S. Tamura et al. / Bioorg. Med. Chem. Lett. 20 (2010) 3872–3875
3875
the following equation: Inhibition ratio (%) = 100 ꢂ [mean (control) ꢀ mean
(sample)/mean (control) ꢀ mean (back)].
with the novel mechanism of action is unconcluded at present. To
open up a new avenue to this issue, further investigations includ-
ing human clinical trial and development of sensitive bioassay
should be regarded to be crucial.
5. Butterfield, J. H.; Wailer, D.; Dewald, G.; Gleich, G. J. Leuk. Res. 1988, 12, 345.
6. Oh, K. B.; Kang, H.; Matsuoka, H. Biosci. Biotech. Biochem. 2001, 65, 939.
7. Aida, M.; Hano, Y.; Nomura, T. Heterocycles 1995, 41, 2761.
8. Aoyama, T.; Terasawa, S.; Sudo, K.; Shioiri, T. Chem. Pharm. Bull. 1984, 32, 3759.
9. Since the dimethyl acetals 17a–17c could not purified by SiO2 column
chromatography because of considerable lability, the yields from the
chalcones 16a–16c to the glycitein analogs 9–11 are listed. On the basis of
observation on the TLC profiles of the reactions from 17a–17c to 9–11, the two
conversions were discriminated to proceed quantitatively. Thus, the yields may
be considered in the transformation of 16a–16c into 17a–17c.
10. Miki, Y.; Fujitani, R.; Konayashi, S.; Ogawa, N.; Hachiken, H. Synlett 1994, 1001.
11. Compound 9: a pale yellow powder. 1H NMR (300 MHz, acetone-d6) d: 8.22
(1H, s, 2-H), 7.36 (1H, s, 5-H), 7.34 (2H, d, J = 8.6 Hz, 20,60-H), 6.84 (1H, s, 8-H),
6.78 (2H, d, J = 8.6 Hz, 30,50-H). FAB-MS (m/z): 271 [M+H]+. HR FAB-MS (m/z):
calcd for C15H10O5+H: 271.2369, found: 271.2364. 10: a pale yellow powder.
1H NMR (300 MHz, acetone-d6) d: 8.33 (1H, s, 2-H), 7.38 (1H, s, 5-H), 7.39 (2H,
d, J = 8.6 Hz, 20,60-H), 7.16 (1H, s, 8-H), 6.80 (2H, d, J = 8.6 Hz, 30,50-H), 3.91 (3H,
s, OCH3). FAB-MS (m/z): 285 [M+H]+. HR FAB-MS (m/z): calcd for C16H12O5+H:
285.2635, found: 285.2634. 11: a pale yellow powder. 1H NMR (300 MHz,
CDCl3) d: 7.94 (1H, s, 2-H), 7.64 (1H, s, 5-H), 7.37 (2H, d, J = 8.5 Hz, 20,60-H), 6.89
(1H, s, 8-H), 6.84 (2H, d, J = 8.5 Hz, 30,50-H), 4.00, 3.99 (3H each, both s,
OCH3 ꢂ 2). FAB-MS (m/z): 299 [M+H]+. HR FAB-MS (m/z): calcd for C17H14O5+H:
299.2901, found: 299.2905.
Acknowledgments
We wish to thank Dr. Atsuo Kuramasu (Graduate School of
Medicine, Tohoku University) for bestowing HMC-1 cell line. This
work was supported in part by Research funds from San-Ei Gen
F. F. I. Inc. The authors are grateful to the Chamber of Tea Associa-
tion of Shizuoka Prefecture for financial support.
References and notes
1. Blank, U.; Ra, C.; Miller, L.; White, K.; Metzger, H.; Kinet, J.-P. Nature 1989, 337,
187.
2. Dombrowicz, D.; Flamand, V.; Brigman, K. K.; Koller, B. H.; Kinet, J.-P. Cell 1993,
75, 969.
3. Tamura, S.; Yoshihira, K.; Fujiwara, K.; Murakami, N. Bioorg. Med. Chem. Lett.
2010, 20, 2299.
12. In 6-well microculture plates, tectorigenin (1) was co-incubated with HMC-1
4. In 24-well microculture plates, HMC-1 cells (5.0 ꢂ 105 cells/mL) were cultured
cells (5.0 ꢂ 105 cells/mL) in 3 mL of the IMDM medium used for the bioassay at
in 0.98 mL of IMDM medium (Sigma) containing 10% fetal bovine serum
the concentration of 50 lM at 37 °C in 5% CO2 for 36 h. Total cellular RNA was
(Sigma), 2%
L-Glutamine Stock solution (Nacalai), 1.2% Penicillin–
isolated using QuickPrep micro mRNA Purification Kit (Amersham) according to
the manufacturer’s instructions. First strand cDNA was synthesized using
anchored oligo(dT) primers and ReverTra Ace reverse transcriptase (TOYOBO).
The resultant cDNAs were respectively amplified by using the following primers:
Streptomycin-solution (Sigma), and 1.2 mM monothioglycerol (Sigma) in the
presence of the test samples at 37 °C in 5% CO2 for 72 h. The test samples were
dissolved in DMF and diluted to the appropriate concentration using complete
medium, then 20 lL of each sample solution was inoculated. The final
concentration of DMF in the culture is 0.2%. After the whole was washed
with PBS containing 0.5% BSA and 0.05% NaN3 twice, the cells were treated with
Fc
Fc
Fc
e
e
e
RI
RIb forward, 50ttaccaggacctctaggagtgg30, reverse 50aggctggatgaaaaggtgtt30;
RI
forward 50ccagcagtggtcttgctcttact30, reverse 50gcatgcaggcatatgtgat
a
forward, 50ataaaagctccgcgtgagaa30, reverse, 50tccttgagcacagacgtttc30;
c
anti-human Fc
the cells were rinsed with the PBS twice and incubated with FITC labeled anti-
mouse IgG antibody (0.001 g, Cosmo Bio) on ice for 45 min in the dark. After
eRI a-chain antibody (0.001 lg, Kyokuto) on ice for 60 min. Then
gcca30; G3PDH forward 50gatgacatcaagaaggtggtg30, reverse 50gctgtagccaaa
ttcgttgtc30. The amplified PCR products were subjected to electrophoresis on a
1.5% TAE (Tris-acetate EDTA buffer) agarose gel, then stained with ethidium
bromide. Image analysis for each blot was conducted by Scion image (Scion) to
determine amount of the expressed mRNA and quantification of each mRNA was
carried out in triplicate. G3PDH was used as a control to correct expression of
l
duplicate washing with the PBS, the harvested cells were analyzed with a flow
cytometer (FACScalibur, Becton Dickinson). All samples were assessed for
inhibitory activity for FceRI expression in triplicate. In the cases of co-
incubation with only DMF and treatment with only FITC labeled anti-mouse
IgG antibody, the fluorescent scores were indicated as mean (control) and
mean (back), respectively. Inhibition ratio of each sample was determined by
FceRIa, b, and c. The relative expression rates of the three subunits were
described as compared with that of unstimulated HMC-1 cells.