; Duroux, J.L. Chalcones:
Structural requirements for antioxidant, estrogenic and antiproliferative activities. Anticancer Res. 2001, 21,
3949–3956.
40. Liu, X.; Zhu, Q.; Zhang, M.; Yin, T.; Xu, R.; Xiao, W.; Wu, J.; Deng, B.; Gao, X.; Gong, W.; et al. Isoliquiritigenin
Ameliorates Acute Pancreatitis in Mice via Inhibition of Oxidative Stress and Modulation of the Nrf2/HO-1
Pathway. Oxid. Med. Cell. Longev. 2018, 2018, 7161592. [CrossRef]
41. Feng, X. Chemical and Biochemical Basis of Cell-Bone Matrix Interaction in Health and Disease. Curr. Chem.
Biol. 2009, 3, 189–196. [CrossRef]
42. Blair, H.C.; Teitelbaum, S.L.; Ghiselli, R.; Gluck, S. Osteoclastic bone resorption by a polarized vacuolar
proton pump. Science 1989, 245, 855–857. [CrossRef]
43. Holliday, L.S.; Lu, M.; Lee, B.S.; Nelson, R.D.; Solivan, S.; Zhang, L.; Gluck, S.L. The amino-terminal domain
of the B subunit of vacuolar H+-ATPase contains a filamentous actin binding site. J. Biol. Chem. 2000, 275,
32331–32337. [CrossRef]
Sample Availability: Samples of the compounds IGL and Robtein are available from the authors.
©
2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).