Synthesis and binding studies of novel diethynyl-pyridine amides with genomic promoter DNA G-quadruplexes

Article abstract of DOI:10.1002/chem.201003157

Herein, we report the design, synthesis and biophysical evaluation of novel 1,2,3-triazole-linked diethynyl-pyridine amides and trisubstituted diethynyl-pyridine amides as promising G-quadruplex binding ligands. We have used a Cu^I-catalysed azide-alkyne cycloaddition click reaction to prepare the 1,2,3-triazole-linked diethynyl-pyridine amides. The G-quadruplex DNA binding properties of the ligands have been examined by using a Foerster resonance energy transfer (FRET) melting assay and surface plasmon resonance (SPR) experiments. The investigated compounds are conformationally flexible, having free rotation around the triple bond, and exhibit enhanced G-quadruplex binding stabilisation and specificity between intramolecular promoter G-quadruplex DNA motifs compared to the first generation of diarylethynyl amides (J. Am. Chem. Soc. 2008, 130, 15950-15956). The ligands show versatility in molecular recognition and promising G-quadruplex discrimination with 2-50-fold selectivity exhibited between different intramolecular promoter G-quadruplexes. Circular dichroism (CD) spectroscopic analysis suggested that at higher concentration these ligands disrupt the c-kit2 G-quadruplex structure. The studies validate the design concept of the 1,3-diethynyl-pyridine-based scaffold and demonstrate that these ligands exhibit not only significant selectivity over duplex DNA but also variation in G-quadruplex interaction properties based on small chemical changes in the scaffold, leading to unprecedented differential recognition of different DNA G-quadruplex sequences. Click side chains! Click chemistry has been used as a promising tool for side chain functionalisation of a diethynyl-pyridine carboxamide scaffold. The obtained ligands were screened by using structurally diverse genomic promoter G-quadruplex DNA sequences leading to enhanced specificity and differential recognition (see picture for an example).

Full text of DOI:10.1002/chem.201003157

FULL PAPER
DOI: 10.1002/chem.201003157
Synthesis and Binding Studies of Novel Diethynyl-Pyridine Amides with
Genomic Promoter DNA G-Quadruplexes
Jyotirmayee Dash,*[a, b] Zoꢀ A. E. Waller,[a, c] G. Dan Pantos¸,[a, f] and
Shankar Balasubramanian*[a, d, e]
Abstract: Herein, we report the design,
synthesis and biophysical evaluation of
novel 1,2,3-triazole-linked diethynyl-
pyridine amides and trisubstituted di-
ethynyl-pyridine amides as promising
G-quadruplex binding ligands. We have
used a CuI-catalysed azide–alkyne cy-
cloaddition click reaction to prepare
the 1,2,3-triazole-linked diethynyl-pyri-
dine amides. The G-quadruplex DNA
binding properties of the ligands have
been examined by using a Fçrster reso-
nance energy transfer (FRET) melting
assay and surface plasmon resonance
(SPR) experiments. The investigated
compounds are conformationally flexi-
ble, having free rotation around the
triple bond, and exhibit enhanced G-
quadruplex binding stabilisation and
specificity between intramolecular pro-
moter G-quadruplex DNA motifs com-
pared to the first generation of diaryl-
exhibited between different intramo-
lecular promoter G-quadruplexes. Cir-
cular dichroism (CD) spectroscopic
analysis suggested that at higher con-
centration these ligands disrupt the c-
kit2 G-quadruplex structure. The stud-
ies validate the design concept of the
AHCTUNGTRENGNeUN thynyl amides (J. Am. Chem. Soc.
2008, 130, 15950–15956). The ligands
show versatility in molecular recogni-
tion and promising G-quadruplex dis-
crimination with 2–50-fold selectivity
1,3-diethynyl-pyridine-based
scaffold
and demonstrate that these ligands ex-
hibit not only significant selectivity
over duplex DNA but also variation in
G-quadruplex interaction properties
based on small chemical changes in the
scaffold, leading to unprecedented dif-
ferential recognition of different DNA
G-quadruplex sequences.
Keywords: acetylene
· amides ·
click chemistry · G-quadruplexes ·
molecular recognition
Introduction
G-quadruplex DNA structural motifs have been identified
as potential anticancer drug targets.[1] Bioinformatics studies
revealed the prevalence of G-quadruplex-forming sequences
in the human genome, and particularly in promoter re-
gions.[2] It has been proposed that they might play important
roles in regulating oncogenic expression of certain onco-
genes, such as c-myc,[3] c-kit[4] and k-ras.[5]
[a] Dr. J. Dash, Dr. Z. A. E. Waller, Dr. G. D. Pantos¸,
Prof. Dr. S. Balasubramanian
Department of Chemistry, University of Cambridge
Lensfield Road, Cambridge CB2 1EW (UK)
Fax : (+44)1223-336-913
E-mail: sb10031@cam.ac.uk
Most of the first generation G-quadruplex ligands com-
prise a planar, aromatic core presumed to stack on the ter-
minal tetrads of the G-quadruplex.[6,7] Some of these ligands
show good selectivity for G-quadruplex DNA over duplex
DNA.[6,7] All G-quadruplex structures share a common G-
quartet structural feature, but vary in their respective se-
quences and loop length, which provides an opportunity to
achieve specificity in molecular recognition by using the
hyper-variable loops and the groove regions. Recently, the
goal of achieving differential recognition of G-quadruplex
DNA by small molecule ligands has received considerable
interest[8,9] and we have been evaluating classes of ligands
for different G-quadruplex DNA targets.[8,9]
We have recently reported G-quadruplex recognition by
two novel G-quadruplex binding ligands based on bis(phe-
nylenethynyl) amides (1 and 2),[9b] containing N,N-dimethyl-
propylamine side chains. We found that ligand 2, with a cen-
tral pyridine ring, shows higher stabilisation potential and
binding affinities for G-quadruplex DNA compared to the
[b] Dr. J. Dash
Department of Chemical Sciences
Indian Institute of Science Education and
Research-Kolkata, Mohanpur Campus
Mohanpur 7412 52, Nadia, West Bengal (India)
Fax : (+91)33-25873020
E-mail: jyotidash@iiserkol.ac.in
[c] Dr. Z. A. E. Waller
School of Pharmacy, University of East Anglia
Norwich, NR4 7TJ (UK)
[d] Prof. Dr. S. Balasubramanian
Cancer Research UK, Cambridge Research Institute
Li Ka Shing Center, Cambridge, CB2 0RE (UK)
[e] Prof. Dr. S. Balasubramanian
School of Clinical Medicine, University of Cambridge
Cambridge, CB2 0SP (UK)
[f] Dr. G. D. Pantos¸
Department of Chemistry, University of Bath
Bath, BA2 7AY (UK)
Supporting information for this article is available on the WWW
under http://dx.doi.org/10.1002/chem.201003157.
Chem. Eur. J. 2011, 17, 4571 – 4581
ꢀ 2011 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
4571

Results and Discussion
Synthesis: Ligands 3a–c were synthesised by using a se-
quence of two chemoselective reactions, amide coupling of
diacid 8 and CuI-catalysed Huisgen cycloaddition of bis-
amide 9 (Scheme 1).[10] The diacid 8 was prepared by using
Scheme 1. Synthesis of triazole-linked ligands 3a–c. a) [PdCl2ACHTUNGTRENNUNG(PPh3)2],
CuI, Et3N, DMF, RT, 7 h, 83%; b) NaOH (2n), THF/MeOH (1:1), RT,
12 h, 91%; c) propargylamine, N’-(3-dimethylaminopropyl)-N-ethylcarbo-
diimide (EDC), 1-hydroxybenzotriazole (HOBt), N-methylmorpholine
2
ꢀ
(NMM), DMF, RT, 10 h; d) R N3 (10a–c), CuSO4·5H2O, sodium ascor-
bate, tBuOH/H2O (1:1), RT, 12 h, 71–75% from 8.
benzene analogue 1 and thus, offers an attractive template
for ligand design. These compounds are conformationally
flexible, as they possess the ability for free rotation around
the triple bond. In order to achieve enhanced binding ability
and differential recognition of this class of molecules to-
wards diverse G-quadruplex sequences we planned to im-
prove the binding properties of the first generation molecule
2 with the synthesis of substituted ligands of the 1,3-diethyn-
yl pyridine scaffold (e.g., 1,4-triazole-linked amides 3 and
trisubstituted amides 4). The heteroaromatic 1,4-substituted
1,2,3-triazole ring system has attracted extensive interest
owing to its wide use as a synthetic building block endowed
with pharmacological potential.[10] The incorporation of this
triazole unit has also been reported to enhance G-quadru-
plex stabilisation and selectivity.[11] We considered that link-
ing the heteroaromatic 1,4-substituted 1,2,3-triazole ring
into the adaptive core of the 1,3-diethynyl pyridine scaffold
may improve the ability of such molecules to interact specif-
ically with G-quadruplex DNA, making them attractive
probes for the investigation of the biological function of G-
quadruplexes. Furthermore, we have designed trisubstituted
ligands 4 wherein the side chains can target the hypervaria-
ble loops and grooves that distinguish each G-quadruplex,
thereby providing the potential for G-quadruplex discrimi-
nation.
our previously reported procedure, starting from the iodo-
AHCTUNGTRENNUNG
aniline derivative 5 and 2,6-diethynylpyridine (6).[9b] The
diacid 8 was coupled with propargylamine by using EDC,
HOBT and NMM in DMF to give the amide derivative 9,
which was directly used without any further purification.
The azides 10a–c were prepared from the corresponding –
halides (see the Supporting Information). The target ligands
3a–c were synthesised selectively from tetra-alkyne 9 and
the azide building blocks 10a–c by copper(I)-catalysed click
chemistry. Under copper(I)-catalysed azide–alkyne Huisgen
cycloaddition conditions the terminal alkyne units of inter-
mediate 9 selectively reacted with the azides 10. The desired
1,4-substituted 1,2,3-triazole-linked products 3a–c were ob-
tained from 8 with yields of 71–75% (Scheme 1). Each
ligand was purified by preparative HPLC to afford samples
of suitable purity for biophysical evaluation.
Methyl 2,6-diethynylisonicotinate (12) was obtained in
two steps through Pd-catalysed Sonogashira coupling of
methyl 2,6-dichloroisonicotinate (11) with trimethylsilyl-
AHCTUNGTREGaNNNU cetylene and removal of the silyl protecting groups by tet-
rabuylammonium fluoride (TBAF) (Scheme 2).[12] Palladi-
um-catalysed cross-coupling of 12 with iodoaniline deriva-
tive 5 gave the desired triester derivative in 73% yield.
Basic hydrolysis of 13 afforded triacid 14 in near quantita-
tive yield. The triacid 14 was treated with the corresponding
amine derivatives 15a and 15b to give ligands 4a and 4b in
81–84% yield (Scheme 2).
4572
www.chemeurj.org
ꢀ 2011 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Chem. Eur. J. 2011, 17, 4571 – 4581

Synthesis and Binding Studies of Diethynyl-Pyridine Amides
FULL PAPER
Small molecules 3a and 4a were found to be significantly
more selective for G-quadruplexes compared to duplex
DNA. In the bis-triazole ligand series, 3a with primary
amino groups showed improved G-quadruplex DNA stabili-
sation over 3b, which possesses pyrrolidino terminal sub-
stituents. Ligand 3c with N,N-dimethylaminopropyl side
chains exhibited comparable stabilisation temperatures to li-
gands 3a and 3b, indicating that stabilising properties are
not adversely affected by slight modification of chain length.
Overall the bis-triazole amide 3a exhibited good stabilisa-
tion potentials with DTm values at 1 mm ligand concentration
of 17.1, 11.8, 20.0 and 16.5 K for k-ras, c-myc, c-kit1 and c-
kit2 G-quadruplexes, respectively.
The trisubstituted ligand 4a shows higher stabilisation po-
tentials for all the quadruplex DNA sequences tested than
observed for ligands 2 and 3. Ligand 4a with N,N-dimethyl
amino side chains showed relatively higher stabilisation
compared to ligand 4b with N-methylpiperazinyl amino side
chains. It is noteworthy that ligand 4a is the best G-quadru-
plex DNA stabilising ligand in the series, and showed DTm
near to the maximum that can be measured by this method
for c-myc and c-kit2 G-quadruplexes (DTm =17.0 and
21.8 K, respectively, i.e., a Tm of 948C at 1 mm ligand concen-
tration). Ligand 4a also showed stronger stabilisation for k-
ras (DTm =33.0 K) and c-kit1 (DTm =31.3 K) G-quadruplex
DNA at 1 mm concentration. Whereas the parent 1,3-dieth-
ynyl pyridine bis-amide 2 exhibited a relatively low stabilisa-
tion potential with DTm values of 12.2, 7.3, 13.5 and 9.2 K
for k-ras, c-myc, c-kit1 and c-kit2, respectively, the triazole-
linked ligands 3 and the trisubstituted ligands 4 significantly
increase the stabilisation potential and selectivity for a par-
ticular quadruplex target.
Scheme 2. Synthesis of trisubstituted ligands. a) i) Trimethylsilylacetylene,
[Pd2A(dba)3] (dba=dibenzylideneacetone), PPh3, CuI, Et3N, 608C;
2A(PPh3)2], CuI, Et3N, DMF,
CHTUNGTRENNUNG
ii) TBAF, THF, ꢀ308C, 5 min, 91%; b) [PdCl
CHTUNGTRENNUNG
1
ꢀ
RT, 7 h, 73%; c) NaOH (2n), THF/MeOH (1:1), RT, 12 h, 99%; d) R
NH2 (15a,b), EDC, HOBt, NMM, DMF, RT, 10 h, 81–84%.
Small molecule–DNA interactions: Small molecule–quadru-
plex DNA recognition was evaluated by using Fçrster reso-
nance energy transfer (FRET)[13] melting and surface plas-
mon resonance (SPR)[14] experiments. Our studies have fo-
cused on the binding of small molecules to four biologically
relevant distinct G-quadruplexes derived from sequences
found in the promoter of the proto-oncogenes k-ras, c-myc
and c-kit (which has two quadruplex forming sequences: c-
kit1 and c-kit2) and a double stranded (ds) DNA control.
FRET melting analysis: FRET melting analysis[13] has been
used to determine the G-quadruplex stabilisation and selec-
tivity of a ligand series towards a particular G-quadruplex
target.[8,9,13] Because each DNA target exhibits a different
melting temperature (Tm) value, the selectivity between two
different quadruplex targets cannot be directly compared by
using shifts in Tm values (DTm). From FRET melting experi-
ments that use dual-labelled sequences (see the Experimen-
tal Section) we found that ligands 3 and 4 show enhanced
stabilisation potential (i.e., a positive DTm) compared to the
parent ligand 2. The results are summarised in Table 1 and
thermal shift profiles of ligands 3 and 4 are depicted in
Figure 1.
SPR binding analysis and selectivity: Surface plasmon reso-
nance can be employed to measure kinetics and equilibrium
binding constants[14] and has been used to determine the se-
lectivity of small molecule ligands for binding different G-
quadruplex sequences.[8,9] SPR data reveal that these ligands
exhibit a wide range of binding affinities and selectivity for
different G-quadruplex sequences. The correlation between
stabilisation (DTm) and equilibrium binding (Kd) is not
straightforward and thus, there is no simple relationship be-
tween DTm and Kd. The results are reported in Table 2 and
binding curves are depicted in Figure 2 (see the Supporting
Information). Ligand 3a with triazole linkers showed a pref-
erence of at least an order of magnitude for the c-kit1 quad-
Table 1. G-quadruplex stabilisation (DTm) potential determined by
FRET melting analysis.[a]
Ligand
DTm at 1 mm concentration [K]
k-ras
c-myc
c-kit1
c-kit2
ds
Table 2. Dissociation constants (Kd) measured by SPR.
2
12.2
17.1
14.8
16.0
33.0
29.4
7.3
11.8
10.4
10.1
17.0
16.7
13.5
20.0
17.5
18.4
31.3
27.5
9.2
16.5
12.7
14.5
21.8
18.2
0.2
0.7
0.6
0.0
1.0
1.8
Ligand
Kd [mm]
c-kit1
3a
3b
3c
4a
4b
k-ras
c-myc
c-kit2
ds
[a]
[a]
[a]
[a]
[a]
[b]
2
1.2ꢁ0.1
0.74ꢁ0.05
8.9ꢁ3.4
19ꢁ0.5
0.57ꢁ0.02
0.35ꢁ0.02
2.5ꢁ0.1
3.04ꢁ0.08
0.69ꢁ0.03
0.20ꢁ0.06
1.9ꢁ0.1
3a
3b
3c
4a
4b
0.35ꢁ0.03
2.8ꢁ0.6
0.36ꢁ0.02
0.43ꢁ0.02
0.91ꢁ0.03
0.47ꢁ0.04
0.40ꢁ0.03
1.6ꢁ0.3
1.8ꢁ0.7
[a] The Tm values of the quadruplexes in 60 mm potassium cacodylate
buffer, pH 7.4 in the absence of ligands are: k-ras (46ꢁ1), c-myc (77ꢁ1),
c-kit1 (57ꢁ1), c-kit2 (71ꢁ1), ds DNA (58ꢁ1)8C; maximum measurable
Tm =958C.
0.21ꢁ0.1
0.12ꢁ0.03
9.4ꢁ1.6
2.1ꢁ0.9
[a] No significant binding up to 25 mm. [b] Non-specific interaction.
Chem. Eur. J. 2011, 17, 4571 – 4581
ꢀ 2011 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.chemeurj.org
4573

J. Dash, S. Balasubramanian et al.
~
!
&
*
^
Figure 1. FRET stabilisation curves for ligands 3 and 4 ( =k-ras, =c-myc, =c-kit1, =c-kit2, =ds DNA).
ruplex compared to the parent ligand 2. Ligands 3a–c did
not show much discrimination between c-myc and c-kit1 G-
quadruplexes, but the compounds showed strong binding af-
finity for both sequences. In agreement with the FRET
melting experiments, ligand 3a, which contains free amino
side chains, showed not only high stabilisation potentials
(Table 1) but also exhibits correspondingly high binding af-
finities (Table 2) compared to ligands 3b and 3c. Ligand 3a
and 3b each show 3–5-fold selectivity for the c-kit2 over the
k-ras quadruplex. Ligand 3c showed high binding affinity to-
wards the c-myc and c-kit1 quadruplexes with submicromo-
lar equilibrium dissociation constants (Kd) of 360 and
470 nm, respectively, and with a modest Kd (1.8 mm) for c-
kit2 and high Kd (19 mm) for k-ras. It is intriguing to note
that ligand 3c showed a preference for the c-myc and the c-
kit1 G-quadruplex sequences, exhibiting 4–6-fold selectivity
for c-myc and c-kit1 over c-kit2 and a 40–50-fold preference
for c-myc and c-kit1 over the k-ras quadruplex (Table 2,
Figure 2). To the best of our knowledge, this is one of the
highest levels of discrimination reported by a small molecule
ligand between intramolecular promoter quadruplexes.
Ligand 4a showed 5–7-fold improvement in binding affin-
ity compared to the parent molecule 2 for the k-ras, c-kit1
and c-kit2 quadruplexes. Ligand 4a exhibited a preference
for the c-kit2 quadruplex (Kd =120 nm) over the k-ras (Kd =
210 nm), c-myc (Kd =430 nm) and c-kit1 (Kd =400 nm) quad-
ruplexes. Ligand 4a was found to have the strongest binding
affinity for the c-kit2 quadruplex and also exhibits higher
4574
www.chemeurj.org
ꢀ 2011 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Chem. Eur. J. 2011, 17, 4571 – 4581

Synthesis and Binding Studies of Diethynyl-Pyridine Amides
FULL PAPER
~
!
&
*
^
Figure 2. SPR binding curves for ligands 3 and 4 ( =k-ras, =c-myc, =c-kit1, =c-kit2, =ds DNA).
binding affinity compared to ligand 4b. Ligand 4a shows a
discrimination of 2–4-fold among the intramolecular quadru-
plexes examined in the study (Table 2). Ligand 4b showed a
preference for the c-myc quadruplex with a submicromolar
Kd of 910 nm (Table 2). Despite this, the ligand demonstrat-
ed evidence of non-specific interactions with duplex DNA
(Figure 2, 4b, see the Supporting Information), suggestive of
multiple binding sites associated with electrostatic aggrega-
tion. These results are indicative that the addition of the pi-
perazino functionality increases non-specific electrostatic in-
teractions with DNA (see the Supporting Information).
G-quadruplex recognition and binding modes of ligands.[15,16]
We used CD spectroscopy to examine the effects of two
high-affinity ligands, 3a and 4a, on c-kit2 G-quadruplex
DNA in the presence and absence of stabilising salt. The
CD spectrum of c-kit2 suggests that in the absence of any
added salt c-kit2 exists as a mixture of a parallel structure (a
positive peak at 260 nm) and an antiparallel conformation
(a minor peak at 295 nm).[4a] We have reported that small
molecule 2 templates the folding of the c-kit2 quadruplex
into the parallel conformation in the absence of any added
salt.[9b] Similarly, we found that ligand 3a and 4a induce
folding of the c-kit2 quadruplex to a parallel structure (Fig-
ure 3A and B). Upon each addition of ligand 3a or 4a to
the c-kit2 quadruplex there is an increase in ellipticity at
Circular dichroism (CD) spectroscopic studies: CD spectros-
copy has been used to understand fundamental properties of
Chem. Eur. J. 2011, 17, 4571 – 4581
ꢀ 2011 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.chemeurj.org
4575

J. Dash, S. Balasubramanian et al.
Figure 3. CD spectra of titration experiments of ligands 3a (A) and 4a (B) in the absence of added salt and ligands 3a (C) and 4a (E) in the presence of
K+ with c-kit2 G-quadruplex (10 mm); CD plots of molar ellipticity of c-kit2 against the concentration of ligands 3a (E) and 4a (F) in the presence of K+
(the solid line represents the Hill 1 fitting).
260 nm, with the concomitant disappearance of the signal at
295 nm. Thus, ligand 3a and 4a appear to induce the forma-
tion of a single parallel conformation of the c-kit2 quadru-
plex (Figure 3). In the CD spectroscopic analysis with c-kit2
(Figure 3), besides the ligand-dependent increase in elliptici-
ty at 260 nm we also observed the appearance of a relatively
weak signal at 399 nm for ligand 3a and 380 nm for ligand
4a. This is indicative of a change in the chirality of the prox-
imal chemical environment of ligand 3a and 4a.
were less prominent.[9b] We have observed a slight increase
in ellipticity at 260 nm (that of the parallel structure) and an
induced CD band at 380 nm of ligand 2. We performed real-
time titrations of ligands 3a and 4a into pre-annealed solu-
tions of the G-quadruplex in buffer containing 100 mm KCl
and 50 mm Tris·HCl at pH 7.4 (Figure 3C and D). Upon ad-
dition of ligand 3a up to 25 mm (2.5 equiv) to the c-kit2
quadruplex there was no significant changes in ellipticity.
However, upon titration of higher concentration of 3a, the
signal at 260 nm was found to decrease in a dose-dependent
fashion until a point at ꢂ200 mm, beyond which no further
reduction in the molar ellipticity was observed. The de-
crease in the CD signal suggested ligand-induced disruption
In the presence of K+ the c-kit2 quadruplex exists pre-
dominantly as a parallel structure (as indicated by a major
positive peak at 260 nm and a minor peak at 240 nm), and
we have reported that ligand 2 induced CD spectral changes
4576
www.chemeurj.org
ꢀ 2011 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Chem. Eur. J. 2011, 17, 4571 – 4581

Synthesis and Binding Studies of Diethynyl-Pyridine Amides
FULL PAPER
of the stacking between the bases of the G-quadruplex tet-
rads consistent with an apparent unfolding effect. This may
be due to the ability of 3a to recognise multiple binding
sites at the higher concentration employed in the CD
study.[4d] A similar but more pronounced effect was observed
when 4a was titrated into c-kit2. A plot of the molar elliptic-
ity against the concentration of 3a and 4a gave a sigmoidal-
shaped curve indicative of a cooperative effect, where the
binding of 3a and 4a at one site increases the affinity for
ligand binding at another site (Figure 3E and F).
Given that G-quadruplex DNA potentially has more than
one binding site, we considered the possibility that ligands
3a and 4a, at higher concentrations, may bind at multiple
sites and thus, start to remodel the secondary structure. By
fitting the sigmoidal-shaped curves to the Hill 1 equation by
using Origin 8.0 (see the Supporting Information), we ob-
tained Hill coefficients (n) of 2.0 for binding of ligands 3a
and 4a to c-kit2. This reveals that the binding of both li-
gands, 3a and 4a, exhibits positive cooperativity (n>2) for
the c-kit2 quadruplex. Additionally, the concentrations of 3a
and 4a that are required to reach 50% reduction of the
molar ellipticity, [D]50%, for c-kit2 are estimated to be (78ꢁ
5) and (36ꢁ2) mm, respectively. From the [D]50% values, it is
therefore possible to see that the cooperative effect is two-
fold more pronounced for ligand 4a.
Figure 4. UV/Vis titration spectra of c-kit2 into a solution of ligands 3a
(A) and 4a (B) in buffer solution containing KCl (100 mm) and Tris·HCl
(10 mm) at pH 7.4.
UV/Vis binding titrations: We considered the possibility
that 3a and 4a might first self-aggregate at high concentra-
tions, which on binding could facilitate unfolding of the
DNA secondary structure. UV/Vis absorption spectroscopy
was used to investigate the DNA binding behaviour of li-
gands 3a and 4a with the c-kit2 quadruplex. UV/Vis experi-
ments were performed in the presence of 10 mm of c-kit2 in
buffer containing 100 mm KCl and 10 mm Tris·HCl at
pH 7.4. The data obeyed the Beer–Lambert law and showed
a linear correlation, indicating that ligand aggregation does
not occur in the presence of DNA (see the Supporting Infor-
mation). The binding affinities were calculated by sequential
addition of aliquots of c-kit2 quadruplex DNA sample into
ligand solutions, with absorbance spectra recorded after
each addition. Ligand 3a showed a strong absorbance at
260 nm and a peak at 350 nm. The UV/Vis spectra for
ligand 4a showed a strong absorption at 253 nm and a
shoulder at 333 nm. The peaks at 253–260 nm overlap with
the absorption peaks of the DNA and therefore, the binding
affinities for the c-kit2 binding experiments were calculated
by using the shoulders at 350 and 333 nm for ligands 3a and
4a, respectively (Figure 4A and B). UV/Vis absorption titra-
tion experiments show that the intensity of the band at 350
and 333 nm decreased with addition of G-quadruplex DNA.
Interaction of ligands 3a with c-kit2 produced up to 48%
hypochromicity along with a red shift of up to 23 nm (Fig-
ure 4A), whereas there was only 16% hypochromicity along
with a 6 nm shift of the band at 333 nm of ligand 4a (Fig-
ure 4B). Both ligands show strong binding to the c-kit2
quadruplex (Kffi107 mꢀ1) in agreement with the SPR results.
The equilibrium binding constants K for ligands 3a and 4a
calculated by using Equation (1) (see the Experimental Sec-
tion and the Supporting Information) were K=1.21ꢁ107
and 3.31ꢁ107 mꢀ1, respectively.
Molecular modelling: Molecular modelling of ligand 3a
with the c-kit2 quadruplex (PDB entry: 2KQG) was per-
formed by using two binding modes, the end-stacking and
the groove-binding mode (Figure 5A, B and D). The dock-
ing results support that ligand 3a - binds preferentially
through the end-stacking mode (lower binding energy) to
the c-kit2 quadruplex. The diethynyl–pyridine core stacks on
the G-quartet with additional cation–dipole interaction of
the pyridine nitrogen with the ion channel. These models
also indicate that the 1,2,3-triazole heteroaromatic rings are
positioned well for efficient p-stacking interactions with
other bases of the c-kit2 G-quadruplex sequence allowing
effective interaction of the side chains into the G-quadru-
plex grooves (Figure 5A, B and D). Ligand 4a displays a
similar stacking interaction with c-kit2 as shown in Fig-
ure 5C. The shorter side arms of ligand 4a, when compared
with 3a, lead to a less pronounced interaction with the
quadruplex loops, although it covers a larger surface area of
the tetrad. This difference in interaction between the quad-
ruplex and ligands 3a and 4a, respectively, could explain the
smaller hypochromic shift observed in the UV/Vis titrations
of c-kit2 with 4a versus 3a. Besides the end-stacking binding
mode, the ligands might bind to the grooves of G-quadru-
Chem. Eur. J. 2011, 17, 4571 – 4581
ꢀ 2011 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.chemeurj.org
4577

J. Dash, S. Balasubramanian et al.
duplex DNA as observed by
SPR, except ligand 4b which
shows some non-specific bind-
ing to duplex DNA (Figure 2
and the Supporting Informa-
tion). The ligand-induced CD
changes suggest that we cannot
rule out the possibility that the
quadruplex structure is being
dynamically remodelled during
the SPR experiments as has
been observed by others.[17] The
ligand–quadruplex complexes
were investigated by molecular
modelling, providing further in-
formation on structure–activity
relationships.
Conclusion
We have designed and synthes-
ised the 1,3-diethynyl-pyridine-
based ligand series 3 and 4. Li-
gands based on 3 were pre-
pared by using copper(I)-cata-
lysed click chemistry. We have
studied the binding properties
of the ligands with four distinct
Figure 5. Amber99 force-field minimisation of the c-kit2 quadruplex with A) ligand 3a, top view; B) ligand 3a,
side view, C) ligand 4a, top view; and D) ligand 3a binding to grooves of the c-kit2 quadruplex (1:1 stoichio-
ACHTUNGTRENNUNGmetry).
G-quadruplexes found in the
plex DNA. The quadruplex DNA structures have different
groove geometries and different patterns of donor–acceptor
sites, which allows for these flexible ligands to display excel-
lent structure-specific recognition, affinity and specificity.
Overall, ligands comprising triazole rings show better sta-
bilisation and binding potential to G-quadruplexe DNA
compared to ligand 2. The observed selectivity may be due
to the fact that ligands 3 have longer side chains each with
at least one extra protonatable site (N atoms in triazole)
and thus, 3 can interact better with the negatively charged
phosphates of the quadruplexes. The selectivity of ligand 3
may also be due to the energy requirements for unfolding of
the folded structure of triazole rings (see the Supporting In-
formation) and the hydrogen-bonding potential of the side
chains. Within the ligand series 3, ligand 3c with N,N-di-
promoter regions of the proto-oncogenes k-ras, c-myc and c-
kit. These results reveal significant correlations between
structural features and binding aptitudes of these ligands. Li-
gands of the trisubstituted series 4 were found to be strong
stabilisers and tight binders. In general, all ligands in this
study showed excellent selectivity for quadruplexes over
duplex DNA and some diversity in G-quadruplex recogni-
tion with Kd (quadruplex) values varying from 120 nm to
19 mm (2-fold to 50-fold specificity). The biological proper-
ties of these small molecules are currently under investiga-
tion and will be reported in due course.
Experimental Section
ACHTUNGTRENNUNGmethylaminopropyl side chains (increasing chain length by
General: All starting materials were obtained from commercial suppliers
and used as received. Solvents were purified by standard techniques.[18]
Experiments were carried out under an inert atmosphere. 1H NMR and
13C NMR spectra were recorded at 500 and 125 MHz, respectively, by
using a Bruker DRX 500 instrument. 1H NMR spectra were recorded in
deuterated solvents as detailed and at ambient probe temperature
(300 K). Chemical shifts are reported in parts per million (ppm) and are
referenced to the residual solvent peak. The following notations are
used: singlet (s), doublet (d), triplet (t), quartet (q), multiplet (m), broad
(br). Data are reported in the following manner: chemical shift (multi-
plicity, coupling constant if appropriate, integration). Signals are quoted
as d values in ppm and coupling constants (J) are reported in Hertz. Re-
sidual protonated solvent signals were used as internal standard
one carbon atom over 3a and 3b), induces significant dis-
crimination among intramolecular G-quadruplexes (binding
ꢂ50-fold better to c-myc than k-ras and increasing the affin-
ity by ꢂ40-fold for the c-kit1 over the k-ras quadruplex
DNA). The small molecule series 4 with three protonated
side chains incorporating amide groups was found to be a
stronger G-quadruplex stabilising series compared to ligands
2 and 3. This may be due to the electrostatic interactions be-
tween the positively charged molecules 4 and the anionic
DNA target, and the hydrogen-bonding potential of the side
chains. None of these ligands shows detectable binding to
(1H NMR:
dACHTNUGTREUN(GNN CHCl3)=7.26, dACHTNUTREGN(GNUN (CH3)2SO)=2.50, dACHUTNGTRENNUG(CH3OH)=3.31, d-
4578
www.chemeurj.org
ꢀ 2011 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Chem. Eur. J. 2011, 17, 4571 – 4581

Synthesis and Binding Studies of Diethynyl-Pyridine Amides
FULL PAPER
A
E
E
vacuo and the residue was dissolved in water and acidified with formic
acid. The precipitate formed was collected by filtration and washed with
water and diethyl ether to give the crude acid 14 (90.0 mg, 99%) as a
light yellow solid, which was used without further purification. 1H NMR
(500 MHz, [D6]DMSO): d=7.89 (s, 2H), 7.69 (d, J=8.5 Hz, 2H), 6.78 (d,
J=8.5 Hz), 6.53 (s, 2H), 4.91 (s, 4H), 3.33 ppm (s, 4H), the OH group
could not be determined.
dACHTUNGTRENNUNG
or DEPT as well as COSY, NOESY spectra. Mass spectra were recorded
on a Micromass Q-Tof (ESI) spectrometer.
Thin layer chromatography (TLC) was performed on Merck Kieselgel 60
F254 glass plates and visualised under UV light. Flash column chroma-
tography (FC) was performed by using Merck Kieselgel 60 silica gel and
distilled solvents. HPLC was performed by using a Varian Pursuit C18,
5m column (250ꢁ21.2 mm) and a gradient elution with 0.1% TFA/MeCN
Preparation of ligand 4: A mixture of triacid 14 (0.25 mmol), EDC
(1.06 mmol, 4.24 equiv), HOBt (1.06 mmol, 4.24 equiv), NMM
(2.10 mmol, 8.40 equiv), amine 15 (0.78 mmol, 3.12 equiv) in DMF
(5 mL) was stirred at RT overnight. The solvent was removed in vacuo
and the residue was purified by HPLC (gradient: H2O/MeCN (1% TFA)
20:80!MeCN (1% TFA) over 35 min, 12 mLminꢀ1) to give the desired
compounds 4.
Ligand 4a: Yield: 84%; reddish brown oil; 1H NMR (500 MHz, D2O):
d=7.54 (d, J=2.1 Hz, 2H), 7.49 (s, 2H), 7.35 (dd, J=8.6, 2.1 Hz, 2H),
6.58 (d, J=8.6 Hz, 1H), 3.21 (t, J=6.9 Hz, 4H), 3.16 (t, J=6.9 Hz, 2H),
3.05–3.03 (m, 6H), 2.77 (s, 18H), 1.89–1.83 ppm (m, 6H); 13C NMR
(125 MHz, D2O): d=168.9 (s), 165.6 (s), 151.9 (s), 142.5 (s), 141.9 (s),
132.4 (d), 130.1 (d), 123.2 (d), 121.7 (s), 114.5 (d), 104.9 (s), 92.3 (s), 88.1
(s), 55.3 (t), 55.2 (t), 42.68 (q), 42.66 (q), 36.8 (t), 36.4 (t), 24.3 (t),
23.8 ppm (t); HRMS (ESI): m/z calcd for C39H51N9O3: 694.8905 [M+H]+;
found: 694.8916.
Ligand 4b: Yield: 81%; reddish brown oil; 1H NMR (500 MHz,
CD3OD): d=7.75 (s, 2H), 7.51 (d, J=2.1 Hz, 2H), 7.49 (dd, J=8.7,
2.1 Hz, 2H), 6.62 (d, J=8.7 Hz, 2H), 3.33 (t, J=6.8 Hz, 2H), 3.28 (t, J=
6.7 Hz, 4H), 3.20-2.96 (m, 24H), 2.80 (t, J=7.2 Hz, 4H), 2.75–2.72 (m,
2H), 2.69–2.68 (m, 9H), 1.81–1.76 ppm (m, 6H); 13C NMR (125 MHz,
CDCl3): d=169.8 (s), 166.7 (s), 155.1 (s), 145.2 (s), 144.8 (s), 133.8 (d),
131.4 (d), 124.6 (d), 122.4 (s), 114.8 (d), 104.9 (s), 92.2 (s), 89.3 (s), 55.7
(t), 55.6 (t), 53.5 (t), 53.1 (t), 50.9 (t), 50.8 (t), 43.7 (q), 43.6 (q), 38.6 (t),
37.9 (t), 26.5 (t), 26.4 ppm (t); HRMS (ESI): m/z calcd for C48H66N12O3:
859.5459 [M+H]+; found: 859.5450.
and 0.1% TFA/H2O (TFA=trifluoroacetic acid) at
12.0 mLminꢀ1
.
General procedure for synthesis of ligands 3: A mixture of dicarboxylic
acid 8[9b] (397.0 mg, 1.0 mmol), EDC·HCl (814.1 mg, 4.24 mmol), HOBt
(572.8 mg, 4.24 mmol), NMM (849.7 mg, 8.40 mmol) and propargylamine
(275.0 mg, 5.0 mmol, 5 equiv) in DMF (10 mL) was stirred at RT for
10 h. The solvent was removed in vacuo and the residue was dissolved in
water. The precipitate formed was filtered off, washed with water and di-
ethyl ether to give crude product 9 (403.0 mg, 86%) as a dark brown
solid, which was used for click reactions without further purification.
A mixture of crude amide 9 (1 equiv), the aryl azide 10 (5 equiv), sodium
ascorbate (0.2 equiv) and CuSO4·5H2O (10 mol%) in H2O/tBuOH (1:1)
was stirred at RT for 12 h. Removal of the solvent in vacuo and purifica-
tion by HPLC (Solvents: A=Acetonitrile (0.1% TFA), B=H2O (0.1%
TFA) afforded the corresponding products 3a–c.
Ligand 3a: Yield: 87%; red oil; 1H NMR (500 MHz, D2O): d=7.63 (s,
2H), 7.52 (s, 1H), 7.18 (s, 2H), 7.04 (s, 2H), 7.00 (s, 2H), 6.10 (s, 2H),
4.46 (t, J=5.6 Hz, 4H), 3.98 (sbr, 4H), 3.30 ppm (t, J=5.7 Hz, 4H);
13C NMR (125 MHz, D2O): d=167.7 (s), 152.5 (s), 142.4 (d), 136.7 (s),
132.6 (d), 130.6 (d), 126.7 (d), 124.1 (d), 117.3 (s), 115.0 (s), 114.1 (d),
102.5 (s), 94.6 (s), 88.0 (s), 47.1 (t), 38.7 (t), 34.4 ppm (t); HRMS (ESI):
m/z calcd for C33H33N13O2: 644.2958 [M+H]+; found: 644.2944.
Ligand 3b: Yield: 83%; red oil; 1H NMR (500 MHz, D2O): d=7.82 (s,
2H), 7.68 (t, J=8.4 Hz, 1H), 7.39 (s, 2H), 7.24 (d, J=7.4 Hz, 2H), 7.19
(d, J=8.5 Hz, 2H), 6.32 (d, J=8.3 Hz, 2H), 4.71–4.67 (m, 4H, merged
with D2O), 4.21 (s, 4H), 3.67 (t, J=5.9 Hz, 4H), 3.56 (m, 4H), 3.01–2.95
(m, 4H), 2.04–1.96 (m, 4H), 1.88–1.80 ppm (m, 4H); 13C NMR
(125 MHz, D2O): d=167.9 (s), 152.5 (s), 145.4 (s), 137.3 (s), 132.7 (d),
130.4 (d), 126.9 (d), 124.1 (d), 120.9 (s), 114.3 (d), 103.0 (s), 94.1 (s), 88.5
(s), 54.6 (s), 53.5 (s), 46.1 (t), 34.6 (t), 22.5 ppm (t), one aromatic CH
could not be unambiguously determined; HRMS (ESI): m/z calcd for
C41H45N13O2: 752.3897 [M+H]+; found: 752.3926.
Ligand 3c: Yield: 84%; red oil; 1H NMR (500 MHz, D2O): d=7.60 (s,
2H), 7.48 (t, J=7.7 Hz, 1H), 7.19 (s, 2H), 7.03 (d, J=7.4 Hz, 2H), 6.99
(d, J=8.5 Hz, 2H), 6.10 (d, J=8.5 Hz, 2H), 4.22 (t, J=6.7 Hz, 4H), 4.01
(s, 4H), 2.91–2.89 (m, 4H), 2.61 (s, 12H), 2.10–2.08 ppm (m, 4H);
13C NMR (125 MHz, D2O): d=167.6 (s), 152.4 (s), 144.7 (s), 141.7 (d),
137.4 (s), 132.5 (d), 130.4 (d), 126.5 (d), 123.7 (d), 120.4 (d), 113.9 (d),
102.9 (s), 93.5 (s), 88.6 (s), 54.3 (t), 46.9 (t), 42.5 (q), 24.5 ppm (t), one ar-
omatic carbon could not be unambiguously determined; HRMS (ESI):
m/z calcd for C39H45N13O2: 728.3897 [M+H]+; found: 728.3920.
FRET melting experiments: All DNA sequences tested were initially dis-
solved as a 100 mm stock solution in MilliQ (MQ) water. Further dilutions
were carried out in 60 mm potassium cacodylate buffer, pH 7.4. Five dual
fluorescently labelled DNA oligonucleotides were used in these experi-
ments: k-ras was a dual-labelled 32-mer oligonucleotide comprising a
quadruplex forming region in the promoter region of the human k-ras
gene, 5’-FAM-AGG GCGGTG TGG GAA GAG GGA AGA GGG
GGA GG-TAMRA; c-myc was a dual-labelled 22-mer oligonucleotide
comprising one of the quadruplex forming regions in the promoter
region of the human c-myc oncogene, 5’-FAM-TGA GGG TGG GTA
GGG TGG GTA A-TAMRA-3’; c-kit1 was a dual-labelled 21-mer oligo-
nucleotide comprising one of the quadruplex forming regions in the pro-
moter region of the human c-kit oncogene, 5’-FAM-GGG AGG GCG
CTG GGA GGA GGG-TAMRA-3’; c-kit2 was a dual-labelled 20-mer
oligonucleotide comprising one of the quadruplex forming regions in the
promoter region of the human c-kit oncogene, 5’-FAM-GGG CGG GCG
CGA GGG AGG GG-TAMRA-3’; ds-DNA was a dual-labelled 20-mer
oligonucleotide comprising a self-complementary sequence with a central
polyethylene glycol linker able to fold into a hairpin, 5’-FAM-TAT AGC
TAT A HEG TAT AGC TAT A-TAMRA-3’. The donor fluorophore was
6-carboxyfluorescein (FAM), and the acceptor fluorophore was 6-carbox-
ytetramethylrhodamine, (TAMRA). Dual-labelled DNA was annealed at
a concentration of 400 nm by heating at 948C for 5 min followed by cool-
ing to room temperature. One mm stock solution of ligands 3 and 4 were
made up in MQ water. The 96-well plates (MJ Research, Waltham, MA)
were prepared by aliquoting 50 mL of the annealed DNA into each well,
followed by 50 mL of the compound solutions by using a Beckman Coult-
er liquid handling robot. Measurements were made in triplicate with an
excitation wavelength of 483 nm and a detection wavelength of 533 nm
by using a LightCycler 480 System RT-PCR machine (Roche). Final anal-
ysis of the data was carried out by using Origin Pro 7.5 data analysis and
graphing software (OriginLab).
Triester derivative 13: A mixture of iodoaniline derivative 5 (544.0 mg,
2 mmol), diethynyl compound 12 (185.1 mg, 1 mmol), [PdCl2ACTHNUTRGEN(UNG PPh3)2]
(70.2 mg, 10 mol%), and CuI (38 mg, 20 mol%) was evacuated and filled
with argon. To the mixture DMF (10 mL) and triethylamine (2 mL) were
added. After stirring at RT under an argon atmosphere for 9 h, the mix-
ture was dried in vacuo. The residue was purified by chromatography on
silica gel (EtOAc/hexane (1:1)!EtOAc) to afford 13 (353.0 mg,73%) as
a light yellow solid. 1H NMR (500 MHz, CDCl3): d=8.14 (d, J=2.0 Hz,
2H), 7.98 (s, 2H), 7.84 (d, J=2.0 Hz, 2H), 6.70 (d, J=8.6 Hz, 2H), 4.90
(s, 4H), 4.00 (s, 3H), 3.87 ppm (s, 6H); 13C NMR (125 MHz, CDCl3): d=
166.3 (s), 164.4 (s), 152.3 (s), 144.4 (s), 138.5 (s), 135.2 (d), 132.5 (d),
125.2 (d), 119.4 (s), 113.5 (d), 105.1 (s), 93.3 (s), 86.9 (s), 53.1 (q),
51.8 ppm (q); HRMS (ESI): m/z calcd for C27H21N3O6: 484.4721 [M+H]+;
found: 484.4742.
Triacid 14: To a solution of the methyl ester derivative 13 (100.0 mg) in
methanol and THF (1:1, 10 mL) NaOH (5 mL, 2n solution in water) was
added at 08C. After stirring for 12 h at RT, the solvents were removed in
Surface plasmon resonance: Surface plasmon resonance measurements
were performed on
a four-channel BIAcore 3000 optical biosensor
system (Biacore Inc.) by using a streptavidin-coated sensor chip (Biacore
Chem. Eur. J. 2011, 17, 4571 – 4581
ꢀ 2011 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.chemeurj.org
4579

J. Dash, S. Balasubramanian et al.
SA-chip). We have used biotinylated G-quadruplex forming sequences;
k-ras: d(biotin-[AGG GCG GGT GTG GGA AAG AGG GAA AGA
GGG GGA GG], c-myc d(biotin-[TGA GGG TGG GTA GGG TGG
GTA A]), c-kit1 d(biotin-[AGG GAG GGC GCT GGG AGG AGG
G]), c-kit2 d(biotin-[CCC GGG CGG GCG CGA GGG AGG GGA
GG]). We have also used a duplex DNA d(biotin-[GGG CAT AGT
Acknowledgements
ACHTUNGTRENNUNG
AHCTUNGTRENNUNG
We thank the BBSRC for project funding and also for a studentship
(Z.A.E.W.), Cancer Research UK for program funding (S.B.) and Euro-
pean Commission (Marie Curie Incoming Postdoctoral Fellowship to
J.D.) for funding. J.D. thanks CSIR India and G.D.P. thanks Pembroke
College, Cambridge for funding. We thank Rabindra Nath Das for his
help with the UV and CD titration experiments, Dr. Pravin Shirude is
thanked for useful discussions relating to the FRET experiments and Dr.
Chris Lowe for critical reading of the manuscript.
ACHTUNGTRENNUNG
ACHTUNGTRENNUNG
AHCTUNGTRENNUNG
GCG TGG CGT TTA GC]) hybridised with its complementary se-
quence. The DNA oligonucleotides were folded in filtered and degassed
running buffer (Tris·HCl 50 mm pH 7.4, 100 mm KCl; 958C for 5 min then
cooled to room temperature overnight) and immobilised (ꢂ500 RU
except k-ras which was 2.5 times higher) in flow cells 2, 3 and 4, leaving
the first flow cell empty as a blank. DNA binding experiments were car-
ried out with running buffer at a flow rate of 20 mLminꢀ1. Solutions of li-
gands 3 and 4 were freshly prepared with running buffer by serial dilu-
tions from stock solutions. These solutions were injected by using the
KINJECT command (Biacore 3000 Control Software version 3.0.1) for
2 min followed by a 30 s 1m KCl injection and a 30 s running buffer injec-
tion for chip regeneration. Each sample injection was repeated in dupli-
cate. The response at equilibrium (Req) was plotted against the concentra-
tion of the analyte to generate a hyperbolic binding curve. The final
graphs were obtained by subtracting blank sensorgrams from the duplex
or quadruplex sensorgrams. Dissociation constants were determined by
fitting the binding curve by using the steady state affinity algorithm
(Biaevaluation 3.0.2).
[1] a) A. M. Burger, F. Dai, C. M. Schultes, A. P. Reszka, M. J. B.
Moore, J. A. Double, S. Neidle, Cancer Res. 2005, 65, 1489–1496;
b) E. Mandine, J.-F. Riou, J.-L. Mergny, P. Mailliet, F. Boussin, On-
cogene 2005, 24, 2917–2928; c) D. J. Patel, A. T. Phan, V. Kuryavyi,
Nucleic Acids Res. 2007, 35, 7429–7455; d) Y. Qin, L. H. Hurley,
Biochimie 2008, 90, 1149–1171; e) S. Neidle, G. N. Parkinson, Bio-
chimie 2008, 90, 1184–1196; f) J.-H. Tan, L.-Q. Gu, J.-Y. Wu, Mini-
Rev. Med. Chem. 2008, 8, 1163–1178; g) S. Balasubramanian, S.
Neidle, Curr. Opin. Chem. Biol. 2009, 13, 345–353.
[2] a) A. K. Todd, M. Johnston, S. Neidle, Nucleic Acids Res. 2005, 33,
2901–2907; b) J. L. Huppert and S. Balasubramanian, Nucleic Acids
Res. 2005, 33, 2908–2916; c) J. L. Huppert, S. Balasubramanian, Nu-
cleic Acids Res. 2006, 35, 406–413.
[3] a) T. Simonsson, P. Pecinka, M. Kubista, Nucleic Acids Res. 1998, 26,
1167–1172; b) A. Siddiqui-Jain, C. L. Grand, D. J. Bearss, L. H.
Hurley, Proc. Natl. Acad. Sci. USA 2002, 99, 11593–11598; c) A. T.
Phan, V. Kuryavyi, H. Y. Gaw, D. J. Patel, Nat. Chem. Biol. 2005, 1,
167–173; d) N. Kumar, R. Basundra, S. Maiti, Nucleic Acids Res.
2009, 37, 103321–103331; e) R. K. Thakur, P. Kumar, K. Halder, A.
Verma, A. Kar, J. L. Parent, R. Basundra, A. Kumar, S. Chowdhury,
Nucleic Acids Res. 2009, 37, 172–183.
[4] a) H. Fernando, A. P. Reszka, J. Huppert, S. Ladame, S. Rankin,
A. R. Venkitaraman, S. Neidle, S. Balasubramanian, Biochemistry
2006, 45, 7854–7860; b) S. Rankin, A. P. Reszka, J. Huppert, M.
Zloh, G. N. Parkinson, A. K. Todd, S. Ladame, S. Balasubramanian,
S. Neidle, J. Am. Chem. Soc. 2005, 127, 10584–10589; c) M. Beju-
gam, S. Sewitz, P. S. Shirude, R. Rodriguez, R. Shahid, S. Balasubra-
manian, J. Am. Chem. Soc. 2007, 129, 12926–12927; d) Z. A. E.
Waller, S. A. Sewitz, S. T. Hsu, S Balasubramanian, J. Am. Chem.
Soc. 2009, 131, 12628–12633.
UV spectroscopy: Absorption spectra were recorded on a Hitachi U-
4100 UV/VIS-NIR spectrophotometer (for ligand 3a) and a Cary 400
Bio UV/Vis spectrophotometer (for ligand 4a) in the 200–450 nm range
at 208C in 0.5 cm (ligand 4a) and 1 cm (ligand 3a) path length quartz
cuvette. Aliquots of
a concentrated solution of c-kit2 quadruplex
([GGGCGGGCGCGAGGGAGGGG] preannealed by heating at 958C
for 5 min and then cooling to room temperature at 0.18C per minute in a
buffer containing Tris·HCl (50 mm, pH 7.4) and KCl (100 mm) were
added to ligands 3a (30 mm) and 4a (20 mm) and scanned immediately.
Binding constants, K, were determined from a reciprocal plot of D/Deap
versus D, by using Equation (1).[19]
D=Deap ¼ D=Deþ1=ðDe  KÞ
ð1Þ
where Deap =jeaꢀef j, De=jebꢀef j, and ea, ef, and eb are the apparent, free
and bound ligand extinctions, respectively. D is the DNA concentration.
Binding constant K is then obtained by the ratio of the slope (=1/De)
and the y intercept (=1/DeK) from the linear fit of the reciprocal plot of
D/Deap versus D. The percent hypochromicity was calculated by using the
percent hypochromicity=De/ef ꢁ 100.
[5] a) S. Cogoi, L. E. Xodo, Nucleic Acids Res. 2006, 34, 2536–2549;
b) S. Cogoi, M. Paramasivam, B. Spolaore, L. E. Xodo, Nucleic
Acids Res. 2008, 36, 3765–3780.
[6] For reviews, see: a) J. Cuesta, M. A. Read, S. Neidle, Mini-Rev.
Med. Chem. 2003, 3, 11–21; b) D. Monchaud, M.-P. Teulade-Fichou,
Org. Biomol. Chem. 2008, 6, 627–636.
Circular dichroism (CD): CD spectra were recorded on a JASCO J-815
spectrophotometer by using a 1 mm path length quartz cuvette. Quadru-
plex c-kit2 ([GGGCGGGCGCGAGGGAGGGG]) was annealed by
heating at 958C for 5 min and then cooling to room temperature at 0.18C
per minute in a buffer containing Tris·HCl (50 mm, pH 7.4) and KCl
(100 mm). Aliquots of ligand 3a and 4a (1 mm in water) were added in
steps to achieve the desired equivalent proportions. The CD spectra rep-
resent an average of three scans and were smoothed and zero corrected.
Final analysis and manipulation of the data was carried out by using
Origin 8.0.
[7] For specific recent examples, see; a) E. M. Rezler, J. Seenisamy, S.
Bashyam, M.-Y. Kim, E. White, W. D. Wilson, L. H. Hurley, J. Am.
Chem. Soc. 2005, 127, 9439–9447; b) A. De Cian, E. DeLemos, J.-L.
Mergny, M.-P. Teulade-Fichou, D. Monchaud, J. Am. Chem. Soc.
2007, 129, 1856–1857; c) K. Shinohara, Y. Sannohe, S. Kaieda, K.
Tanaka, H. Osuga, H. Tahara, Y. Xu, T. Kawase, T. Bando, H. Su-
giyama, J. Am. Chem. Soc. 2010, 132, 3778–3782; d) S. G. Rzuczek,
D. S. Pilch, A. Liu, L. Liu, E. J. LaVoie, J. E. Rice, J. Med. Chem.
2010, 53, 3632–3644.
[8] a) K. Jantos, R. Rodriguez, S. Ladame, P. S. Shirude, S. Balasubra-
manian, J. Am. Chem. Soc. 2006, 128, 13662–13663; b) A. Bugaut,
K. Jantos, J.-L. Wietor, R. Rodriguez, J. K. M. Sanders, S. Balasubra-
manian, Angew. Chem. 2008, 120, 2717–2720; Angew. Chem. Int.
Ed. 2008, 47, 2677–2680; c) Z. A. E. Waller, P. S. Shirude, R. Rodri-
guez, S. Balasubramanian, Chem. Commun. 2008, 1467–1469;
d) W. C. Drewe, R. Nanjunda, M. Gunaratnam, M. Beltran, G. N.
Parkinson, A. P. Reszka, W. D. Wilson, S. Neidle, J. Med. Chem.
2008, 51, 7751–7767; e) S. Mꢃller, G. D. Pantos¸, R. Rodriguez, S. Ba-
lasubramanian, Chem. Commun. 2009, 80–82; f) G. Collie, A. P.
Reszka, S. M. Haider, V. Gabelica, G. N. Parkinson, S. Neidle,
Chem. Commun. 2009, 7482–7484.
Molecular modelling: Molecular modelling of the quadruplex–ligand in-
teractions were performed by using the 2KQG (PDB entry) as the start-
ing quadruplex structure and pre-optimised structures (PM3,
0.01 Kcalmolꢀ1 ꢂꢀ1, convergence criterion) of 3b and 4a. The complexes
were optimised by using the Amber99 force field with a continuous sol-
vent model following the steepest descent algorithm (to 0.05 Kcalmo-
lꢀ1 ꢂꢀ1) and the Polak–Ribiere algorithm (to 0.01 Kcalmolꢀ1 ꢂꢀ1). The re-
sulting structures were placed in a “water box”, thus minimising the
structures in the presence of solvent specified at atomic level. These opti-
misations were carried out by using the OPLS force field to
0.05 Kcalmolꢀ1 ꢂꢀ1 convergence (see the Supporting Information).
4580
www.chemeurj.org
ꢀ 2011 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Chem. Eur. J. 2011, 17, 4571 – 4581

Synthesis and Binding Studies of Diethynyl-Pyridine Amides
FULL PAPER
[9] a) J. Dash, P. S. Shirude, S. Balasubramanian, Chem. Commun. 2008,
3055–3057; b) J. Dash, P. S. Shirude, S.-T. D. Hsu, S. Balasubramani-
an, J. Am. Chem. Soc. 2008, 130, 15950–15956.
[10] a) H. C. Kolb, M. G. Finn, K. B. Sharpless, Angew. Chem. 2001, 113,
2056–2075; Angew. Chem. Int. Ed. 2001, 40, 2004–2021; b) H. C.
Kolb, K. B. Sharpless, Drug Discovery Today 2003, 8, 1128–1137;
c) J. E. Moses, A. D. Moorhouse, Chem. Soc. Rev. 2007, 36, 1249–
1262.
[11] a) A. D. Moorhouse, A. M. Santos, M. Gunaratnam, M. Moore, S.
Neidle, J. E. Moses, J. Am. Chem. Soc. 2006, 128, 15972–15973;
b) W. C. Drewe, S. Neidle, Chem. Commun. 2008, 5295–5297;
c) J. E. Moses, D. J. Ritson, F. Zhang, C. M. Lombardo, S. Haider, N.
Oldham, S. Neidle, Org. Biomol. Chem. 2010, 8, 2926–2930.
[12] J. M. Heemstra, J. S. Moore, Org. Lett. 2004, 6, 659–662.
[13] a) R. A. J. Darby, M. Sollogoub, C. McKeen, L. Brown, A. Risitano,
N. Brown, C. Barton, T. Brown, K. R. Fox, Nucleic Acids Res. 2002,
30, 39e; b) A. De Cian, L. Guittat, M. Kaiser, B. Sacca, S. Amrane,
A. Bourdoncle, P. Alberti, M.-P. Teulade-Fichou, L. Lacroix, J.-L.
Mergny, Methods 2007, 42, 183–195.
[14] a) M.-P. Teulade-Fichou, C. Carrasco, L. Guittat, C. Bailly, P. Alber-
ti, J.-L. Mergny, A. David, J.-M. Lehn, W. D. Wilson, J. Am. Chem.
Soc. 2003, 125, 4732–4740; b) B. Nguyen, F. A. Tanious, W. D.
Wilson, Methods 2007, 42, 150–161.
[15] a) S. Paramasivan, I. Rujan, P. H. Bolton, Methods 2007, 43, 324–
331; b) P. Balagurumoorthy, S. K. Brahmachari, J. Biol. Chem. 1994,
269, 21858–21869; c) B. Jin, L. Gaffney, C. Wang, R. A. Jones, K. J.
Breslauer, Proc. Natl. Acad. Sci. USA 1992, 89, 8832–8866.
[16] E. W. White, F. Tanious, M. A. Ismail, A. P. Reszka, S. Neidle, D. W.
Boykin, W. D. Wilson, Biophys. Chem. 2007, 126, 140–153.
[17] K. Halder, S. Chowdhury, Biochemistry 2007, 46, 14762–14770.
[18] D. D. Perrin, W. L. F. Armarego, Purification of Laboratory Chemi-
cals, 3rd ed., Pergamon Press, Oxford, 1988.
[19] A. Wolfe, G. H. Shimer, Jr., T. Meehan, Biochemistry 1987, 26,
6392–6396.
Received: November 3, 2010
Published online: March 8, 2011
Chem. Eur. J. 2011, 17, 4571 – 4581
ꢀ 2011 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.chemeurj.org
4581