Efficient synthesis and biological evaluation of demethyl geranylgeranoic acid derivatives

Article abstract of DOI:10.1016/j.bmc.2010.07.003

Synthetic retinoids have generated in the fields of dermatology and oncology due to their potent anti-proliferative and differentiation activities. We efficiently synthesized different demethyl geranylgeranoic acid (GGA) analogs, and evaluated their biological activities. Among the demethyl analogs synthesized, 3-demethyl derivative exhibited the highest anti-proliferative activity in HL-60 cells. In addition, a 3-demethyl derivative induced apoptosis more potently than 9Z-retinoic acid. These activities were due to the high binding affinity of 3-demethyl derivative for retinoid receptors. We found that, in a conjugated polyene system combined with a methyl substituent, the position of the methyl played an important role in the regulation of gene transcription and apoptosis-inducing activity. These results provided useful information on the structure-activity relationships of GGA derivatives that function as acyclic retinoic acid analogs. This information is likely to be useful in the development of new anti-cancer drugs.

Full text of DOI:10.1016/j.bmc.2010.07.003

Bioorganic & Medicinal Chemistry 18 (2010) 5795–5806
Contents lists available at ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc
Efficient synthesis and biological evaluation of demethyl geranylgeranoic
acid derivatives q
a
b
a
a
c
Akimori Wada a, , Fei Wang , Yoshitomo Suhara , Yumiko Yamano , Takashi Okitsu , Kimie Nakagawa ,
*
Toshio Okano c
a Department of Organic Chemistry for Life Science, Kobe Pharmaceutical University, 4-19-1 Motoyamakita-machi, Higashinada-ku, Kobe 658-8558, Japan
b Department of Environmental Sciences, Yokohama College of Pharmacy, Yokohama 245-0066, Japan
c Department of Hygienic Sciences, Kobe Pharmaceutical University, 4-19-1 Motoyamakita-machi, Higashinada-ku, Kobe 658-8558, Japan
a r t i c l e i n f o
a b s t r a c t
Article history:
Synthetic retinoids have generated in the fields of dermatology and oncology due to their potent anti-
proliferative and differentiation activities. We efficiently synthesized different demethyl geranylgeranoic
acid (GGA) analogs, and evaluated their biological activities. Among the demethyl analogs synthesized, 3-
demethyl derivative exhibited the highest anti-proliferative activity in HL-60 cells. In addition, a 3-dem-
ethyl derivative induced apoptosis more potently than 9Z-retinoic acid. These activities were due to the
high binding affinity of 3-demethyl derivative for retinoid receptors. We found that, in a conjugated poly-
ene system combined with a methyl substituent, the position of the methyl played an important role in
the regulation of gene transcription and apoptosis-inducing activity. These results provided useful infor-
mation on the structure–activity relationships of GGA derivatives that function as acyclic retinoic acid
analogs. This information is likely to be useful in the development of new anti-cancer drugs.
Ó 2010 Elsevier Ltd. All rights reserved.
Received 28 May 2010
Revised 30 June 2010
Accepted 2 July 2010
Available online 8 July 2010
Keywords:
Retinoid receptors
Retinoic acid analog
Geranylgeranoic acid
Demethyl analog
Coupling reaction
Vinyl triflate
1. Introduction
ated.8–15 Among these analogs, acyclic retinoid (AR) 3, which has a
didehydrated structure due to the 4–5 single bond in geranylgera-
The two retinoids, all-E-retinoic acid (ATRA) 1 and 9Z-retinoic
acid (9CRA) 2 (Fig. 1) are metabolites of vitamin A (retinol) and bind
noic acid (GGA) 4, is expected to be a potent antitumor agent16,17
and is currently being tested in clinical trials.18,19 GGA was consid-
ered to be a retinoic acid analog because it was derived from retinoic
acid by cleaving the 1–6 single bond and subsequently hydrogenat-
ing the two double bonds at the 7–8 and 11–12 positions (number-
ing in retinoic acid). In addition, it is well known that GGA 4 and
geranylgeraniol (GG-OH) 5 can strongly induce apoptosis in various
cell lines.20–23 These observations prompted us to investigate the
structure–activity relationships of GGA analogs as the next step in
our studies on the synthesis of retinoid analogs and their biological
activities.24–27 In this study, we synthesized 3-, 7-, 11-, and 15-dem-
ethyl geranylgeranoic acids 6a–d and evaluated their biological
activities.
the retinoic acid receptors (RAR
a, b, and c) and retinoid X receptors
(RXR , b, and
a
c
), respectively.2–4 These receptors are members of the
nuclear receptor superfamily, and play important roles in cell differ-
entiation, cell proliferation, and embryonic development through
regulation of gene transcription. RXRs form heterodimers with other
nuclear receptors, including RARs, the thyroid-hormone receptor
(TR), the vitamin-D receptor (VDR), and the peroxisome-prolifera-
tor-activated receptors (PPARs). Retinoids and their synthetic ana-
logs have been developed as therapeutic agents in the fields of
dermatology and oncology due to their potent anti-proliferative
and differentiation-inducing activities. In particular, ATRA potently
induces differentiationof acute promyelocytic leukemia(APL) blasts
and is widely used as a chemotherapeutic treatment for APL.5,6 How-
ever, the clinical use of retinoid is very restricted due to its strong
side effects, particularly-headaches and mucocutaneous toxicity.7
To overcome these problems, various novel retinoid analogs have
been synthesized and their biological activities have been evalu-
2. Results and discussion
2.1. Chemistry
To obtain demethyl analogs, we followed the general synthetic
strategy shown in Scheme 1. The key step was the introduction of
the hydrogen atom B or methyl substituent C into enol triflate A,
which was stereoselectively derived from b-keto ester28; these
transformations were achieved with palladium-catalyzed coupling
reactions.29
q
See Ref. 1.
* Corresponding author. Tel.: +81 78 441 7561; fax: +81 78 441 7562.
E-mail address: a-wada@kobepharma-u.ac.jp (A. Wada).
0968-0896/$ - see front matter Ó 2010 Elsevier Ltd. All rights reserved.
doi:10.1016/j.bmc.2010.07.003

5796
A. Wada et al. / Bioorg. Med. Chem. 18 (2010) 5795–5806
Figure 1. Structures of retinoic acids and related compounds.
Scheme 1. Strategy for the synthesis of demethyl analogs.
Scheme 2 shows the synthetic route for the 3-demethyl analog
the presence of a palladium catalyst achieved the introduction of
a methyl substituent to give the ester 18. Then, 18 was converted
to the corresponding acid 6b by basic hydrolysis.
6a, starting from commercially available farnesyl bromide 7. Com-
pound 7 was converted into the (Z)-vinyl triflate 9 according to the
previously reported method.28 A coupling reaction between triflate
9 and tributyltin hydride proceeded smoothly to afford the ester 10
in 94% yield. A basic hydrolysis of the ester 10 generated the de-
sired 3-demethyl acid 6a in 73% yield.
The synthesis of the 7-demethyl analog 6b started with geranyl
bromide 11 (Scheme 3). In a manner similar to that for the synthe-
sis of 10 from 7, compound 11 was converted into the ester 14.
After reduction of the ester 14 with diisobutylaluminium hydride
(DIBAL-H), the resulting alcohol was brominated with PPh3 and
CBr4 to give 15. Then, 15 was transformed into the triflate 17 in
the same manner as described for the preparation of 13 from 12.
The coupling reaction between triflate 17 and tetramethyltin in
For preparation of 11-demethyl and 15-demethyl analogs 6c
and 6d (Scheme 4), we conducted the coupling reaction between
allyl sulfones 23a and 23b and allyl bromides 25a and 25b. The
sulfones 23a and 23b were readily obtained from the reaction of
the corresponding allyl halides with the sodium salt of p-toluene-
sufinic acid; the vinyl bromides 25a and 25b were prepared from
geranyl acetate 24a and farnesyl acetate 24b, respectively, accord-
ing to a previously reported method.30,31 The coupling reaction of
23 and 25 was accomplished with n-BuLi as a base and with a sub-
sequent deacetylation in a DIBAL-H reduction. This gave the sulfo-
nyl alcohol 26 in a mixture of isomers with double bonds at the
carbon atom next to the connection position. The ratio of these

A. Wada et al. / Bioorg. Med. Chem. 18 (2010) 5795–5806
5797
Scheme 2. Synthetic route for 3-demethyl GGA. Reagents: (a) ethyl acetoacetate, 60% NaH, n-BuLi; (b) ((CH3)3Si)2NK, Tf2NPh; (c) Bu3SnH, Pd(PPh3)4, LiCl; (d) 10% KOH, EtOH.
Scheme 3. Synthetic route for 7-demethyl GGA. Reagents: (a) ethyl acetoacetate, 60% NaH, n-BuLi; (b) ((CH3)3Si)2NK, Tf2NPh; (c) Bu3SnH, Pd(PPh3)4, LiCl; (d) i—DIBAL-H; ii—
PPh3, CBr4; (e) ethyl acetoacetate, 60% NaH, n-BuLi; (f) ((CH3)3Si)2NK, Tf2NPh; (g) CuI, Ph3As, Pd(PhCN)2CI2, Me4Sn; (h) 10% KOH, EtOH.
isomers was determined by a 1H NMR spectrum (10E:10Z = 2:1 for
26a, 14E:14Z = 3:1 for 26b). The separation of these isomers would
have been difficult; therefore we used the mixture without further
purification. Removal of the p-toluenesulfonyl group of 26 was
achieved by treating with sodium amalgam and Na2HPO4 to give
the alcohol 27, which was finally converted into the corresponding
acid 6 in two oxidation steps with aldehyde.
phase distribution of HL-60 cells treated with GGA and its ana-
logs at 2.5 Â 10À5 M. We found that, among the analogs, only
the 3-demethyl analog 6a could affect the G0/G1 cell cycle tran-
sition, and 6a showed 1.7-fold higher potency than GGA 4
(Fig. 2).
We determined apoptosis-inducing activity of the analogs by
cell cycle analysis in HL-60 cells treated with increasing concentra-
tions of GGA and demethyl analogs. Dose–response relationships
for GGA and its analogs (Fig. 3) indicated that the apoptosis-induc-
ing activity of compound 6a was 10-fold more potent than that of
GGA 4. The other demethyl analogs 6b–d were less potent than 6a,
but at high concentrations, 6b and 6c exhibited slightly higher
activities than GGA 4.
2.2. Biological evaluation
We evaluated our synthesized analogs for anti-proliferative
activity, apoptosis-inducing activity, and receptor activation. To
examine the anti-proliferative effect, we measured the cell cycle

5798
A. Wada et al. / Bioorg. Med. Chem. 18 (2010) 5795–5806
Scheme 4. Synthetic route for 10-demethyl- and 14-demethyl GGAs. Reagents: (a) ethyl acetoacetate, 60% NaH, n-BuLi; (b) ((CH3)3Si)2NK, Tf2NPh; (c) Bu3SnH, Pd(PPh3)4, LiCl;
(d) i—DIBAL-H; ii—PPh3, NBS; (e) TsNa; (f) i—salicylic acid, SeO2, t-BuOOH; ii—PPh3, CBr4; (g) i—n-BuLi; ii—DIBAL-H; (h) Na/Hg, Na2HPO4; (i) i—MnO2; ii—NaClO2, 2-methyl-2-
butene, NaH2PO4.
Figure 2. Cell cycle regulatory activity of GGA and its analogs in HL-60 cells. The
percentage of cells in G0/G1 phase represents the number observed in the presence
of the compounds (2.5 Â 10À5 M for 24 h) compared to the number observed in the
absence of 9CRA analogs. G0/G1-specific cell cycle arrest is evidenced by an
Figure 3. Dose–response relationships indicate the apoptosis-inducing activity of
GGA and its analogs. Different concentrations of GGA analogs (10À6–10À4 M) were
added to HL-60 cells. Apoptosis is expressed as the percent of dead cells compared
to the total number of untreated cells. The vertical bars indicate the SEM.
increase in the relative number of cells with G0 compared to G1 DNA. The vertical
***
***
**
bars indicate the SEM.
p < 0.001.
p < 0.001; p < 0.01.

A. Wada et al. / Bioorg. Med. Chem. 18 (2010) 5795–5806
5799
In order to determine whether the biological activity of the ana-
logs was mediated by retinoid receptors, the analogs were tested in
a transcriptional assay, where the transcriptional activation of
the activities of GGA analogs were dramatically affected by the po-
sition of the demethylated in GGA. Thus, the 3-demethyl GGA 6a
showed the highest activities in both assays. This result contrasted
markedly with our previous findings that 13-demethyl analogs of
ATRA and 9CRA exhibited approximately half the potency of ATRA
RXRa was indicated by a luciferase reporter. The results are sum-
marized in Figure 4. GGA did not show any transcriptional activity
compared to the EtOH negative control. Among the demethyl ana-
logs, the 3-demethyl derivative 6a exhibited the highest activity; it
and 9CRA in transcriptional activation of RXRa 27
Taken together,
.
our results strongly suggested that the combination of methyl sub-
stituents and conjugated configurations might play an important
role in the potency of retinoid biological activities. Further work
is needed to define a more precise role for demethylated position
in GGA analogs; these studies are currently ongoing.
activated RXRa with similar or higher potency than that 9CRA or
ATRA.
It is well documented that ATRA can induce the differentiation of
HL-60 cells into granulocytes and subsequently cause apoptosis by
binding to RARs.32,33 In contrast, 9CRA controls cell’s biological
activities, including apoptosis, by binding with almost equal affinity
to RARs and RXRs.34–37 Recently, an RAR-independent RXR signaling
pathway was demonstrated with exposure to high concentrations of
9CRA in HL-60 cell lines. In that study, high 9CRA concentrations
caused apoptosis through the activated RXR homodimer.38,39 The
high apoptosis-inducing activity of 6a (Fig. 3) was observed at con-
centrations on the order of a micromolar or more; this concentration
was three orders of magnitude higher than the doses of ATRA and
9CRA (nM) required to induce apoptosis. Therefore, the activity of
6a would be attributed to RXR homodimer.
3. Conclusion
In summary, we discovered a novel method for the synthesis of
demethyl GGA derivatives that function as acyclic retinoid mimet-
ics. The biological evaluation of the demethyl GGA analogs synthe-
sized in this study indicated that 6a represented a potent GGA
analog. Our findings will provide useful information for further
analog research and for biological studies in the mechanism of ac-
tion of retinoids.
The high potency of apoptosis-inducing activity of 6a was fur-
ther supported by the following fact. Thus, in the transcriptional
activity of analogs toward a rat cellular retinoic acid-binding pro-
tein II (CRABPII) gene including RXREs in transfected MG-63 cells,
although none of the analogs 6a–d at 10À6 M exhibited higher
transcriptional activity than 9CRA, 3-demethyl derivative 6a
exhibited the highest activity among the analogs and its potency
was about two-thirds of 9CRA (Fig. 5).
Finally, we assessed the transcriptional activity toward a human
RARb gene promoter with three copies of retinoic acid responsive
elements (RAREs) in transfected MG-63 cells. None of the analogs
6a–d exhibited a comparable or even higher RARb/RARE mediated
gene expression than did ATRA (Fig. 6). This fact strongly indicated
that the apoptosis-inducing activity of 6a was mediated through
RXR homodimer not RAR.
4. Experimental
4.1. General
IR spectra were recorded on a Perkin-Elmer FT-IR Paragon 1000
spectrometer in CHCl3. 1H NMR and 13C NMR spectra were ob-
tained on a Varian Gemini-300 NMR or a Varian VXR-500 spec-
trometer with tetramethylsilane as an internal standard in CDCl3.
Mass spectra were determined on a Hitachi M-4100 instrument.
Column chromatography was performed with a Merck silica gel
60. Commercially available chemicals were used without further
purification except when otherwise noted. Diisopropylamine was
purified by distillation from CaH2. A standard workup indicated
that the organic layers were washed with brine, dried over anhy-
drous sodium sulfate, filtered, and concentrated in vacuo with a ro-
tary evaporator.
In this study, we examined the anti-proliferative and apoptosis-
inducing activities of demethyl GGAs in HL-60 cells. We found that
Figure 4. Transcriptional potency of ATRA, 9CRA, and their analogs on a human RXR
a-GAL4 transgene expressed in MG-63 cells. The fold induction represents the increase in
the expression of a RXR-regulated reporter gene relative to that observed for the ethanol treated control, which is defined as 1.0. Results represent the mean of three
***
*
experiments where cells were exposed to analog concentrations at 10À6 M for 48 h; vertical bars show the SEM.
p < 0.001; p < 0.05.

5800
A. Wada et al. / Bioorg. Med. Chem. 18 (2010) 5795–5806
Figure 5. Transcriptional activity of ATRA, 9CRA, and their analogs toward a rat CRBPII-RXRE expression gene in transfected MG-63 cells. The cells were cotransfected with a
luciferase reporter plasmid (pGVB2 vector) containing a rat CRABPII gene promoter including a RXRE and a pRL-CMV vector as an internal control. Luciferase activities
induced by ATRA, 9CRA and the analogs in MG-63 cells were quantified and are shown as the fold increase in induction as compared with luciferase activity observed in the
ethanol treated control cells (defined as 1.0). Results represent the mean of three experiments (values in column) at 10À6 M for 48 h; vertical bars indicate the SEM.
***
p < 0.001.
Figure 6. Transcriptional activity of ATRA, 9CRA, and their analogs toward a human RAR
a-RARE expression gene in transfected MG-63 cells. The cells were cotransfected with
a luciferase reporter plasmid (pGVB2 vector) containing a human RAR gene promoter including a RARE and a pRL-CMV vector as an internal control. Luciferase activities
a
induced by ATRA, 9CRA and the analogs in MG-63 cells were quantified and are presented as fold increase in induction as compared to the luciferase activity observed in the
ethanol treated control cells, which is defined as 1.0. Each result represents the mean of three experiments (values in column) at 10À6 M for 48 h; vertical bars indicate the
***
SEM.
p < 0.001.
4.2. Synthesis of 3-demethyl analog (6a)
quenched with saturated NH4Cl aqueous solution. The mixture
was extracted with ether (3Â 50 mL), followed by standard work-
up. The residue was purified by flash column chromatography on
silica gel (hexane/AcOEt = 10:1) to give 8 (2.1 g, 63% yield) as a pale
yellow oil. This compound is known, but there is no spectral data.40
4.2.1. Ethyl (6E,10E)-7,11,15-trimethyl-3-oxo-6,10,14-
hexadecatrienoate (8)
To
a suspension of NaH (60% dispersion in oil, 440 mg,
11.0 mmol) in oil in THF (10 mL) was added ethyl acetoacetate
(1.27 mL, 10.0 mmol), and the mixture was stirred at 0 °C for
10 min. Then n-BuLi (1.59 M hexane solution, 6.60 mL, 10.5 mmol)
was added to the suspension, followed by stirring at 0 °C for addi-
tional 10 min. After addition of farnesyl bromide
11.0 mmol), the solution was stirred at room temperature for 1 h,
IR m
max cmÀ1: 3029, 2927, 1741, 1715, 1650; 1H NMR (300 MHz)
d: 1.26 (3H, t, J = 7.2 Hz, CH2CH3), 1.57 (6H, s, CH3 Â 2), 1.60 (3H, s,
CH3), 1.66 (3H, s, CH3), 1.96–2.05 (8H, m, CH2 Â 4), 2.26–2.28 (2H,
m, CH2), 2.53–2.58 (2H, m, CH2), 3.41 (2H, s, CH2), 4.18 (2H, q,
J = 7.2 Hz, OCH2), 5.05–5.08 (3H, br s, @CH Â 3); 13C NMR
(75 MHz) d: 14.0, 15.9 (2C), 17.6, 22.1, 25.6, 26.5, 26.7, 39.5, 39.6,
7 (3.3 g,

A. Wada et al. / Bioorg. Med. Chem. 18 (2010) 5795–5806
5801
43.0, 49.3, 61.3, 122.0, 124.0, 124.3, 131.2, 135.0, 136.7, 167.1,
202.5; EI-LRMS m/z 334 (M+), 135, 109; EI-HRMS calcd for
21H34O3 334.2506; found: 334.2527.
4.3. Synthesis of 7-demethylgeranylgeranoic acid (6b)
C
4.3.1. Ethyl (6E)-7,11-dimethyl-3-oxo-6,10-dodecadienoate (12)
In a manner similar to that for the synthesis of 8 from 7, a crude
product, which was obtained from 11 (2.39 g, 11.0 mmol), NaH
(60% dispersion in oil, 440 mg, 11.0 mmol), n-BuLi (1.59 M hexane
solution, 6.60 mL, 0.5 mmol), and ethyl acetoacetate (1.27 mL,
10.0 mmol), was purified by flash column chromatography on sil-
ica gel (hexane/AcOEt = 10:1) to give 12 (2.3 g, 86% yield) as a pale
yellow oil. The spectral data of this compound were identical with
those of the literature.41
4.2.2. Ethyl (2Z,6E,10E)-7,11,15-trimethyl-3-(trifluoromethyl-
sulfonyloxy)-2,6,10,14-hexadecatetraenoate (9)
To a solution of 0.5 M potassium bis(trimethylsilyl)amide solu-
tion in toluene (14.0 mL, 7.0 mmol) were added compound 8
(1.94 g, 5.84 mmol) dissolved in THF (3 mL) and N-phenyl-bis(tri-
fluoromethanesulfonimide) (2.53 g, 7.1 mmol) at À78 °C under
Ar. After the mixture was warmed to room temperature, then stir-
red for 12 h. The resulting solution was diluted with ether and
quenched with saturated NH4Cl aqueous solution. The mixture
was extracted with ether (3Â 50 mL), followed by standard work-
up. The residue was purified by flash column chromatography on
silica gel (hexane/AcOEt = 80:1) to afford 9 (2.32 g, 84% yield) as
a pale yellow oil. This compound is known, but there is no spectral
data.40
1H NMR (300 MHz) d: 1.27 (3H, t, J = 7.2 Hz, CH2CH3), 1.59 (3H,
s, CH3), 1.60 (3H, s, CH3), 1.67 (3H, s, CH3), 1.94–2.06 (4H, m,
CH2 Â 2), 2.22–2.32 (2H, m, CH2), 2.56 (2H, t, J = 7.5 Hz,
CH2CH2CO), 3.42 (2H, s, COCH2CO), 4.18 (2H, q, J = 7.2 Hz, CH2O),
5.04–5.09 (2H, m, @CH Â 2).
4.3.2. Ethyl (2Z,6E)-7,11-dimethyl-3-(trifluoromethylsulfonyl-
oxy)-2,6,10-dodecatrienoate (13)
IR m
max cmÀ1; 3033, 2928, 1727, 1678, 1428; 1H NMR (300 MHz)
d: 1.30 (3H, t, J = 7.2 Hz, CH2CH3), 1.59 (6H, s, CH3 Â 2), 1.62 (3H, d,
J = 0.9 Hz, CH3), 1.67 (3H, d, J = 0.6 Hz, CH3), 1.97–2.06 (8H, m,
CH2 Â 4), 2.26–2.31 (2H, m, CH2), 2.38–2.43 (2H, m, CH2), 4.24
(2H, q, J = 7.2 Hz, OCH2), 5.06–5.11 (3H, m, @CH Â 3), 5.74 (1H, s,
@CH); 13C NMR (75 MHz) d: 14.0, 15.9, 16.0, 17.6, 24.4, 25.7,
26.5, 26.7, 34.6, 39.6, 39.7, 61.2, 112.0, 120.6, 123.8, 124.3, 131.3,
135.3, 138.2, 158.4, 162.5; EI-LRMS m/z 466 (M+), 136; EI-HRMS
calcd for C22H33F3O5S 466.1999; found: 466.2001.
In a manner similar to that for the synthesis of 9 from 8, a crude
product, which was obtained from 12 (1.71 g, 6.42 mmol), 0.5 M
potassium bis(trimethylsilyl)amide solution in toluene (15.4 mL,
7.70 mmol),
and
N-phenyl-bis(trifluoromethanesulfonimide)
(2.75 g, 7.70 mmol), was purified by flash column chromatography
on silica gel (hexane/AcOEt = 10:1) to afford 13 (2.0 g, 78% yield) as
a pale yellow oil. The spectral data of this compound were identical
with those of the literature.41
1H NMR (300 MHz) d: 1.29 (3H, t, J = 7.2 Hz, CH2CH3), 1.58 (3H,
s, CH3), 1.60 (3H, s, CH3), 1.66 (3H, s, CH3), 1.99–2.06 (4H, m,
CH2 Â 2), 2.25–2.30 (2H, m, CH2), 2.37–2.42 (2H, m, CH2), 4.23
(2H, q, J = 7.2 Hz, OCH2), 5.03–5.07 (2H, m, @CH Â 2), 5.73 (1H, s,
@CH).
4.2.3. Ethyl (2E,6E,10E)-7,11,15-trimethyl-2,6,10,14-hexadeca-
tetraenoate (10)
To a solution of compound 9 (50 mg, 0.107 mmol) in THF (5 mL)
was added LiCl (13.6 mg, 0.321 mmol), Pd(PPh3)4 (6.2 mg,
5.35 lmol), and Bu3SnH (62.3 mg, 0.214 mmol) and stirred at room
temperature for 10 min. The reaction mixture was extracted with
ether (3Â 10 mL), followed by standard workup. The residue was
purified by flash column chromatography on silica gel (hexane/
AcOEt = 10:1) to give 10 (32 mg, 94% yield) as a pale yellow oil.
4.3.3. Ethyl (2E,6E)-7,11-dimethyl-2,6,10-dodecatrienoate (14)
In a manner similar to that for the synthesis of 10 from 9, a
crude product, which was obtained from 13 (1.44 g, 3.62 mmol),
LiCl (460 mg, 10.9 mmol), Pd(PPh3)4 (25 mg, 21.6 lmol), and
IR
m
max cmÀ1; 3027, 2928, 1709, 1654, 1447; 1H NMR (300 MHz)
Bu3SnH (2.1 g, 7.25 mmol), was purified by flash column chroma-
tography on silica gel (hexane/AcOEt = 10:1) to give 14 (886 mg,
98% yield) as a pale yellow oil.
d: 1.28 (3H, t, J = 7.2 Hz, CH2CH3), 1.59 (9H, br s, CH3 Â 3) 1.67 (3H,
s, CH3), 1.98–2.09 (8H, m, CH2 Â 4), 2.13–2.24 (4H, m, CH2 Â 2),
4.18 (2H, q, J = 7.2 Hz, OCH2), 5.07–5.12 (3H, br s, @CH Â 3), 5.82
(1H, dt, J = 15.6, 1.5 Hz, @CH), 6.96 (1H, dt, J = 15.6, 6.9 Hz, @CH);
13C NMR (75 MHz) d: 14.3, 16.0, 16.1, 17.7, 25.7, 26.4, 26.5, 26.7,
32.4, 39.7 (2C), 60.1, 121.4, 122.7, 124.1, 124.4, 131.2, 135.0,
136.4, 148.9, 166.7; EI-LRMS m/z 318 (M+), 136, 114; EI-HRMS
calcd for C21H34O2 318.2557; found: 318.2538.
IR mmax cmÀ1; 3030, 2929, 1712, 1643; 1H NMR (300 MHz) d:
1.26 (3H, t, J = 7.2 Hz, CH2CH3), 1.58 (6H, s, CH3 Â 3), 1.66 (3H, s,
CH3), 1.97–2.06 (4H, m, CH2 Â 2), 2.12–2.23 (4H, m, CH2 Â 2),
4.16 (2H, q, J = 7.2 Hz, CH2O), 5.06–5.10 (2H, m, @CH Â 2), 5.80
(1H, d, J = 15.6 Hz, @CH), 6.95 (1H, dt, J = 15.6, 6.6 Hz, @CH); 13C
NMR (75 MHz) d: 14.2, 16.0, 17.6, 25.6, 26.4, 26.6, 32.4, 39.6,
60.0, 121.4, 122.7, 124.1, 131.3, 136.3, 148.8, 166.6; EI-LRMS m/z
250 (M+), 235, 207, 135; EI-HRMS calcd for C16H26O2 250.1932;
found: 250.1956.
4.2.4. (2E,6E,10E)-7,11,15-Trimethyl-2,6,10,14-hexadecatetrae-
noic acid (6a)
To a solution of compound 10 (180 mg, 0.565 mmol) in ethanol
(3 mL) was added 10% KOH aqueous solution (3 mL), and then
heated at 70 °C for 2 h. After cooled to room temperature, the reac-
tion mixture was neutralized with 10% HCl aqueous solution and
the resulting solution was extracted with AcOEt (3Â 10 mL), fol-
lowed by standard workup. The residue was purified by flash col-
umn chromatography on silica gel (hexane/AcOEt = 1:1) to give
6a (119 mg, 73% yield) as a pale yellow oil.
4.3.4. (2E,6E)-1-Bromo-7,11-dimethyl-2,6,10-dodecatriene (15)
Compound 14 (585 mg, 2.34 mmol) was dissolved in CH2Cl2
(3 mL) and cooled to À78 °C. After DIBAL-H (1 M solution in tolu-
ene, 4.9 mL, 4.9 mmol) was added to the solution, the mixture
was stirred at room temperature for 1 h. The resulting solution
was quenched with saturated NH4Cl aqueous solution, then fil-
tered through Celite. The filtrate was extracted with ether (3Â
50 mL), followed by standard workup. The residue was purified
by flash column chromatography on silica gel (hexane/
AcOEt = 10:1) to give (2E,6E)-7,11-dimethyl-2,6,10-dodecatrien-
1-ol (413 mg, 85% yield) as a pale yellow oil.
IR m
max cmÀ1; 3521, 2926, 1697, 1651, 1421; 1H NMR (300 MHz)
d: 1.60 (9H, s, CH3 Â 3), 1.68 (3H, s, CH3), 1.95–2.13 (8H, m,
CH2 Â 4), 2.16–2.20 (2H, m, CH2), 2.24–2.29 (2H, m, CH2), 5.08–
5.14 (3H, m, @CH Â 3), 5.83 (1H, d, J = 15.6 Hz, @CH), 7.09 (1H,
dt, J = 15.6, 6.6 Hz, @CH); 13C NMR (75 MHz) d: 16.0, 16.1, 17.6,
25.7, 26.3, 26.5, 26.7, 32.5, 39.6, 39.7, 120.8, 122.5, 124.0, 124.4,
131.2, 135.1, 136.6, 151.9, 172.1; EI-LRMS m/z 290 (M+), 136; EI-
HRMS calcd for C19H30O2 290.2244; found: 290.2239.
IR mmax cmÀ1; 3430, 3010, 2978, 2874, 1618, 1456, 1378; 1H
NMR (300 MHz) d: 1.45–1.60 (1H, br s, OH), 1.59 (6H, br s,
CH3 Â 2), 1.68 (3H, s, CH3), 1.80–2.20 (8H, m, CH2 Â 4), 4.03–4.12
(2H, m, OCH2), 5.09 (2H, br s, @CH), 5.59–5.78 (2H, m, @CH Â 2);

5802
A. Wada et al. / Bioorg. Med. Chem. 18 (2010) 5795–5806
13C NMR (75 MHz) d: 16.0, 17.7, 25.7, 26.7, 27.6, 32.4, 39.7, 63.8,
123.6, 124.3, 129.0, 131.3, 133.0, 135.6.
IR mmax cmÀ1; 3018, 2929, 1706, 1646; 1H NMR (300 MHz) d:
1.27 (3H, t, J = 7.2 Hz, CH2CH3), 1.59 (3H, s, CH3), 1.60 (3H, s,
CH3), 1.68 (3H, s, CH3), 1.90–2.10 (8H, m, CH2 Â 4), 2.14–2.18
(4H, m, CH2 Â 2), 2.15 (3H, s, CH3), 4.14 (2H, q, J = 7.2 Hz, CH2O),
5.09–5.12 (2H, m, @CH Â 2), 5.40–5.43 (2H, m, @CH Â 2), 5.65
(1H, s, @CH); 13C NMR (75 MHz) d: 14.3, 16.0, 17.7, 18.8, 25.7,
26.7, 28.0, 30.5, 32.7, 39.7, 40.9, 59.4, 115.7, 123.9, 124.3, 128.7,
131.1, 131.2, 135.3, 159.4, 166.8; EI-LRMS m/z 318 (M+), 303,
168; EI-HRMS calcd for C21H34O2 318.2557; found: 318.2549.
To a solution of alcohol (0.407 g, 1.95 mmol) in CH2Cl2 was added
PPh3 (666 mg, 2.54 mmol) and CBr4 (972 mg, 2.93 mmol) and stirred
at room temperature for 1 h. After the solution was concentrated,
the residue was dissolved in hexane (20 mL), then filtered through
Celite. The filtrate was concentrated. The residue was purified by
flash column chromatography on silica gel (hexane/AcOEt = 10:1)
to give 15 (445 mg, 84% yield) as a pale yellow oil.
IR m
max cmÀ1; 3020, 2928, 1660, 1439, 1377; 1H NMR (300 MHz)
d: 1.59 (6H, br s, CH3 Â 2), 1.68 (3H, s, CH3), 1.98–2.11 (8H, m,
CH2 Â 4), 3.94 (2H, d, J = 6.6 Hz, CH2Br), 5.09–5.11 (2H, br s,
@CH Â 2), 5.71–5.76 (2H, m, @CH Â 2); 13C NMR (75 MHz) d:
16.0, 17.7, 25.7, 26.6, 27.2, 32.2, 33.4, 39.6, 123.2, 124.3, 126.4,
131.2, 135.8, 136.2.
4.3.8. (2E,6E,10E)-3,11,15-Trimethyl-2,6,10,14-hexadecatetrae-
noic acid (6b)
In a manner similar to that for the synthesis of 6a from 10, a
crude product, which was obtained from 18 (140 mg, 0.314 mmol)
in ethanol (5 mL) and 10% KOH (3 mL), was purified by flash col-
umn chromatography on silica gel (hexane/AcOEt = 1:1) to afford
6b (94 mg, 74% yield) as a pale yellow oil.
4.3.5. Ethyl (6E,10E)-11,15-dimethyl-3-oxo-6,10,14-hexadecatri-
enoate (16)
In a manner similar to that for the synthesis of 8 from 7, a crude
product, which was obtained from 15 (245 mg, 1.64 mmol), NaH
(60% dispersion in oil, 72 mg, 1.80 mmol), 1.59 M (n-BuLi hexane
IR mmax cmÀ1; 3520, 3030, 2927, 1691, 1640, 1438; 1H NMR
(300 MHz) d: 1.59 (3H, s, CH3), 1.60 (3H, s, CH3), 1.68 (3H, s,
CH3), 1.98–2.08 (8H, m, CH2 Â 4), 2.10–2.30 (4H, m, CH2 Â 2)
2.17 (3H, s, CH3), 5.10–5.12 (2H, m, @CH Â 2), 5.40–5.44 (2H, m,
@CH Â 2), 5.69 (1H, s, @CH–CO); 13C NMR (75 MHz) d: 16.0, 17.7,
19.1, 25.7, 26.7, 28.0, 30.4, 32.7, 39.7, 41.2, 115.4, 123.9, 124.4,
128.5, 131.2, 131.3, 135.3, 162.7, 172.4; EI-LRMS m/z 290 (M+),
275, 249, 123; EI-HRMS calcd for C19H30O2 290.2244; found:
290.2247.
solution, 1.08 mL, 1.72 mmol), and ethyl acetoacetate (209 lL,
1.64 mmol), was purified by flash column chromatography on silica
gel (hexane/AcOEt = 10:1) to give 16 (220 mg, 42% yield) as a pale
yellow oil.
IR m
max cmÀ1; 3027, 2929, 1741, 1715, 1648; 1H NMR (300 MHz)
d: 1.27 (3H, t, J = 7.2 Hz, CH2CH3), 1.57 (3H, d, J = 0.9 Hz, CH3), 1.59
(3H, s, CH3), 1.67 (3H, d, J = 0.9 Hz, CH3), 1.94–2.06 (8H, m,
CH2 Â 4), 2.24–2.29 (2H, m, CH2), 2.59 (2H, t, J = 7.5 Hz, CH2),
3.42 (2H, s, CH2), 4.18 (2H, q, J = 7.2 Hz, CH2O), 5.06–5.10 (2H, m,
@CH Â 2), 5.38–5.45 (2H, m, @CH Â 2); 13C NMR (75 MHz) d:
14.0, 16.0, 17.6, 25.6, 26.4, 26.7, 27.8, 32.7, 39.6, 42.8, 49.3, 61.3,
123.8, 124.3, 127.9, 131.2, 131.5, 135.3, 167.1, 202.3; EI-LRMS m/
z 320 (M+), 279, 259, 147; EI-HRMS calcd for C20H32O3 320.2350;
found: 320.2360.
4.4. Synthesis of 11-demethylgeranylgeranoic acid (6c)
4.4.1. Ethyl 7-methyl-3-oxo-6-octenoate (20)
In a manner similar to that for the synthesis of 8 from 7, a crude
product, which was obtained from 19 (4.5 g, 30.2 mmol), NaH (60%
dispersion in oil, 1.45 g, 36.2 mmol), 1.59 M (n-BuLi hexane solu-
tion, 23 mL, 36.0 mmol), and ethyl acetoacetate (4.3 g, 33.0 mmol)
was purified by flash column chromatography on silica gel (hex-
ane/AcOEt = 10:1) to give 20 (4.19 g, 73% yield) as a pale yellow oil.
4.3.6. Ethyl (2Z,6E,10E)-11,15-dimethyl-3-(trifluoromethyl-
sulfonyloxy)-2,6,10,14-hexadecatetraenoate (17)
IR m
max cmÀ1; 3027, 2984, 1741, 1716, 1645; 1H NMR (300 MHz)
d: 1.22 (3H, t, J = 7.2 Hz, CH2CH3), 1.56 (3H, s, CH3), 1.61 (3H, s,
CH3), 2.22 (2H, q, J = 7.2 Hz, CH2), 2.51 (2H, t, J = 7.2 Hz, CH2),
3.37 (2H, s, CH2), 4.13 (2H, q, J = 7.2 Hz, CH2O), 5.00 (1H, tq,
J = 7.2, 1.2 Hz, @CH); 13C NMR (75 MHz) d: 14.0, 17.5, 22.1, 25.5,
42.9, 49.3, 61.2, 122.2, 132.9, 167.1, 202.5; EI-LRMS m/z 198
(M+), 180, 130, 111; EI-HRMS calcd for C11H18O3 198.1255; found:
198.1274.
In a manner similar to that for the synthesis of 9 from 8, a crude
product, which was obtained from 16 (821 mg, 2.56 mmol), bis(tri-
methylsilyl)amide solution in toluene (6.14 mL, 3.07 mmol), and N-
phenyl-bis(trifluoromethanesulfonimide) (1.10 g, 3.07 mmol), was
purified by flash column chromatography on silica gel (hexane/
AcOEt = 10:1) to afford 17 (800 mg, 69% yield) as a pale yellow oil.
IR m
max cmÀ1; 3023, 2930, 1728, 1679, 1428; 1H NMR (300 MHz)
d: 1.30 (3H, t, J = 7.2 Hz, CH2CH3), 1.59 (3H, s, CH3), 1.60 (3H, s,
CH3), 1.68 (3H, d, J = 1.2 Hz, CH3), 1.97–2.04 (8H, m, CH2 Â 4),
2.29 (2H, q, J = 6.8 Hz, CH2), 2.42 (2H, t, J = 6.8 Hz, CH2), 4.25 (2H,
q, J = 7.2 Hz, OCH2), 5.07–5.11 (2H, br s, @CH Â 2), 5.30–5.60 (2H,
m, @CH Â 2), 5.74 (1H, s, @CH); 13C NMR (75 MHz) d: 14.0, 16.0,
17.7, 25.7, 26.7, 27.8, 28.8, 32.7, 34.5, 39.7, 61.2, 112.1, 123.6,
124.3, 126.4, 131.3, 133.1, 135.5, 158.2, 162.4; EI-LRMS m/z 452
(M+), 411, 321, 275; EI-HRMS calcd for C21H31F3O5S 452.1843;
found: 452.1869.
4.4.2. Ethyl (2Z)-7-methyl-3-(trifluoromethylsulfonyloxy)-2,6-
octadienoate (21)
In a manner similar to that for the synthesis of 9 from 8, a
crude product, which was obtained from 20 (4.62 g, 23.3 mmol),
0.5 M potassium bis(trimethylsilyl)amide solution in toluene
(55.9 mL, 27.9 mmol), and N-phenyl-bis(trifluoromethanesulfoni-
mide) (9.98 g, 27.9 mmol), was purified by flash column chromatog-
raphy on silica gel (hexane/AcOEt = 10:1) to afford 21 (12.1 g, 83%
yield) as a pale yellow oil.
IR m
max cmÀ1; 3032, 2983, 1727, 1678, 1428; 1H NMR (300 MHz)
4.3.7. Ethyl (2E,6E,10E)-3,11,15-trimethyl-2,6,10,14-hexadeca-
tetraenoate (18)
To a solution of compound 17 (262 mg, 0.58 mmol) in 1-methyl-
2-pyrrolidinone (NMP, 10 mL) was added CuI (11 mg, 0.058 mmol),
Ph3As (17.8 mg, 0.058 mmol), Pd(PhCN)2Cl2 (11.1 mg, 0.029 mmol),
d: 1.29 (3H, t, J = 7.2 Hz, CH2CH3), 1.60 (3H, s, CH3), 1.69 (3H, d,
J = 0.9 Hz, CH3), 2.21–2.28 (2H, m, CH2), 2.37–2.41 (2H, m, CH2),
4.24 (2H, q, J = 7.2 Hz, CH2O), 5.01–5.07 (1H, m, @CH), 5.73 (1H,
s, @CH); 13C NMR (75 MHz) d: 13.9, 17.6, 24.4, 25.6, 34.5, 61.2,
112.0, 120.7, 134.4, 158.4, 162.4; EI-LRMS m/z 331 (M+H+), 262,
and SnMe4 (169
l
L, 1.16 mmol), and heated at 100 °C for 10 h. The
197, 123; EI-HRMS calcd for
331.0839.
C12H17F3O5S 331.0826; found:
mixture was diluted with AcOEt (30 mL) and the resulting mixture
was washed with saturated KF aqueous solution (2Â 20 mL) and
water (2Â 20 mL), dried over MgSO4, and concentrated. The residue
was purified by flash column chromatography on silica gel (hexane/
AcOEt = 10:1) to give 18 (169 mg, 92% yield) as a pale yellow oil.
4.4.3. Ethyl (2E)-7-methyl-2,6-octadienoate (22)
In a manner similar to that for the synthesis of 10 from 9, a
crude product, which was obtained from 21 (6.5 g, 19.7 mmol), LiCl

A. Wada et al. / Bioorg. Med. Chem. 18 (2010) 5795–5806
5803
(2.5 g, 59 mmol), Pd(PPh3)4 (455 mg, 0.39 mmol), and Bu3SnH
(10.6 mL, 39.3 mmol) was purified by flash column chromatogra-
phy on silica gel (hexane/AcOEt = 10:1) to give 22 (2.84 g, 79%
yield) as a pale yellow oil. This compound is known, but there is
no spectral data.42
to give (2E,6E)-8-hydroxy-3,7-dimethyl-2,6-octadienyl acetate.
The spectral data of this compound were identical with those of
the literature.31
1H NMR (300 MHz, CDCl3) d: 1.59 (3H, s, CH3), 1.64 (3H, s, CH3),
1.99 (3H, s, CH3), 2.00–2.18 (4H, m, CH2 Â 2), 2.21 (1H, br s, OH),
3.91 (2H, s, OCH2), 4.52 (2H, d, J = 7.0 Hz, OCH2), 5.28 (1H, t,
J = 7.0 Hz, @CH)), 5.30 (1H, t, J = 6.5 Hz, @CH).
IR m
max cmÀ1; 3025, 2931, 1707, 1654, 1447; 1H NMR (300 MHz)
d: 1.27 (3H, t, J = 7.2 Hz, CH2CH3), 1.59 (3H, s, CH3), 1.68 (3H, d,
J = 0.6 Hz, CH3), 2.11–2.25 (4H, m, CH2 Â 2), 4.17 (2H, q,
J = 7.2 Hz, CH2O), 5.05 (1H, t, J = 6.5 Hz, @CH), 5.81 (1H, dt,
J = 15.6, 1.8 Hz, @CH), 6.95 (1H, dt, J = 15.6, 6.6 Hz, @CH); 13C
NMR (75 MHz) d: 14.2, 17.6, 25.6, 26.5, 32.4, 60.1, 121.4, 122.8,
132.7, 149.9, 166.7; EI-LRMS m/z 182 (M+), 137, 114; EI-HRMS
calcd for C11H18O2 182.1306; found: 182.1329.
To a solution of this alcohol in CH2Cl2 (100 mL) was continu-
ously added PPh3 (7.37 g, 28.1 mmol) and CBr4 (10.7 g, 32.4 mmol)
at 0 °C under Ar, and stirred at room temperature for 12 h. The
mixture was washed with saturated NH4Cl aqueous solution and
brine, dried over MgSO4, and concentrated. The residue was puri-
fied by flash column chromatography on silica gel (hexane/
AcOEt = 3:1) to give 25a (3.16 g, 25% yield in two steps) as a pale
yellow oil. This compound is known, but there is no spectral data.31
1H NMR (300 MHz) d: 1.62 (3H, s, CH3), 1.69 (3H, s, CH3), 1.97
(3H, s, CH3), 1.96–2.18 (4H, m, CH2 Â 2), 3.87 (2H, s, CH2Br), 4.49
(2H, d, J = 7.0 Hz, OCH2), 5.26 (1H, t, J = 7.0 Hz, @CH), 5.48 (1H, t,
J = 7.0 Hz, @CH).
4.4.4. (2E)-1-Methyl-4-(7-methyl-2,6-octadienylsulfonyl)-
benzene (23a)
Compound 22 (2.84 g, 15.6 mmol) was dissolved in CH2Cl2
(30 mL) and cooled to À78 °C under Ar. After DIBAL-H (1 M solu-
tion in toluene, 32 mL, 32 mmol) was added to the solution, the
mixture was stirred at room temperature for 1 h. The resulting
solution was quenched with saturated NH4Cl aqueous solution,
then filtered through Celite. The filtrate was extracted with ether
(3Â 50 mL), followed by standard workup.
4.4.6. (2E,6E,10E)- and (2E,6E,10Z)-3,7,15-Trimethyl-9-(4-meth-
ylphenylesulfony)l-2,6,10,14-hexadecatetraen-1-ol (26a)
To a solution of 23a (546 mg, 1.96 mmol) in THF/HMPA (10:1,
10 mL) was added n-BuLi (1.59 M hexane solution, 1.84 mL,
2.94 mmol) at 0 °C under Ar, and the resulting mixture was stirred
for an additional 1 h at 0 °C. Then 25a (593 mg, 2.16 mmol) in THF
(5 mL) was added to the solution and was stirred at 0 °C for 12 h.
After warmed to room temperature, the mixture was quenched
with 1 M HCl aqueous solution, then extracted with ether (3Â
30 mL), followed by standard workup. Continuously, the residue
was dissolved in ether (20 mL) at 0 °C and DIBAL-H (1 M in toluene
solution, 2.94 mL, 2.94 mmol) was added to the solution. The mix-
ture was stirred at 0 °C to room temperature for 2 h, quenched
with saturated NH4Cl aqueous solution at 0 °C, extracted with
ether (3Â 50 mL), followed by standard workup. The residue was
purified by flash column chromatography on silica gel (hexane/
AcOEt = 3:1) to give 26a (228 mg, 27% yield) as a mixture of stereo-
isomer (10E:10Z = 3:1, a pale yellow oil).
The residue was purified by flash column chromatography on
silica gel (hexane/AcOEt = 10:1) to give (2E,6E)-7-methyl-2,6-octa-
dien-1-ol as a pale yellow oil.
1H NMR (300 MHz, CDCl3) d: 1.55 (3H, s, CH3), 1.67 (3H, s, CH3),
1.77 (1H, s, OH), 1.91–2.20 (4H, m, CH2 Â 2), 4.06 (2H, br s, OCH2),
5.12 (1H, br s, @CH), 5.56–5.80 (2H, m, @CH Â 2); 13C NMR
(75 MHz, CDCl3) d: 17.7, 25.6, 27.6, 32.3, 63.6, 123.7, 129.0,
131.9, 132.9.
The alcohol was dissolved in THF (30 mL) and cooled to À20 °C
under Ar. To a solution of this alcohol was added PPh3 (5.5 g,
21.0 mmol) and NBS (3.74 g, 21.0 mmol), and the mixture was stir-
red at À10 °C to 0 °C for 30 min. Further addition of sodium salt of
p-toluenesulfinic acid (7.0 g, 28.0 mmol) and NaI (210 mg,
1.4 mmol) followed by stirring at room temperature for 5 h, and
then AcOEt and saturated Na2S2O3 aqueous solution was added.
After separation of AcOEt layer, the aqueous layer was extracted
with AcOEt (3Â 30 mL), and combined organic layers were fol-
lowed by standard workup. The residue was purified by flash col-
umn chromatography on silica gel (hexane/AcOEt = 3:1) to give
23a (2.65 g, 61% yield in two steps) as a pale yellow oil.
IR mmax cmÀ1; 3027, 2927, 1598, 1318; 1H NMR (300 MHz) d:
1.53 (3H, s, CH3), 1.64 (3H, d, J = 1.6 Hz, CH3), 1.92–2.01 (4H, m,
CH2 Â 2), 2.41 (3H, s, PhCH3), 3.69 (2H, d, J = 7.2 Hz, CH2SO2Ph),
4.98 (1H, t, J = 6.5 Hz, @CH), 5.37–5.48 (2H, m, @CH Â 2), 7.30
(2H, d, J = 8.1 Hz, Ar-H), 7.70 (2H, d, J = 8.1 Hz, Ar-H); 13C NMR
(75 MHz) d: 17.6, 21.5, 25.5, 27.1, 32.6, 60.1, 116.1, 123.2, 128.4,
129.5, 132.1, 135.4, 141.1, 144.4.
(2E,6E,10E)-isomer: IR mmax cmÀ1: 3608, 3533, 2968, 2927,
1664, 1597, 1447; 1H NMR (300 MHz, CDCl3) d: 1.45 (3H, s, CH3),
1.48 (3H. s, CH3), 1.57 (3H, s, CH3), 1.60 (3H, s, CH3), 1.62–2.10
(9H, m, CH2 Â 4, OH), 2.23 (1H, dd, J = 13.5, 11.0 Hz, CH2), 2.40
(3H, s, CH3), 2.81 (1H, br d, J = 13.5 Hz, CH2), 3.92 (1H, td, J = 11.0,
3.5 Hz, CH), 4.05 (2H, d, J = 7.0 Hz, OCH2), 4.92 (1H, t, J = 7.0 Hz,
@CH), 5.02–5.38 (4H, m, @CH Â 4), 7.24 (2H, d, J = 8.5 Hz, Ar-H),
7.63 (2H, d, J = 8.5 Hz, Ar-H); 13C NMR (75 MHz) d: 15.6, 15.9,
17.4, 21.4, 25.5, 26.1, 27.1, 32.5, 37.1, 39.0, 58.9, 67.6, 121.7,
123.2, 123.5, 127.9, 129.0, 129.2, 129.8, 131.8, 134.4, 138.5,
139.5, 144.2.
4.4.7. (2E,6E,10E)- and (2E,6E,10Z)-3,7,15-Trimethyl-2,6,10,14-
hexadecatetraen-1-ol (27a)
4.4.5. (2E,6E)-8-Bromo-3,7-dimethyl-2,6-octadienyl acetate (25a)
To a solution of t-BuOOH (10.7 g) in CH2Cl2 (100 mL) was added
SeO2 (181 mg, 1.6 mmol) and salicylic acid (5.06 g, 36.6 mmol),
and the mixture was stirred at room temperature for 1 h. Geranyl
acetate 24a (6.46 g, 24.4 mmol) in CH2Cl2 (50 mL) was added by
dropwise at 0 °C, and stirred for 12 h. After the reaction mixture
was concentrated, the residue was dissolved in ether (150 mL),
washed with 25% Na2S2O4 aqueous solution (2Â 100 mL), and
water (100 mL), and the organic layer was concentrated. The
resulting residue was dissolved in ethanol (100 mL) and cooled
to 0 °C. NaBH4 (1.84 g, 48.8 mmol) was added to the solution over
20 min, then quenched with saturated NH4Cl aqueous solution
(50 mL). The reaction mixture was extracted with ether (3Â
100 mL), followed by standard workup. The residue was purified
by flash column chromatography on silica gel (hexane/AcOEt = 3:1)
To a solution of compound 26a (127 mg, 0.295 mmol) in anhy-
drous ethanol (10 mL) was added Na2HPO4 (168 mg, 1.18 mmol)
and sodium amalgam 5.0% (543 mg, 1.18 mmol), and the reaction
mixture was heated to reflux for 10 h. After the solution was cooled
to room temperature, the reaction was quenched with 1 M HCl
aqueous solution, and extracted with ether (3Â 50 mL), followed
by standard workup. The residue was purified by flash column
chromatography on silica gel (hexane/AcOEt = 3:1) to give 27a
(72 mg, 88% yield) as a mixture of stereoisomer (10E:10Z = 3:1, a
pale yellow oil).43
(2E,6E,10E)-isomer: IR mmax cmÀ1; 3611, 3010, 2928, 1667,
1450, 1383; 1H NMR (300 MHz) d: 1.36 (1H, br s, OH), 1.58 (6H,
s, CH3 Â 2), 1.64 (3H, s, CH3), 1.67 (3H, s, CH3), 1.90–2.20 (12H,
m, CH2 Â 6), 4.12 (2H, d, J = 7.0 Hz, OCH2), 5.01 (2H, t, J = 6.0 Hz,

5804
A. Wada et al. / Bioorg. Med. Chem. 18 (2010) 5795–5806
@CH Â 2), 5.28–5.50 (3H, m, @CH Â 3); EI-LRMS m/z 276 (M+), 189,
(3H, s, CH3), 1.55 (3H, d, J = 5.5 Hz, CH3), 1.63 (3H, s, CH3), 1.70–
2.10 (9H, m, CH2 Â 4, OH), 2.21 (1H, dd, J = 14.0, 12.0 Hz, CH2),
2.39 (3H, s, CH3), 2.68 (1H, br d, J = 14 Hz), 3.51 (1H, td, J = 12.0,
3.5 Hz, SO2CH), 4.10 (2H, d, J = 6.5 Hz, CH2O), 5.00–5.40 (5H, m,
@CH Â 5), 7.27 (2H, d, J = 8.5 Hz, Ar-H), 7.66 (2H, d, J = 8.5 Hz, Ar-
H); 13C NMR (75 MHz) d: 15.7, 15.8, 16.1, 17.9, 21.5, 26.1, 26.4,
37.2, 39.2, 39.4, 59.1, 67.6, 122.7, 123.4, 123.9, 128.4, 129.1,
129.3, 129.4, 134.5, 134.6, 134.8, 139.2, 144.2.
135; EI-HRMS calcd for C19H32O 276.2452; found: 276.2469.
4.4.8. (2E,6E,10E)- and (2E,6E,10Z)-3,7,15-Trimethyl-2,6,10,14-
hexadecatetraenoic acid (6c)
To a solution of 27a (140 mg, 0.506 mmol) in ether (20 mL) was
added MnO2 (1.4 g, 16.1 mmol), and stirred at room temperature
for 2 h. Then the mixture was filtered through Celite and concen-
trated to afford the crude aldehyde. The aldehyde was dissolved
in t-BuOH (30 mL), then NaClO2 (203 mg, 2.24 mmol), 2-methyl-
2-butene (15 mL, 134 mmol), water (10 mL), and NaH2PO4
(215 mg, 1.79 mmol) were added. After stirring for 12 h, AcOEt
(30 mL) and water (50 mL) was added, and organic layer was sep-
arated, dried over MgSO4, and concentrated. The residue was puri-
fied by flash column chromatography on silica gel (hexane/
AcOEt = 3:1) to give 6c (96 mg, 65% yield in two steps) as a mixture
of stereoisomer (10E:10Z = 3:1, a pale yellow oil).
4.5.4. (2E,6E,10E,14E)- and (2E,6E,10E,14Z)-3,7,11-Trimethyl-
2,6,10,14-hexadecatetraen-1-ol (27b)
In a manner similar to that for the synthesis of 27a from 26a, a
crude product, which was obtained from 26b (106 mg, 0.247 mmol),
Na2HPO4 (140 mg, 0.986 mmol), sodium amalgam 5.0% (378 mg,
378 mg), was purified by flash column chromatography on silica
gel (hexane/AcOEt = 3:1 to 2:1) to give 27b (51.8 mg, 76% yield) as
a mixture of stereoisomer (14E:14Z = 2:1, a pale yellow oil).46
(2E,6E,10E,14E)-isomer: IR mmax cmÀ1; 3611, 3444, 3010, 2935,
1666, 1649, 1450, 1383; 1H NMR (300 MHz) d: 1.49 (1H, br s,
OH), 1.55 (3H, d, J = 4.0 Hz, CH3), 1.59 (3H, s, CH3), 1.67 (6H, s,
CH3 Â 2), 1.90–2.20 (12H, m, CH2 Â 6), 4.12 (2H, d, J = 6.5 Hz,
CH2O), 5.09 (2H, t, J = 5.5 Hz, @CH Â 2), 5.25–5.50 (3H, m,
@CH Â 3); EI-LRMS m/z 276 (M+), 259, 205, 191; EI-HRMS calcd
for C19H32O 276.2452; found: 276.2426.
(2E,6E,10E)-isomer: IR mmax cmÀ1; 3611, 3010, 2928, 1667,
1450, 1383; 1H NMR (300 MHz) d: 1.42 (3H, s, CH3), 1.68 (6H, br
s, CH3 Â 2), 1.96–2.10 (8H, m, CH2 Â 4), 2.10–2.40 (4H, m,
CH2 Â 2), 2.12 (3H, s, CH3), 5.10 (2H, br s, @CH Â 2), 5.20–5.50
(2H, m, @CH Â 2), 5.69 (1H, s, @CH); EI-LRMS m/z 290 (M+), 191,
135; EI-HRMS calcd for C19H30O2 290.2244; found: 290.2269.
4.5. Synthesis of 15-demethylgeranylgeranoic acid (6d)
4.5.5. (2E,6E,10E,14E)- and (2E,6E,10E,14Z)-3,7,11-Trimethyl-
2,6,10,14-hexadecatetraenoic acid (6d)
4.5.1. (2E)-1-(2-Butenylsulfonyl)-4-methylbenzene (23b)
To a solution of crotyl chloride (4.4 mL, 0.44 mmol) in methanol
(40 mL) was added sodium salt of p-toluenesulfinic acid (22 g,
88 mmol), and the solution was refluxed for 3 h. After removal of
methanol, the residue was poured into water, and extracted with
ether (3Â 100 mL), followed by standard workup. The residue
was purified by flash column chromatography on silica gel (hex-
ane/AcOEt = 5:1 to 3:1) to give 23b (4.51 g, 97% yield). The spectral
data of this compound were identical with those of the literature.44
In a manner similar to that for the synthesis of 6c from 27a, a
crude product, which was obtained from 27b (253 mg,
0.918 mmol), MnO2 (2.53 g, 29.1 mmol), t-BuOH (10 mL), NaClO2
(386 mg, 4.26 mmol), NaH2PO4 (409 mg, 3.41 mmol), 2-methyl-2-
butene (15 mL, 134 mmol), water (10 mL), was purified by flash
column chromatography on silica gel (hexane/AcOEt = 3:1) to give
6d (168 mg, 63% yield) as
(14E:14Z = 2:1, a pale yellow oil).
a
mixture of stereoisomer
IR
m
max cmÀ1; 3027, 2921, 1598, 1319, 1142; 1H NMR (300 MHz)
(2E,6E,10E,14E)-isomer: IR mmax cmÀ1; 3528, 3029, 2931, 1691,
1640, 1438; 1H NMR (300 MHz) d: 1.57 (3H, s, CH3), 1.58 (3H, d,
J = 6.5 Hz, CH3), 1.61 (3H, s, CH3), 1.90–2.20 (8H, m, CH2 Â 4),
2.15–2.20 (4H, m, CH2 Â 2), 2.18 (3H, s, CH3), 5.00–5.50 (4H, m,
@CH Â 4), 5.70 (1H, s, @CH); EI-LRMS m/z 290 (M+), 209, 15; EI-
HRMS calcd for C19H30O2 290.2245; found: 290.2258.
d: 1.65 (3H, d, J = 5.5 Hz, CH3), 2.42 (3H, s, PhCH3), 3.68 (2H, d,
J = 7.2 Hz, SO2CH2), 5.34–5.44 (1H, m, @CH), 5.48–5.60 (1H, m,
@CH), 7.31 (2H, d, J = 8.4 Hz, Ar-H), 7.70 (2H, d, J = 8.4 Hz, Ar-H);
13C NMR (75 MHz) d: 18.0, 21.5, 60.1, 117.0, 128.3, 129.5, 135.5,
136.2, 144.5.
4.5.2. (2E,6E,10E)-12-Bromo-3,7,11-trimethyl-2,6,10-dodecat-
rienyl acetate (25b)
4.6. Biological assay
In a manner similar to that for the synthesis of 25a from 24a,
farnesyl acetate 24b (5.0 g, 18.9 mmol) was converted into the bro-
moacetate 25b (1.1 g, 38% yield) as a pale yellow oil. The spectral
data of this compound were identical with those of the literature.45
IR mmax cmÀ1: 3075, 2936, 1666, 1647, 1449, 1384; 1H NMR
(300 MHz) d: 1.59 (3H, s, CH3), 1.70 (3H, s, CH3), 1.74 (3H, s,
CH3), 1.98–2.15 (8H, m, CH2 Â 4), 2.05 (3H, s, CH3), 3.96 (2H, s,
CH2Br), 4.58 (2H, d, J = 6.9 Hz, –CH2OAc), 5.09 (1H, t, J = 6.0 Hz,
@CH), 5.33 (1H, t, J = 6.9 Hz, @CH), 5.56 (1H, t, J = 6.6 Hz, @CH);
13C NMR (75 MHz) d: 14.6, 15.9, 16.4, 21.0, 26.1, 26.8, 38.7, 39.4,
41.8, 61.3, 118.3, 124.2, 131.1, 131.9, 134.6, 142.1, 171.0.
4.6.1. HL-60 cells and cell cycle synchronization
HL-60 cells were maintained in continuous culture in RPMI-
1640 medium (Nissui Seiyaku Co., Ltd, Tokyo, Japan), supple-
mented with 10% dextran-coated, charcoal-treated fetal calf serum
(FCS) (Gibco BRL, Grand Island, NY, USA) and kanamycin (0.06 mg/
mL) (Sigma, St. Lois, MO, USA), at 37 °C in a humidified atmosphere
of 5% CO2 in air. The doubling time of HL-60 cells was approxi-
mately 24 h. For synchronization at S phase, cells (4 Â 105 cells/
mL) were cultured in 30 mL of RPMI-1640 medium, supplemented
with 2.5 mM thymidine. After two washes with Ca-, Mg-free phos-
phate-buffered saline [PBS(À)], the synchronization of the cell cy-
cle was repeated. The cells thus obtained were used in biological
assays.
4.5.3. (2E,6E,10E,14E)- and (2E,6E,10E,14Z)-3,7,11-Trimethyl-13-
(4-methylphenylsulfonyl)-2,6,10,14-hexadecatetraen-1-ol (26b)
In a manner similar to that for the synthesis of 26a from 23a, a
crude product, which was obtained from 23b (1.68 g, 8 mmol) and
25b (2.49 g, 7.25 mmol), was purified by flash column chromatog-
raphy on silica gel (hexane/AcOEt = 1:1) to give 26b (3.34 g, 97%
yield) as a mixture of stereoisomer (14E:14Z = 2:1, a pale yellow
oil).
4.6.2. Flow cytometry
Cells (105 cells/well) were placed in 24-well tissue culture
plates, and cultured for 3d with retinoids (10À6–10À4 M) in
RPMI-1640 medium at 37 °C in a humidified atmosphere of 5%
CO2 in air. To reduce the effects of contact inhibition, control cells
were adjusted to 60–70% confluency at the time of the fluorescent
activated cell sorting (FACS) analysis. Each group of cells was
collected in PBS(À). Then, cells were resuspended in PBS(À) that
(2E,6E,10E,14E)-isomer: IR mmax cmÀ1; 3610, 3530, 3026, 2921,
1666, 1598, 1446; 1H NMR (300 MHz) d: 1.45 (3H, s, CH3), 1.52

A. Wada et al. / Bioorg. Med. Chem. 18 (2010) 5795–5806
5805
contained 0.2% Triton X and 1
1 h. Cells were washed with PBS(À) and incubated with 0.5 mL of
DNA-staining solution that contained propidium iodide (50 g/
l
L RNase, and incubated at 37 °C for
Research Promotion Fund of the Japanese Private School Promotion
Foundation.
l
mL) at 4 °C for 20 min. The cells were analyzed with a flow cytom-
eter equipped with an argon laser (488 nm, Becton–Dickinson FAC-
Scan™), and the cell cycle distribution was analyzed with ModiFiT
LT software (Verity Software House; Topsham, ME).
A. Supplementary data
Supplementary data associated with this article can be found, in
the online version, at doi:10.1016/j.bmc.2010.07.003. These data
include MOL files and InChiKeys of the most important compounds
described in this article.
4.6.3. Transcriptional activity assay of RXRa-Gal4
Human osteosarcoma MG-63 cells, which are positive for RXR
gene expression, were maintained in Dulbecco’s modified Eagle
medium (Gibco BRL) supplemented with 1% penicillin, 1% strepto-
mycin, and 10% dextran-coated, charcoal-treated, FCS (Gibco BRL).
The day before transfection, cells were seeded on six-well culture
plates at a density of 2 Â 105 cells per well in order to ensure that
References and notes
1. Retinoids and related compounds. Part 32. See part 31; Okitsu, T.; Nakazawa,
D.; Nakagawa, K.; Okano, T.; Wada, A. Chem. Pharm. Bull. 2010, 58, 418.
2. Mangelsdorf, D. J.; Umesono, K.; Evans, R. M. In The Retinoids; Sporn, M. B.,
Roberts, A. B., Goodman, D. S., Eds., 2nd ed.; Raven Press: New York, 1994; pp
319–350 .
3. Germain, P.; Chambon, P.; Eichele, G.; Evans, R. M.; Lazar, M. A.; Leid, M.; de
Lera, Á. R.; Lotan, R.; Mangelsdorf, D. J.; Gronemeyer, H. Pharmacol. Rev. 2006,
58, 712.
4. Germain, P.; Chambon, P.; Eichele, G.; Evans, R. M.; Lazar, M. A.; Leid, M.; de
Lera, Á. R.; Lotan, R.; Mangelsdorf, D. J.; Gronemeyer, H. Pharmacol. Rev. 2006,
58, 760.
5. Chomienne, C.; Balitrand, N.; Ballerini, P.; Castaigne, S.; de Thé, H.; Degos, L. J.
Clin. Invest. 1991, 88, 2150.
they were confluent on the day of transfection. The RXRa-Gal4
transgene comprised a one-hybrid plasmid (pM vector) that con-
tained a human RXR sequence connected to a yeast GAL4-DNA
binding domain sequence. The cells were cotransfected with
1.0 lg of RXR-Gal4 and either 0.5 mg of a luciferase reporter plas-
mid (pGVP2 vector) that also contained a GAL4-DNA binding site
or 0.5 mg of a pRL-CMV vector as an internal control. Each set of
experiments was repeated at least three times with 10À6 M of
the test compound. The results are presented as means SEM of
the fold increase in induction.
6. Warrel, R. P. Annu. Rev. Med. 1996, 47, 555.
7. Delia, D.; Aiello, A.; Lombardi, L.; Pelici, P. G.; Grignani, F.; Formelli, F.; Menard,
S.; Costa, A.; Veronesi, V.; Pierotti, M. A. Acid Cancer Res. 1993, 53, 6036.
8. Morishita, K.; Yakushiji, N.; Ohsawa, F.; Takamatsu, K.; Matsuura, N.;
Makishima, M.; Kawahata, M.; Yamaguchi, K.; Tai, A.; Sasaki, K.; Kakuta, H.
Bioorg. Med. Chem. Lett. 2009, 19, 1001.
4.6.4. Transcriptional activity assay of RARE or RXRE
9. Charton, J.; Deprez-Poulain, R.; Hennuyer, N.; Tailleux, A.; Staels, B.; Deprez, B.
Bioorg. Med. Chem. Lett. 2009, 19, 489.
Human osteosarcoma MG-63 cells, which are positive for RXR
gene expression, were maintained in Dulbecco’s modified Eagle’s
medium (Gibco BRL) supplemented with 1% penicillin, 1% strepto-
mycin, and 10% dextran-coated charcoal-treated FCS (Gibco BRL).
The day before transfection, cells were seeded on six-well culture
plates at a density of 2 Â 105 cells per well so that they were con-
fluent on day of transfection. The retinoid-responsive luciferase re-
porter constructs human RARb-RARE3-SV40-Luc and rat CRBPII-
RXRE-SV40-Luc were generated by cloning three copies of the ret-
inoic acid response element (RARE) from the RARb promoter (59/
33: GGGTAAAGTTCACCGAAAGTTCACTCG) or the RXRE from the
rat CRBPII promoter (639/605: GCTGTCACAGGTCACAGGTCA-
CAGGTCACAGTTCA) in the pGL3 vector. The pRL-CMV vector was
an internal control using the Tfx-50 reagent. After transfection,
the cells were incubated with retinoids (10À6 M) for 2 days. Lucif-
erase activity of the cell lysates was measured with a luciferase as-
say system (Toyo Ink Co., Ltd), according to the manufacture’s
instructions. Transactivation determined from the luciferase activ-
ity was standardized with respect to the luciferase activity of the
same cells measured with the Sea Pansy luciferase assay system
as a control (Toyo Ink Co., Ltd). Each set of experiments was re-
peated at least three times, and the results (means SEM) are pre-
sented in terms of folds in increase induction compared to the
vehicle (ethanol)-treated control, which is expressed as 1.0.
10. Garca, J.; Khanwalkar, H.; Pereira, R.; Erb, C.; Vogel, J. J.; Collete, P.; Mauvais, P.;
Bourguet, W.; Gronemeyer, H.; de Lera, Á. R. ChemBioChem 2009, 10, 1252.
11. Álvarez, S.; Pazos-Randulfe, Y.; Khanwalkar, H.; Germain, P.; Álvarez, R.;
Gronemeyer, H.; de Lera, Á. R. Bioorg. Med. Chem. 2008, 16, 9719.
12. Sakaki, J.; Kishida, M.; Konishi, K.; Gunji, H.; Toyama, A.; Matsumoto, Y.;
Kanazawa, T.; Uchiyama, H.; Fukuya, H.; Mitani, H.; Arai, Y.; Kimura, M. Bioorg.
Med. Chem. Lett. 2007, 17, 4808.
13. Sun, W.; Desai, S.; Piao, H.; Carroll, P.; Canney, D. J. Heterocycles 2007, 71, 557.
14. Walker, J. R.; Alshafie, G.; Nieves, N.; Ahrens, J.; Clagett-Dame, M.; Abou-Issa,
H., ; Curley, R. W., Jr. Bioorg. Med. Chem. 2006, 14, 3038.
15. Ikegami, S.; Iimori, T.; Sudo, M.; Kitsukawa, M.; Foroumadi, A.; Yonemura, T.;
Takahashi, H.; Kizaki, K.; Hshii, H. Bioorg. Med. Chem. 2006, 14, 5099.
16. Kado, N.; Suzuki, T.; Aizawa, K.; Munemasa, Y.; Matsumura, T.; Sawaki, D.;
Magai, R. FEBS Lett. 2008, 582, 1755.
17. Suzuki, M.; Sunagawa, N.; Chiba, I.; Moriwaki, H.; Yoshimi, N. Int. J. Oncol. 2006,
28, 1193.
18. Takai, K.; Okuno, M.; Yasuda, I.; Matsushima-Nishiwaki, R.; Uematsu, T.;
Tsurumi, H.; Shiratori, Y.; Muto, Y.; Moriwaki, H. Intervirology 2005, 48, 39.
19. Ralhan, R.; Kaur, J. J. Biol. Regul. Homeost. Agents 2003, 17, 66.
20. Shidoji, Y.; Okamoto, K.; Muto, Y.; Komura, S.; Ohishi, N.; Yagi, K. J. Cell.
Biochem. 2006, 97, 178.
21. Nakamura, N.; Shidoji, Y.; Yamada, Y.; Hatakeyama, H.; Moriwaki, H.; Muto, Y.
Biochem. Biophys. Res. Commun. 1995, 207, 382.
22. Ohizumi, H.; Masuda, Y.; Yoda, M.; Hashimoto, S.; Aiuchi, T.; Nakajo, S.; Sakai,
I.; Ohsawa, S.; Nakaya, K. Anticancer Res. 1997, 17, 1051.
23. Miquel, K.; Pradines, A.; Favre, G. Biochem. Biophys. Res. Commun. 1996, 225,
869.
24. Wada, A.; Matsuura, N.; Mizuguchi, Y.; Nakagawa, K.; Ito, M.; Okano, T. Bioorg.
Med. Chem. 2008, 16, 8471.
25. Wada, A.; Mizuguchi, Y.; Miyake, H.; Niihara, M.; Ito, M.; Nakagawa, K.; Okano,
T. Lett. Drug Des. Discov. 2007, 4, 442.
26. Wada, A.; Mizuguchi, Y.; Shinmen, M.; Ito, M.; Nakagawa, K.; Okano, T. Lett.
Drug Des. Discov. 2006, 3, 118.
4.7. Statistical analysis
27. Wada, A.; Fukunaga, K.; Ito, M.; Mizuguchi, Y.; Nakagawa, K.; Okano, T. Bioorg.
Med. Chem. 2004, 12, 3931.
28. Xie, H.; Becker, J. M.; Naider, F.; Gibbs, R. A. J. Org. Chem. 2000, 65, 8552.
29. For review, see; Ritter, K. Synthesis 1993, 735.
30. Fairlamb, I. J. S.; Dickinson, J. M.; Peggy, M. Tetrahedron Lett. 2001, 42, 2205.
31. Yue, X.; Lan, J.; Li, J.; Liu, Z.; Lin, Y. Tetrahedron 1999, 55, 133.
32. Breitman, T. R.; Selonick, S. E.; Collins, S. J. Proc. Natl. Acad. Sci. U.S.A. 1980, 77,
2936.
Statistical significance was determined with Dunnett’s test. The
data were compared to EtOH-treated control cells, and levels of
***
p < 0.001,
**
p < 0.01, and
significance were evaluated as
*
p < 0.05.
33. Martin, S. J.; Bradley, J. G.; Cotter, T. G. Clin. Exp. Immunol. 1990, 79, 448.
34. Heyman, R. A.; Mangelsdorf, D. J.; Dyck, J. A.; Stein, R. B.; Eichele, G.; Evans, R.
M.; Thaller, C. Cell 1992, 68, 397.
Acknowledgments
35. Allenby, G.; Bocquel, M. T.; Saunders, M.; Kazmer, S.; Speck, J.; Rosenberger, M.;
Lovey, A.; Kastner, P.; Grippo, J. F.; Chambon, P.; Levin, A. A. Proc. Natl. Acad. Sci.
U.S.A. 1993, 90, 30.
36. Nagy, L.; Thomázy, V. A.; Shipley, G. L.; Fésüs, L.; Lamph, W.; Heyman, R. A.;
Chandraratna, R. A. S.; Davies, P. J. A. Mol. Cell. Biol. 1995, 15, 3540.
This work was supported in part by a Grant-in-Aid for Scientific
Research (C) (A.W.) from the Ministry of Education, Culture, Sports,
Science, and Technology of Japan, and by grants from the Kobe
Pharmaceutical University Collaboration Fund and the Science

5806
A. Wada et al. / Bioorg. Med. Chem. 18 (2010) 5795–5806
37. Orlandi, M.; Mantovani, B.; Ammar, K.; Avitabile, E.; Dal Monte, P.; Bartolini, G.
Med. Princ. Pract. 2003, 12, 164.
38. Hida, T.; Tai, K.; Tokuhara, N.; Ishibashi, A.; Kikuchi, K.; Hibi, S.; Yoshimura, H.;
Nagai, M.; Yamauchi, T.; Kobayashi, S. Jpn. J. Pharmacol. 2001, 85, 60.
39. Benoit, G.; Altucci, L.; Flexor, M.; Ruchaud, S.; Lillehaug, J.; Raffelsberger, W.;
Gronemeyer, H.; Lanotte, M. EMBO J. 1999, 18, 7011.
42. Stephan, E.; Pourcelot, G.; Gresson, P. Chem. Ind. 1988, 562.
43. Chow, S. Y.; Williams, H. J.; Huang, Q.; Nand, S.; Scott, A. I. J. Org. Chem. 2005,
70, 9997.
44. Hirano, K.; Makino, K. Chem. Pharm. Bull. 1988, 36, 1727.
45. Zoretic, P. A.; Wang, M.; Zhang, Y.; Shen, Z. J. Org. Chem. 1996, 61, 1806.
46. Coates, R. M.; Ley, D. A.; Cavender, P. L. J. Org. Chem. 1978, 43, 4915.
40. Mu, Y.; Eubanks, L. M.; Poulter, C. D. Bioorg. Med. Chem. 2002, 10, 1207.
41. Gibbs, R. A.; Krishnan, U.; Dolence, J. M.; Poulter, C. D. J. Org. Chem. 1995, 60,
7821.