Design and synthesis of pyrrolobenzodiazepine-gallic hybrid agents as p53-dependent and-independent apoptogenic signaling in melanoma cells

Article abstract of DOI:10.1016/j.ejmech.2015.12.039

A new class of pyrrolo[2,1-c][1,4]benzodiazepine-Gallic hybrid agents (PBD-GA) conjugated through alkyl spacers has been designed and synthesized. The combination of these two core pharmacophores with modification in the C-8 position of the PBD ring with

Full text of DOI:10.1016/j.ejmech.2015.12.039

European Journal of Medicinal Chemistry 109 (2016) 59e74
Contents lists available at ScienceDirect
European Journal of Medicinal Chemistry
journal homepage: http://www.elsevier.com/locate/ejmech
Research paper
Design and synthesis of pyrrolobenzodiazepine-gallic hybrid agents as
p53-dependent and -independent apoptogenic signaling in melanoma
cells
Yu-Wei Chou a, Gopal Chandru Senadi b, Chung-Yu Chen c, Kung-Kai Kuo d,
,
*
Ying-Ting Lin a, Jeh-Jeng Wang b, Jia-Hau Lee b, Ya-Ching Wang a, Wan-Ping Hu a
a Department of Biotechnology, Kaohsiung Medical University, Kaohsiung, Taiwan
b Department of Medicinal and Applied Chemistry, Kaohsiung Medical University, Kaohsiung, Taiwan
c School of Pharmacy, Kaohsiung Medical University, Kaohsiung, Taiwan
d Department of Surgery, School of Medicine, Kaohsiung Medical University, Taiwan
a r t i c l e i n f o
a b s t r a c t
Article history:
A new class of pyrrolo[2,1-c][1,4]benzodiazepine-Gallic hybrid agents (PBD-GA) conjugated through alkyl
spacers has been designed and synthesized. The combination of these two core pharmacophores with
modification in the C-8 position of the PBD ring with alkyl spacers afforded oxygen-tethered compounds
5ae5d and amide-tethered analogues 11ae11d with improved anticancer activity for two melanoma cell
lines, A375 and RPMI7951, differing in their p53 status. The agents 5ae5d were cytotoxic in melanoma
compared to agents 11ae11d. In particular, compounds 5b and 5c were found to possess the most potent
activity compared with other hybrid agents and were proved with the help of quantitative structure
activity relationship studies (QSAR). These PBD conjugates caused S phase arrest for the A375 cell line via
increased reactive oxygen species (ROS) generation, deoxyribonucleic acid (DNA) damage, ataxia telan-
giectasia mutated (ATM)/ATM-Rad3-related (ATR) and checkpoint kinases 1 (Chk1) activation. Moreover,
the PBD-GA induced A375 apoptotic cell death followed through p53 (ATM downstream target) increase,
B-cell leukemia-xL (Bcl-xL) and mitochondrial membrane potential (DJmt) decrease, cytochrome c
release, and caspase-3/Poly Adp Ribose Polymerase (PARP) cleavage. On the other hand, mutant p53
RPMI7951 cell death occurred by PBD-GA-mediated mitochondria- and caspase-dependent pathways via
lysosomal membrane permeabilization (LMP), but not through p53 signaling. Finally, compound 5b was
shown to reduce murine melanoma size in a mouse model. These results suggest that the PBD-GA could
be used as a useful chemotherapeutic agent in melanoma with activated p53 or mutant p53.
© 2015 Elsevier Masson SAS. All rights reserved.
Received 12 June 2015
Received in revised form
11 September 2015
Accepted 20 December 2015
Available online 23 December 2015
Keywords:
Pyrrolobenzodiazepine
Mitochondria
Gallic acid
Antitumor
Free radical
Melanoma
1. Introduction
antitumor activity via sequence-selective binding to the B-form of
DNA and inhibiting the synthesis of nucleic acid [1]. However, only
Pyrrolo[2,1-c][1,4]-benzodiazepines (PBDs) cores are some of
the most potent naturally occurring antibiotics from the family of
Streptomyces species. These compounds are known to exhibit
a few DNA-interactive agents have been discovered to bind DNA
with high sequence selectivity [2,3]. Hence, the discovery of novel
small-molecule drug candidates is still an essential area of research.
In this context, for the last few years our research group has
focused on developing new PBD conjugates and evaluating their
binding ability. We have also reported an efficient synthesis of DC-
81 (Fig. 1A) with an overall yield of 35% over 6 steps (67% yield
based on the recovered starting material at the fifth step) [4]. In
general, DC-81 and indole carboxylate core molecules are
commonly used as medicinal compounds such as antimitotic drugs
[5,6]. Based on this fact, in 2006, we synthesized DC-81 hybrids
linked with indole carboxylates and the preliminary in vivo tests
Abbreviations used: PBD-GA, pyrrolo[2,1-c] [1,4]benzodiazepine-Gallic; QSAR,
quantitative structural activity relationship; ROS, reactive oxygen species; DNA,
deoxyribonucleic acid; ATR, ataxia telangiectasia mutated; ATM, ATR, ATM-Rad3-
related; Chk1, checkpoint kinases 1; Bcl-xL, B-cell leukemia-xL; PARP, poly (ADP-
ribose) polymerase; FTIC, fluorescein isothiocyanate; PI, propidium iodide; LMP,
lysosomal membrane permeabilization.
* Corresponding author.
E-mail address: wphu@kmu.edu.tw (W.-P. Hu).
http://dx.doi.org/10.1016/j.ejmech.2015.12.039
0223-5234/© 2015 Elsevier Masson SAS. All rights reserved.

60
Y.-W. Chou et al. / European Journal of Medicinal Chemistry 109 (2016) 59e74
Fig. 1. Biologically active PBD derivatives.
showed that these hybrid agents have potent antitumor activity [7].
Later, this indole carboxylate-PBD hybrid with a six-carbon spacer
structure (IN6CPBD) was proved to potently induce apoptosis in
A375 melanoma cells through mitochondrial dysfunction and a
caspase-3-mediated pathway (Fig. 1B) [8,9]. It also tends to reduce
melanoma metastasis in mouse lungs, with better efficacy and
superior safety than its mother compound, DC-81 [10]. By altering
the spacer length, we recently elucidated the four-carbon spacer
(IN4CPBD) for its anti-metastatic mechanism [11]. On the other
hand, the enediyne moieties contain either DNA intercalating
groups [12] or DNA minor-groove binding functions [13] and thus
are considered potential DNA-damaging agents due to their ability
to generate benzenoid diradicals [14]. From these previous studies,
we were inspired to evaluate the molecular mechanism of PBD-
enediyne conjugates for their anti-tumor activity (Fig. 1C) [15,16].
In the last few years, a number of pharmacological and biolog-
ical properties have attracted attention to the development of
synthetic gallic acid derivatives [17]. Gallic acid and its derivatives
affect the activity of a variety of DNA and RNA [18]; they also play an
important role in the prevention of inflammatory and malignant
processes [19]. Gallic acid derivatives also selectivity inhibit pro-
liferation, metastasis, and anti-apoptotic processes. These studies
have revealed considerable tumor-specific cytotoxic effects in a
wide variety of human and murine tumor cell lines [20]. The most
important advantage of gallic acid and its derivatives is that they
can selectively induce apoptosis to cancer cells without affecting
the normal cells [21,22].
whether apoptosis was induced by p53-dependent or p53-
independent mechanisms using two melanoma cell lines: A375
(wild-type p53) and RPMI7951 (mutant p53). Moreover, we were
also interested in studying the in vivo efficacy of PBD-GA in the B16
murine melanoma cell tumorigenesis in skin.
2. Results and discussion
2.1. Chemistry
The synthesis of our newly designed PBD-Gallic hybrid agents
was initiated from compound 1. We have synthesized the key
precursor 1 from vanillic acid according to our previous literature
protocol involving 8 steps [4]. The reaction of compound 1 with
various dibromoalkanes in the presence of ethyl methyl ketone and
K2CO3 afforded the compounds 2ae2d in 79e91% yields, respec-
tively. Then, the reaction of compound 2 with commercially avail-
able 3,4,5-trimethoxy phenol 3 in the presence of K2CO3/CH3CN
gave compounds 4ae4d in 71e87% yields. Finally, the reduction of
compound 4 in the presence of lithiumborohydride (LiBH4) in THF
produced the desired target PBD-Gallic derivatives 5ae5d in good
yields, as shown in Scheme 1.
In order to compare the activity of oxygen-tethered PBD con-
jugates 5ae5d, we synthesized the amide-tethered PBD conjugates,
as shown in Scheme 2. The reaction of 3,4,5-trimethoxy benzoyl
chloride 6 with various amino alcohols 7 in the presence of a base
afforded the compound 8aed in 90e97% yields. The reaction of
compound 8 with tosyl chloride and NaH gave the tosylated com-
pound 9aed in 53e70% yields. The reaction of compounds 9 and 1
with K2CO3 in the presence of CH3CN afforded the compound
10aed in 71e81% yields. Finally, the reduction of imine compound
10 with LiBH4/THF resulted in the amide-tethered PBD-Gallic
hybrid agents 11a-d, as shown in Scheme 2. After successful syn-
thesis of PBD-Gallic hybrids, we next evaluated their biological
activity.
Several cancer cell lines have been shown to cause cell death by
DNA damage-induced cell cycle arrest due to generation of reactive
oxygen species (ROS) [23,24]. Human bodies are constantly
exposed to exogenous or endogenous sources and antioxidants play
a crucial role in preventing oxidative damage to biological mole-
cules. Mitochondria are important and actively participate in the
production of ROS. The permeabilization of the outer membrane
and the subsequent pro-apoptotic protein release from the inner
membrane of the mitochondria are the most crucial events in the
initiation and execution of apoptosis [25].
2.2. Biology
The tumor protein p53 is activated by the deregulated expres-
sion of oncogenes, which induce replication stress and thereby
cause DNA damage [26]. The p53-dependent anti-apoptotic protein
Bcl-xL and the death-promoting Bax protein of the Bcl-2 family are
considered requisite gateways to the mitochondrial apoptotic
pathway [27]. In addition, ROS production also causes lysosome
damage. Lysosomes are acidic, single-membrane bound organelles
that are filled with hydrolases [28], and the cathepsin family of
proteases is the best characterized [29].
Based on this previous background and our continuing research
interest in the PBD conjugates, we were motivated to develop a new
series of pyrrolo[2,1-c][1,4]benzodiazepine (PBD)-Gallic hybrid
agents conjugated through alkyl spacers (Fig. 2), and to determine
2.2.1. In vitro cytotoxic effects
The cytotoxic effects of the synthesized hybrid agents 5ae5d
and 11ae11d were assessed in various human cells by MTTassay. As
shown in Table 1, oxygen-tethered hybrid agents 5b and 5c were
potently cytotoxic in the melanoma A375 cell line as compared
with other agents. In addition, there was no significant cytotoxic
effect in human dermal fibroblast cells. In order to confirm whether
the new hybrid agent is more effective as an antiproliferative agent
than DC-81 and gallic acid, we used conjugate agents 5b and 5c
because of their greater inhibitory activity. Our data indicated that
agents 5b and 5c exhibit greater inhibitory activity than DC-81 and
gallic acid on A375 cells (Fig. 3A). Moreover, agents 5b and 5c

Y.-W. Chou et al. / European Journal of Medicinal Chemistry 109 (2016) 59e74
61
Fig. 2. PBD-Gallic hybrid agents used in this study.
Scheme 1. Synthetic method for the PBD-Gallic hybrid agents 5ae5d. Reaction condition: a) Compound 1 (1.0 equiv), K2CO3/EMK. b) Compound 2 (1.0 equiv), 3 (1.0 equiv), K2CO3/
CH3CN. c) Compound 4 (1.0 equiv), LiBH4/THF.
Scheme 2. Synthetic method for the PBD-Gallic hybrid agents 11ae11d. Reaction condition: a) Compound 6 (1.0 equiv), K2CO3/CH2Cl2. b) Compound 8 (1.0 equiv), TsCl (1.5 equiv),
NaH/THF. c) Compound 9 (1.0 equiv), 1 (1.0 equiv), K2CO3/CH3CN. d) Compound 10 (1.0 equiv), LiBH4/THF.

62
Y.-W. Chou et al. / European Journal of Medicinal Chemistry 109 (2016) 59e74
Table 1
Cytotoxic activities of compounds in different human cell lines.a
Compound (1
m
M)
Cell lines
A375 (p53 wt)
RPMI7951 (p53 mutant)
MCF-7 (p53 wt)
A549
H1299 (p53 knockout)
Fibroblast (p53 wt)
5a
5b
5c
5d
11a
11b
11c
11d
69.7 3.4
37.4 0.7
37.7 0.3
84.8 1.0
82.6 0.5
79.5 0.9
74.7 0.8
86.5 0.7
59.5 1.3
62.3 0.7
64.6 1.1
55.9 0.4
97.7 0.6
83.0 0.7
111.0 1.3
69.6 0.4
51.7 4.3
55.3 4.3
55.0 3.6
79.0 2.2
94.6 3.2
96.3 4.4
100.6 3.5
95.4 2.8
88.7 2.1
77.9 2.0
78.0 1.1
101.1 2.4
96.1 1.2
100.2 3.8
96.8 2.1
100.9 2.3
71.9 0.7
73.0 0.6
69.4 2.0
90.2 0.9
96.4 0.4
95.0 0.7
96.9 1.2
92.4 0.4
97.3 0.2
109.0 2.0
110.7 1.0
93.4 0.3
101.1 0.6
98.2 0.3
98.7 1.0
94.9 0.7
a
Cells were cultured with compounds 5a-d, 11a-d at a concentration of 1 mM for 24 h before growth and viability were assessed using the MTT assay.
exhibited higher inhibitory activity on A375 cells (wild-type p53)
compared to RPMI7951 cells (mutant p53) at a concentration of
1 mM for 24 h in the MTT assay. Nevertheless, the inhibitory activity
of PBD-Gallic agents on RPMI7951 cells as well as on A375 cells was
confirmed by a colony formation assay in which the cells were
treated for a longer time than in the MTT assay (Fig. 3B).
its exocyclic 2-amino group. The distance between the C-11 of the
hybrid agents and the 2-amino group of the guanine was measured
and was found to be in the range of 2.7e3.7 Å. In the two illustrative
docking binding modes shown in Fig. 4, the PBD hybrid agent core
was positioned almost perpendicular to the guanine base in the
DNA, with a C-11 carbon coordinated to the exocyclic 2-amino
group of the guanine. The high transition state frequency sug-
gests that hybrid agents 5ae5d and 11ae11d all have the ability to
form covalent bonds with the guanine base.
2.2.2. Molecular docking studies
The PBD core has a chiral center at the C-11 position and a DNA-
reactive imine moiety at the N-10 and C-11 positions. These mol-
ecules are covalent minor groove binders and can covalently bind
to a guanine base at its exocyclic 2-amino group in double-helical
B-DNA (AGA-motive) [30]. These molecules are accommodated
within the minor groove covering the centrally located 5e6 bp.
With this a priori knowledge, the molecular docking studies were
performed to study the DNA-ligand interactions of newly synthe-
sized conjugates 5aed and 11aed. The checkpoint is if our com-
pounds have any chance to get into the transition state before the
covalent bond forms. In Supplementary Table S1, the results show
that among the 50 best docking poses in terms of energy, all PBD
hybrid agents showed high frequency to have the guanine base at
2.2.3. Covalent interaction
We proposed that the mechanism of action of the hybrid agents
is associated with their ability to form an adduct in the minor
groove, thus interfering with DNA processing [32]. After insertion
in the minor groove, an aminal bond is formed through nucleo-
philic attack of the exocyclic 2-amino group of the guanine at the
electrophilic C-11 position of the PBD, as shown in the Fig. 5.
2.2.4. PBD-gallic hybrids induced ROS generation and DNA lesion
Because excessive ROS production has been identified to cause
cell death in several cancers, we measured the production of
intracellular H2O2 using a DCFH-DA probe. After being incubated
for the indicated time, the cells showed a significant level of
intracellular H2O2 at 24 h (Fig. 6A). One of the most abundant and
well-characterized DNA lesions generated by oxidative stress is 8-
oxoguanine [33]. The levels of this adduct in the nuclear DNA of
A375 cells after PBD-Gallic hybrid administration was determined.
The immunocytochemistry analysis indicated that the expression
of 8-oxoguanine increased with 0.5
(Fig. 6B).
mM of 5b and 5c treatment
2.2.5. PBD-gallic hybrid-induced ATR/ATM activation and S phase
arrest in A375 cells
A previous study reported that the control of cell death is linked
to the cell cycle. Cells with a defective cell cycle are more vulnerable
to some anticancer agents according to numerous preclinical
studies [34]. Compounds manipulating the cell cycle may be able to
arrest cell growth, inhibit differentiation, and induce apoptosis.
Ataxia-telangiectasia mutated (ATM) is considered a primary
regulator in response to DNA double-strand breaks [35], whereas
ATR (ATM-related) has been implicated primarily in the response to
ultraviolet light (UV), replication blocks, and hypoxia. Checkpoint
kinase 1 (Chk1) is a direct downstream target for the ATR kinase to
regulate the S-phase checkpoint. A major and crucial target for
Chk1 in cell cycle checkpoints is the dual-specificity phosphatase
Cdc25, which dephosphorylates and activates Cdks [36,37]. In the
immunocytochemistry analysis, the activation of ATR/ATM was
increased after PBD-Gallic hybrid treatment (Fig. 7A). As compared
with the untreated control group, cell treatment with 5b and 5c
resulted in an increase in Chk1 phosphorylation, whereas the level
Fig. 3. Effect of PBD-Gallic on cell viability. (A) Cell viability of 0.5
mM compounds
tested against A375 cells for 24 h (same experimental conditions as in Table 1). (B)
Cells were plated into 6-well plates at a density of 100 cells per well. On the second
day, cells were treated with PBD-Gallic. Every 3 days, the medium was replaced with
fresh medium containing the agent at 0.5 mM concentration. After a 10 day treatment,
the medium was removed, and cell colonies were stained with SRB dyes, and pictures
were taken using a digital camera. **P < 0.01 vs control group. Similar results were
obtained in three independent experiments.

Y.-W. Chou et al. / European Journal of Medicinal Chemistry 109 (2016) 59e74
63
Fig. 4. Two docking binding modes of hybrid agents interaction with DNA. Hybrid agents (A) 5b and (B) 5c interaction with guanine base in DNA. The white portion is DNA (DNA
structure is from PDB ID: 2KY7 [31]), the green part is guanine of DNA and the brown part is hybrid agents 5b or 5c. (For interpretation of the references to color in this figure
caption, the reader is referred to the web version of this article.)
Fig. 5. Proposed mechanism (A) the view of PBD hybrid small molecule 5b with deoxyguanosine closes to form a covalent bond. (B) The PBD hybrid agent 5b deoxyguanosine
adduct in DNA, showing formation of an aminal bond between the C-11 position of the PBD hybrid and exocyclic 2-amino group of guanine base.
of Cdc25c was reduced (Fig. 7B). Moreover, the DNA content of
A375 cell nuclei was measured by flow cytometric analysis. As
concomitantly, decreased cell populations at G1 and G2/M phases.
The preceding results demonstrated that PBD-Gallic induces ROS
generation, DNA damage, ATR/ATM and checkpoint-related signals
Chk1 activation, which led to increased numbers of cells in the S
shown in Fig. 7C, treatment with 0.5
mM PBD-Gallic for 24 h
significantly increased cell percentage at the
S
phase and,

64
Y.-W. Chou et al. / European Journal of Medicinal Chemistry 109 (2016) 59e74
Fig. 6. PBD-Gallic induced ROS generation and DNA lesion. (A) A375 cells were treated with 0.5 mM PBD-Gallic for 0, 12, and 24 h and stained with DCFH-DA. (B) Visualization of 8-
oxoguanine in the nuclear DNA of A375 cells. Cells probed with mouse anti-8-oxoguanine monoclonal antibody followed by rhodamine-labeled secondary antibody (IF, red) and
counterstained with DAPI (nuclei, blue). Similar results were obtained in three independent experiments. (For interpretation of the references to color in this figure caption, the
reader is referred to the web version of this article.)
phase of the cell cycle.
xL, and cleaved both caspase-3 and PARP to identify apoptotic
cells (Fig. 8A). The apoptosis-associated mRNA expressions (p53,
bax, bcl-xl) of 5be5c on A375 cells are a time-dependent
manner by real-time quantitative PCR (Fig. 8B). Mitochondrial
membrane potential (DJmt) is a vital factor for determining
cellular status. The decline in DJmt is an early event in the
process of cell death [42]. Therefore, we investigated whether
DJmt disruption was involved in PBD-Gallic-induced apoptosis.
2.2.6. PBD-gallic hybrids induced p53-dependent mitochondrial
apoptosis in A375 cells
The p53 gene is considered a tumor-suppressor gene [38],
which might be a crucial regulator of cell cycle checkpoints, DNA
repair and apoptosis [39]. The p53 gene is also one of the
downstream targets of ATM used as a marker of DNA double-
strand breaks. The p53-dependent anti-apoptotic protein Bcl-
xL and the death-promoting proteins Bax of the Bcl-2 family
are considered as requisite gateways to the mitochondrial
apoptotic pathway [26]. Caspase-3 has been shown to be one of
the most important cell executioners for apoptosis [40,41]. Poly
(ADP-ribose) polymerase (PARP) has been identified as a sub-
strate for caspase-3. The expression of apoptosis-related pro-
teins was determined by Western blotting assay. Our results
showed that apoptotic cell death triggered by 5b and 5c was
associated with increased levels of p53, decreased levels of Bcl-
We treated A375 cells with 0.5 mM PBD-Gallic for 0, 12, and 24 h,
and then analyzed them using flow cytometry after DiOC6 dye
labeling. Cells treated with PBD-Gallic exhibited a significant
decline in DJmt after 12 h treatment (Fig. 8C). Another assess-
ment of mitochondrial function was to determine the trans-
location of cytochrome
membrane space to the cytosol [43,44]. Immunofluorescent
staining showed that treating cells with 0.5 M PBD-Gallic
c from the mitochondrial inter-
m
significantly increases the release of cytochrome c from mito-
chondria to cytosol (Fig. 8D).

Y.-W. Chou et al. / European Journal of Medicinal Chemistry 109 (2016) 59e74
65
Fig. 7. Effect of PBD-Gallic on induction of DNA-damage-sensing kinases and cell cycle distribution in A375 cells. (A) Immunofluorescence staining with p-ATM (green), p-ATR (red),
and DAPI (blue) in A375 cells after 0.5 M PBD-GAs for 24 h. (B) Western blots showed the effect of PBD-Gas on the protein expression of cell cycle checkpoints in A375 cells. For the
internal control, the same amounts of protein extract were also probed with antibody against GAPDH. (C) Flow cytometric analyses of cell cycle distribution of A375 cells after
exposure to 0.5 M PBD-Gallic for 24 h *p < 0.05, **p < 0.01 as compared with the control. Similar results were obtained in three independent experiments. (For interpretation of the
references to color in this figure caption, the reader is referred to the web version of this article.)
m
m
2.2.7. PBD-gallic hybrid induced p53-independent mitochondrial
apoptosis in RPMI7951 cells via LMP
Lysosomal membrane permeabilization (LMP) occurs in
response to a large variety of cell death stimuli causing release of
cathepsins from the lysosomal lumen into the cytosol where they
participate in apoptosis signaling. Previous studies have reported
that factors in LMP include DNA damage, ROS, and p53 [45,46]. To
determine whether PBD-Gallic induced RPMI7951 apoptosis,
which might require active p53 participation, we measured the
lysosomal Hþ concentration using the lysotracker. As shown in
Fig. 9A, the wild-type p53 of A375 cells had no effect on LMP after
PBD-Gallic treatment. However, a silencing of p53 decreased

66
Y.-W. Chou et al. / European Journal of Medicinal Chemistry 109 (2016) 59e74
Fig. 8. Effect of PBD-Gallic on mitochondrial function and apoptosis in A375 cells. (A) After exposure to 0.5
with specific antibodies as indicated. (B) Expression of p53, bax, and bcl-xl mRNA in different groups. The mRNA expression analyzed by quantitative real-time PCR and the
expressional levels were normalized to the level of GAPDH mRNA. (C) The DJmt of A375 cells after exposure to 0.5 M PBD-Gallic for 24 h and stained with DiOC6 then analyzed by
mM PBD-Gallic for 24 h, cell lysates were collected and Western blotted
m
flow cytometry. (D) Immunofluorescent staining of cytochrome c (green), the distribution of COX IV (mitochondrial marker, red), and DAPI (blue) in A375 cells. *p < 0.05 vs control
group. Similar results were obtained in three independent experiments. (For interpretation of the references to color in this figure caption, the reader is referred to the web version
of this article.)
lysosomal Hþ concentration in A375 cells after 48 h PBD-Gallic
treatment, as well as mutant p53 of RPMI7951. These data indi-
cate that p53 might be independent of PBD-Gallic -induced LMP in
RPMI7951 cells. Because aspartic cathepsin D is involved in
mitochondrial, caspase-dependent apoptosis signaling [47,48], the
extent of lysosomal damage, cytochrome c release, and PARP
degradation of RPMI7951 cells after PBD-Gallic administration was
determined. According to the immunocytochemistry analysis, the
release of cathepsin and cytochrome c into the cytosol was
increased by the PBD-Gallic (Fig. 9BeC), and data from the
Western blot experiment showed degradation of PARP when
RPMI7951 cells were exposed to PBD-Gallic as compared with the
control group (Fig. 9D).
after annexin V and PI staining. Moreover, to address whether
PBD-Gallic has a better effect, we injected mouse melanoma
B16 cells into the footpad of the ICR mice. Compound 5b at various
doses was delivered to the mice. We then observed the tumor
sizes sequentially. Compound 5b induced significant tumor
reduction in a concentration-dependent manner, indicating the
anti-cancer activity of PBD-Gallic (Fig. 10B). Furthermore, all doses
of 5b were well tolerated, as indicated by animal body weight
(Fig. 10C).
3. Conclusions
In this study, we performed a series of experiments using two
isogenic melanoma cell lines, A375 and RPMI7951, differing in
their p53 status and potential differences in PBD-Gallic-induced
cytotoxicity. The QSAR studies showed that the hybrid agents
5ae5d, 11ae11d are able to form a covalent bond with the minor
groove of DNA. Moreover, the PBD-Gallic was able to induce DNA
damage, increase cells in the S phase, activate p53, and increase
mitochondrial, caspase-dependent apoptotic cell death by gener-
ating ROS in A375 cells. On the other hand, PBD-Gallic induced
lysosome- and mitochondria-dependent cell apoptosis in
RPMI7951 with mutant p53, as shown in Fig. 11. Furthermore,
2.2.8. Antitumor activity of 5b in tumor-bearing mice
In order to evaluate the effect of PBD-Gallic on B16 cell lines,
we examined in vitro and in vivo antitumor activity (Fig. 10).
Fluorescein isothiocyanate (FITC)-conjugated annexin V was uti-
lized to detect the externalization of phosphatidylserine that oc-
curs at an early stage of apoptosis. Propidium iodide (PI) is used as
a marker of necrosis due to cell membrane destruction [49]. As
demonstrated in Fig. 10A, treatment of B16 cells with 0.5
mM 5b for
24 h resulted in more apoptotic cells than the untreated control

Y.-W. Chou et al. / European Journal of Medicinal Chemistry 109 (2016) 59e74
67
Fig. 9. PBD-Gallic result in mitochondrial apoptosis by lysosomal membrane permeabilization in RPMI7951. (A) A375 and RPMI7951 cells were treated with 0.5
m
M PBD-Gallic for
indicated time to determine the lysosomal Hþ concentration by lysotracker. (B) & (C) Immunofluorescent staining of cathespin D(red), LAMP-1 (lysosomal marker, green), cyto-
chrome c (green), the distribution of COX IV (red), and DAPI (blue) in RPMI7951 cells. (D) Induction of PARP cleavage by PBD-Gallic (same experimental conditions as in Fig. 8A).
Similar results were obtained in three independent experiments. (For interpretation of the references to color in this figure caption, the reader is referred to the web version of this
article.)
PBD-Gallic could induce a marked increase of annexin V binding in
B16 cells and could also reduce murine melanoma size in the
mouse model. This study successfully demonstrated the in vitro
and in vivo efficacy of PBD-Gallic in B16 melanoma cell
tumorigenesis in ICR mice. Finally, we revealed a novel PBD-Gallic
antitumor proliferation mechanism and we suggest that these
agents may have potential chemotherapeutic activity for mela-
nomas with wild type p53 or mutant p53.

68
Y.-W. Chou et al. / European Journal of Medicinal Chemistry 109 (2016) 59e74
Fig. 10. Effect of compound 5b on cell apoptosis and tumor volume of B16 cells. (A) B16 cells treated with 0.5 mM 5b for 24 h and then stained with PI (red), Hoechst33258 (blue),
and an annexin V-FITC conjugate (green) specifically detecting the exposure of PS residues at the cell surface. (B) Tumor was established by injection of 5 ꢀ 106 cells/mL of B16 into
each sole of feet of the female ICR mice. (C) Animal body weight plotted as a percentage of that on day 0. (For interpretation of the references to color in this figure caption, the
reader is referred to the web version of this article.)
4. Experimental section
All tested compounds yielded data consistent with a purity of at
least 98%. Reaction progress and product mixtures were routinely
monitored by TLC using Merck TLC aluminum sheets (silica gel 60
F254), and also visualized with aqueous KMnO4. Column chroma-
tography was carried out with 230e400 mesh silica gel 60 (Merck).
All chemicals and reagents were purchased from commercial sup-
pliers (Sigma Aldrich, Alfa Aesar and Merck) and were used without
further purification.
4.1. Chemistry
4.1.1. Materials and methods
1H NMR and 13C NMR spectra were recorded on a OXFORD 200
spectrometer or a Varian Mercury Plus 400 spectrometer. The
chemical shift (d) values are reported in ppm, and the coupling
constants (J) are given in Hz. The spectra were recorded using CDCl3
or DMSO-d6 as a solvent. 1H NMR chemical shifts are referenced to
TMS (0 ppm) or CDCl3 (7.26 ppm). 13C NMR was referenced to CDCl3
(77.0 ppm). The abbreviations used are as follows: s, singlet; bs,
broad singlet; d, doublet; dd, double doublet; t, triplet; m, multiplet
Mass spectra and high resolution mass spectra (HRMS) were
measured using the ESI. All products reported showed 1H NMR
spectra in agreement with the assigned structures. The purity of the
tested compounds were analyzed by reverse-phase HPLC (Waters
Spherisorb R S10 0DS2; 20 ꢀ 250 mm semi-prep column) using an
Waters 600 HPLC Pump system equipped with a Waters 2487 dual
4.1.2. Procedure for the synthesis of compound 2ae2d
To a solution of compound 1 (0.63 mmol) in ethyl methyl ketone
(EMK) as solvent (10 mL) in a 100 mL round bottom flask was
cooled to 0 ꢁC. Then the reaction mixture was charged with po-
tassium carbonate (1.89 mmol) and continued stirring for another
30 min at the same temperature. Finally, the corresponding
dibromo compound was added and allowed to reach room tem-
perature gradually and stirred for 6hr. The completion of the re-
action was monitored by TLC chromatogram. The reaction was
quenched with ice water and extracted with dichloromethane and
dried over Na2SO4. The removal of solvent under reduced pressure
l
absorbance detector. The mobile phase used was CH3CN and H2O.

Y.-W. Chou et al. / European Journal of Medicinal Chemistry 109 (2016) 59e74
69
added slowly and stirred at room temperature for 24 h. The
completion of the reaction was monitored by TLC chromatogram.
The reaction was quenched with ice water and extracted with
dichloromethane. The organic layer was given a brine wash and
dried over Na2SO4 and concentrated under reduced pressure to
afford the crude compound. The product was purified by column
chromatography using methylene chloride: methanol ¼ 70: 1e50:
1
to obtain the pure compounds 8ae8d in 90e97% yields
respectively.
4.1.6. Procedure for the synthesis of compound 9ae9d
To a solution of compound 8 (0.71 mmol) in THF (10 mL) CH2Cl2
in 250 mL round bottom flask was cooled to ꢂ15 ꢁC. To this cooled
solution sodium hydride (2.13 mmol) was added and stirred for
30 min. Finally, tosyl chloride (0.85 mmol) was added to the reac-
tion mixture and stirred under ꢂ15 ꢁC for 1 h. The completion of the
reaction was monitored by TLC chromatogram. The reaction was
quenched with ice water and extracted with dichloromethane. The
dichloromethane layer was give brine and water wash. The
resulting solution was dried over NaSO4 and concentrated under
reduced pressure to give the crude compound. This was further
purified by column chromatography using ethyl acetate/hexane to
afford the pure compounds 9ae9d in 53e70%.
4.1.7. Procedure for the synthesis of compound 10ae10d
To as solution of compound 1 (0.63 mmol) in acetonitrile
(10 mL) in a 100 mL round bottom flask was cooled to 0 ꢁC. To this
cooled solution potassium carbonate (1.89 mmol) was charged and
continued the stirring for another 30 min at the same temperature.
Then the corresponding compound 9 (0.76 mmol) was added and
stirred at rt for 24 h. The completion of the reaction was monitored
with the help of TLC chromatogram. The reaction was quenched
with ice water and extracted with dichloromethane and dried over
Na2SO4. The removal of solvent under reduced pressure gave the
crude compounds 10ae10d. The crude compounds were further
purified by column chromatography using dichloromethane/
Methanol ratio 100:1 to afford the pure compounds in 71e81%
yields respectively.
Fig. 11. A proposed mechanism for PBD-Gallic -induced melanoma apoptosis with
p53-dependent A375 cells or p53-independent RPMI7951 cells.
gave the crude compounds 2ae2d. The crude compounds were
further purified by column chromatography using dichloro-
methane/methanol ratio 150:1 to afford the pure compounds in
79e81% yields respectively.
4.1.3. Procedure for the synthesis of compound 4ae4d
To as solution of compound 2 (0.45 mmol) in acetonitrile
(10 mL) in a 100 mL round bottom flask was cooled to 0 ꢁC. To this
cooled solution potassium carbonate (1.35 mmol) was charged and
continued the stirring for another 30 min at the same temperature.
Then the 3,4,5- Trimethoxyphenol (0.68 mmol) was added and
stirred at 80 ꢁC for 24 h. The completion of the reaction was
monitored with the help of TLC chromatogram. The reaction was
quenched with ice water and extracted with dichloromethane and
dried over Na2SO4. The removal of solvent under reduced pressure
gave the crude compounds 4ae4d. The crude compounds were
further purified by column chromatography using dichloro-
methane/Methanol ratio 70:1 to afford the pre compounds in
71e87% yields respectively.
4.1.8. Procedure for the synthesis of compound 11ae11d
To a solution of compound 10 (0.34 mmol) in THF (10 mL) in a
100 mL round bottom flask was cooled to ꢂ15 ꢁC for 30 min. To this
cooled solution was added LiBH4 (0.70 mmol) and continued the
stirring at same temperature for 48 h. The completion of the re-
action was monitored by TLC. The reaction was quenched with ice
water and extracted with dichloromethane and dried over Na2SO4.
The pure compounds 11ae11d were obtained by using preparative
HPLC and further by freeze drying in 71e77%.
4.1.9. Spectral characterization for compounds 2, 4, 5, 8, 9, 10 and
11
4.1.4. Procedure for the synthesis of compound 5ae5d
To a solution of compound 4 (0.37 mmol) in THF (10 mL) in a
100 mL round bottom flask was cooled to ꢂ15 ꢁC for 30 min. To this
cooled solution was added LiBH4 (0.74 mmol) and continued the
stirring at same temperature for 48 h. The completion of the re-
action was monitored by TLC. The reaction was quenched with ice
water and extracted with dichloromethane and dried over Na2SO4.
The pure compounds 5ae5d were obtained by using preparative
HPLC and further by freeze drying in 79e85% yields respectively.
4.1.9.1. (S)-8-(3-bromopropoxy)-7-methoxy-1,2,3,11a-tetrahydro-
5H-benzo[e]pyrrolo[1,2-a][1,4]diazepin-5-one (2a). Yellow color oil;
Yield: 91%; 1H NMR (CDCl3, 400 MHz)
d 7.36 (s, 1H), 7.29 (s, 1H),
5.58 (d, J ¼ 10 Hz, 1H), 4.66 (d, J ¼ 10 Hz, 1H), 4.24e4.13 (m, 3H),
3.92 (s, 3H), 3.80e3.73 (m, 2H), 3.70e3.64 (m, 2H), 3.61e3.53 (m,
2H), 2.74e2.70 (m, 1H), 2.44e2.37 (m, 2H), 2.13e1.98 (m, 3H), 1.26
(t, J ¼ 7.2 Hz, 3H); 13C NMR (CDCl3, 100 MHz)
d 170.1, 164.9, 150.7,
147.2, 133.7, 122.3, 111.3, 106.9, 78.0, 66.4, 64.7, 57.4, 55.9, 46.5, 31.8,
29.6, 26.4, 23.6, 15.2; HRMS (ESI, m/z) C19H25BrN2O5 calcd 441.1025
found 441.1028.
4.1.5. Procedure for the synthesis of compound 8ae8d
To a solution of compound 6 (4.3 mmol) in CH2Cl2 in 250 mL
round bottom flask was cooled in an ice bath followed by the
addition of K2CO3 (12.9 mmol) and stirred for about 30 min. Then
the solution of corresponding amino butanol (6.45 mmol) was
4.1.9.2. (S)-8-(4-bromobutoxy)-7-methoxy-1,2,3,11a-tetrahydro-5H-
benzo[e]pyrrolo[1,2-a][1,4]diazepin-5-one (2b). Yellow color oil;
Yield: 87%; 1H NMR (CDCl3, 400 MHz)
d 7.36 (s, 1H), 7.25 (s, 1H),

70
Y.-W. Chou et al. / European Journal of Medicinal Chemistry 109 (2016) 59e74
5.57 (d, J ¼ 10.0 Hz, 1H), 4.65 (d, J ¼ 10 Hz, 1H), 4.14e4.05 (m, 3H),
3.92 (s, 3H), 3.80e3.73 (m, 2H), 3.70e3.64 (m, 2H), 3.62e3.51 (m,
2H), 2.73e2.70 (m, 1H), 2.13e1.98 (m, 7H), 1.27 (t, J ¼ 7.2 Hz, 3H);
111.2, 106.4, 92.1, 78.1, 68.7, 67.8, 64.7, 60.9, 57.4, 56.0, 55.9, 46.6,
28.9, 28.5, 26.4, 23.6, 22.5, 15.2; HRMS (ESI, m/z) C30H40N2O9Na
calcd 595.2631 found 595.2634.
13C NMR (CDCl3, 100 MHz)
d 170.1, 164.9, 150.8, 147.0, 133.7, 121.9,
111.2, 106.4, 78.0, 67.8, 64.6, 57.3, 55.9, 46.5, 33.1, 29.1, 27.4, 26.3,
23.5, 15.2; HRMS (ESI, m/z) C20H27BrN2O5 calcd 455.1181 found
455.1178.
4.1.9.8. (S)-10-(ethoxymethyl)-7-methoxy-8-((6-(3,4,5-
trimethoxyphenoxy)hexyl)oxy)-1,2,3,11a-tetrahydro-5H-benzo[e]pyr-
rolo[1,2-a][1,4]diazepine-5,11(10H)-dione (4d). Light yellow oil;
Yield: 71%; 1H NMR (CDCl3, 400 MHz)
d 7.35 (s, 1H), 7.25 (s, 1H), 6.15
4.1.9.3. (S)-8-((5-bromopentyl)oxy)-7-methoxy-1,2,3,11a-tetrahy-
(s, 2H), 5.58 (d, J ¼ 10 Hz, 1H), 4.64 (d, J ¼ 10 Hz, 1H), 4.13e4.03 (m,
3H), 3.94 (t, J ¼ 6 Hz, 2H), 3.92 (s, 3H), 3.84 (s, 6H), 3.78 (s,3H),
3.76e3.72 (m, 2H), 3.69e3.53 (m, 2H), 2.73e2.70 (m, 1H), 2.13e1.99
(m, 3H),1.97e1.80 (m, 4H),1.61e1.55 (m, 4H),1.26 (t, J ¼ 7.2 Hz, 3H);
dro-5H-benzo[e]pyrrolo[1,2-a][1,4]diazepin-5-one (2c). Yellow color
oil; Yield: 82%; 1H NMR (CDCl3, 400 MHz)
d 7.36 (s, 1H), 7.25 (s, 1H),
5.58 (d, J ¼ 10.0 Hz, 1H), 4.64 (d, J ¼ 10 Hz, 1H), 4.14e4.01 (m, 3H),
3.92 (s, 3H), 3.80e3.73 (m, 2H), 3.70e3.65 (m, 2H), 3.45 (t,
J ¼ 6.8 Hz, 2H), 2.74e2.70 (m, 1H), 2.13e1.87 (m, 7H), 1.69e1.61 (m,
13C NMR (CDCl3, 100 MHz)
d 170.3, 165.1, 155.6, 153.6, 151.2, 147.2,
133.9, 132.1, 121.9, 111.3, 106.5, 92.1, 78.1, 68.9, 68.0, 64.7, 60.9, 57.5,
56.0, 55.9, 46.6, 29.1, 28.8, 26.5, 25.8, 25.7, 23.7, 15.3; HRMS (ESI, m/
z) C31H42N2O9Na calcd 609.2788 found 609.2784.
2H),1.27 (t, J ¼ 7.2 Hz, 3H); 13C NMR (CDCl3,100 MHz)
d 170.2,165.0,
151.0, 147.1, 133.7, 121.9, 111.2, 106.4, 78.0, 68.5, 64.7, 57.4, 56.0, 46.5,
33.3, 32.2, 27.9, 26.4, 24.5, 23.6,15.2; HRMS (ESI, m/z) C21H29BrN2O5
calcd 469.1338 found 469.1340.
4.1.9.9. (S)-7-methoxy-8-(3-(3,4,5-trimethoxyphenoxy)propoxy)-
1,2,3,11a-tetrahydro-5H-benzo[e]pyrrolo[1,2-a][1,4]diazepin-5-one
4.1.9.4. (S)-8-((6-bromohexyl)oxy)-7-methoxy-1,2,3,11a-tetrahydro-
(5a). Light yellow oil; Yield: 81%; 1H NMR (CDCl3, 400 MHz)
d 7.67
5H-benzo[e]pyrrolo[1,2-a][1,4]diazepin-5-one (2d). Yellow color oil;
(d, J ¼ 4.4 Hz, 1H), 7.52 (s, 1H), 6.86 (s, 1H), 6.16 (s, 2H), 4.36e4.21
(m, 1H), 4.15 (t, J ¼ 6 Hz, 2H), 3.94 (s, 3H), 3.83 (s, 6H), 3.78 (s, 3H),
3.72e3.54 (m, 3H), 3.48 (s, 1H), 2.37e2.30 (m, 4H), 2.10e1.98 (m,
Yield: 79%; 1H NMR (CDCl3, 400 MHz)
d 7.35 (s, 1H), 7.25 (s, 1H),
5.58 (d, J ¼ 10.0 Hz, 1H), 4.66 (d, J ¼ 10 Hz, 1H), 4.16e4.02 (m, 3H),
3.93 (s, 3H), 3.79e3.73 (m, 2H), 3.70e3.53 (m, 2H), 3.43 (t,
J ¼ 6.8 Hz, 2H), 2.74e2.69 (m, 1H), 2.11e1.88 (m, 7H), 1.55e1.51 (m,
2H); 13C NMR (CDCl3, 100 MHz)
d 164.6, 162.4, 155.4, 153.6, 150.6,
147.7,140.6,132.3,120.3,111.6,110.6, 95.7, 92.3, 60.9, 56.2, 56.1, 56.0,
53.7, 46.6, 29.6, 29.3, 24.1; HRMS (ESI, m/z) C25H30N2O7 calcd
470.5220 found 470.5223.
4H),1.27 (t, J ¼ 7.2 Hz, 3H); 13C NMR (CDCl3,100 MHz) a 170.0,164.8,
€
150.9, 146.9, 133.6, 121.6, 111.0, 106.2, 77.9, 68.5, 64.5, 57.2, 55.8,
46.4, 33.4, 32.3, 28.3, 27.5, 26.2, 24.8, 23.4, 15.1; HRMS (ESI, m/z)
C
22H31BrN2O5 calcd 483.1494 found 483.1492.
4.1.9.10. (S)-7-methoxy-8-(4-(3,4,5-trimethoxyphenoxy)butoxy)-
1,2,3,11a-tetrahydro-5H-benzo[e]pyrrolo[1,2-a][1,4]diazepin-5-one
4.1.9.5. (S)-10-(ethoxymethyl)-7-methoxy-8-(3-(3,4,5-
trimethoxyphenoxy)propoxy)-1,2,3,11a-tetrahydro-5H-benzo[e]pyr-
rolo[1,2-a][1,4]diazepine-5,11(10H)-dione (4a). Light yellow oil;
(5b). Light yellow oil; Yield: 83%; 1H NMR (CDCl3, 400 MHz)
d 7.66
(d, J ¼ 4.4 Hz, 1H), 7.50 (s, 1H), 6.81 (s, 1H), 6.14 (s, 2H), 4.20e4.07
(m,1H), 4.00 (t, J ¼ 6.0 Hz, 2H), 3.92 (s, 3H), 3.84 (s, 6H), 3.77 (s, 3H),
3.74e3.54 (m, 3H), 3.47 (s, 1H), 2.34e2.28 (m, 2H), 2.10e1.93 (m,
Yield: 79%; 1H NMR (CDCl3, 400 MHz)
d 7.36 (s,1H), 7.29 (s, 1H), 6.17
(s, 2H), 5.56 (d, J ¼ 10 Hz, 1H), 4.67 (d, J ¼ 10.0 Hz, 1H), 4.29e4.23
(m, 2H), 4.17 (t, J ¼ 6.0 Hz, 2H), 4.13e4.11 (m,1H), 3.92 (s, 3H), 3.84
(s, 6H), 3.78 (s, 3H), 3.77e3.69 (m, 2H), 3.67e3.53 (m,2H),
2.73e2.69 (m, 1H), 2.37e2.31 (m, 2H), 2.13e1.98 (m,3H), 1.26 (t,
6H); 13C NMR (CDCl3, 100 MHz)
d 164.6, 162.4, 155.6, 153.6, 150.7,
147.7, 140.5, 132.1, 120.2, 111.5, 110.4, 95.8, 92.1, 60.9, 56.2, 56.1, 56.0,
53.6, 46.6, 29.6, 29.3, 25.9, 24.1; HRMS (ESI, m/z) C26H32N2O7 calcd
484.5490 found 484.5490.
J ¼ 7.2 Hz, 3H); 13C NMR (CDCl3, 100 MHz)
d 170.1, 164.9, 155.2,
153.5, 150.9, 147.1, 133.7, 132.1, 122.1, 111.2, 106.6, 92.1, 77.9, 65.3,
64.6, 64.4, 60.8, 57.4, 55.9, 55.8, 46.5, 28.9, 26.3, 23.5, 15.1; HRMS
(ESI, m/z) C28H36N2O9Na calcd 567.2318 found 567.2317.
4.1.9.11. (S)-7-methoxy-8-((5-(3,4,5-trimethoxyphenoxy)pentyl)
oxy)-1,2,3,11a-tetrahydro-5H-benzo[e]pyrrolo[1,2-a][1,4]diazepin-5-
one (5c). Light yellow oil; Yield: 85%; 1H NMR (CDCl3, 400 MHz)
d
7.67 (d, J ¼ 4.4 Hz, 1H), 7.52 (s, 1H), 6.81 (s, 1H), 6.15 (s, 2H),
4.1.9.6. (S)-10-(ethoxymethyl)-7-methoxy-8-(4-(3,4,5-
trimethoxyphenoxy)butoxy)-1,2,3,11a-tetrahydro-5H-benzo[e]pyr-
rolo[1,2-a][1,4]diazepine-5,11(10H)-dione (4b). Light yellow oil;
4.17e4.02 (m, 1H), 3.96 (t, J ¼ 6.0 Hz, 2H), 3.94 (s, 3H), 3.86 (s, 6H),
3.79 (s, 3H), 3.74e3.55 (m, 3H), 3.48 (s, 1H), 2.36e2.30 (m, 2H),
2.10e1.83 (m, 6H), 1.70e1.63 (m, 2H); 13C NMR (CDCl3, 100 MHz)
Yield: 87%; 1H NMR (CDCl3, 400 MHz)
d
7.36 (s,1H), 7.28 (s,1H), 6.16
d 164.6, 162.4, 155.7, 153.7, 150.8, 147.8, 140.6, 132.2, 120.2, 111.6,
(s, 2H), 5.58 (d, J ¼ 10.0 Hz,1H), 4.68 (d, J ¼ 10 Hz,1H), 4.15e4.12 (m,
3H), 4.03 (t, J ¼ 6.0 Hz, 2H), 3.89 (s, 3H), 3.84 (s, 6H), 3.81 (s, 3H),
3.74e3.66 (m, 2H), 3.64e3.43 (m, 2H), 2.74e2.68 (m, 1H), 2.18e1.96
110.5, 92.2, 68.8, 67.9, 61.0, 56.2, 56.1, 53.7, 46.6, 29.6, 29.0, 28.7,
24.2, 22.6; HRMS (ESI, m/z) C27H34N2O7 calcd 499.2444 found
499.2441.
(m, 7H), 1.26 (t, J ¼ 7.2 Hz, 3H); 13C NMR (CDCl3, 100 MHz)
d 170.4,
165.6, 155.8, 153.8, 151.5, 147.4, 134.1, 132.3, 121.9, 111.5, 106.7, 92.4,
78.3, 68.8, 67.8, 65.0, 61.1, 57.8, 56.2, 56.0, 46.9, 26.7, 26.2, 25.8, 23.9,
4.1.9.12. (S)-7-methoxy-8-((6-(3,4,5-trimethoxyphenoxy)hexyl)oxy)-
1,2,3,11a-tetrahydro-5H-benzo[e]pyrrolo[1,2-a][1,4]diazepin-5-one
15.5; HRMS (ESI, m/z)
581.2478.
C
29H38N2O9Na calcd 581.2457 found
(5d). Light yellow oil; Yield: 79%; 1H NMR (CDCl3, 400 MHz)
d 7.67
(d, J ¼ 4.4 Hz, 1H), 7.51 (s, 1H), 6.81 (s, 1H), 6.15 (s, 2H), 4.15e4.02
(m, 2H), 3.96 (t, J ¼ 6.0 Hz, 2H), 3.95 (s, 3H), 3.86 (s, 6H), 3.79 (s, 3H),
3.78e3.55 (m, 3H), 3.48 (s, 1H), 2.36e2.30 (m, 2H), 2.10e1.80 (m,
4.1.9.7. (S)-10-(ethoxymethyl)-7-methoxy-8-((5-(3,4,5-
trimethoxyphenoxy)pentyl)oxy)-1,2,3,11a-tetrahydro-5H-benzo[e]
pyrrolo[1,2-a][1,4]diazepine-5,11(10H)-dione (4c). Light yellow oil;
6H), 1.57e1.54 (m, 3H); 13C NMR (CDCl3, 100 MHz)
d 164.6, 162.3,
155.7, 153.6, 150.8, 147.7, 140.6, 132.1, 120.1, 111.5, 110.4, 92.2, 68.8,
68.1, 60.9, 56.1, 56.0, 53.7, 46.6, 29.6, 29.2, 28.8, 25.8, 25.7, 24.1;
HRMS (ESI, m/z) C28H36N2O7 calcd 512.6030 found 512.6031.
Yield: 83%; 1H NMR (CDCl3, 400 MHz)
d 7.36 (s,1H), 7.26 (s,1H), 6.15
(s, 2H), 5.58 (d, J ¼ 10.0 Hz,1H), 4.65 (d, J ¼ 10 Hz,1H), 4.14e3.98 (m,
3H), 3.97 (t, J ¼ 6.0 Hz, 2H), 3.92 (s, 3H), 3.84 (s, 6H), 3.80 (s, 3H),
3.77e3.64 (m, 2H), 3.63e3.53 (m, 2H), 2.74e2.69, (m,1H), 2.11e1.84
(m, 7H), 1.72e1.66 (m, 2H), 1.27 (t, J ¼ 7.2 Hz, 3H); 13C NMR (CDCl3,
4.1.9.13. N-(4-hydroxybutyl)-3,4,5-trimethoxybenzamide
(8b).
7.03 (s,
Pale yellow solid; Yield: 97%; 1H NMR (CDCl3, 400 MHz)
d
100 MHz)
d
170.2, 165.0, 155.5, 153.5, 151.1, 147.1, 133.8, 132.1, 121.9,
2H), 6.86e6.83 (m, 1H), 3.88 (s, 6H), 3.87 (s, 3H), 3.71 (t, J ¼ 6.0 Hz,

Y.-W. Chou et al. / European Journal of Medicinal Chemistry 109 (2016) 59e74
71
2H), 3.45 (q, J ¼ 6.0 Hz, 2H), 2.53e2.01 (s, 1H), 1.75e1.64 (m, 4H);
13C NMR (CDCl3, 100 MHz)
167.4, 153.1, 140.7, 130.1, 104.3, 62.3,
60.8, 56.2, 39.9, 29.8, 26.2; HRMS (ESI, m/z) C14H21NO5Na calcd
306.1317 found 306.1316.
J ¼ 10.0 Hz, 1H), 4.15e4.01 (m, 3H), 3.86 (s, 3H), 3.85 (s, 6H), 3.84
(s,3H), 3.79e3.72 (m, 2H), 3.71e3.52 (m, 2H), 3.48e3.45 (m, 2H),
2.73e2.69 (m, 1H), 2.13e1.99 (m, 3H), 1.98e1.87 (m, 2H), 1.73e1.66
(m, 2H), 1.61e1.53 (m, 2H), 1.26 (t, J ¼ 7.2 Hz, 3H); 13C NMR (CDCl3,
d
100 MHz) d 170.1, 167.0, 164.9, 152.8,150.9, 146.9, 140.4, 133.7, 129.9,
4.1.9.14. N-(5-hydroxypentyl)-3,4,5-trimethoxybenzamide
Pale yellow solid; Yield: 95%; 1H NMR (CDCl3, 400 MHz)
(8c).
7.17e7.14
121.7, 111.1, 106.3, 104.2, 77.9, 68.7, 64.6, 60.6, 57.3, 55.9, 55.8, 46.5,
39.8, 29.1, 28.3, 26.3, 23.5, 23.4, 15.1; HRMS (ESI, m/z)
d
(m, 1H), 7.07 (s, 2H), 3.85 (s, 6H), 3.84 (s, 3H), 3.59 (t, J ¼ 6.0 Hz, 2H),
C31H41N3O9Na calcd 622.2740 found 622.2736.
3.39 (q, J ¼ 6.0 Hz, 2H), 3.32e3.01 (s, 1H), 1.62e1.51 (m, 4H),
1.43e1.37 (m, 2H); 13C NMR (CDCl3, 100 MHz)
d
167.3, 152.8, 140.4,
4.1.9.21. (S)-N-(6-((10-(ethoxymethyl)-7-methoxy-5,11-dioxo-
2,3,5,10,11,11a-hexahydro-1H-benzo[e]pyrrolo[1,2-a][1,4]diazepin-8-
yl)oxy)hexyl)-3,4,5-trimethoxybenzamide (10d). Light yellow oil;
129.9, 104.3, 62.0, 60.6, 55.9, 39.9, 31.9, 29.0, 22.9; HRMS (ESI, m/z)
15H23NO5Na calcd 320.1474 found 320.1471.
C
Yield: 78%; 1H NMR (CDCl3, 400 MHz)
d 7.34 (s,1H), 7.24 (s,1H), 7.02
4.1.9.15. N-(6-hydroxyhexyl)-3,4,5-trimethoxybenzamide
(8d).
7.03 (s,
(s, 2H), 6.47e6.44 (m, 1H), 5.57 (d, J ¼ 10.0 Hz, 1H), 4.67 (d,
J ¼ 10.0 Hz, 1H), 4.13e4.03 (m, 3H), 3.90 (s, 3H), 3.88 (s, 6H), 3.87
(s,3H), 3.76e3.73 (m, 2H), 3.65e3.52 (m, 2H), 3.44e3.43 (m, 2H),
2.73e2.69 (m, 1H), 2.13e1.98 (m, 3H), 1.91e1.84 (m, 2H), 1.69e1.62
(m, 2H), 1.57e1.43 (m, 4H), 1.28 (t, J ¼ 7.2 Hz, 3H); 13C NMR (CDCl3,
Pale yellow solid; Yield: 93%; 1H NMR (CDCl3, 400 MHz)
d
2H), 6.59e6.58 (m, 1H), 3.88 (s, 6H), 3.87 (s, 3H), 3.61 (t, J ¼ 6.0 Hz,
2H), 3.44 (q, J ¼ 6.0 Hz, 2H), 2.28e2.25 (s, 1H), 1.64e1.51 (m, 4H),
1.39e1.34 (m, 4H); 13C NMR (CDCl3, 100 MHz)
d 167.2, 152.9, 140.4,
129.9, 104.1, 62.3, 60.7, 56.0, 39.8, 32.2, 29.4, 26.3, 25.1; HRMS (ESI,
m/z) C16H25NO5Na calcd 334.1630 found 306.1633.
100 MHz) d 170.2, 167.1, 165.1, 153.0, 151.1, 147.1, 133.8, 130.1, 121.8,
111.2, 106.4, 104.2, 78.1, 68.8, 64.7, 60.8, 57.5, 56.2, 55.9, 46.6, 39.9,
29.6, 29.5, 28.6, 26.6, 26.4, 25.5, 23.6, 15.2; HRMS (ESI, m/z)
4 . 1. 9 . 16 . 4 - ( 3 , 4 , 5 - t r i m e t h o x y b e n z a m i d o ) b u t y l 4 -
C32H43N3O9Na calcd 636.2900 found 636.2903.
methylbenzenesulfonate (9b). White solid; Yield: 66%; 1H NMR
(CDCl3, 400 MHz)
7.08 (s, 2H), 7.06e7.03 (m, 1H), 4.03 (t, J ¼ 6.0 Hz, 2H), 3.86 (s, 6H),
3.85 (s, 3H), 3.39 (q, J ¼ 6.0 Hz, 2H), 2.43 (s, 3H), 1.74e1.60 (m, 4H);
13C NMR (CDCl3, 100 MHz)
167.1, 152.8, 144.8, 140.3, 132.4, 129.7,
129.6, 127.5, 104.1, 70.2, 60.6, 55.9, 39.0, 26.1, 25.4, 21.4, HRMS (ESI,
m/z) C21H27NO7SNa calcd 460.1406 found 460.1408.
d
7.74 (d, J ¼ 4.4 Hz, 2H), 7.34 (d, J ¼ 4.4 Hz, 2H),
4.1.9.22. (S)-3,4,5-trimethoxy-N-(4-((7-methoxy-5-oxo-2,3,5,11a-
tetrahydro-1H-benzo[e]pyrrolo[1,2-a][1,4]diazepin-8-yl)oxy)butyl)
benzamide (11b). Light yellow oil; Yield: 74%; 1H NMR (CDCl3,
d
d
400 MHz)
d
7.68 (d, J ¼ 4.4 Hz, 1H), 7.51 (s, 1H), 7.07 (s, 2H),
6.88e6.86 (m, 1H), 6.81 (s, 1H), 4.20e4.08 (m, 2H), 3.88 (s, 3H), 3.87
(s, 6H), 3.81 (s, 3H), 3.75e3.66 (m, 2H), 3.62e3.49 (m, 3H),
2.36e2.31 (m, 2H), 2.12e1.96 (m, 4H), 1.90e1.82 (m, 2H); 13C NMR
4 .1. 9 .17 . 5 - ( 3 , 4 , 5 - t r i m e t h o x y b e n z a m i d o ) p e n t y l 4 -
(CDCl3, 100 MHz) d 167.2, 164.5, 162.6, 153.0, 150.1, 147.5, 140.7,
methylbenzenesulfonate (9c). White solid; Yield: 70%; 1H NMR
130.3, 120.3, 111.5, 110.2, 104.3, 68.7, 60.9, 56.2, 55.9, 53.7, 46.7, 39.2,
29.6, 26.5, 25.8, 24.2; HRMS (ESI, m/z) C27H33N3O7 calcd 512.2397
found 512.2401.
(CDCl3, 400 MHz)
d
7.75 (d, J ¼ 4.4 Hz, 2H), 7.35 (d, J ¼ 4.4 Hz, 2H),
7.32e7.29 (m, 1H), 7.13 (s, 2H), 3.99 (t, J ¼ 6.0 Hz, 2H), 3.85 (s, 6H),
3.83 (s, 3H), 3.37 (q, J ¼ 6.0 Hz, 2H), 2.43 (s, 3H), 1.68e1.34 (m, 6H);
13C NMR (CDCl3, 100 MHz)
d
166.8, 152.5, 144.6, 140.0, 132.3, 129.6,
4.1.9.23. (S)-3,4,5-trimethoxy-N-(5-((7-methoxy-5-oxo-2,3,5,11a-
tetrahydro-1H-benzo[e]pyrrolo[1,2-a][1,4]diazepin-8-yl)oxy)pentyl)
benzamide (11c). Light yellow oil; Yield: 73%; 1H NMR (CDCl3,
129.5, 127.3, 104.0, 70.2, 60.3, 55.7, 39.4, 28.4, 28.0, 22.3, 21.1; HRMS
(ESI, m/z) C22H29NO7SNa calcd 474.1562 found 474.1560.
400 MHz)
d
7.67 (d, J ¼ 4.4 Hz, 1H), 7.49 (s, 1H), 7.04 (s, 2H), 6.79 (s,
4 . 1. 9 . 18 . 6 - ( 3 , 4 , 5 - t r i m e t h o x y b e n z a m i d o ) h e x y l 4 -
1H), 6.57e6.56 (m, 1H), 4.11e4.02 (m, 2H), 3.88 (s, 3H), 3.87 (s, 6H),
3.81 (s, 3H), 3.75e3.66 (m, 2H), 3.62e3.44 (m, 3H), 2.34e2.29 (m,
2H), 2.09e2.88 (m, 6H), 1.73e1.50 (m, 2H); 13C NMR (CDCl3,
methylbenzenesulfonate (9d). White solid; Yield: 61%; 1H NMR
(CDCl3, 400 MHz)
7.05 (s, 2H), 6.67e6.64 (m, 1H), 4.02 (t, J ¼ 7.2 Hz, 2H), 3.87 (s, 6H),
3.86 (s, 3H), 3.42e3.34 (m, 2H), 2.45 (s, 3H), 1.66e1.23 (m, 8H); 13
NMR (CDCl3, 100 MHz) 167.1, 152.9, 144.7, 140.4, 132.7, 129.8,
129.5, 127.6, 104.2, 70.4, 60.7, 56.1, 39.8, 29.2, 28.5, 25.9, 24.8, 21.5;
HRMS (ESI, m/z) C23H31NO7SNa calcd 488.1819 found 488.1721.
d
7.77 (d, J ¼ 4.4 Hz, 2H), 7.33 (d, J ¼ 4.4 Hz, 2H),
100 MHz) d 167.2,164.8,162.8,153.3,150.9,147.9,140.8,130.4,120.4,
C
111.7, 110.6, 104.5, 69.1, 61.1, 56.5, 56.3, 53.9, 46.9, 40.3, 29.8, 29.4,
28.7, 24.4, 23.9; HRMS (ESI, m/z) C28H35N3O7 calcd 526.2553 found
526.2555.
d
4.1.9.24. (S)-3,4,5-trimethoxy-N-(6-((7-methoxy-5-oxo-2,3,5,11a-
tetrahydro-1H-benzo[e]pyrrolo[1,2-a][1,4]diazepin-8-yl)oxy)hexyl)
benzamide (11d). Light yellow oil; Yield: 77%; 1H NMR (CDCl3,
4.1.9.19. (S)-N-(4-((10-(ethoxymethyl)-7-methoxy-5,11-dioxo-
2,3,5,10,11,11a-hexahydro-1H-benzo[e]pyrrolo[1,2-a][1,4]diazepin-8-
yl)oxy)butyl)-3,4,5-trimethoxybenzamide (10b). Light yellow oil;
400 MHz)
d
7.67 (d, J ¼ 4.4 Hz, 1H), 7.51 (s, 1H), 7.00 (s, 2H), 6.79 (s,
Yield: 80%; 1H NMR (CDCl3, 400 MHz)
d
7.33 (s, 1H), 7.25 (s, 1H),
1H), 6.26e6.22 (m, 1H), 4.11e4.05 (m, 2H), 3.93 (s, 3H), 3.91 (s, 6H),
3.88 (s, 3H), 3.81e3.73 (m, 2H), 3.62e3.44 (m, 3H), 2.36e2.29 (m,
2H), 2.07e1.87 (m, 4H), 1.66e1.24 (m, 6H); 13C NMR (CDCl3,
7.21e7.18 (m, 1H), 7.11 (s, 2H), 5.57 (d, J ¼ 10.0 Hz, 1H), 4.67 (d,
J ¼ 10.0 Hz, 1H), 4.16e4.05 (m, 3H), 3.87 (s, 3H), 3.86 (s, 6H), 3.81
(s,3H), 3.80e3.65 (m, 2H), 3.65e3.50 (m, 4H), 2.74e2.70 (m, 1H),
2.11e1.94 (m, 5H), 1.88e1.83 (m, 2H), 1.28 (t, J ¼ 7.2 Hz, 3H); 13C
100 MHz) d 167.3, 164.6, 162.4,153.2,150.8,147.8, 140.6,130.3, 120.1,
111.5, 110.4, 104.3, 68.8, 60.9, 56.3, 56.1, 53.7, 46.7, 40.1, 29.7, 29.6,
28.7, 26.6, 25.6, 24.2; HRMS (ESI, m/z) C29H37N3O7 calcd 540.2710
found 540.2711.
NMR (CDCl3, 100 MHz)
d 170.0, 167.0, 164.9, 152.8, 150.7, 146.7,
140.4, 133.8, 129.9, 121.8, 110.9, 106.1, 104.2, 77.9, 68.5, 64.6, 60.6,
57.3, 55.9, 55.7, 46.5, 39.1, 26.3, 26.1, 25.7, 23.5, 15.1.
4.2. Experimental protocol for biological studies
4.1.9.20. (S)-N-(5-((10-(ethoxymethyl)-7-methoxy-5,11-dioxo-
2,3,5,10,11,11a-hexahydro-1H-benzo[e]pyrrolo[1,2-a][1,4]diazepin-8-
yl)oxy)pentyl)-3,4,5-trimethoxybenzamide (10c). Light yellow oil;
4.2.1. Cell culture
Compounds were dissolved in DMSO at a final concentration of
10 mM and store at ꢂ20 ꢁC. Several cell lines, human melanoma
(A375 and RPMI7951), breast (MCF-7), lung (A549, H1299), and
Yield: 81%; 1H NMR (CDCl3, 400 MHz)
d
7.32 (s,1H), 7.23 (s,1H), 7.07
(s, 2H), 6.8e6.87 (m, 1H), 5.57 (d, J ¼ 10.0 Hz, 1H), 4.67 (d,

72
Y.-W. Chou et al. / European Journal of Medicinal Chemistry 109 (2016) 59e74
mouse melanoma (B16) purchased from American Type Culture
Collection (Manassas, VA), was maintained in DMEM (A375, B16),
MEM (RPMI7951, MCF-7), RPMI1640 (A549) or DMEM-F12 (H1299)
4.2.9. Gene knockdown
A375 cell was plated in 12-well plates at 6 ꢀ 104 cells per well
and cultured overnight at 37 ꢁC in 1 mL of DMEM medium without
antibiotics. The next day, each well was transfected with 30 nM
supplemented with10% FCS and 100 U/mL penicillin G, and 100 mg/
mL streptomycin sulfate (Gibco, BRL). Cells were passaged at
confluence after treatment with 5 mM EDTA (Gibco, BRL) and
incubated at 37 ꢁC in a humidified atmosphere containing 5% CO2.
Fibroblasts were obtained from adult foreskin specimens as pre-
viously described.[53].
siRNA specific for tp53 with 1.5
(Invitrogen). Transfection with 30 nM non target siRNA with 1.5
of Lipofectamine served as the negative control. Cells were har-
vested 24 h after siRNA transfection and then subjected to analyses.
mL of Lipofectamine RNAiMAX
m
L
4.2.10. p53 siRNA
forward, 50- UUACACAUGUAGUUGUAGUGGAUG - 30; reverse, 50
- CCAUCCACUACAACUACAUGUGUA - 30
4.2.2. Cell viability
The protocols used were as described previously [7].
4.2.3. Colony formation assay
4.2.11. Lysosomal Hþ measurement
A375 cells were plated into 6-well plates at a density of 100 cells
per well. On the second day, cells were treated with PBD-GA. Every
3 days, the medium was replaced with fresh medium containing
the agent at 0.5 mM concentration. After a 10 day treatment, the
medium was removed, and cell colonies were stained with SRB
dyes, and pictures were taken using a digital camera.
RPMI 7951 cells were incubated with LysoTracker Green (75 nM)
for 15 min at 37 ꢁC prior to treatment with compounds for indicated
times. Cells were washed and mean fluorescence quantified with
flow cytometer.
4.2.12. Protein extraction and western blot analysis
Mouse monoclonal antibody against p53 and Cdc25c were
purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).
Rabbit polyclonal antibody against p-p53, p-Chk1, BCL-XL and PARP
were purchased from Cell Signaling Biotechnology (Boston, MA,
USA), GeneTex (Irvine, CA, USA), ABGENT (Sandiego, CA, USA) and
Santa Cruz Biotechnology (Santa Cruz, CA, USA), respectively.
Mouse monoclonal antibody against GAPDH and caspase-3 were
purchased from GeneTex (Irvine, CA, USA) and ABGENT (Sandiego,
CA, USA). The methods used were as reported previously [54].
4.2.4. Determination of intracellular ROS level
The methods used were as reported previously [8].
4.2.5. Mitochondrial membrane potential assessment (DJmt
)
The methods utilized were as described previously [8].
4.2.6. Immunocytochemical staining
To clarify the role of the DNA damage indicator p-ATR and p-
ATM, the 8-oxoguanine oxidative stress marker, the mitochondrial
marker COX IV and cytochrome c in A375 cells; cathespin D and
LAMP-1 in RPMI7951 cells; tumor apoptosis marker Annexin V/PI in
B16 cells treated with PBD-GA and its expression were correlated
with apoptotic. Cells were seeded on glass coverslips with a density
of 1 ꢀ 104 cells and were incubated overnight. The cells were
4.2.13. Annexin V/PI staining
Cultured B16 cells were seeded on glass coverslips with a den-
sity of 3 ꢀ 105 cells/well in 6-well plate for 24 h until cell attach-
ment. Then the cells were exposed to compounds at 0.5 mM for 24 h.
The cells were washed twice with PBS and were then stained with
annexin V- FITC and PI (Annexin V-FITC Apoptosis detection Kit;
Strong Biotech Corporation, Taiwan), and then incubated at room
temperature for at least 15 min in the dark. After staining, the
preparations were washed and transferred to glass slides for
observation under a fluorescence microscope (Leica DMI6000,
Wetzlar Germany).
treated with 0.5 mM PBD-GA for 24 h. Immunocytochemistry was
performed on all test samples. Cells were washed several times by
using PBS and fix by 4% formaldehyde for 5 min at 4 ꢁC, then per-
meabilized cell with 0.5% Triton X-100 for 5 min. Non-specific
binding was blocked by 5% bovine serum albumin at 37 ꢁC for
45 min. Cells were incubated 1 h with primary antibodies (mouse
anti-p-ATR and mouse anti-p-ATM at 1:1000, mouse anti-8-
oxoguanine 1:250, rabbit anti-COX IV and mouse anti-
cytochrome c at 1:1000, mouse anti-LAMP1 and rabbit anti-
cathepsin D at 1:500) at RT. Subsequently, slides were incubated
with secondary antibodies for 30 min at RT. Finally, added about
4.2.14. Animal experiment
Seven-week-old female ICR strain mice were obtained and
maintained as described in our previous study.54 B16 cells were
harvested from in vitro incubation and were inoculated s.c. at
40 mL mounting medium contains DAPI to slide and cover with glass
coverslips then sealed with nail polish.
1 ꢀ 106 per animal in 20
ml PBS into the footpad of ICR mice. When
tumors had reached a mean diameter of 4e7 mm (day 0), the an-
imals were randomized into groups of three and treated by i.v.
injection at 0, 2, 4 mg/kg. Body weights and two perpendicular
diameters of the tumors were measured at least 3 times per week.
Each tumor volume was calculated according to the following
equation: v ¼ 0.5236[(l þ w)/2]3, where l and w are the largest and
smallest perpendicular diameters. Tumor volume and body
weights were expressed as mean SEM relative to tumor volume
or body weight values on day 0 (start of treatment). The T/C% ratio
(mean relative tumor volume of the treated tumors/mean relative
volume of control group ¼ 100) was calculated each time the tu-
mors were measured. The lowest value is expressed as the optimal
T/C% for each group. Statistical analysis was performed using t-test.
4.2.7. Cell cycle analysis
The methods used were as reported previously [7].
4.2.8. Quantitative RT-PCR
The methods used were as reported previously [7].
The primers used were:
p53: forward, 50-CCATCCACTACAACTACATGTG - 30; reverse, 50 -
AAAGCTGTTCCGTCCCAGTA - 30
bax: forward, 50- GGATGCGTCCACCACCAAGAAG - 30; reverse, 50
- GCCTTGAGCACCAGTTTGC - 30
bcl-xl: forward, 50- GCACTGTGCGTGGAAAGCGTAGAC
reverse, 50 - CTGAAGAGTGAGCCCAGCAGAACC - 30
-
30;
GAPDH: forward, 50 - GAAGGTGAAGGTCGGAGTCAACG - 30;
reverse, 50 - AGTCCTTCCACGATAACCAAAGTTG - 30
4.2.15. Statistical analysis
The methods used were as reported previously [7].

Y.-W. Chou et al. / European Journal of Medicinal Chemistry 109 (2016) 59e74
703e709.
73
Acknowledgment
[18] M. Uozaki, H. Yamasaki, Y. Katsuyama, M. Higuchi, T. Higuti, A.H. Koyama,
Antiviral effect of octyl gallate against DNA and RNA viruses, Antivir. Res. 73
(2007) 85e91.
We gratefully acknowledge funding from the Ministry of Science
and Technology (MOST), Taiwan. Also supported by a grant from
the Kaohsiung Medical University Research Foundation
(KMU-M102001).
[19] A. Bernhaus, M. Fritzer-Szekeres, M. Grusch, P. Saiko, G. Krupitza,
S. Venkateswarlu, G. Trimurtulu, W. Jaeger, T. Szekeres, Digalloylresveratrol, a
new phenolic acid derivative induces apoptosis and cell cycle arrest in human
HT-29 colon cancer cells, Cancer Lett. 274 (2009) 299e304.
[20] J.A. Jara, V. Castro-Castillo, J. Saavedra-Olavarría, L. Peredo, M. Pavanni, F. Janea,
M.E. Letelier, E. Parra, M.I. Becker, A. Morello, U. Kemmerling, J.D. Maya,
J. Ferreira, Antiproliferative and uncoupling effects of delocalized, lipophilic,
cationic gallic acid derivatives on cancer cell lines. Validation in vivo in sin-
genic mice, J. Med. Chem. 57 (2014) 2440e2454.
[21] M. Inoue, R. Suzuki, T. Koide, N. Sakaguchi, Y. Ogihara, Y. Yabu, Antioxidant,
gallic acid, induces apoptosis in HL-60RG cells, Biochem. Biophys. Res. Com-
mun. 204 (1994) 898e904.
[22] H.M. Chen, Y.C. Wu, Y.C. Chia, F.R. Chang, H.K. Hsu, Y.C. Hsieh, C.C. Chen,
S.S. Yuan, Gallic acid, a major component of Toona sinensis leaf extracts,
contains a ROS-mediated anti-cancer activity in human prostate cancer cells,
Cancer Lett. 286 (2009) 161e171.
[23] J. Wang, J. Yi, Cancer cell killing via ROS: to increase or decrease that is the
question, Cancer Biol. Ther. 7 (2008) 1875e1884.
[24] D. Trachootham, Y. Zhou, H. Zhang, Y. Demizu, Z. Chen, H. Pelicano, P.J. Chiao,
G. Achanta, R.B. Arlinghaus, J. Liu, P. Huang, Selective killing of oncogenically
transformed cells through a ROS-mediated mechanism by beta-phenylethyl
isothiocyanate, Cancer Cell 10 (2006) 241e252.
[25] M. Crompton, The mitochondrial permeability transition pore and its role in
cell death, Biochem. J. 341 (1999) 233e249.
Appendix A. Supporting information
Supporting information related to this article can be found at
http://dx.doi.org/10.1016/j.ejmech.2015.12.039.
Experimental procedures for QSAR studies and docking figures
for compound 5a,d and 11aed. 1H and 13C spectra for the com-
pounds 2, 4, 5, 8, 9, 10 and 11. The HPLC chromatogram for the
compounds 5aed and 11aed.
References
[1] D.E. Thurston, Advances in the study of pyrrolo[2,1-c][1, 4]-benzodiazepine
(PBD) antitumor antibiotics, in: S. Neidle, M.J. Waring (Eds.), Molecular As-
pects of Anticancer Drug-DNA Interactions, vol. 1, Macmillan Press, New York,
1993, p. 54.
[26] D. Dominguez-Sola, C.Y. Ying, C. Grandori, L. Ruggiero, B. Chen, M. Li,
D.A. Galloway, W. Gu, J. Gautier, R. Dalla-Faver, Non-transcriptional control of
DNA replication by c-Myc, Nature 448 (2007) 445e451.
[2] S. Alcaro, F. Ortuso, R.S. Coleman, DNA cross-linking by azinomycin B: Monte
Carlo simulations in the evaluation of sequence selectivity, J. Med. Chem. 45
(2002) 861e865.
[3] M. Rettig, W. Langel, A. Kamal, K. Weisz, NMR structural studies on the co-
valent DNA binding of a pyrrolobenzodiazepineenaphthalimide conjugate,
Org. Biomol. Chem. 8 (2010) 3179e3187.
[27] B. Fadeel, S. Orrenius, Apoptosis:
a basic biological phenomenon with
wide-ranging implications in human disease, J. Intern Med. 258 (2005)
479e517.
[28] C. de Duve, Lysosomes revisited, Eur. J. Biochem. 137 (1983) 391e397.
[29] B. Turk, V. Stoka, Protease signalling in cell death: caspases versus cysteine
cathepsins, FEBS Lett. 581 (2007) 2761.
[4] W.eP. Hu, J.eJ. Wang, F.L. Lin, Y.C. Lin, S.R. Lin, M.H. Hsu, An efficient synthesis
of pyrrolo[2,1-c]-[1,4]benzodiazepine. Synthesis of the antibiotic DC-81, J. Org.
Chem. 66 (2001) 2881e2883.
[30] A. Kamal, R.V.C.R.N.C. Shetti, M.J. Ramaiah, P. Swapna, K.S. Reddy,
A. Mallareddy, M.P.N. Rao, M. Chourasia, G.N. Sastry, A. Juvekar, S. Zingde,
P. Sarma, S.N.C.V.L. Pushpavalli, M.P. Bhadra, Carbazoleepyrrolo[2,1-c][1,4]
benzodiazepine conjugates: design, synthesis, and biological evaluation, Med.
Chem. Commun. 2 (2011) 780e788.
[31] R.X. Xu, A.M. Hassell, D. Vanderwall, M.H. Lambert, W.D. Holmes, M.A. Luther,
W.J. Rocque, M.V. Milburn, Y. Zhao, H. Ke, R.T. Nolte, Atomic structure of PDE4:
insights into phosphodiesterase mechanism and specificity, Science 288
(2000) 1822e1825.
[5] P.E. Cross, R.P. Dickinson, M.J. Parry, M.J. Randall, Selective thromboxane
synthetase inhibitors. 3. 1H-imidazol-1-yl-substituted benzo[b]furan-, benzo
[b]thiophene-, and indole-2- and -3-carboxylic acids, J. Med. Chem. 29 (1986)
1637e1643.
[6] S. Mahboobi, H. Pongratz, H. Hufsky, J. Hockemeyer, M. Frieser, A. Lyssenko,
€
D.H. Paper, J. Bürgermeister, F.D. Bohmer, H.H. Fiebig, A.M. Burger,
S. Baasner, T. Beckers, Synthetic 2-aroylindole derivatives as a new class of
potent tubulin-inhibitory, antimitotic agents, J. Med. Chem. 44 (2001)
4535e4553.
[32] A. Kamal, M.K. Reddy, A.K. Srivastava, Y.V.V. Srikanth, (2012) Pyrrolobenzo-
diazepines as Sequence Selective DNA Binding Agents, Medicinal Chemistry
and Drug Design, Prof Deniz Ekinci (Ed.), ISBN: 978-953-51-0513-8, InTech,
Available from: intechopen.com/books/medicinal-chemistry-and drug-
design/pyrrolobenzodiazepines-as-sequence-selective-dna-binding-agents.
[33] A. Barzilai, K. Yamamoto, DNA damage responses to oxidative stress, DNA
Repair 3 (2004) 1109e1115.
[34] W. Meikrantz, R. Schlegel, Apoptosis and the cell cycle, J. Cell Biochem. 58
(1995) 160e174.
[35] M.B. Kastan, D.S. Lim, The many substrates and functions of ATM, Nat. Rev.
Mol. Cell. Biol. 1 (2000) 179e186.
[7] J.J. Wang, Y.K. Shen, W.P. Hu, M.C. Hsieh, F.L. Lin, M.K. Hsu, M.H. Hsu,
Design, synthesis, and biological evaluation of pyrrolo[2,1-c][1,4]benzodi-
azepine and indole conjugates as anticancer agents, J. Med. Chem. 49
(2006) 1442e1449.
[8] W.P. Hu, H.S. Yu, P.J. Sung, F.Y. Tsai, Y.K. Shen, L.S. Chang, J.J. Wang, DC-81-
indole conjugate agent induces mitochondria mediated apoptosis in human
melanoma A375 cells, Chem. Res. Toxicol. 20 (2007) 905e912.
[9] W.P. Hu, F.Y. Tsai, H.S. Yu, P.J. Sung, L.S. Chang, J.J. Wang, Induction of
apoptosis by DC-81-indole conjugate agent through NF-kappaB and JNK/AP-1
pathway, Chem. Res. Toxicol. 21 (2008) 1330e1336.
[10] C.H. Lee, W.P. Hu, C.H. Hong, H.S. Yu, W.T. Liao, C.Y. Chen, Y.L. Chen, B.H. Chen,
G.S. Chen, J.J. Wang, Pyrrolo[2,1-c][1,4]benzodiazepine and indole conjugate
(IN6CPBD) has better efficacy and superior safety than the mother compound
DC-81 in suppressing the growth of established melanoma in vivo, Chem. Biol.
Interact. 180 (2009) 360e367.
[36] N. Rhind, P. Russell, Chk1 and Cds1: linchpins of the DNA damage and
replication checkpoint pathways, J. Cell Sci. 113 (2000) 3889e3896.
[37] J. Bartek, J. Lukas, Chk1 and Chk2 kinases in checkpoint control and cancer,
Cancer Cell 3 (2003) 421e429.
[38] J. Hutson, J. Ramsdale, M. Wells, p53 protein expression in putative pre-
cursor lesions of epithelial ovarian cancer, Histopathology 27 (1995)
367e371.
[11] M.C. Hsieh, W.P. Hu, H.S. Yu, W.C. Wu, L.S. Chang, Y.H. Kao, J.J. Wang, A DC 81-
indole conjugate agent suppresses melanoma A375 cell migration partially via
interrupting VEGF production and stromal cell-derived factor-1a-mediated
[39] C.K. Ho, G. Li, Mutant p53 melanoma cell lines respond differently to CP-
31398-induced apoptosis, Br. J. Dermatol. 153 (2005) 900e910.
[40] G.S. Salvesen, V.M. Dixit, Caspases: intracellular signaling by proteolysis, Cell
91 (1997) 443e448.
[41] Y. Shi, Mechanisms of caspase activation and inhibition during apoptosis, Mol.
Cell. 9 (2002) 459e470.
signaling, Toxicol. Appl. Pharmacol. 150 (2011) 150e159.
[12] M. Konishi, H. Ohkuma, T. Tsuno, T. Oki, G.D. VanDuyne, J. Clardy, Crystal and
molecular structure of dynemicin A: a novel 1,5-diyn-3-ene antitumor anti-
biotic, J. Am. Chem. Soc. 112 (1990) 3715e3716.
[13] M.D. Lee, T.S. Dunne, M.M. Siegel, C.C. Chang, G.O. Morton, D.B. Borders,
Calichemicins,
a novel family of antitumor antibiotics. 1. Chemistry and
[42] D.A. Hildeman, T. Mitchell, T.K. Teague, P. Henson, B.J. Day, J. Kappler,
partial structure of calichemicin.gamma.1I, J. Am. Chem. Soc. 109 (1987)
3464e3466.
P.C. Marrack, Reactive oxygen species regulate activation-induced
T cell
apoptosis, Immunity 10 (1999) 735e744.
[14] K.C. Nicolaou, W.M. Dai, Chemistry and biology of the enediyne anticancer
antibiotics, Angew. Chem. Int. Ed. 30 (1991) 1387e1416.
[15] W.P. Hu, J.J. Liang, C.L. Kao, Y.C. Chen, C.Y. Chen, F.Y. Tsai, M.J. Wu, L.S. Chang,
Y.L. Chen, J.J. Wang, Synthesis and antitumor activity of novel enediyne
-linked pyrrolo[2,1-c] [1,4]benzodiazepine hybrids, Bioorg. Med. Chem. 17
(2009) 1172e1180.
[16] C.Y. Chen, Y.K. Chen, J.J. Wang, C.C. Hsu, F.Y. Tsai, P.J. Sung, H.C. Lin, L.S. Hu,
W.P. Chang, DC-81-enediyne induces apoptosis of human melanoma A375
cells: involvement of the ROS, p38 MAPK, and AP-1 signaling pathways, Cell.
Biol. Toxicol. 29 (2013) 85e99.
[17] H. Khaledi, A.A. Alhadi, W.A. Yehye, H.M. Ali, M.A. Abdulla, P. Hassandarvish,
Antioxidant, cytotoxic activities, and structureeactivity relationship of gallic
acid-based indole derivatives, Arch. Pharm. Chem. Life Sci. 344 (2011)
[43] C.C. Yang, S.D. Lin, H.S. Yu, Effect of growth factors on dermal fibroblast
contraction in normal skin and hypertrophic scar, J. Dermatol. Sci. 14 (1997)
162e169.
[44] R.M. Kluck, E. Bossy-Wetzel, D.R. Green, D.D. Newmeyer, The release of cy-
tochrome
c from mitochondria: a primary site for Bcl-2 regulation of
apoptosis, Science 275 (1997) 1132e1136.
[45] E. Rudolf, M. Cervinka, Sulforaphane induces cytotoxicity and lysosome- and
mitochondria-dependent cell death in colon cancer cells with deleted p53,
Toxicol Vitro 25 (2011) 1302e1309.
[46] P. Boya, Lysosomal function and dysfunction: mechanism and disease, Anti-
oxid. Redox Signal 17 (2012) 766e774.
[47] C.E. Chwieralski, T. Welte, F. Bühling, Cathepsin-regulated apoptosis,

74
Y.-W. Chou et al. / European Journal of Medicinal Chemistry 109 (2016) 59e74
ꢀ
Apoptosis 11 (2006) 143e149.
[49] S. Pervaiz, M.A. Seyed, J.L. Hirpara, M.V. Clement, K.W. Loh, Purified photo-
products of merocyanine 540 trigger cytochrome C release and caspase 8-
dependent apoptosis in human leukemia and melanoma cells, Blood 93
(1999) 4096e4108.
[48] A.C. Johansson, H. Appelqvist, C. Nilsson, K. Kågedal, K. Roberg, K. Ollinger,
Regulation of apoptosis-associated lysosomal membrane permeabilization,
Apoptosis 15 (2010) 527e540.