Crystal Structure of the Human Cannabinoid Receptor CB1

Article abstract of DOI:10.1016/j.cell.2016.10.004

Cannabinoid receptor 1 (CB₁) is the principal target of Δ⁹-tetrahydrocannabinol (THC), a psychoactive chemical from Cannabis sativa with a wide range of therapeutic applications and a long history of recreational use. CB₁ is activated by endocannabinoids and is a promising therapeutic target for pain management, inflammation, obesity, and substance abuse disorders. Here, we present the 2.8 ? crystal structure of human CB₁ in complex with AM6538, a stabilizing antagonist, synthesized and characterized for this structural study. The structure of the CB₁-AM6538 complex reveals key features of the receptor and critical interactions for antagonist binding. In combination with functional studies and molecular modeling, the structure provides insight into the binding mode of naturally occurring CB₁ ligands, such as THC, and synthetic cannabinoids. This enhances our understanding of the molecular basis for the physiological functions of CB₁ and provides new opportunities for the design of next-generation CB₁-targeting pharmaceuticals.

Full text of DOI:10.1016/j.cell.2016.10.004

Article
Crystal Structure of the Human Cannabinoid
Receptor CB1
Graphical Abstract
Authors
Tian Hua, Kiran Vemuri, Mengchen Pu, ...,
Alexandros Makriyannis,
Raymond C. Stevens, Zhi-Jie Liu
Correspondence
lbohn@scripps.edu (L.M.B.),
a.makriyannis@northeastern.edu (A.M.),
stevens@shanghaitech.edu.cn (R.C.S.),
liuzhj@shanghaitech.edu.cn (Z.-J.L.)
In Brief
A look at ligand engagement with the
human CB1 receptor opens up avenues
for design of new modulators with
favorable physiological profiles.
Highlights
Data Resources
d
d
d
d
AM6538 is presented as a stabilizing, tight binding
antagonist of CB1
5TGZ
Crystal structure of human CB1 in complex with AM6538 is
determined
Molecular docking predicts CB1 binding modes of THC and
synthetic cannabinoids
Resolution of the binding pocket provides path for rational
CB1 drug design
Hua et al., 2016, Cell 167, 750–762
October 20, 2016 ª 2016 Elsevier Inc.
http://dx.doi.org/10.1016/j.cell.2016.10.004

Article
Crystal Structure of the Human
Cannabinoid Receptor CB1
Tian Hua,1,2 Kiran Vemuri,3 Mengchen Pu,2 Lu Qu,1,2 Gye Won Han,4 Yiran Wu,1 Suwen Zhao,1 Wenqing Shui,1
Shanshan Li,1 Anisha Korde,3 Robert B. Laprairie,5 Edward L. Stahl,5 Jo-Hao Ho,5 Nikolai Zvonok,3 Han Zhou,3
3,
Irina Kufareva,6 Beili Wu,7 Qiang Zhao,7 Michael A. Hanson,8 Laura M. Bohn,5, Alexandros Makriyannis,
*
*
1,2,
Raymond C. Stevens,1,4,9, and Zhi-Jie Liu
*
*
1iHuman Institute, ShanghaiTech University, Shanghai 201210, China
2National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101, China
3Center for Drug Discovery, Department of Pharmaceutical Sciences and Department of Chemistry and Chemical Biology,
Northeastern University, Boston, MA 02115, USA
4Departments of Biological Sciences and Chemistry, Bridge Institute, University of Southern California, Los Angeles, CA 90089, USA
5Departments of Molecular Therapeutics and Neuroscience, The Scripps Research Institute, Jupiter, FL 33458, USA
6University of California, San Diego, La Jolla, CA 92093, USA
7CAS Key Laboratory of Receptor Research, Shanghai Institute of Materia Medica, Chinese Academy of Sciences, Shanghai 201203, China
8GPCR Consortium, San Marcos, CA 92078, USA
9Lead Contact
*Correspondence: lbohn@scripps.edu (L.M.B.), a.makriyannis@northeastern.edu (A.M.), stevens@shanghaitech.edu.cn (R.C.S.),
liuzhj@shanghaitech.edu.cn (Z.-J.L.)
http://dx.doi.org/10.1016/j.cell.2016.10.004
SUMMARY
terpenoid molecule, was isolated and characterized (Gaoni and
Mechoulam, 1964). This provided an early molecular foundation
Cannabinoid receptor 1 (CB1) is the principal target for medicinal chemists to develop related structural analogs and
of D9-tetrahydrocannabinol (THC), a psychoactive
chemical from Cannabis sativa with a wide range of
therapeutic applications and a long history of recrea-
tional use. CB1 is activated by endocannabinoids
new synthetic ligands (Makriyannis and Rapaka, 1990; Razdan,
1986). Initially, due to their lipophilic nature, it was assumed
that cannabinoids exerted their effects by perturbing the phys-
ical properties of biological membranes (Makriyannis, 2014;
Mavromoustakos et al., 1995). This assumption was challenged
with the discovery, cloning, and expression of the first cannabi-
noid-specific membrane receptor, then designated as the
and is a promising therapeutic target for pain man-
agement, inflammation, obesity, and substance
˚
abuse disorders. Here, we present the 2.8 A crystal
cannabinoid receptor (CB) (Devane et al., 1988; Matsuda et al.,
1990). With the subsequent identification of a second receptor,
the designation evolved to CB1 and CB2 (Munro et al., 1993).
The discovery of the endogenous agonists to the receptors,
structure of human CB1 in complex with AM6538, a
stabilizing antagonist, synthesized and character-
ized for this structural study. The structure of the
CB1-AM6538 complex reveals key features of the the endocannabinoids, anandamide (Devane et al., 1992), and
2-arachidonoyl glycerol (2-AG) (Mechoulam et al., 1995) soon
followed.
receptor and critical interactions for antagonist
binding. In combination with functional studies and
molecular modeling, the structure provides insight
into the binding mode of naturally occurring CB1
ligands, such as THC, and synthetic cannabinoids.
This enhances our understanding of the molecular
basis for the physiological functions of CB1 and pro-
vides new opportunities for the design of next-gener-
Cannabinoid receptors belong to the class A G protein-
coupled receptor (GPCR) family, signal through inhibitory Gai/o
heterotrimeric G proteins (Howlett, 1985), and interact with b-ar-
restins (Jin et al., 1999). CB1 is the most highly expressed GPCR
in the human brain and is expressed throughout the body, with
the highest levels found in the central nervous system (Herken-
ham et al., 1990).
ation CB1-targeting pharmaceuticals.
Cannabis has been used for centuries in many cultures to
treat a wide range of medical conditions. More recently, thera-
peutic considerations have moved beyond the plant extract
to explore and produce more pharmacologically refined com-
INTRODUCTION
Marijuana from Cannabis sativa L. has been used for both thera- pounds. CB1-selective small-molecule agonists have shown
peutic and recreational purposes for many centuries (Lem- therapeutic promise in a wide range of disorders, including
berger, 1980; Li, 1973). In the 1940s, chemistry based on com- pain and inflammation (Cravatt and Lichtman, 2004), multiple
pounds isolated from the plant (Wollner et al., 1942) produced sclerosis (Pertwee, 2002; Pryce and Baker, 2015), and
´
novel biologically active molecules (Adams et al., 1948; Ghosh neurodegenerative disorders (Fernandez-Ruiz et al., 2015).
et al., 1940); however, it was not until the 1960s that the ac- The first CB1-selective antagonist/inverse agonist, rimona-
tive constituent of marijuana, D9-tetrahydrocannabinol (THC), a bant (SR141716, Acomplia [Sanofi-Aventis]) (Rinaldi-Carmona
750 Cell 167, 750–762, October 20, 2016 ª 2016 Elsevier Inc.

Figure 1. Overall Structure of CB1-AM6538 Complex
(A) Side view of the CB1-AM6538 complex. The receptor is shown in gray cartoon representation. The ligand AM6538, shown with green sticks, demarcates the
binding pocket, which is partially occluded by the N-terminal loop (red). The nitrate group is not modeled in the experimental crystal structure, as the electron
density was not observed. The extracellular loops (ECLs) are shown in brown and the intracellular loops (ICLs) are shown in purple.
(B) Top view of the extracellular side. The disulfide bond in ECL2 is shown as yellow sticks.
See also Figures S2 and S3.
et al., 1994), received approval from the European Medical RESULTS
Agency as an adjunct to diet and exercise for treating obesity
(Janero and Makriyannis, 2009). Antagonists of CB1 have Synthesis of CB1 Stabilizing Antagonist AM6538 for
been explored as potential therapeutics for obesity-related Structural Studies
metabolic disorders (Mazier et al., 2015), mental illness (Black One of the key factors facilitating the structure determination
et al., 2011; Rubino et al., 2015), liver fibrosis (Mallat et al., of CB1 (Figure 1) is utilization of the antagonist AM6538, the
2013), and nicotine addiction (Schindler et al., 2016). synthesis of which resulted from the strategic modification of
However, rimonabant and other ligands in its class were not rimonabant to enhance its ability to stabilize the ligand-receptor
approved in the United States due to concerns about adverse complex and promote CB1 crystal formation. In contrast with
events, such as increased anxiety, depression, and suicidal rimonabant, the 5-phenyl ring substituent was modified so as to
ideation.
introduce motifs (ex. alkyne unit) that could favor increased
Numerous studies have investigated how ligands binding affinity for the CB1 receptor (Tam et al., 2010). The rimonabant
CB1 can mediate downstream signaling. While the variety of analog, AM251, (1, Figure 2A) (Lan et al., 1999), a compound that
compounds exhibiting different pharmacological profiles have hasbeenusedextensivelyasapharmacologicalstandardCB1-se-
provided clues regarding CB1 activation, the molecular details lective antagonist, was used as the precursor in the AM6538
defining the binding modes of both endogenous and exogenous syntheticprocess.SynthesisofAM6538involvesthefunctionaliza-
ligands are still largely unknown (Guo et al., 1994; Makriyannis, tion of the iodo substituent at the para position of the 5-phenyl ring
2014; Picone et al., 2005). In order to address this deficit in un- in AM251 with an acetylenic chain system consisting of four car-
derstanding, we have determined the crystal structure of CB1 bons and substituted at the omega carbon. To this end, we initially
in complex with a tight binding antagonist AM6538. In conjunc- focused on targeting cysteine residues within CB1 by introducing
tion with molecular docking, the structure was used to elucidate suitable electrophilic groups (Janero et al., 2015; Li et al., 2005;
the binding modes of a diverse set of antagonists/inverse ago- Mercier et al., 2010; Picone et al., 2005; Szymanski et al., 2011)
nists and agonists of CB1. The structural details of the cannabi- at the fourth carbon of the alkyne unit, capable of forming a cova-
noid receptor reported herein improve our understanding of how lentbondwiththecysteinethiolgroup.ForAM6538, weintroduced
ligands engage to modulate the cannabinoid system and provide at this position a nitrate group (ONO2) whose role was to serve as a
a useful model to facilitate the design of next-generation phar- polar group, which may be displaced by a suitable nucleophile
maceuticals to avoid unwanted side effects. The findings provide (e.g., thiol) (Pattison and Brown, 1956; Yeates et al., 1985) at or
insight into mechanisms of slow dissociation of antagonists, near the binding domain or alternatively bind as an intact group
which may potentially translate into long acting pharmacological so as to obtain a non-covalent, near-irreversible attachment by in-
effects.
teracting with hydrogen bonding amino acid residues, as well as
Cell 167, 750–762, October 20, 2016 751

Figure 2. Synthesis and Characterization of
AM6538
(A) Synthetic procedures for compound AM6538.
(B) Saturation [3H]-CP55,940 binding assays in the
absence (control) or presence of rimonabant
(100 nM) or AM6538 (50 nM) demonstrates that
both antagonists cause displacement of specific
binding of the radioligand when present concur-
rently in the 1 hr binding assay.
(C) Following pretreatment of membranes (37ꢀC,
6 hr) with buffer only (none), rimonabant (100 nM),
or AM6538 (50 nM); membranes were washed
with buffer 33 prior to [3H]-CP55,940 binding as
described for (B).
(D) Percentage of remaining binding (Bmax) de-
tected following the conditions described in (B)
(concurrent) and (C) (pretreat and wash). Both
antagonists decrease the binding of [3H]-
CP55,940 to ꢁ30% when incubated concurrently
during the 1 hr binding assay. Under pretreatment
and washout conditions, rimonabant does not
affect subsequent radioligand binding, while
AM6538 continues to compete despite washing of
the membranes.
See also Figure S1 and Table S1.
ures (Lv et al., 2016) identified Flavo-
doxin (Chun et al., 2012) as a stabilizing
fusion partner when inserted within the
receptor’s third intracellular loop (ICL3)
at Val306 and Pro332. Additionally, the
WT receptor was truncated on both
the N and C termini by 98 and 58 resi-
dues, respectively. Finally, in order to
residues capable of p-p interactions. In the present study, affinity improve the expression and thermostability of the receptor,
mass spectrometry analysis suggests that AM6538 reacts with four computationally predicted mutations (Thr2103.46Ala
CB1 as an intact molecule with no evidence of covalent modifica- [D’Antona et al., 2006], Glu2735.37Lys, Thr2835.47Val, and
tion of relevant cysteine residues.
Arg3406.32Glu) were introduced to the CB1 sequence (Figures
AM6538 was a strong candidate for crystallographic studies S2A–S2C) (superscripts denote amino acid position as
of the receptor based on its high affinity and wash-resistant described by Ballesteros and Weinstein [1995]). The
binding to CB1 as determined by radioligand competition assays modified CB1 construct was inserted into a pTT5 vector for
against the tritiated agonist, [3H]-CP55,940 (Ki = 3.4 1.0 nM) expression in HEK293F cells to generate protein (Figure S2D)
(Figures 2B–2D). This is in contrast to rimonabant, which can that formed crystals in lipidic cubic phase supplemented
˚
be readily washed out of membranes, permitting subsequent with cholesterol (Figure S3E); the crystals diffracted to 2.8 A
radioligand binding (Figures 2B–2D). Importantly, the crystallized (Table 1).
CB1 construct (described below) has comparable affinity for
AM6538 as the wild-type receptor (Ki = 5.1 0.9 nM).
Based on affinity mass spectrometry analysis, intact AM6538
is associated with the CB1 protein (Figure S3F). Electron
In functional assays, AM6538 is a competitive antagonist of the density with three branches was observed near the orthosteric
effects of CP55,940 and THC on CB1-mediated inhibition of ad- binding site and modeled as core AM6538 atoms with the
enylyl cyclase activity and b-arrestin2 recruitment in overexpres- terminal nitrate group omitted (Figures 3D and S3). A molecular
sion systems (Figures S1A and S1B and Table S1). Competitive dynamics (MD) simulation was performed on the CB1-AM6538
antagonism was confirmed by the [35S]-GTPgS binding assays complex with the nitrate group intact and modeled through
performed in mouse cerebellum (Figure S1C). For comparison docking analysis, and the results revealed that the root mean
purposes, competitive antagonism was demonstrated for rimo- square fluctuation (RMSF) values for the nitrate group and
nabant in the same systems (Figure S1 and Table S1).
the hinge carbon atom are higher, suggesting that the
nitrate group is more mobile than other atoms in AM6538 (Fig-
ure S4B). As a modeled ligand with other possibilities to fit the
Structure Determination of CB1-AM6538 Complex
To facilitate crystallization, it was necessary to modify the electron density, further studies on ligand binding are under
wild-type (WT) CB1 sequence. Construct optimization proced- investigation.
752 Cell 167, 750–762, October 20, 2016

part of the N terminus of CB1, residues 99–112, forms a V-shaped
loop, whichinserts into the ligand-binding pocket and functions as
a plug, restricting access to the pocket from the extracellular side
(Figures 1A and 1B). While the influence of crystal packing interac-
tions onthe conformation ofthe N terminus (Figure S3B) cannot be
ruled out, it is interesting to note that the N terminus has been
consistently observed in an ordered form in the structures of the
related lipid receptors LPA1 (lysophosphatidic acid receptor 1)
(Chrencik et al., 2015) and S1P1 (sphingosine 1-phosphate recep-
tor 1) (Hanson et al., 2012) and that the function of CB1 is very
sensitive to the presence of the ordered portion of the N terminus
(Andersson et al., 2003; Fay and Farrens, 2013). ECL2 in CB1
consists of 21 residues folding into an intricate structure that
projects four residues (268–271) into the binding pocket.
Previous work has shown that the four residues are important
for mediating interactions with certain classes of ligands
(Ahn et al., 2009; Bertalovitz et al., 2010) and that the two
cysteines (Cys257 and Cys264) in ECL2 are critical to the function
of CB1 (Fay et al., 2005). In the structure, the conformation of
ECL2 is constrained by the presence of an intraloop disulfide
bond (Cys257-Cys264) (Figure 1B) previously found in the
structures of the closely related LPA1 and S1P1 receptors. The
highly conserved disulfide bond between ECL2 and helix III
(Cys3.25) in most class A GPCRs is lacking in all three lipid receptor
structures.
Table 1. Crystallographic Data Collection and Refinement
Statistics
Data Collection and Refinement Statistics
Ligand
AM6538
29
Number of crystals
Data Collection
Space group
C2
Cell dimensions
˚
a,b,c (A)
116.56, 52.63, 143.63
111.14
b (ꢀ)
Number of reflections measured
Number of unique reflections
160,794
19,837
˚
Resolution (A)
47.30 - 2.80 (2.90-2.80)
0.126 (0.520)
10.1 (2.1)
a
Rmerge
Mean I/s(I)
Completeness (%)
Redundancy
CC1/2
97.4 (94.1)
8.1 (4.6)
0.999 (0.44)
Refinement
˚
Resolution (A)
47.05 - 2.80
19,827 (985)
0.207/0.238
Number of reflections (test set)
Rwork/Rfree
Number of Atoms
CB1
AM6538 Interactions in CB1 Ligand-Binding Pocket
The position of the ligand-binding pocket of CB1 is different from
the previously described orthosteric binding sites of other class
A GPCRs. AM6538 lies quite low in the binding pocket of CB1,
immediately above the conserved Trp3566.48 (Figures 3A and
3B). The ligand adopts an extended conformation with the ligand
strain close to its local minimum as determined by quantum
mechanical calculations (Figure S3D).
2,312
1,103
33
Flavodoxin
AM6538b
Lipid and other
102
2
Average B Factor (A )
˚
Wilson
73.6
87.4
110.6
66.6
119.5
79.7
Overall
AM6538 forms mainly hydrophobic interactions with ECL2
and the N terminus, as well as with all CB1 helices except helix
IV (Figures 3A and 3B). As described above, the ligand has a pyr-
azole ring core with three functional groups. For clarity, we have
termed the 2,4-dichlorophenyl ring ‘‘arm 1,’’ the 4-aliphatic chain
substituted phenyl ring ‘‘arm 2,’’ and the piperidin-1-ylcarbamoyl
‘‘arm 3’’ (Figure 3C). The pyrazole ring core (including the 4-methyl
group) is situated between helices II and VII, forming hydrophobic
interactions with the side chains of Phe1702.57, Phe3797.35, and
Ser3837.39 (Figure 3C) and is capped by the N-terminal loop inter-
actions (Met103N-term). Arm 1 is located in a narrow side pocket
(Figure 3B) formed by helices II, III, VI, and VII and forms edge-
face p-p interactions with the side chain of Phe1702.57 and with
CB1
Flavodoxin
AM6538
Lipid and other
rmsds
˚
Bond lengths (A)
0.004
0.638
Bond angles (ꢀ)
Ramachandran Plot Statistics (%)c
Favored regions
97.7
2.3
0
Allowed regions
Disallowed regions
aData for high-resolution shells are shown in parenthesis.
bNitrate group is excluded due to the absence of electron density.
cAs defined in MolProbity.
the backbone amide bond between Gly1662.53 and Ser1672.54
.
This substituted ring moiety forms hydrophobic interactions with
Val1963.32, Trp3566.48, Cys3867.42, Leu3877.43, and Met103N-term
(Figure 3C). The 2,4-dichlorophenyl ring in arm 1 fits well into the
shape of the narrow side pocket (Figure S3C), which explains
why 2,4-dichloro or 2-chloro substitutions result in optimal binding
Structural Features of CB1 in Complex with AM6538
The overall CB1 structural fold shares a similar architecture with (Lange and Kruse, 2005).
previously solved class A GPCR structures, containing seven
transmembrane (7TM) a-helices (ItoVII) connected bythree extra- (Figure 3B) formed by helices III, V, VI, and ECL2. The phenyl
Arm 2 of the ligand extends toward a long, narrow channel
cellular loops (ECL1–3), three intracellular loops (ICL1–3), and an group in arm 2 establishes p-p interactions with Phe102N-term
,
amphipathic helix VIII (Figures 1A and S3A). The non-truncated Phe268ECL2, and Trp3566.48; hydrophobic interactions with
Cell 167, 750–762, October 20, 2016 753

Figure 3. Analysis of the Ligand Binding
Pocket of CB1
(A) Key residues in CB1 for AM6538 binding.
AM6538 (green carbons) and CB1 residues (teal
carbons) involved in ligand binding are shown in
stick representation. The receptor is shown in gray
cartoon representation.
(B) The shape of the ligand binding pocket.
AM6538 (green carbons) and ML056 (brown car-
bons) are shown in stick representation.
(C) Schematic representation of interactions be-
tween CB1 and AM6538. The 2,4-dichlorophenyl
ring in the red circle is termed as arm 1; the
4-aliphatic chain substituted phenyl ring in the blue
circle is termed as arm 2; the piperidin-1-ylcarba-
moyl in the green circle is termed as arm 3. The
nitrate group, which was not observed in the
electron density, is shown in gray.
(D) Electron density maps calculated from the
refined structure of the CB1-AM6538 complex.
jFoj-jFcj omit map (blue mesh) of the ligand
AM6538 is shown (contoured at 3 s).
See also Figure S3.
˚
helix I by about 7 A, mainly due to interac-
tions with the two bulky residues
Phe1702.57 and Phe1742.61
.
The role of Lys1923.28 in CB1 has been
intensively researched. It was reported
that
Lys192Ala/Lys192Gln/Lys192Glu
mutants decreased the affinities of
Leu1933.29, Val1963.32, and Leu3596.51 are observed. A triple several agonists such as CP55,940, HU-210, and anandamide
bond within the long aliphatic chain in arm 2 forms p-p interac- (Chin et al., 1998; Hurst et al., 2002; Pan et al., 1998; Song and
tions with Phe268ECL2 and Trp3566.48 and forms hydrophobic Bonner, 1996). Previously, it was suggested that Lys1923.28
interactions with several residues, including Leu1933.29
,
has direct interactions with CB1 ligands. However, in our CB1
Val1963.32, Thr1973.33, Leu3596.51, and Met3636.55 (Figure 3C). structure, Lys1923.28 does not interact directly with AM6538.
Interestingly, the binding mode of the long hydrophobic chain Instead, it forms a salt bridge/hydrogen bond network that stabi-
is similar to that of ML056 with the S1P1 receptor (Figure 3B), lizes the conformation of ECL1, the N terminus, and the extracel-
implying that this could be a conserved binding pocket for long lular parts of helices II and III. The side chain of Lys1923.28 points
aliphatic chains in lipid-binding receptors. In regards to the ni- away from the binding pocket and forms salt bridges with
trate group that has not been observed in the crystallographic Asp1762.63 and Asp184ECL1, while Asp184ECL1 further stabilizes
structure, our docking experiments define a domain in which the N terminus by forming a hydrogen bond with the backbone of
the nitrate group is interacting with residues Thr1973.33
,
Phe102N-term (Figure 4C).
Tyr2755.39, and Trp2795.43 through hydrogen bonding and p-p
interactions (Figure S4A).
Structural Comparison of the CB1, LPA1, and S1P1
Finally, arm 3 extends toward a gap constituted by helices I, II, Receptors
VII capped by the N-terminal loop (Figure 3B). It forms interac- CB1, LPA1, and S1P1 receptors all bind lipid-derived endoge-
tions with hydrophobic residues, Met103N-term, Ile105N-term
,
,
nous ligands (anandamide/sn-2-arachidonoylglycerol, sphingo-
sine-1-phosphate, lysophosphatidic acid) (Shimizu, 2009). Early
Ile1191.35
, , , ,
Ser1231.39 Phe1702.57 Phe1742.61 Ala3807.36
Ser3837.39, and Met3847.40 (Figure 3C). Unlike the p-p interac- sequence analysis revealed that CB1 has a moderate sequence
tions formed by the other two arms, the interactions between identity with LPA1 (13% overall, 28% in TM regions) and S1P1
arm 3 and the receptor are non-specific.
(14% overall, 27% in TM regions) (Bramblett et al., 1995; Isberg
Among the interactions between AM6538 and CB1, et al., 2016) (Figure S5). Crystal structures of LPA1 (Chrencik
Phe1702.57 plays an important role by interacting with the pyra- et al., 2015) and S1P1 (Hanson et al., 2012) have been recently
zole ring core, as well as rings in arm 1 and arm 3. Moreover, determined. The main structural difference between the three
Phe1702.57 is pushed by the ligand to move toward helix I, result- lipid receptors occurs in the extracellular portion, with the most
ing in a tilt of the last two turns (residues 170–177) of helix II striking being the unique conformation of the N-terminal loop of
toward helix I, compared to S1P1 and LPA1, the two closest CB1 (Figures 4A and 4B). For all three receptors, the N terminus
homologs (Figures 4A and 4B). This tilted helix II, in turn, pushes has a role in ligand recognition. Comparing the ligand binding
754 Cell 167, 750–762, October 20, 2016

Figure 4. Comparison of CB1, LPA1, and S1P1 Structural Features
(A) Side view of CB1 with structurally divergent regions of LPA1 (PDB: 4Z34) and S1P1 (PDB: 3V2Y) overlaid. LPA1 and S1P1 receptors are shown in gray cartoons.
˚
The CB1 N-terminal loop (red) occupies the polar binding pocket, helix I (red helix) is shifted out 7 A compared with the other two receptors. ECL3 of CB1 shows a
three helical turn extension of helix VII (brown helix).
(B) 90ꢀ rotation of (A) for a top view of CB1 with structurally divergent regions of LPA1 (4Z34) and S1P1 (3V2Y) overlaid. CB1 shows a conserved conformation of
˚
ECL2 (blue) with the other two receptors, helix II is shifted out 2 A (purple helix).
(C–E) The interaction network of position 3.28 of CB1 (K192), LPA1 (R124), and S1P1 (R120). Polar interactions are represented by black dashed lines. (C) CB1 is
shown in gray cartoon, AM6538 is shown in green sticks and the key residues are shown in blue sticks; (D) LPA1 is shown in gray cartoon, ONO-9780307 is shown
in purple-blue sticks and the key residues are shown in cyan sticks; (E) S1P1 is shown in gray cartoon, ML056 is shown in orange sticks and the key residues are
shown in pink sticks.
See also Figure S5.
positions of the three receptors, AM6538 lies more horizontally CB1, allowing access to the re-entrant N-terminal loop, and
than the ligands in LPA1 and S1P1, with arm 1 inserted deeper contribute to the extensive surface area and multiple sub-
into the side pocket (Figure 4A). Consistently, the N-terminal pockets associated with CB1. Finally, the ECL3 region of CB1 dif-
loop in CB1 is positioned deeper into the binding pocket fers from that of its related receptors by a three helical turn exten-
compared to the N-terminal helices of LPA1 and S1P1, which sion of helix VII, which increases the rigidity and presumably
are both positioned as a cap on their respective ligand binding decreases the flexibility of this loop region in CB1 (Figure 4A).
pockets. As a consequence, helix I of CB1 is pushed outward
˚
The arrangement of Lys1923.28 in CB1 is unique when
ꢁ7 A relative to LPA1 and S1P1 by arm 2, opening a wider gap be- compared with its equivalent residue Arg3.28 in LPA1 and S1P1.
tween helices I and VII than what was observed in LPA1 and S1P1 In LPA1 and S1P1, Arg3.28 points into the binding pocket forming
(Figure 4A). Moreover, helix II and ECL1 change their conforma- a strong interaction with the phosphate head group of the ligands
˚
tion in CB1, with helix II shifting 2 A further from the binding pocket (Figures 4D and 4E); it is stabilized by the negatively charged or
compared with LPA1 and S1P1, and ECL1 changing from a short polar residue 3.29 (Gln125 in LPA1 and Glu121 in S1P1). How-
helical region in LPA1 and S1P1 to a loop in CB1 (Figure 4B). These ever, in CB1 the environment near Leu1933.29 and the ligand is
conformational changes effectively enlarge the binding pocket of hydrophobic, thus, it is energetically favorable for the positively
Cell 167, 750–762, October 20, 2016 755

Figure 5. Docking of Different Antagonists in the CB1 Crystal Structure
(A) CB1 binding pocket with rimonabant (blue sticks), otenabant (raspberry sticks), and taranabant (brown sticks) are shown in gray surface representation.
(B) Chemical structures of rimonabant, otenabant, and taranabant. The red/blue/green rectangles highlight previously described ‘‘arms’’ of the molecule termed
arm 1/arm 2/arm 3 (see Figure 3C).
(C) Predicted binding modes of rimonabant (blue sticks), otenabant (raspberry sticks), and taranabant (brown sticks) with CB1. The interacting residues are shown
in yellow sticks, and H178 is shown in green sticks.
See also Figure S4 and Table S2.
charged Lys1923.28 to point away from the binding pocket (Fig- square deviation (RMSD) of 0.55 A. For the three antagonists,
˚
ure 4C). In fact, Lys1923.28 functions as a stabilization anchor their first-ranked docking poses resemble that of AM6538 in
by forming a salt bridge/hydrogen bond network instead of the crystal structure, with three arms that fit into the three
directly interacting with the ligand as Arg3.28 in LPA1 and S1P1. branches of the binding pocket, as described in the AM6538
Another major difference of the endogenous ligands of CB1 binding mode (Figure 5A). As denoted for AM6538, the arms in
(anandamide, 2-AG), LPA1 (LPA) and S1P1 (S1P) is the head the side pocket, long channel, and gap are termed arm 1, arm
group. The heads of LPA1 and S1P1 ligands are negatively 2, and arm 3 (Figure 5B). The scaffolds of arm 1 and arm 2 of
charged phosphate groups, while the heads of CB1 ligands are the three antagonists are very similar to each other, and so are
neutral. In fact, phosphorylation of the head group of CB1 ligands the docking poses. The biggest difference is from arm 3, yet
anandamide and 2-AG would transform them into ligands of they are all quite bulky, which we speculate is the signature for
LPA1 (Chrencik et al., 2015).
CB1 antagonists. Taranabant has the highest affinity with CB1
among the three ligands (Table S2). It does not have a rigid aro-
matic ring at the core, allowing its arm 2 and arm 3 to have more
Binding Modes of Representative Antagonists to CB1
We performed docking of AM6538 and three CB1 antagonists: freedom to form stronger interactions with surrounding residues
rimonabant, otenabant, and taranabant (Figure 5, Table S2), (Figure 5C). Mutagenesis of Phe1702.57Ala or Phe1742.61Ala re-
which represent diverse scaffolds of CB1 antagonists used in sults in dramatically reduced functional affinity for rimonabant
clinical trials. For each compound, the top one ranked pose and AM6538, while neither mutation alters the potency of the
was used for analysis. The docking pose of AM6538 reproduces agonist, CP55,940. More conservative mutations to tryptophan
the crystallographic pose (Figure S4A), with a root mean (Phe1702.57Trp or Phe1742.61Trp) at either site have no
756 Cell 167, 750–762, October 20, 2016

appreciable effect on antagonist binding, further supporting the ure S4J), further supporting the predicted binding pose of
importance of the hydrophobic interactions at this site (Figures CP55,940 (Figure 6G).
S4G and S4H). In addition, we performed 50 ns MD simulations
to visually assess the predicted ligand-receptor interactions, DISCUSSION
starting from the docking poses. The RMSD values of AM6538,
˚
rimonabant, and otenabant are about 1.4 A. For taranabant, the The ligand used in this study, AM6538, was designed with the aim
˚
value is larger (about 3 A), in accordance with its lack of the of stabilizing the ligand-CB1 receptor complex and promoting CB1
core aromatic ring (Figures S4C–S4F). The predicted interactions crystal formation. For this purpose, our approach focused on the
of the ligands are conserved during the short MD simulations. The use of the substituted biarylpyrazole chemotype based on the
central structure of AM6538 in MD simulation is closest to the structure of rimonabant for obtaining highly utilized proprietary
docking pose.
probes. Within this class of compounds, a slight modification of
the chemotype led to AM251, a commonly used CB1 inverse
agonist/antagonist(Lanetal., 1999), andAM281, aCB1 antagonist
Docking Poses of Representative Agonists of CB1
Although the crystal structure we present is in the inactive state, whose radiolabeling produced the first in vivo imaging agent for la-
we are able to investigate how representative agonists likely bind beling CB1 in nonhuman primates and humans (Berding et al.,
to the orthosteric pocket of CB1 by integrating molecular dock- 2004; Gatley et al., 1998). AM6538 acts as a CB1 stabilizing antag-
ing, mutagenesis, and SAR data (Ahn et al., 2009; Aung et al., onist, and the ligand was effective in allowing structural deter-
2000; Bertalovitz et al., 2010). Six CB1 agonists (Table S2)—the mination of CB1. AM6538 reacts as an intact molecule with no
classical cannabinoids, THC and CP55,940; the endogenous ag- crystallographic evidence of covalent binding while at the
onists, anandamide and 2-AG; and indole derivatives, JWH-018 same time not revealing the location of the terminal nitrate group
and WIN 55,212-2—were selected for docking studies. These in the X-ray structure. While radioligand binding studies demon-
agonists mainly interact with ECL2, N-terminal loop, helices III, strate that AM6538 binds tightly to the receptor, the precise
VI, and VII, and they do not interact with helices I and II. Their pre- mode of action for stabilizing the receptor remains to be
dicted binding modes are shown in Figure 6. For THC and determined.
CP55,940, the rings reside between the N-terminal loop and
To date, there remains considerable controversy with re-
ECL2, forming p-p interactions with Phe268ECL2 (Figures 6A gards to CB1 ligands and their diverse medical applications.
and 6B), and the carbon chains extend into the long channel This is likely due in part to the wide availability and illicit nature
and interact with residues from helices III, VI, and VII. of the most famous CB1 pharmaceutical, marijuana. Marijuana
CP55,940 does not interact with helices I and II, which is sup- has been widely used across many cultures to treat multiple
ported by our mutagenesis studies: mutations on Phe170 and conditions, with most of the results relayed via oral tradition,
Phe174 (Phe1702.57Ala/Trp or Phe1742.61Ala/Trp) do not alter anecdote, political position, or with economic interest prevent-
the potency of CP55,940 (Figure S4G). Anandamide and 2-AG ing an objective interpretation of therapeutic efficacy in any
were predicted to adopt a C-shaped conformation and occupy particular disease state (Whiting et al., 2015). The medicinal
a similar space as THC (Figures 6C and 6D). Their hydrophilic marijuana movement continues to gain support, and clinical tri-
heads are sandwiched between the N-terminal loop and ECL2, als with well-defined endpoints will continue to educate the
and their long aliphatic tails extend deeper into the long channel. medical and pharmaceutical communities regarding the relative
JWH-018 and WIN 55,212-2, however, are predicted to bind benefits and drawbacks of targeting this physiological system.
deeper in the pocket than THC (Figures 6E and 6F). Both the The crystal structure of CB1 in complex with AM6538 reveals
indole rings and naphthalene rings form p-p interactions with an expansive and complicated binding pocket network consist-
Phe268ECL2. The N-substituents reach the end of the long chan- ing of multiple sub-pockets and channels to various regions of
nel and interact with helix V. The binding mode of JWH-018 and the receptor. The three-arm ligand structure is common to CB1
WIN 55,212-2 is supported by mutations on helix V (McAllister antagonists and inverse agonists and may be critical for
et al., 2003; Song et al., 1999) and SAR study of N-alkyl chain stabilizing the inherent flexibility of the native receptor in a
length (Aung et al., 2000). Notably, all of the agonists interact non-signaling conformation. Combining the 3D structure of
with Phe268ECL2 and Phe3797.35 in our docking poses, which CB1 and molecular docking of the three representative antago-
is consistent with mutagenesis studies on ECL2 (Ahn et al., nists, which act as inverse agonists, rimonabant, otenabant,
2009) and Phe3797.35 (Figure S4I). Any of the following indivi- and taranabant, the role of each arm is clearly illustrated. Arm
dual mutations—Phe268ECL2Trp, Pro269ECL2Ala, His270ECL2Ala, 1 is crucial for high affinity binding, while arm 2 extends into
Ile271ECL2Ala, or breaking of the disulfide bond Cys257-Cys264 the long channel. An aliphatic or aromatic ring on arm 3 pushes
on ECL2—dramatically decreased the binding of all three on helices I and II, causing them to bend outward, and poten-
different types of agonists, yet had little impact on antagonist tially modulating the pharmacological signaling state of the
binding (Ahn et al., 2009). The prominent role of Phe3797.35 to receptor. Together with structure and modeling data, we spec-
facilitate CP55,940 functional affinity is supported by the loss ulate that a bulky ring on arm 3 is essential for CB1 antagonism.
of CP55,940 potency with the Phe3797.35 Trp mutation and an This observation provides direction for designing more diverse
even greater loss of agonist activity with the Phe3797.35Ala mu- compounds as we have learned that variable chemical groups
tation (Figure S4I). While these mutations dramatically affected are tolerated at the core of arm 3, a long carbon chain can be
CP55,940 agonism, they had no impact on antagonist/inverse added at the para-position of the phenyl ring in arm 2. For
agonist (AM6538 or rimonabant) displacement of agonist (Fig- example, introduction of
a 4-cyanobut-1-ynyl at arm 2
Cell 167, 750–762, October 20, 2016 757

Figure 6. Docking Poses of Different Cannabinoid Receptor Agonists
(A–F) Chemical structures and predicted binding poses of THC (pink sticks) (A), CP55,940 (magenta sticks) (B), Anandamide (cyan sticks) (C), 2-AG (green sticks)
(D), JWH-018 (yellow sticks) (E), and WIN 55,212-2 (blue sticks) (F).
(G) Zoom-in view of predicted CP55,940 binding pose. CP55,940 is shown in magenta sticks, AM6538 is shown in green sticks, and the key residues are shown in
slate sticks.
See also Figure S4 and Table S2.
758 Cell 167, 750–762, October 20, 2016

AUTHOR CONTRIBUTIONS
produces AM6545 (Table S2), a high-affinity CB1 neutral antag-
onist (Tam et al., 2010).
Conceptualization, L.M.B., A.M., R.C.S., Z.-J.L.; Methodology, K.V., A.M.
J.-H.H., R.B.L., E.L.S., B.W., Q.Z.; Validation, G.W.H.; Formal Analysis, T.H.,
M.P., L.Q., G.W.H., Y.W., S.Z., W.S., S.L., R.B.L., E.L.S., N.Z., B.W., Q.Z.,
M.A.H., L.M.B., A.M., Z.-J.L.; Investigation, T.H., K.V., L.Q., G.W.H., W.S.,
S.L., A.K., R.B.L., E.L.S., J.-H.H., N.Z., H.Z., I.K.; Writing – Original Draft,
T.H.; Writing, Reviewing & Editing, T.H., K.V., Y.W., S.Z., W.S., I.K., M.A.H.,
L.M.B., A.M., R.C.S., Z.-J.L.; Visualization, T.H., M.P., M.A.H.; Supervision,
L.M.B., A.M., R.C.S., Z.-J.L.
Understanding the nuances of CB1 binding and activation is
important, as human use has noted differences between the
phytocannabinoid agonist THC and the synthetic cannabinoid
constituents of ‘‘Spice’’ or ‘‘K-2’’ such as JWH-018. In general,
cannabinoid agonists are routinely abused substances; yet,
while overdose of THC/marijuana has not been documented,
there have been cases of severe and even deadly responses
to the ingestion of such synthetic mixtures resulting in federal
restrictions by many countries, including the US. It remains un-
clear as to why THC can have such a high safety margin, while
the synthetic cannabinoid constituents can prove toxic with
varying severities of serious side effects (Hermanns-Clausen
et al., 2013). Going forward, the study of cannabinoids present
in Cannabis sativa will provide clues to its high efficacy and
safety margins and may continue to inspire a rich source of
pharmacologically refined compounds and novel therapeu-
tics; the utility of the crystal structure may provide inspiration
for drug design toward refining efficacy and avoiding adverse
events.
ACKNOWLEDGMENTS
This work was supported by the Ministry of Science and Technology of
China grants 2014CB910400 and 2015CB910104 and The National Nature
Science Foundation of China grant 31330019 to (Z.-J.L.); National Institutes
of Health grants P01DA009158 (A.M. and L.M.B.), R37DA023142 (A.M.), and
R01AI118985 (I.K.); and NSF grants. We thank the Shanghai Municipal Gov-
ernment, ShanghaiTech University, and GPCR Consortium for financial sup-
port. The synchrotron radiation experiments were performed at the BL41XU
of Spring-8 with approval of the Japan Synchrotron Radiation Research Insti-
tute (JASRI) (proposal numbers 2015B1031 and 2016A2731), GM/CA@APS of
Argonne National Lab, which is supported by the U.S. Department of Energy,
Office of Science, Office of Basic Energy Sciences under contract number DE-
AC02-06CH11357, and beamline BL17U1 (Shanghai Synchrotron Radiation
Facility [SSRF]). We thank the Cloning, Cell Expression, and Protein Purifica-
tion Core Facilities of iHuman Institute for their support. We thank A. Walker
for assistance with the manuscript; we also thank F. Xu, V. Cherezov, V. Ka-
tritch, A. Ishchenko, H. Tao, J. Cheng, D. Liu, W. Zhong, and W. Liu for helpful
discussions. The NIDA Drug supply program provided standards used in this
study. A.M. is a founder of MAKScientific, LLC, a research company engaged
in discovering medications for metabolic disorders with an interest in CB1.
R.C.S. is a board member and shareholder with Birdrock Bio, an antibody ther-
apeutic company with an interest in CB1.
STAR+METHODS
Detailed methods are provided in the online version of this paper
and include the following:
d KEY RESOURCES TABLE
d CONTACT FOR REAGENT AND RESOURCE SHARING
d EXPERIMENTAL MODEL AND SUBJECT DETAILS
B Mice
Received: July 15, 2016
d METHOD DETAILS
Revised: September 6, 2016
Accepted: October 3, 2016
Published: October 20, 2016
B Synthesis and Characterization of AM6538
B Rational Design of Thermostabilizing Mutations of CB1
B Protein Engineering for Structure Determination
B Protein Expression in Mammalian Expression System
B Protein Purification
SUPPORTING CITATIONS
B Lipidic Cubic Phase Crystallization of CB1-AM6538
Complex
The following references appear in the Supplemental Information: Ben-Shabat
et al., 1998; Felder et al., 1995; Fong et al., 2007; Griffith et al., 2009; Kuster
et al., 1993; Showalter et al., 1996; Wiley et al., 1998.
B Data Collection and Structure Determination
B Quantum Mechanical Optimization of AM6538
B Docking Simulations of CB1 Ligands
B Molecular Dynamics Simulation of CB1 in Complex
with AM6538 and Representative Antagonists
B Radioligand Binding Assay
REFERENCES
Abagyan, R., and Totrov, M. (1994). Biased probability Monte Carlo conforma-
tional searches and electrostatic calculations for peptides and proteins. J. Mol.
Biol. 235, 983–1002.
B WT and Mutant hCB1-CHO Cell Line Generation for
Functional Studies
Abraham, M.J., Murtola, T., Schulz, R., Pa´ ll, S., Smith, J.C., Hess, B., and Lin-
dahl, E. (2015). GROMACS: High performance molecular simulations through
multi-level parallelism from laptops to supercomputers. SoftwareX 1–2, 19–25.
B Functional Analysis Studies
B Protein Stability Assays
Adams, R., MacKenzie, S., Jr., and Loewe, S. (1948). Tetrahydrocannabinol
homologs with double branched alkyl groups in the 3-position. J. Am.
Chem. Soc. 70, 664–668.
B Affinity Mass Spectrometry Analysis of AM6538
d QUANTIFICATION AND STATISTICAL ANALYSIS
d DATA AND SOFTWARE AVAILABILITY
B Data Resources
Adams, P.D., Afonine, P.V., Bunko´ czi, G., Chen, V.B., Davis, I.W., Echols, N.,
Headd, J.J., Hung, L.W., Kapral, G.J., Grosse-Kunstleve, R.W., et al. (2010).
PHENIX: a comprehensive Python-based system for macromolecular struc-
ture solution. Acta Crystallogr. D Biol. Crystallogr. 66, 213–221.
SUPPLEMENTAL INFORMATION
Ahn, K.H., Bertalovitz, A.C., Mierke, D.F., and Kendall, D.A. (2009). Dual role of
the second extracellular loop of the cannabinoid receptor 1: ligand binding and
receptor localization. Mol. Pharmacol. 76, 833–842.
Supplemental Information includes five figures and two tables and can be
found with this article online at http://dx.doi.org/10.1016/j.cell.2016.10.004.
Cell 167, 750–762, October 20, 2016 759

Alexandrov, A.I., Mileni, M., Chien, E.Y., Hanson, M.A., and Stevens, R.C.
(2008). Microscale fluorescent thermal stability assay for membrane proteins.
Structure 16, 351–359.
D’Antona, A.M., Ahn, K.H., and Kendall, D.A. (2006). Mutations of CB1 T210
produce active and inactive receptor forms: correlations with ligand affinity, re-
ceptor stability, and cellular localization. Biochemistry 45, 5606–5617.
Devane, W.A., Dysarz, F.A., 3rd, Johnson, M.R., Melvin, L.S., and Howlett,
A.C. (1988). Determination and characterization of a cannabinoid receptor in
rat brain. Mol. Pharmacol. 34, 605–613.
Andersson, H., D’Antona, A.M., Kendall, D.A., Von Heijne, G., and Chin, C.N.
(2003). Membrane assembly of the cannabinoid receptor 1: impact of a long
N-terminal tail. Mol. Pharmacol. 64, 570–577.
Devane, W.A., Hanus, L., Breuer, A., Pertwee, R.G., Stevenson, L.A., Griffin,
G., Gibson, D., Mandelbaum, A., Etinger, A., and Mechoulam, R. (1992). Isola-
tion and structure of a brain constituent that binds to the cannabinoid receptor.
Science 258, 1946–1949.
Aung, M.M., Griffin, G., Huffman, J.W., Wu, M., Keel, C., Yang, B., Showalter,
V.M., Abood, M.E., and Martin, B.R. (2000). Influence of the N-1 alkyl chain
length of cannabimimetic indoles upon CB(1) and CB(2) receptor binding.
Drug Alcohol Depend. 60, 133–140.
Emsley, P., Lohkamp, B., Scott, W.G., and Cowtan, K. (2010). Features and
Ballesteros, J.A., and Weinstein, H. (1995). Integrated methods for the
construction of three-dimensional models and computational probing of
structure-function relations in G protein-coupled receptors. In Methods in
Neurosciences, C.S. Stuart, ed. (Academic Press), pp. 366–428.
development of Coot. Acta Crystallogr. D Biol. Crystallogr. 66, 486–501.
Fay, J.F., and Farrens, D.L. (2013). The membrane proximal region of the
cannabinoid receptor CB1 N-terminus can allosterically modulate ligand affin-
ity. Biochemistry 52, 8286–8294.
Ben-Shabat, S., Fride, E., Sheskin, T., Tamiri, T., Rhee, M.H., Vogel, Z.,
Bisogno, T., De Petrocellis, L., Di Marzo, V., and Mechoulam, R. (1998). An
entourage effect: inactive endogenous fatty acid glycerol esters enhance
2-arachidonoyl-glycerol cannabinoid activity. Eur. J. Pharmacol. 353, 23–31.
Fay, J.F., Dunham, T.D., and Farrens, D.L. (2005). Cysteine residues in the hu-
man cannabinoid receptor: only C257 and C264 are required for a functional
receptor, and steric bulk at C386 impairs antagonist SR141716A binding.
Biochemistry 44, 8757–8769.
Berding, G., Mu¨ ller-Vahl, K., Schneider, U., Gielow, P., Fitschen, J., Stuhr-
mann, M., Harke, H., Buchert, R., Donnerstag, F., Hofmann, M., et al. (2004).
[123I]AM281 single-photon emission computed tomography imaging of cen-
tral cannabinoid CB1 receptors before and after Delta9-tetrahydrocannabinol
therapy and whole-body scanning for assessment of radiation dose in tourette
patients. Biol. Psychiatry 55, 904–915.
Felder, E., and Schrott-Fischer, A. (1995). Quantitative evaluation of myelin-
ated nerve fibres and hair cells in cochleae of humans with age-related high-
tone hearing loss. Hear. Res. 91, 19–32.
Felder, C.C., Joyce, K.E., Briley, E.M., Mansouri, J., Mackie, K., Blond, O., Lai,
Y., Ma, A.L., and Mitchell, R.L. (1995). Comparison of the pharmacology and
signal transduction of the human cannabinoid CB1 and CB2 receptors. Mol.
Pharmacol. 48, 443–450.
Bertalovitz, A.C., Ahn, K.H., and Kendall, D.A. (2010). Ligand Binding Sensi-
tivity of the Extracellular Loop Two of the Cannabinoid Receptor 1. Drug
Dev. Res. 71, 404–411.
Feller, S.E., and MacKerell, A.D. (2000). An improved empirical potential en-
ergy function for molecular simulations of phospholipids. J. Phys. Chem. B
104, 7510–7515.
Black, M.D., Stevens, R.J., Rogacki, N., Featherstone, R.E., Senyah, Y., Giar-
dino, O., Borowsky, B., Stemmelin, J., Cohen, C., Pichat, P., et al. (2011).
AVE1625, a cannabinoid CB1 receptor antagonist, as a co-treatment with
antipsychotics for schizophrenia: improvement in cognitive function and
reduction of antipsychotic-side effects in rodents. Psychopharmacology
(Berl.) 215, 149–163.
Ferna´ ndez-Ruiz, J., Romero, J., and Ramos, J.A. (2015). Endocannabinoids
and Neurodegenerative Disorders: Parkinson’s Disease, Huntington’s Chorea,
Alzheimer’s Disease, and Others. Handbook Exp. Pharmacol. 231, 233–259.
Fong, T.M., Guan, X.M., Marsh, D.J., Shen, C.P., Stribling, D.S., Rosko, K.M.,
Lao, J., Yu, H., Feng, Y., Xiao, J.C., et al. (2007). Antiobesity efficacy of a novel
cannabinoid-1 receptor inverse agonist, N-[(1S,2S)-3-(4-chlorophenyl)-2-
(3-cyanophenyl)-1-methylpropyl]-2-methyl-2-[[5-(trifluoromethyl)pyridin-2-yl]
oxy]propanamide (MK-0364), in rodents. J. Pharmacol. Exp. Ther. 321, 1013–
1022.
Bohn, L.M., Zhou, L., and Ho, J.H. (2015). Approaches to Assess Functional
Selectivity in GPCRs: Evaluating G Protein Signaling in an Endogenous Envi-
ronment. Methods Mol. Biol. 1335, 177–189.
Bramblett, R.D., Panu, A.M., Ballesteros, J.A., and Reggio, P.H. (1995).
Construction of a 3D model of the cannabinoid CB1 receptor: determination
of helix ends and helix orientation. Life Sci. 56, 1971–1982.
Friesner, R.A., Banks, J.L., Murphy, R.B., Halgren, T.A., Klicic, J.J., Mainz,
D.T., Repasky, M.P., Knoll, E.H., Shelley, M., Perry, J.K., et al. (2004). Glide:
a new approach for rapid, accurate docking and scoring. 1. Method and
assessment of docking accuracy. J. Med. Chem. 47, 1739–1749.
Caffrey, M., and Cherezov, V. (2009). Crystallizing membrane proteins using
lipidic mesophases. Nat. Protoc. 4, 706–731.
Cherezov, V., Hanson, M.A., Griffith, M.T., Hilgart, M.C., Sanishvili, R., Nagar-
ajan, V., Stepanov, S., Fischetti, R.F., Kuhn, P., and Stevens, R.C. (2009). Ras-
tering strategy for screening and centring of microcrystal samples of human
membrane proteins with a sub-10 microm size X-ray synchrotron beam.
J. R. Soc. Interface 6 (Suppl 5), S587–S597.
Friesner, R.A., Murphy, R.B., Repasky, M.P., Frye, L.L., Greenwood, J.R.,
Halgren, T.A., Sanschagrin, P.C., and Mainz, D.T. (2006). Extra precision glide:
docking and scoring incorporating a model of hydrophobic enclosure for pro-
tein-ligand complexes. J. Med. Chem. 49, 6177–6196.
Chin, C.N., Lucas-Lenard, J., Abadji, V., and Kendall, D.A. (1998). Ligand
binding and modulation of cyclic AMP levels depend on the chemical nature
of residue 192 of the human cannabinoid receptor 1. J. Neurochem. 70,
366–373.
Gaoni, Y., and Mechoulam, R. (1964). Isolation, Structure, and Partial Synthe-
sis of an Active Constituent of Hashish. J. Am. Chem. Soc. 86, 1646–1647.
Gatley, S.J., Lan, R., Volkow, N.D., Pappas, N., King, P., Wong, C.T., Gifford,
A.N., Pyatt, B., Dewey, S.L., and Makriyannis, A. (1998). Imaging the brain
marijuana receptor: development of a radioligand that binds to cannabinoid
CB1 receptors in vivo. J. Neurochem. 70, 417–423.
Chrencik, J.E., Roth, C.B., Terakado, M., Kurata, H., Omi, R., Kihara, Y.,
Warshaviak, D., Nakade, S., Asmar-Rovira, G., Mileni, M., et al. (2015). Crystal
Structure of Antagonist Bound Human Lysophosphatidic Acid Receptor 1. Cell
161, 1633–1643.
Ghosh, R., Todd, A.R., and Wilkinson, S. (1940). 206. Cannabis indica. Part IV.
The synthesis of some tetrahydrodibenzopyran derivatives. J. Am. Chem.
Soc., 1121–1125.
Chun, E., Thompson, A.A., Liu, W., Roth, C.B., Griffith, M.T., Katritch, V.,
Kunken, J., Xu, F., Cherezov, V., Hanson, M.A., and Stevens, R.C. (2012).
Fusion partner toolchest for the stabilization and crystallization of G protein-
coupled receptors. Structure 20, 967–976.
Griffith, D.A., Hadcock, J.R., Black, S.C., Iredale, P.A., Carpino, P.A., DaSilva-
Jardine, P., Day, R., DiBrino, J., Dow, R.L., Landis, M.S., et al. (2009).
Discovery of 1-[9-(4-chlorophenyl)-8-(2-chlorophenyl)-9H-purin-6-yl]-4-ethyl-
Collaborative Computational Project, Number 4 (1994). The CCP4 suite: pro-
grams for protein crystallography. Acta Crystallogr. D Biol. Crystallogr. 50,
760–763.
aminopiperidine-4-carboxylic acid amide hydrochloride (CP-945,598), a
novel, potent, and selective cannabinoid type 1 receptor antagonist. J. Med.
Chem. 52, 234–237.
Cravatt, B.F., and Lichtman, A.H. (2004). The endogenous cannabinoid system
Guo, Y., Abadji, V., Morse, K.L., Fournier, D.J., Li, X., and Makriyannis, A.
(1994). (-)-11-Hydroxy-70-isothiocyanato-10,10-dimethylheptyl-delta 8-THC: a
and its role in nociceptive behavior. J. Neurobiol. 61, 149–160.
760 Cell 167, 750–762, October 20, 2016

novel, high-affinity irreversible probe for the cannabinoid receptor in the brain.
Lv, X., Liu, J., Shi, Q., Tan, Q., Wu, D., Skinner, J.J., Walker, A.L., Zhao, L., Gu,
X., Chen, N., et al. (2016). In vitro expression and analysis of the 826 human G
protein-coupled receptors. Protein Cell 7, 325–337.
J. Med. Chem. 37, 3867–3870.
Halgren, T.A., Murphy, R.B., Friesner, R.A., Beard, H.S., Frye, L.L., Pollard,
W.T., and Banks, J.L. (2004). Glide: a new approach for rapid, accurate dock-
ing and scoring. 2. Enrichment factors in database screening. J. Med. Chem.
47, 1750–1759.
MacKerell, A.D., Bashford, D., Bellott, M., Dunbrack, R.L., Evanseck, J.D.,
Field, M.J., Fischer, S., Gao, J., Guo, H., Ha, S., et al. (1998). All-atom empirical
potential for molecular modeling and dynamics studies of proteins. J. Phys.
Chem. B 102, 3586–3616.
Hanson, M.A., Roth, C.B., Jo, E., Griffith, M.T., Scott, F.L., Reinhart, G., De-
sale, H., Clemons, B., Cahalan, S.M., Schuerer, S.C., et al. (2012). Crystal
structure of a lipid G protein-coupled receptor. Science 335, 851–855.
Mackerell, A.D., Jr., Feig, M., and Brooks, C.L., 3rd. (2004). Extending
the treatment of backbone energetics in protein force fields: limitations of
gas-phase quantum mechanics in reproducing protein conformational distri-
butions in molecular dynamics simulations. J. Comput. Chem. 25, 1400–1415.
Herkenham, M., Lynn, A.B., Little, M.D., Johnson, M.R., Melvin, L.S., de Costa,
B.R., and Rice, K.C. (1990). Cannabinoid receptor localization in brain. Proc.
Natl. Acad. Sci. USA 87, 1932–1936.
Makriyannis, A. (2014). 2012 Division of medicinal chemistry award address.
Trekking the cannabinoid road: a personal perspective. J. Med. Chem. 57,
3891–3911.
Hermanns-Clausen, M., Kneisel, S., Szabo, B., and Auwa¨ rter, V. (2013). Acute
toxicity due to the confirmed consumption of synthetic cannabinoids: clinical
and laboratory findings. Addiction 108, 534–544.
Makriyannis, A., and Rapaka, R.S. (1990). The molecular basis of cannabinoid
activity. Life Sci. 47, 2173–2184.
Howlett, A.C. (1985). Cannabinoid inhibition of adenylate cyclase. Biochem-
istry of the response in neuroblastoma cell membranes. Mol. Pharmacol. 27,
429–436.
Makriyannis, A., and Vemuri, V.K. (April, 2016). Cannabinergic nitrate esters
and related analogs. Patent Application US 2016/0096822 A1.
Mallat, A., Teixeira-Clerc, F., and Lotersztajn, S. (2013). Cannabinoid signaling
Hurst, D.P., Lynch, D.L., Barnett-Norris, J., Hyatt, S.M., Seltzman, H.H.,
Zhong, M., Song, Z.H., Nie, J., Lewis, D., and Reggio, P.H. (2002). N-(piper-
idin-1-yl)-5-(4-chlorophenyl)-1-(2,4-dichlorophenyl)-4-methyl-1H-pyrazole-3-
carboxamide (SR141716A) interaction with LYS 3.28(192) is crucial for its
inverse agonism at the cannabinoid CB1 receptor. Mol. Pharmacol. 62,
1274–1287.
and liver therapeutics. J. Hepatol. 59, 891–896.
Matsuda, L.A., Lolait, S.J., Brownstein, M.J., Young, A.C., and Bonner, T.I.
(1990). Structure of a cannabinoid receptor and functional expression of the
cloned cDNA. Nature 346, 561–564.
Mavromoustakos, T., Yang, D.P., and Makriyannis, A. (1995). Small angle
X-ray diffraction and differential scanning calorimetric studies on O-methyl-
(-)-delta 8-tetrahydrocannabinol and its 50 iodinated derivative in membrane
bilayers. Biochim. Biophys. Acta 1237, 183–188.
Isberg, V., Mordalski, S., Munk, C., Rataj, K., Harpsøe, K., Hauser, A.S.,
Vroling, B., Bojarski, A.J., Vriend, G., and Gloriam, D.E. (2016). GPCRdb: an in-
formation system for G protein-coupled receptors. Nucleic Acids Res. 44 (D1),
D356–D364.
Mazier, W., Saucisse, N., Gatta-Cherifi, B., and Cota, D. (2015). The Endocan-
nabinoid System: Pivotal Orchestrator of Obesity and Metabolic Disease.
Trends Endocrinol. Metab. 26, 524–537.
Janero, D.R., and Makriyannis, A. (2009). Cannabinoid receptor antagonists:
pharmacological opportunities, clinical experience, and translational prog-
nosis. Expert Opin. Emerg. Drugs 14, 43–65.
McAllister, S.D., Rizvi, G., Anavi-Goffer, S., Hurst, D.P., Barnett-Norris, J.,
Lynch, D.L., Reggio, P.H., and Abood, M.E. (2003). An aromatic microdomain
at the cannabinoid CB(1) receptor constitutes an agonist/inverse agonist bind-
ing region. J. Med. Chem. 46, 5139–5152.
Janero, D.R., Yaddanapudi, S., Zvonok, N., Subramanian, K.V., Shukla, V.G.,
Stahl, E., Zhou, L., Hurst, D., Wager-Miller, J., Bohn, L.M., et al. (2015). Molec-
ular-interaction and signaling profiles of AM3677, a novel covalent agonist se-
lective for the cannabinoid 1 receptor. ACS Chem. Neurosci. 6, 1400–1410.
McCoy, A.J., Grosse-Kunstleve, R.W., Adams, P.D., Winn, M.D., Storoni, L.C.,
and Read, R.J. (2007). Phaser crystallographic software. J. Appl. Cryst. 40,
658–674.
Jin, W., Brown, S., Roche, J.P., Hsieh, C., Celver, J.P., Kovoor, A., Chavkin, C.,
and Mackie, K. (1999). Distinct domains of the CB1 cannabinoid receptor
mediate desensitization and internalization. J. Neurosci. 19, 3773–3780.
Mechoulam, R., Ben-Shabat, S., Hanus, L., Ligumsky, M., Kaminski, N.E.,
Schatz, A.R., Gopher, A., Almog, S., Martin, B.R., Compton, D.R., et al.
(1995). Identification of an endogenous 2-monoglyceride, present in canine
gut, that binds to cannabinoid receptors. Biochem. Pharmacol. 50, 83–90.
Kabsch, W. (2010). Xds. Acta Crystallogr. D Biol. Crystallogr. 66, 125–132.
Kandasamy, S.K., and Larson, R.G. (2006). Molecular dynamics simulations of
model trans-membrane peptides in lipid bilayers: a systematic investigation of
hydrophobic mismatch. Biophys. J. 90, 2326–2343.
Mercier, R.W., Pei, Y., Pandarinathan, L., Janero, D.R., Zhang, J., and
Makriyannis, A. (2010). hCB2 ligand-interaction landscape: cysteine residues
critical to biarylpyrazole antagonist binding motif and receptor modulation.
Chem. Biol. 17, 1132–1142.
Katoh, K., and Standley, D.M. (2013). MAFFT multiple sequence alignment
software version 7: improvements in performance and usability. Mol. Biol.
Evol. 30, 772–780.
Munro, S., Thomas, K.L., and Abu-Shaar, M. (1993). Molecular characteriza-
Kuster, J.E., Stevenson, J.I., Ward, S.J., D’Ambra, T.E., and Haycock, D.A.
(1993). Aminoalkylindole binding in rat cerebellum: selective displacement
by natural and synthetic cannabinoids. J. Pharmacol. Exp. Ther. 264, 1352–
1363.
tion of a peripheral receptor for cannabinoids. Nature 365, 61–65.
Pan, X., Ikeda, S.R., and Lewis, D.L. (1998). SR 141716A acts as an inverse
agonist to increase neuronal voltage-dependent Ca2+ currents by reversal
of tonic CB1 cannabinoid receptor activity. Mol. Pharmacol. 54, 1064–1072.
Lan, R., Liu, Q., Fan, P., Lin, S., Fernando, S.R., McCallion, D., Pertwee, R., and
Makriyannis, A. (1999). Structure-activity relationships of pyrazole derivatives
as cannabinoid receptor antagonists. J. Med. Chem. 42, 769–776.
Pattison, F.L.M., and Brown, G.M. (1956). Organic Nitrates As Synthetic
Intermediates: Preparations Of Nitrates And Some Representative Reactions.
Can. J. Chem. 34, 879–884.
Lange, J.H., and Kruse, C.G. (2005). Keynote review: Medicinal chemistry
strategies to CB1 cannabinoid receptor antagonists. Drug Discov. Today 10,
693–702.
Pertwee, R.G. (2002). Cannabinoids and multiple sclerosis. Pharmacol. Ther.
95, 165–174.
Picone, R.P., Khanolkar, A.D., Xu, W., Ayotte, L.A., Thakur, G.A., Hurst, D.P.,
Abood, M.E., Reggio, P.H., Fournier, D.J., and Makriyannis, A. (2005). (-)-70-
Isothiocyanato-11-hydroxy-10,10-dimethylheptylhexahydrocannabinol
(AM841), a high-affinity electrophilic ligand, interacts covalently with a cysteine
in helix six and activates the CB1 cannabinoid receptor. Mol. Pharmacol. 68,
1623–1635.
Lemberger, L. (1980). Potential therapeutic usefulness of marijuana. Annu.
Rev. Pharmacol. Toxicol. 20, 151–172.
Li, H.-L. (1973). An archaeological and historical account of cannabis in China.
Econ. Bot. 28, 437–448.
Li, C., Xu, W., Vadivel, S.K., Fan, P., and Makriyannis, A. (2005). High affinity
electrophilic and photoactivatable covalent endocannabinoid probes for the
CB1 receptor. J. Med. Chem. 48, 6423–6429.
Pryce, G., and Baker, D. (2015). Endocannabinoids in Multiple Sclerosis and
Amyotrophic Lateral Sclerosis. Handbook Exp. Pharmacol. 231, 213–231.
Cell 167, 750–762, October 20, 2016 761

Razdan, R.K. (1986). Structure-activity relationships in cannabinoids. Pharma-
Song, Z.H., and Bonner, T.I. (1996). A lysine residue of the cannabinoid recep-
tor is critical for receptor recognition by several agonists but not WIN55212-2.
Mol. Pharmacol. 49, 891–896.
col. Rev. 38, 75–149.
´
Rinaldi-Carmona, M., Barth, F., Heaulme, M., Shire, D., Calandra, B., Congy,
Song, Z.H., Slowey, C.A., Hurst, D.P., and Reggio, P.H. (1999). The difference
between the CB(1) and CB(2) cannabinoid receptors at position 5.46 is crucial
for the selectivity of WIN55212-2 for CB(2). Mol. Pharmacol. 56, 834–840.
´
C., Martinez, S., Maruani, J., Neliat, G., Caput, D., et al. (1994). SR141716A,
a potent and selective antagonist of the brain cannabinoid receptor. FEBS
Lett. 350, 240–244.
Szymanski, D.W., Papanastasiou, M., Melchior, K., Zvonok, N., Mercier, R.W.,
Janero, D.R., Thakur, G.A., Cha, S., Wu, B., Karger, B., and Makriyannis, A.
(2011). Mass spectrometry-based proteomics of human cannabinoid receptor
2: covalent cysteine 6.47(257)-ligand interaction affording megagonist recep-
tor activation. J. Proteome Res. 10, 4789–4798.
Robert, X., and Gouet, P. (2014). Deciphering key features in protein structures
with the new ENDscript server. Nucleic Acids Res. 42, W320–W324.
Rubino, T., Zamberletti, E., and Parolaro, D. (2015). Endocannabinoids and
Mental Disorders. Handbook Exp. Pharmacol. 231, 261–283.
Schindler, C.W., Redhi, G.H., Vemuri, K., Makriyannis, A., Le Foll, B., Bergman,
J., Goldberg, S.R., and Justinova, Z. (2016). Blockade of Nicotine and Canna-
binoid Reinforcement and Relapse by a Cannabinoid CB1-Receptor Neutral
Antagonist AM4113 and Inverse Agonist Rimonabant in Squirrel Monkeys.
Neuropsychopharmacology 41, 2283–2293.
´
Tam, J., Vemuri, V.K., Liu, J., Batkai, S., Mukhopadhyay, B., Godlewski, G.,
Osei-Hyiaman, D., Ohnuma, S., Ambudkar, S.V., Pickel, J., et al. (2010). Pe-
ripheral CB1 cannabinoid receptor blockade improves cardiometabolic risk
in mouse models of obesity. J. Clin. Invest. 120, 2953–2966.
Tang, W., and Prusov, E.V. (2012). Total synthesis of RNA-polymerase inhibitor
ripostatin B and 15-deoxyripostatin A. Angew. Chem. Int. Ed. Engl. 51, 3401–
3404.
Schro¨ dinger (2015a). Glide, version 6.9 (Schro¨ dinger, LLC).
Schro¨ dinger (2015b). Induced Fit Docking Protocol 2015-4, Glide version 6.4,
Prime version 3.7 (Schro¨ dinger, LLC).
Whiting, P.F., Wolff, R.F., Deshpande, S., Di Nisio, M., Duffy, S., Hernandez,
A.V., Keurentjes, J.C., Lang, S., Misso, K., Ryder, S., et al. (2015). Cannabi-
noids for Medical Use: A Systematic Review and Meta-analysis. JAMA 313,
2456–2473.
Sherman, W., Day, T., Jacobson, M.P., Friesner, R.A., and Farid, R. (2006).
Novel procedure for modeling ligand/receptor induced fit effects. J. Med.
Chem. 49, 534–553.
Wiley, J.L., Compton, D.R., Dai, D., Lainton, J.A., Phillips, M., Huffman, J.W.,
and Martin, B.R. (1998). Structure-activity relationships of indole- and pyrrole-
derived cannabinoids. J. Pharmacol. Exp. Ther. 285, 995–1004.
Shimizu, T. (2009). Lipid mediators in health and disease: enzymes and recep-
tors as therapeutic targets for the regulation of immunity and inflammation.
Annu. Rev. Pharmacol. Toxicol. 49, 123–150.
Wollner, H.J., Matchett, J.R., Levine, J., and Loewe, S. (1942). Isolation of a
Physiologically Active Tetrahydrocannabinol from Cannabis Sativa Resin.
J. Am. Chem. Soc. 64, 26–29.
Showalter, V.M., Compton, D.R., Martin, B.R., and Abood, M.E. (1996). Eval-
uation of binding in a transfected cell line expressing a peripheral cannabinoid
receptor (CB2): identification of cannabinoid receptor subtype selective li-
gands. J. Pharmacol. Exp. Ther. 278, 989–999.
Yeates, R.A., Laufen, H., and Leitold, M. (1985). The reaction between organic
nitrates and sulfhydryl compounds. A possible model system for the activation
of organic nitrates. Mol. Pharmacol. 28, 555–559.
Smart, O.S., Womack, T.O., Flensburg, C., Keller, P., Paciorek, W., Sharff, A.,
Vonrhein, C., and Bricogne, G. (2012). Exploiting structure similarity in refine-
ment: automated NCS and target-structure restraints in BUSTER. Acta Crys-
tallogr. D Biol. Crystallogr. 68, 368–380.
Zoete, V., Cuendet, M.A., Grosdidier, A., and Michielin, O. (2011). Swiss-
Param:
a fast force field generation tool for small organic molecules.
J. Comput. Chem. 32, 2359–2368.
762 Cell 167, 750–762, October 20, 2016

STAR+METHODS
KEY RESOURCES TABLE
REAGENT or RESOURCE
SOURCE
IDENTIFIER
Antibodies
HA Epitope Tag Antibody, Alexa Fluor 488 conjugate (16B12)
Chemicals, Peptides, and Recombinant Proteins
Polyethylenimine (PEI)
Thermo Fisher Scientific Inc.
Cat#A-21287; RRID: AB_2535829
Polysciences
Roche
Cat#23966-2
Cat#5056489001
Cat#I1149
EDTA-free complete protease inhibitor cocktail tablets
Iodoacetamide
Sigma
n-dodecyl-beta-D-maltopyranoside (DDM)
Cholesterol hemisucinate (CHS)
Anatrace
Sigma
Cat#D310
Cat#C6512
Cat#D10251
N-[4-(7-diethylamino-4-methyl-3-coumarinyl)phenyl]
maleimide (CPM)
Invitrogen
TALON IMAC resin
1-Oleoyl-rac-glycerol (monoolein)
Cholesterol
Clontech
Cat#635507
Cat#M7765
Cat#C8667
Cat#0949
Sigma
Sigma
CP55,940
Tocris
SR141716A (Rimonabant)
[3H]-CP 55,940
[3H]-SR141716A
Tocris
Cat#0923
NIDA Drug Supply Program
NOCD-092
NOCD-083
B79706
NIDA Drug Supply Program
Aldrich
4’-Bromopropiophenone
2,4-Dichlorophenylhydrazine hydrochloride
1-Aminopiperidine
But-3-yn-1-ol
Fisher Scientific/Acros
Aldrich
AC166740250
A75900
Aldrich
130850
Hu¨ nig’s base
Aldrich
D125806
Tetrakis(triphenylphosphine)palladium(0)
Copper(I) iodide
TCI Chemicals/Aldrich
Aldrich
T1350/216666
215554
Sodium iodide
Aldrich
383112
Tetrabutylammonium iodide
Silver nitrate
Aldrich
140775
Aldrich
209139
THC
35S]-GTPgS
Sigma
Cat#T-005-1ML
Cat#NEG030H250UC
[
PerkinElmer
Critical Commercial Assays
HTRF HiRange cAMP Assay Kit
PathHunter Detection Kit
CISBIO
DiscoveRx
NEB
Cat# 62AM6PEC
Cat#93-0001
Cat#E0554S
Q5 site directed mutagenesis kit
Deposited Data
CB1_AM6538 complex structure
This paper
PDB: 5TGZ
Experimental Models: Cell Lines
Freestyle 293-F cells
Phoenix-AMPHO
Invitrogen
Cat#R790-07
Cat#ABP-RCV-10001
CCL-61
Allele Biotechnology
ATCC
CHO-K1
CHO-hCB1R PathHunter DiscoveRx
Experimental Models: Organisms/Strains
Mice/ C57BL/6J
DiscoveRx
Cat#93-0959C2
Jackson Labs
000664
Recombinant DNA
Human CB1 gene
GenScript
Clontech
N/A
pMSCVpuro vector
Cat#634401
(Continued on next page)
Cell 167, 750–762.e1–e7, October 20, 2016 e1

Continued
REAGENT or RESOURCE
pcDNA 3.1 (+) vector
3HA-human CB1 receptor cDNA
SOURCE
IDENTIFIER
V79020
Thermo Scientific
Missouri S&T cDNA
Resource Center
Cat#CNR010TN01
Sequence-Based Reagents
Primers for site-direct mutagenesis
This Paper
This Paper
This Paper
This Paper
This Paper
This Paper
This Paper
This Paper
This Paper
This Paper
This Paper
This Paper
N/A
N/A
N/A
N/A
N/A
N/A
N/A
N/A
N/A
N/A
N/A
N/A
F170W_forward:GTGTCATTTGG GTCTACAGC
F170A_forward:GTGTCATTGCT GTCTACAGC
F170_reverse:TCCCCAGGAGGTCTG
F174W_forward:CTACAGCTGG ATTGACTTCCA
F170A_forward:CTACAGCGCC ATTGACTTC
F174_reverse:ACAAAAATGACACTCCCCAG
F379A_forward:GTGGCTGCATTCTGCAGT
F379W_forward:GTGTGGGCATTCTGCAGT
F379_reverse:CGTCTTAATGAGCTTGTTCATC
Primers for cloning WT CB1 to the modified pTT5 vector
pTT5_forward:CTGTATTTTCAGGGCGGCGGCCGCGTCCCT
GCCGACCAGGTGAACATT
pTT5_reverse:GTGGTGATGGTGGTGATGGTGGTGGGAGGG
GAACATGCTGCGGAAAGC
This Paper
N/A
Software and Algorithms
Schro¨ dinger Suite 2015-4
GROMACS 5.1.2
SwissParam
Schro¨ dinger
https://www.schrodinger.com
https://www.gromacs.org
www.swissparam.ch
Abraham et al., 2015
Zoete et al., 2011
Kabsch, 2010
XDS
Xds.mpimf-heidelberg.mpg.de
www.ccp4.ac.uk/html/scala.html
SCALA
Collaborative Computational
Project, Number 4, 1994
Phaser
Phenix
Buster
COOT
McCoy et al., 2007
Adams et al., 2010
Smart et al., 2012
Emsley et al., 2010
https://www.phenix-online.org
https://www.phenix-online.org
https://www.globalphasing.com/buster
www2.mrc-lmb.cam.ac.uk/personal/
pemsley/coot
Prism v.6.0
GraphPad Software Inc.
Schro¨ dinger
N/A
Jaguar 9.0
www.schrodinger.com
www.molsoft.com
ICM
Abagyan and Totrov, 1994
Other
Solid white 384-well assay plates
Low-volume (20 mL) 384-well assay plates
DMEM/F-12 (1:1) cell culture media
Opti-MEM cell culture media
FreeStyle 293 Expression Medium
Phoenix package system
Penicillin/Streptomycin
Puromycin
VWR
Cat#82051-278 (CS)
Cat#784080
VWR
Invitrogen
Cat#11330-057
Cat#11058-021
Cat#12338-026
N/A
Invitrogen
Life Technologies
Stanford University
Invitrogen
Cat#15140-122
Cat#A11138-03
Cat#10687-010
Cat#10131-035
Cat#VS0642
Invitrogen
Hygromycin B
Life Technologies
Life Technologies
Sartorius
Geneticin
100kDa cutoff concentrators
PD Minitrap G-25 column
96-well glass sandwich plates for LCP crystallization
Lipofectamine 2000
GE Healthcare
NOVA
Cat#28-9180-07
Cat#NOA90020
11668027
Thermo Scientific
e2 Cell 167, 750–762.e1–e7, October 20, 2016

CONTACT FOR REAGENT AND RESOURCE SHARING
Further information and requests for reagents may be directed to, and will be fulfilled by the corresponding author Raymond C.
Stevens (stevens@shanghaitech.edu.cn).
EXPERIMENTAL MODEL AND SUBJECT DETAILS
Mice
Experimentally naive mice (C57BL/6J) were purchased from Jackson Labs at 9 weeks of age and were housed in groups of five per
cage in a specific-pathogen free facility, under a 12-h light-dark cycle with food and water ad libitum. At ꢁ16 weeks of age, mice were
euthanized by cervical dislocation prior to cerebellum dissection. A total of four mice were used to generate 4 independent exper-
iments for assessing [35S]GTPgS binding. All experiments were performed with the approval of the Institutional Animal Care and Use
Committee of The Scripps Research Institute, Jupiter, FL and in accordance to NIH guidelines.
METHOD DETAILS
Synthesis and Characterization of AM6538
All reagents and solvents used for chemical synthesis were purchased from Sigma-Aldrich, TCI Chemicals, Fisher Scientific, Acros or
Alfa Aesar. The palladium catalysts were purchased from Sigma-Aldrich or TCI Chemicals. 1H NMR (500 MHz) and 13C spectra (125
MHz) were recorded on a Varian Inova spectrometer. Chemical shifts (d) are reported in parts per million and are referenced to CDCl3
for 7.26 or 77.7. Multiplicities are indicated as br (broadened), s (singlet), d (doublet), t (triplet) or m (multiplet). Coupling constants (J)
are reported in hertz (Hz). Thin layer chromatography (TLC) was performed on Merck-Millipore 210 - 270 mm TLC silica gel plates,
˚
(60 A) and coated with a F254 fluorescent indicator. Flash column chromatography was performed on a Biotage Isolera Spektra sys-
tem with UV collections at 254 and 280 nm using Luknova flash columns preloaded with normal phase silica gel (50 mm). All moisture
sensitive reactions were performed under an atmosphere of high-purity argon while using oven-dried glassware. The intermediates
and final compounds were characterized using a combination of 1H NMR, 13C NMR and LC/MS techniques. The LC/MS analysis was
performed using a Waters MicroMass ZQ system (electrospray ionization mode) equipped with a Waters 2525 binary gradient
module, a Waters 2996 photodiode array detector, a Waters 2424 ELS detector, two Waters 515 HPLC pump, a fluidics organizer
and a pump control module II. Compounds were analyzed with gradient elution using acetonitrile/water as the mobile phase and
an XTerra MS C18 or an XTerra MS C8, 4.6 mm 3 50 mm column (5 mm). Melting-points were recorded on a Fisher Scientific
apparatus. IR spectra were obtained on a PerkinElmer Spectrum One FT-IR spectrometer. Elemental analyses were performed using
a PerkinElmer Series II 2400 CHNS analyzer.
4-(4-(1-(2,4-dichlorophenyl)-4-methyl-3-(piperidin-1-ylcarbamoyl)-1H-pyrazol-5-yl)phenyl)but-3-yn-1-yl
methanesulfonate (2)
To a stirred solution of 1-(2,4-dichlorophenyl)-5-(4-iodophenyl)-4-methyl-N-(piperidin-1-yl)-1H-pyrazole-3-carboxamide (Lan et al.,
1999) (1, 1.1 g, 2 mmol) in DMF (30 ml), under argon was added but-3-yn-1-yl methanesulfonate (Tang and Prusov, 2012) (888 mg,
6 mmol), and Hu¨ nig’s base (1.9 mL 20 mmol). The reaction mixture was degassed by introducing a steady stream of argon into the
solution for 5 min and to this was added tetrakis(triphenylphosphine)palladium (0) (231 mg, 10 mol%) and CuI (76 mg, 20 mol%). The
resulting mixture was stirred for 3 hr at room temperature. The solvent from the reaction mixture was removed in vacuo at 70ꢀC and
the residue was dissolved in dichloromethane (100 ml) and washed with deionized water (2 3 ꢁ50 mL). The organic layer was sepa-
rated, dried over anhydrous MgSO4, filtered and the filtrate was removed in vacuo. The residue obtained was purified by flash column
chromatography on silica gel (n-hexane/AcOEt = 1/1) to provide 2 as a white solid (511 mg, 45%); m.p 176-178ꢀC; 1H NMR (500 MHz,
CDCl3-d) d 7.64 (br. s., 1H, NH), 7.41 (d, J = 1.46 Hz, 1H, ArH), 7.34 (d, J = 8.30 Hz, 2H, ArH), 7.25 - 7.31 (m, 2H, ArH), 7.05 (d, J =
8.30 Hz, 2H, ArH), 4.37 (t, J = 6.84 Hz, 2H, -O-CH2-), 3.07 (s, 3H, -S(O)2-CH3), 2.79 - 2.97 (m, 6H, -CH2-CH2- and -N(CH2CH2)2CH2,
2.37 (s, 3H, HetAr-CH3), 1.75 (m, 4H, -N(CH2CH2)2CH2, 1.43 (br. s., 2H, -N(CH2CH2)2CH2; 13C NMR (125 MHz, CDCl3-d) d 160.2,
144.7, 143.6, 136.2, 136.1, 133.2, 132.0, 130.8, 130.5, 129.7, 128.8, 128.1, 123.5, 118.5, 85.8, 82.5, 67.4, 57.3, 38.0, 25.7, 23.6,
21.0, 9.6; ES m/z 575.1710 (M++H).
1-(2,4-dichlorophenyl)-5-(4-(4-iodobut-1-ynyl)phenyl)-4-methyl-N-(piperidin-1-yl)-1H-pyrazole-3-carboxamide (3).
To a stirred solution of 2 (500 mg, 0.86 mmol) in anhydrous acetone (50 ml), under argon was added sodium iodide (1.3 g,
8.6 mmol) and tetrabutylammonium iodide (64 mg, 0.17 mmol). The resulting reaction mixture was refluxed overnight. The solvent
from the reaction mixture was removed in vacuo and the residue was dissolved in dichloromethane (75 ml) and washed with de-
ionized water (2 3 ꢁ50 mL). The organic layer was separated, dried over anhydrous MgSO4, filtered and the filtrate was removed
in vacuo. The residue obtained was purified by flash column chromatography on silica gel (n-hexane/AcOEt = 7/3) to provide 3 as
a white solid (326 mg, 62%); m.p 171-173ꢀC; 1H NMR (500 MHz, CDCl3-d) d 7.65 (s, 1H, NH), 7.43 (d, J = 1.47 Hz, 1H, ArH), 7.38
(d, J = 7.81 Hz, 2H, ArH), 7.27 - 7.33 (m, 2H, ArH), 7.07 (d, J = 8.30 Hz, 2H, ArH), 3.31 (t, J = 7.32 Hz, 2H, I-CH2), 3.01 (t, J =
7.32 Hz, 2H, -CH2-CH2), 2.88 (m, 4H, -N(CH2CH2)2CH2, 2.39 (s, 3H, HetAr-CH3), 1.68 - 1.87 (m, 4H, -N(CH2CH2)2CH2, 1.45
(m, 2H, -N(CH2CH2)2CH2; 13C NMR (125 MHz, CDCl3-d) d 160.2, 144.7, 143.7, 136.3, 136.1, 133.2, 132.0, 130.8, 130.6, 129.6,
Cell 167, 750–762.e1–e7, October 20, 2016 e3

128.6, 128.1, 123.9, 118.5, 90.3, 81.9, 57.3, 25.7, 24.8, 23.6, 9.6, 1.6; IR (neat) 3308, 2929, 2851, 2787, 2509, 2160, 2031, 1689,
1524, 1486, 1245, 967, 967, 842, 781 cm-1; ES m/z 607.1102 (M++H).
4-(4-(1-(2,4-dichlorophenyl)-4-methyl-3-(piperidin-1-ylcarbamoyl)-1H-pyrazol-5-yl)phenyl)but-3-yn-1-yl nitrate (4,
AM6538).
To a stirred solution of 3 (300 mg, 0.5 mmol) taken in anhydrous acetonitrile (30 ml), under argon was added silver nitrate (100 mg,
0.6 mmol). The resulting reaction mixture was heated to 70ꢀC for 1 hr. The contents were cooled to room temperature and the solids
were filtered over a celite pad. The filtrate was removed in vacuo and the residue was dissolved in dichloromethane (75 ml) and
washed with deionized water (2 3 ꢁ50 mL). The organic layer was separated, dried over anhydrous MgSO4, filtered and the filtrate
was removed in vacuo. The residue obtained was purified by flash column chromatography on silica gel (n-hexane/AcOEt = 6/4) to
provide 4 (AM6538) (Makriyannis and Vemuri, 2016) as a white solid (173 mg, 65%); m.p 178-180ꢀC; 1H NMR (500 MHz, CDCl3-d)
d 7.63 (s, 1H, NH), 7.41 (d, J = 1.95 Hz, 1H, ArH), 7.34 (d, J = 8.30 Hz, 2H, ArH), 7.24 - 7.32 (m, 2H, ArH), 7.05 (d, J = 8.30 Hz, 2H, ArH),
4.62 (t, J = 6.59 Hz, 2H, -O-CH2), 2.81 - 2.91 (m, 6H, -CH2-CH2 and -N(CH2CH2)2CH2), 2.37 (s, 3H, HetAr-CH3), 1.75 (m, 4H, -N(CH2-
CH2)2CH2, 1.43 (m, 2H, -N(CH2CH2)2CH2; 13C NMR (125 MHz, CDCl3-d) d 160.2, 144.7, 143.6, 136.2, 136.1, 133.2, 132.0, 130.8,
130.5, 129.7, 128.8, 128.1, 123.5, 118.5, 85.3, 82.4, 70.4, 57.3, 25.7, 23.6, 18.9, 9.6; IR (neat) 3319, 2935, 2857, 2811, 2502,
2160, 2031, 1976, 1682, 1616, 1528, 1488, 1277, 968, 881, 824, 781 cm-1; ES m/z 542.1627 (M++H); Elemental analysis calculated
for C26H25Cl2N5O4: C% 57.57, H% 4.65, N% 12.91; found: C% 57.34, H% 4.46, N% 12.74.
Rational Design of Thermostabilizing Mutations of CB1
To improve general stability and homogeneity of the detergent-stabilized CB1, mutations were rationally designed. A 3D homology
model of human CB1 was constructed and refined with ICM (Abagyan and Totrov, 1994) using the X-ray structure of sphingosine
1-phosphate receptor 1 (S1P1 receptor, PDB: 3V2W) (Hanson et al., 2012) as a template. Best scoring substitutions were visually
inspected and evaluated from the evolutionary conservation perspective resulting in a list of proposed substitutions. The predicted
substitutions were analyzed for improvement of the receptor monodispersity (as evidenced by SEC traces) and thermal stability (as
evidenced by increase in Tm in the CPM assay(Alexandrov et al., 2008).
Protein Engineering for Structure Determination
The sequence of the human CB1 gene was synthesized by GenScript. The Flavodoxin (PDB: 1I1O, MW 14.9kDa, with Y98W mutation)
fusion protein was fused to the third intracellular loop of the human CB1 gene, using overlapping PCR. The construct has truncations
of the CB1 residues 1-98, 307-331 and 415-472. The resulting CB1-Flavodoxin chimera sequence was subcloned into a modified
mammalian expression pTT5 vector, which contains a haemagglutinin (HA) signal sequence, a FLAG tag and 10 3 His tag, followed
by a tobacco etch virus (TEV) protease cleavage site, before the N terminus of the chimera sequence. The CB1 gene was further modi-
fied by introducing four rationally designed mutations, Thr2103.46Ala (D’Antona et al., 2006), Glu2735.37Lys, Thr2835.47Val and
Arg3406.32Glu, using standard QuickChange PCR.
Protein Expression in Mammalian Expression System
HEK293Fcells(Invitrogen)weregrowninsuspensionstartingfromthedensitiesat0.2-0.33106 inahumidifiedincubatorwith5%CO2 at
37ꢀC with a shake speed of 130rpm. Passage cells when the cell density reaches to 1.6-1.8 3 106 cells/ml, about every 2-3 days. CB1-
Flavodoxinconstructwas transfectedand expressedinHEK293F cells(Invitrogen)(Passagenumberis12-20) using theFreeStyleTM 293
Expression system (Invitrogen). Briefly, HEK293F cells were seeded on day 0 at 6 3 105 cells/ml in freeStyle 293 expression medium
(Invitrogen). On day 2 the transduction was performed at a cell density of 1.0 to 1.2 3 106 cells/ml and the cell viability over 95% using
PEI-DNA complexes. Approximately 48 hr post-transfection, cells were harvested by centrifugation at 400 g for 20 min at 4ꢀC.
Protein Purification
Frozen cell pellets were thawed and lysed by repeated washing and centrifugation in the hypotonic buffer of 10 mM HEPES (pH 7.5),
10 mM MgCl2, 20 mM KCl, and the high osmotic buffer of 10 mM HEPES (pH 7.5), 1.0 M NaCl, 10 mM MgCl2, 20 mM KCl, with EDTA-
free complete protease inhibitor cocktail tablets (Roche). The washed membranes were suspended in hypotonic buffer with 30%
glycerol and flash-frozen with liquid nitrogen and stored at ꢂ80ꢀC until further use. Purified membranes were thawed at room
temperature and incubated with 20 mM AM6538 and inhibitor cocktail at 4ꢀC for 3 hr. The membranes were further incubated with
1.0 mg/ml iodoacetamide (Sigma) for 1 hr. The membranes were solubilized in the buffer containing 50 mM HEPES (pH 7.5),
500 mM NaCl, 1% (w/v) n-dodecyl-beta-D-maltopyranoside (DDM, Anatrace) and 0.2% (w/v) cholesterol hemisucinate (CHS,
Sigma-Aldrich) at 4ꢀC for 2.5-3 hr. The supernatants containing the solubilized CB1 proteins were isolated by high-speed centrifu-
gation, and then incubated with TALON IMAC resin (Clontech) and 20 mM imidazole, at 4ꢀC overnight. The resin was washed
with 15 column volumes of washing buffer I containing 25 mM HEPES (pH 7.5), 500 mM NaCl, 10% (v/v) glycerol, 0.05% (w/v)
DDM, 0.01% (w/v) CHS, 30 mM imidazole and 20 mM AM6538, and 5 column volumes of washing buffer II containing 25 mM HEPES
(pH 7.5), 500 mM NaCl, 10% (v/v) glycerol, 0.05% (w/v) DDM, 0.01% (w/v) CHS, 50 mM imidazole and 20 mM AM6538. The protein
was eluted using 2.5 column volumes of elution buffer containing 25 mM HEPES (pH 7.5), 500 mM NaCl, 10% (v/v) glycerol, 0.02%
(w/v) DDM, 0.004% (w/v) CHS, 250 mM imidazole and 10 mM AM6538. A PD MiniTrap G-25 column (GE Healthcare) was used to
remove imidazole. The protein was treated overnight with TEV protease to cleave the N-terminal FLAG/His tags from the proteins.
e4 Cell 167, 750–762.e1–e7, October 20, 2016

Finally, the purified protein was concentrated to about 50 mg/ml with a 100 kDa cutoff concentrator (Sartorius) and used in crystal-
lization trials. The protein yield and monodispersity were tested by analytical size exclusion chromatography.
Lipidic Cubic Phase Crystallization of CB1-AM6538 Complex
For the initial crystallization setup, purified CB1-Flavodoxin in complex with AM6538 was reconstituted into lipidic cubic phase (LCP)
by mixing with molten lipid (90% (w/v) monoolein and 10% (w/v) cholesterol) at a protein/lipid ratio of 2:3 (v/v) using a mechanical
syringe mixer (Caffrey and Cherezov, 2009). LCP crystallization trials were performed using an NT8-LCP crystallization robot
(Formulatrix). 96-well glass sandwich plates were incubated and imaged at 20ꢀC using an automatic incubator/imager (RockImager
1000, Formulatrix). The crystals grew in the condition of 0.1M HEPES pH 7.0-7.4, 100mM (NH4)2HPO4, 25%–32% PEG400, 2-20 mM
Ethylenediaminetetraacetic acid disodium salt dehydrate (EDTA) and grew to the full size after 2 wk. The crystals were harvested
using micromounts (MiTeGen) and flash-frozen in liquid nitrogen.
Data Collection and Structure Determination
X-ray diffraction data were collected at the Spring-8 beam line 41XU, Hyogo, Japan, using a Pilatus3 6M detector (X-ray wavelength
˚
1.0000 A). A rastering and data-collection strategy was followed as previously described (Cherezov et al., 2009; Hanson et al., 2012).
Data were integrated and scaled using XDS (Kabsch, 2010) and merged using SCALA (Collaborative Computational Project, Number
4, 1994). Initial phase information was obtained by molecular replacement (MR) with Phaser (McCoy et al., 2007) using the receptor
portion of LPA1 (PDB: 4Z34) and Flavodoxin structure (PDB: 1I1O) as search models. Refinement was performed with Phenix (Adams
et al., 2010) and Buster (Smart et al., 2012) followed by manual examination and rebuilding of the refined coordinates in the program
COOT (Emsley et al., 2010) using both j2Foj-jFcj and jFoj-jFcj maps.
Quantum Mechanical Optimization of AM6538
Optimizing the geometry of AM6538 by quantum-mechanical energy minimization was performed using Jaguar 9.0 (Schrodinger,
¨
2015a). Density functional theory (DFT) with B3LYP functional and basis set 6-31G**++ was used. The conformation in the crystal
structure was used as starting point.
Docking Simulations of CB1 Ligands
Prediction of ligand binding to CB1 was done with Schrodinger Suite 2015-4. Processing of the protein structure was performed with
the Protein Preparation Wizard. Converting of ligands from 2D to 3D structures was performed using LigPrep. Molecular docking was
performed by two different methods: for antagonists, rigid protein docking in extra precision was used with Glide 6.9 (Friesner et al.,
¨
2004; Friesner et al., 2006; Halgren et al., 2004; Schrodinger, 2015a); for agonists, Induced Fit Docking (Felder and Schrott-Fischer,
˚
1995; Schrodinger, 2015b; Sherman et al., 2006), allowing optimization of residues within 5.0 A, in extra precision, was used.
¨
Molecular Dynamics Simulation of CB1 in Complex with AM6538 and Representative Antagonists
Molecular dynamics simulation was performed using GROMACS 5.1.2 (Abraham et al., 2015), using force field CHARMM27 (Feller
and MacKerell, 2000; MacKerell et al., 1998; Mackerell et al., 2004). Crystal structures of CB1 with AM6538 or inverse agonists in the
binding pocket (binding mode predicted by molecular docking) was embedded into a pre-equilibrated POPC (1-palmytoil-2-oleoyl-
sn-glycero-3-phosphatidylcholine) lipid bilayer following an online protocol (Kandasamy and Larson, 2006). The topology files of li-
gands and POPC molecules were generated using online server SwissParam (Zoete et al., 2011). The systems were solvated with
water, and chloride ions were added to neutralize the system. Molecular Dynamics simulations were performed in the NPT ensemble,
at temperature of 310K and pressure of 1 atm using semi-isotropic coupling. First, each system was balanced position-restrained MD
for 10 ns (total energy was stable). Then 50 ns MD simulations with no position restraints were performed to each system for three
independent runs, and these trajectories are used for analysis. Ligand RMSD and RMSF values were calculated with non-hydrogen
protein atoms superimposed to the starting structure. The central structure was the structure with the smallest RMSD of all protein
and ligand atoms from all three trajectories, followed by energy minimization.
Radioligand Binding Assay
Stably transfected, hCB1 HEK293F cell lines expressing the WT receptor were used for saturation and competition binding assays
using [3H]-CP55,940 (0.79 nM, specific activity: 88.3 Ci/mmol, Perkin Elmer) with unlabeled CP55,940 (30 mM) used for nonspecific
binding determination. Binding assays were performed at 37ꢀC for 1 hr in the presence of 25 mg protein per well prior to collection
of membranes by rapid filtration, washing and scintillation facilitated detection of tritium retained on the membranes according to
standard procedures (Janero et al., 2015).Saturation binding assays and subsequent nonlinear hyperbolic curve fitting analysis
(Graphpad Prism 6.0) revealed a Bmax of 10.2 2.6 pmol/mg and Kd = 5.6 2.3 nM. Assays were performed in the same manner
for determination of affinity for the crystallization CB1 construct wherein [3H]-CP55,940 (revealed a Bmax of 47.2 13.1 pmol/mg
and Kd = 37.8 13.9 nM). For wash out experiments at the WT CB1, membranes were incubated at 37ꢀC for 1 hr in the presence
of vehicle (buffer with 1% DMSO), 100 nM rimonabant or 50 nM AM6538. The membranes were then resuspended in assay buffer
containing 1% BSA followed by centrifugation 2 times and then washed and collected a third time in assay buffer alone. These mem-
branes were then subject to the saturation binding assay as described above in this section.
Cell 167, 750–762.e1–e7, October 20, 2016 e5

WT and Mutant hCB1-CHO Cell Line Generation for Functional Studies
The 3 3 HA (haemagglutinin)-N terminus tagged hCB1 receptor cDNA was obtained from cDNA.org and subcloned into a murine
stem cell virus for cell line transduction (pMSCV-puro, Clontech). Point mutations were introduced to the N terminus-3xHA-tagged
human CB1 receptor cDNA in MSCV retroviral vector by using Q5ꢀ Site-Directed Mutagenesis kit (New England Biolabs) to create
mutant CB1 plasmids (F170A, F170W, F174A, F174W, F379A and F379W). The primers used to make the mutations are given in the
Key Resources table. The WT and mutant CB1 constructs were then packaged into retrovirus via Phoenix package system, and the
produced retroviruses were applied to CHO-K1 cells for gene transduction. Stable cell lines were generated following selection
with antibiotic (puromycin) selection. Cells were passaged onto 384-well plates for pharmacological characterization. Cells were
maintained in DMEM/F-12 media supplemented with 10% fetal bovine serum, 1% penicillin/streptomycin, and 5 mg/mL puromycin
(Invitrogen, Waltham, MA).
Functional Analysis Studies
CISBIO cAMP HTRF Assay
Inhibition of forskolin-stimulated cAMP was determined using the CISBIO cAMP Homogeneous Time-Resolved Fluorescence reso-
nance energy transfer (FRET) (HTRF) HiRange assay according to the manufacturer’s instructions (Cisbio Assays, Bedford, MA).
Cells (5,000 cells/well in low-volume 384 well plates) were cotreated at room temperature for 30 min with 25 mM RO-20-1724 and
20 mM forskolin (Sigma-Aldrich), and hCB1R ligands at concentrations ranging from 0.03 – 10,000 nM. Cells were then incubated
with cAMP-d2 antibody in assay diluent and cryptate solution in lysis buffer for 60 min at room temperature (Cisbio Assays). Fluo-
rescence was measured at 620/665 nm using a Perkin-Elmer EnVision plate reader (Waltham, MA). FRET was calculated as fluores-
cence at 665 nm/620 nm. Basal cAMP levels were determined from cells incubated in the absence of RO-20-1724, forskolin, and
ligand. cAMP levels were determined in cells incubated with RO-20-1724 and forskolin. Compounds were dissolved in DMSO in
PBS and diluted to final solvent concentrations of 1% at the times and concentrations indicated. Agonist properties in the assays
used for the WT cells used competitive analysis were as follows: EC50 = 7.9 2.0 nM, Emax = 3.21 0.39 (fold over baseline, set
as 100% CP55,940); THC: EC50 = 160.1 26.0 nM; Emax = 1.36 0.05 (fold over baseline, set as 100% THC). NR3 individual exper-
iments performed in duplicate presented as mean SEM.
DiscoveRx bArrestin2 Assay
bArrestin2 recruitment was determined using the CHO-hCB1R PathHunter assay (DiscoveRx) according to the manufacturer’s
instructions following a 1.5 hr incubation at 37ꢀC with the indicated concentrations of ligands. All experiments included a vehicle con-
trol. Agonist properties in the cell lines were as follows: CP55,940: EC50 = 23.8 4.6 nM, Emax = 4.03 0.19 (fold over baseline, set as
100% CP55,940); THC: EC50 = 89.2 38.9 nM; Emax = 2.24 0.16 (fold over baseline, set as 100% THC). NR3 individual experiments
performed in duplicate presented as mean S. E. M.
[
35S]GTPgS Binding to CB1 in C57 Mouse Cerebellum Membranes
G protein-coupling in mouse brain was measured using a previously published protocol (Bohn et al., 2015; Janero et al., 2015). The
cerebellum from C57BL/6 mice (4-7 months old) were homogenized (glass on glass) in homogenization buffer (10 mM Tris-HCl, pH
7.4, 100 mM NaCl, 1 mM EDTA, 1 mM DTT). The homogenate was passed through a 26-gauge needle, centrifuged twice at 20,000 x g
for 30 min at 4ꢀC, and resuspended in ice-cold assay buffer (50 mM Tris-HCl pH 7.4, 100 mM NaCl, 5 mM MgCl2, 1 mM EDTA and
2 mM GDP, 1 mM DTT). For each reaction, 2.5 mg of membrane protein was incubated in assay buffer containing ꢁ0.1 nM [35S]GTPgS
and increasing concentrations of test compound in a total volume of 200 mL for 2 hr at room temperature. Test compounds
(CP55,904, rimonabant, AM6538, and THC) were first diluted through serial dilutions in DMSO, then with assay buffer to a final
DMSO concentration of 1%. Reactions were terminated by filtering membrane-bound and free [35S]GTPgS through GF/B filters using
a 96-well plate harvester (Brandel Inc., Gaithersburg, MD) and rinsing with ice-cold dH2O. Filters were dried overnight, and radioac-
tivity was determined with a microplate scintillation counter. For experiments used to analyze drug competition, agonists and antag-
onists were incubated with the membranes simultaneously. Agonist properties in the mouse cerebellum: CP55,940: EC50 = 63.0
5.5 nM, Emax = 2.40 0.04 (fold over baseline, set as 100% CP55,940); N = 4 individual mouse cerebella preparations performed
in duplicate presented as mean SEM.
Protein Stability Assays
Protein thermostability was tested by a microscale fluorescent thermal stability assay using the thiol-specific fluorochrome N-[4-(7-
diethylamino-4-methyl-3-coumarinyl)phenyl]maleimide (CPM), which reacts with the native cysteines embedded in the protein inte-
rior as a sensor for the overall integrity of the folded state. The CPM dye (Invitrogen) was dissolved in DMSO at 4 mg/ml and stored
at ꢂ80ꢀC. Prior to use the dye stock was diluted 1:20 in buffer 25 mM HEPES, pH 7.5, 150 mM NaCl, 10% glycerol, 0.05% (w/v) DDM
and 0.01% (w/v) CHS. The tested protein (ꢁ5 mg) was diluted in the same buffer to a final volume of 120 ml. 1 ml of the diluted dye was
added and thoroughly mixed with protein. The reaction mixture was incubated at room temperature for 15 min, and subsequently
transferred to a sub-micro quartz fluorimeter cuvette (Starna Cells, Inc.) and heated in a controlled way with a ramp rate of 1ꢀC/min
over a temperature range from 20-90ꢀC in a Cary Eclipse Fluorescence Spectrophotometer (Agilent Technologies). The excitation
wavelength was set at 387 nm, while the emission wavelength was 463 nm. Protein homogeneity was also tested by analytical
size-exclusion chromatography (aSEC) using a 1260 Infinity HPLC system (Agilent Technologies).
e6 Cell 167, 750–762.e1–e7, October 20, 2016

Affinity Mass Spectrometry Analysis of AM6538
The CB1 protein co-purified with AM6538 was first desalted using PD MiniTrap G-25 column cartridge to deplete free ligands. Then
the protein complex sample (ꢁ1 mg) was filtered through 30 kDa MW cutoff ultrafiltration membrane (Sartorius, Germany) by centri-
fugation at 13,000 g for 10 min at 4ꢀC in the buffer containing 150 mM ammonium acetate, 0.02% (w/v) DDM and 0.004% (w/v) CHS.
The protein complexes retained on the ultrafiltration membrane was transferred to a new centrifugal tube. The ligands were disso-
ciated from the complexes with 90% methanol and separated from the denatured protein by centrifugation at 13,000 g for 20 min at
25ꢀC. The supernatant was dried out in speed vacuum, reconstituted in 50% methanol, diluted by 50-fold prior to LC-MS analysis
using Agilent 6230 TOF equipped with an Agilent 1260 HPLC system. The compound was eluted with 95% methanol/0.1% formic
acid from a Hypersil GOLD C18 column (2.1 mm 3 100 mm, 3 mm, Thermo Fisher Scientific, USA) at a flow rate of 0.4 mL/min.
Full-scan mass spectra were acquired in the range of 100-1000 m/z on Agilent 6230 TOF with major ESI source settings: voltage
3000 V, gas temperature 350ꢀC, fragmentor 100 V.
QUANTIFICATION AND STATISTICAL ANALYSIS
Concentration-response curves for cAMP and b-arrestin2 are presented as % of CP55,940 or THC at 1 mM, as indicated. Concen-
tration-response curves were fit to a non-linear regression (three parameter) model to determine EC50 and Emax, or a Gaddum/Schild
EC50 shift global non-linear regression model in Prism (v. 6.0, GraphPad Software Inc., San Diego, CA), as indicated. In order to best
fit data to the Gaddum/Schild EC50 shift global non-linear regression, pEC50, pA2, Hill slope, Emax, and Emin were shared for all data-
sets. Schild slope was constrained to unity after determining a competitive antagonism model (i.e. Schild slope = 1) was the preferred
model for these data.
DATA AND SOFTWARE AVAILABILITY
Data Resources
The accession number for the coordinates and structures factors of CB1_AM6538 reported in this paper is PDB: 5TGZ.
Cell 167, 750–762.e1–e7, October 20, 2016 e7

Supplemental Figures
Figure S1. Rimonabant and AM6538 Are Competitive Antagonists of CP55,940 and THC, Related to Figure 2
(A and B) Rimonabant (left) and AM6538 (right) competitively antagonize CP55,940 (top) and THC (bottom)-induced (A) Inhibition of forskolin-stimulated cAMP
accumulation in hCB1-CHO cells and (B) b-arrestin 2-recruitment in hCB1-CHO DiscoveRx PathHunter cells.
(C) Rimonabant (left) and AM6538 (right) competitively antagonize CP55,940-stimulated [35S]-GTPgS binding in mouse cerebellum membrane preparations. Data
are presented as the mean S. E. M. of 3 or more assays run in duplicate or triplicate. Competitive nonlinear analysis was performed in GraphPad Prism 6.0 and
parameters are included in Table S1. Characterization of agonist effects in the cells and cerebellum are provided in the supplemental methods.

Figure S2. Stability Assay of CB1 Mutants, Related to Figure 1
(A and B) Analytical size exclusion chromatography (aSEC) of CB1 mutants testing the effects of mutations and mutation combination on protein homogeneity. (A)
The raw data show that the CB1 mutant containing all four mutations (orange trace) has the highest protein yield. (B) The normalized data show that the com-
bination (orange trace) improves protein homogeneity.
(C) CPM ramping assay of CB1 mutants testing the effects of mutations and mutation combinations on protein thermostability. The Tm value of the CB1 mutant
containing all four mutations (orange trace) is higher than other mutants, indicating that this mutation combination improves protein thermostability.
(D) Coomassie-stained polyacrylamide gel electrophoresis (PAGE) of the purified crystallization-grade CB1. CB1-1: Coomassie-stained PAGE of sample purified
by cobalt immobilized-metal affinity chromatography (TALON-IMAC); CB1-2: Coomassie-stained PAGE of sample after TEV protease digestion. The black line
indicates where three intervening lanes from the original gel were removed during figure preparation for clarity of presentation. Three additional lanes following
CB1 were omitted as well.

Figure S3. Fusion Protein Engineering and Crystal Packing of CB1-AM6538 Complex, Related to Figures 1 and 3
(A) Overall structure of CB1-AM6538 complex. CB1 and Flavodoxin are colored in orange and slate, respectively. AM6538 is shown in green stick representation
and FMN (the substrate of Flavodoxin) is shown in magenta stick representation.
(B) Crystal packing of the CB1-AM6538 complex, N terminus involved in the crystal packing.
(C) The 2,4-dichorophenyl ring of AM6538 fits well into the shape of the side-pocket. The receptor is shown in gray cartoon and gray surface, AM6538 is shown in
cyan carbons.
(D) Superposition of AM6538 in crystal structure (green) and local minimum calculated by quantum mechanics (magenta).
(E) Crystal images for CB1 in complex with AM6538 (scale bar is 90 mm).
(F) The high-resolution mass spectrometry spectra of the pure standard AM6538 (top) and the ligand dissociated from CB1 complex (bottom). The theoretical m/z
for the monoisotopic peak of AM6538 is 542.1356.

(legend on next page)

Figure S4. MD Simulations of the Predicted Antagonists and Mutagenesis Validation of the Docking Predictions, Related to Figures 5 and 6
(A) Docking pose of AM6538 (magenta sticks) and predicted hydrogen bond (orange dashed lines) and p-p interaction (blue dashed lines) in comparison with
AM6538 in crystal structure (green sticks).
(B) RMSF of AM6538 in MD simulation.
(C–F) AM6538 (C), rimonabant (D), otenabant (E) and taranabant (F) Central structures in MD (protein is shown in light cyan cartoon; ligands are shown in blue
sticks) versus docking poses (protein is shown in white cartoon and ligands are shown in yellow sticks), and ligand RMSD (three independent runs).
(G) Mutations of hCB1 at Phe170Ala or Phe174Ala disrupts the ability of AM6538 and rimonabant to displace CP55,940 while preserving its functional activity. The
corresponding tryptophan mutations have no effect on agonist or antagonist actions.
(H) A loss of antagonist affinity is further demonstrated in competition response curves agonist 100 nM CP55,940.
(I) Mutation of Phe379Trp and Phe379Ala progressively worsen the functional affinity of CP55,940.
(J) When tested against concentrations of CP55,940 that maximally stimulate the receptor, AM6538 and rimonabant maintain their potency as antagonists
(100 nM CP55,940 for WT and Phe379Trp and 10 mM CP55,940 for Phe379Ala; normalization is made per mutant). Data are presented as mean S. E. M. of 3 or
more assays performed in duplicate or triplicate.

Figure S5. Multiple Sequence Alignment of Human CB1 with CB2, LPA1, and S1P1 Receptors, Related to Figure 4
Positions that are identical between the receptors are highlighted with a red background. Alignment was done by MAFFT v7.299b (Katoh and Standley, 2013) and
the graphics were prepared using ESPript 3.0 server (Robert and Gouet, 2014).