Itaconic acid derivatives and diketopiperazine from the marine-derived fungus Aspergillus aculeatus CRI322-03

Article abstract of DOI:10.1016/j.phytochem.2011.02.013

Three metabolites, pre-aurantiamine (1), (-)-9-hydroxyhexylitaconic acid (4) and (-)-9-hydroxyhexylitaconic acid-4-methyl ester (5), together with two known compounds, paraherquamide E (6) and secalonic acid D (7), were isolated from the marine-derived fu

Full text of DOI:10.1016/j.phytochem.2011.02.013

Phytochemistry 72 (2011) 816–820
Contents lists available at ScienceDirect
Phytochemistry
journal homepage: www.elsevier.com/locate/phytochem
Itaconic acid derivatives and diketopiperazine from the marine-derived fungus
Aspergillus aculeatus CRI322-03
Bassey S. Antia a,b, Thammarat Aree c, Chairut Kasettrathat a, Suthep Wiyakrutta d, Okon D. Ekpa b,
Udofot J. Ekpe b, Chulabhorn Mahidol a,e,f, Somsak Ruchirawat a,e,f, Prasat Kittakoop a,e,
⇑
a Chulabhorn Research Institute, Vibhavadi-Rangsit Road, Bangkok 10210, Thailand
b Department of Pure and Applied Chemistry, University of Calabar, Calabar, Nigeria
c Department of Chemistry, Faculty of Science, Chulalongkorn University, Bangkok 10330, Thailand
d Department of Microbiology, Faculty of Science, Mahidol University, Bangkok 10400, Thailand
e Chulabhorn Graduate Institute and the Center for Environmental Health, Toxicology and Management of Chemicals (ETM), Chemical Biology Program, Vibhavadi-Rangsit Road,
Bangkok 10210, Thailand
f Chulabhorn Research Centre, Institute of Molecular Biosciences, Mahidol University, Bangkok, Thailand
a r t i c l e i n f o
a b s t r a c t
Article history:
Received 16 July 2010
Received in revised form 27 December 2010
Accepted 14 February 2011
Available online 10 March 2011
Three metabolites, pre-aurantiamine (1), (ꢀ)-9-hydroxyhexylitaconic acid (4) and (ꢀ)-9-hydroxyhexylit-
aconic acid-4-methyl ester (5), together with two known compounds, paraherquamide E (6) and secalon-
ic acid D (7), were isolated from the marine-derived fungus, Aspergillus aculeatus.
Ó 2011 Elsevier Ltd. All rights reserved.
Keywords:
Aspergillus aculeatus
Marine-derived fungi
Diketopiperazine
Itaconic acid derivatives
1. Introduction
from a marine sponge, Stylissa flabelliformis, while the strain
CRI323-04 was isolated from a different sponge (Xestospongia
Marine-derived fungi are rich sources of bioactive compounds
(Parvatkar et al., 2009; Prachyawarakorn et al., 2008; Trisuwan
et al., 2008, 2009). Our continuing search for bioactive compounds
from marine-derived fungi isolated from Thai marine invertebrates
has led to the discovery of many bioactive compounds (Ingavat
et al., 2009; Kasettrathat et al., 2008; Prachyawarakorn et al.,
2008). In our experience, these fungi could grow rapidly in salt
containing media (seawater), but most of them hardly grow in
media without salt supplements, and sometimes, those that do
grow in non-saline media change their morphology when cultured
under such conditions. We define these fungi as ‘‘marine-derived
fungi’’ rather than marine fungi which obligately require seawater
testudinaria). Herein, we report isolation of three new compounds;
pre-aurantiamine (1), (ꢀ)-9-hydroxyhexylitaconic acid (4), and
(ꢀ)-9-hydroxyhexylitaconic acid-4-methyl ester (5), as well as
two known metabolites, paraherquamide E (6) (Liesch and Wich-
mann, 1990) and secalonic acid D (7) (Andersen et al., 1977)
(Fig. 1), from A. aculeatus CRI322-03.
2. Results and discussion
2.1. Structural determination
for their growth. Recently, we reported a new tyrosine-derived
a
-
Separation of a crude broth extract of the marine-derived
fungus, A. aculeatus CRI322-03, by Sephadex LH-20 and silica gel
chromatographic techniques yielded pre-aurantiamine (1), (ꢀ)-9-
hydroxyhexylitaconic acid (4), and (ꢀ)-9-hydroxyhexylitaconic
acid-4-methyl ester (5). Similar separation of the corresponding
mycelial extract provided pre-aurantiamine (1), paraherquamide
E (6), and secalonic acid D (7). Identification of known fungal
metabolites 6 and 7 was achieved by analysis of spectroscopic data,
as well as by data comparison with those reported in the literature
(Andersen et al., 1977; Liesch and Wichmann, 1990). The structure
glucosidase inhibitor, aspergillusol A, obtained on a gram scale
from the marine-derived fungus Aspergillus aculeatus CRI323-04
(Ingavat et al., 2009). Interestingly, we found that another strain
of A. aculeatus, designated as CRI322-03, produced different classes
of secondary metabolites. Fungal strain CRI322-03 was isolated
⇑
Corresponding author at: Chulabhorn Research Institute, Vibhavadi-Rangsit
Road, Bangkok 10210, Thailand. Tel.: +66 86 9755777; fax: +66 2 5740622x1513.
E-mail address: prasatkittakoop@yahoo.com (P. Kittakoop).
0031-9422/$ - see front matter Ó 2011 Elsevier Ltd. All rights reserved.
doi:10.1016/j.phytochem.2011.02.013

B.S. Antia et al. / Phytochemistry 72 (2011) 816–820
817
14
13
O
OR3
O
O
O
7
5
9
1 OR1
OR2
8
NH
3
N
NH
N
9
2
15
2
10
HN
6
10
8
HN
NH
NR
4
3
7
11
4
12
1
6
5
O
O
1, R = H
2, R = CH3
4, R1 = H, R2 = H, R3 = H
3, Aurantiamine
4a, R1 = CH3, R2 = CH3, R3 = H
4b, R1 = CH3, R2 = CH3, R3 = (S)-MTPA
4c, R1 = CH3, R2 = CH3, R3 = (R)-MTPA
5, R1 = H, R2 = CH3, R3 = H
Fig. 1. Structure of compounds 1–5.
of paraherquamide E (6) was also confirmed by a single X-ray
crystallographic analysis (Aree et al., 2010).
diketopiperazine unit (e.g. 1), and a prenyltransferase can transfer
an isoprene unit to furnish 3. Both enzymes are known in the biosyn-
thesis of several natural products (Gondry et al., 2009; Li, 2009;
Saleh et al., 2009).
Pre-aurantiamine (1) exhibited a molecular formula C11H14N4O2,
as indicated by APCI-TOF MS data. Its IR spectrum exhibited charac-
teristic stretching frequencies of an amide NH (3193 cmꢀ1) and
amide carbonyls (1660 and 1634 cmꢀ1). The presence of amide car-
bonyls in 1 was further supported by the 13C NMR spectroscopic res-
onances at dC 160.3 and 165.3. The 1H NMR spectrum (acetone-d6) of
pre-aurantiamine (1) showed signals for three exchangeable NH
protons, three sp2 methines, two sp3 methines, and two methyl
groups. The 13C NMR and DEPT data for 1 indicated the presence
of two methyl, five methine, and four non-protonated carbons in
1. The 1H–1H COSY spectrum of pre-aurantiamine (1) displayed cor-
relations between H-10 and H-13; H-13 and H3-14; and H-13 and
H3-15, which established a possible valine unit in 1. The 1H–1H COSY
spectrum of 1 also demonstrated allylic coupling between H-5 and
H-6. The HMBC spectrum exhibited correlations from H-2 to C-4
and C-5; H-5 to C-2, C-4, and C-6; H-6 to C-4, C-5, and C-12; H-10
to C-9, C-12, C-14, and C-15; H-13 to C-9, and both H3-14 and H3-
15 to C-10. Interestingly, the HMBC spectrum of 1 also showed a
four-bond correlation (4JCH coupling) from H-5 to C-7, and from H-
6 to C-9. The HMBC correlations from 1-NH to C-2 and C-5, and from
8-NH to C-7 and C-9 established the positions of 1-NH and 8-NH,
respectively. Based upon these spectroscopic data, the structure of
pre-aurantiamine (1) was established. Assignments of proton and
carbon signals for pre-aurantiamine (1) are shown in Table 1. The
NOESY spectrum of pre-aurantiamine (1) showed a correlation be-
tween H-5 and H-6, indicating that these olefinic protons are in close
proximity, and thus establishing the Z geometry of the 6,7-double
bond in 1. Additionally, crystals of pre-aurantiamine (1) were ob-
tained and subsequently subjected to a single X-ray crystallographic
analysis (ORTEP plot in Fig. 2). The structure of pre-aurantiamine (1)
was therefore conclusively confirmed, and indeed, the 6,7-double
bond in 1 has the Z-configuration. In the solid state of 1, a hydrogen
bond between the 8-NH proton and the N-3 was observed (Fig. 2).
Methylation of pre-aurantiamine (1) with MeI/K2CO3 in DMF affor-
ded a monomethylated product 2. Pre-aurantiamine (1) is structur-
ally related to (ꢀ)-aurantiamine (3) (Larsen et al., 1992), which is an
isomeric derivative of viridamine (Holzapfel and Marsh, 1977). Pre-
aurantiamine (1) exhibited a negative specific rotation (ꢀ160)
similar to those of aurantiamine (3) (ꢀ116) (Larsen et al., 1992)
and viridamine (ꢀ95) (Holzapfel and Marsh, 1977; Larsen et al.,
1992), suggesting that these diketopiperazines likely share the same
absolute configuration at C-10. A total synthesis of aurantiamine
The APCI-TOF MS data established the molecular formula
11H18O5 for compound 4. The IR absorption bands at 1702 and
C
1628 cmꢀ1 suggested the presence of carbonyl groups, and the
13C NMR spectrum showed resonances at dC 174.1 and 167.3, fur-
ther supporting the presence of carbonyl carbons in 4. The 1H
NMR spectrum of compound 4 exhibited signals for exo-methylene
protons at dH 5.79 and 6.32, two sp3 methines at dH 3.49 and 3.70,
four methylenes at dH 1.33–1.91, and a methyl group at dH 1.09.
Analysis of 13C NMR and HMQC spectra of 4 established that the
methine at dH 3.70 (dC 67.0) corresponded to an oxygen-bonded
sp3 methine, while the signal at dH 3.49 (dC 46.7) did not. The DEPT
spectrum of 4 demonstrated the presence of one methyl, five
methylene, two methine, and three non-protonated carbons.
According to the molecular formula, together with the data de-
scribed above, compound 4 has one hydroxyl group and two car-
boxylic acid units. The 1H–1H COSY spectrum of 4 showed
coupling between H-2 and H2-5, and also established a partial
structure from H2-5 along the chain through H3-10 of a hydrox-
yhexyl moiety in 4. The HMBC spectrum exhibited correlations
from H-2 to C-1, C-3, C-4, C-5, C-6, and C-11, from H2-5 to C-1,
C-2, and C-3, and from H2-11 to C-2, C-3, and C-4. On the basis
of these data, compound 4 was identified as 9-hydroxyhexylita-
conic acid. The 1H and 13C NMR resonances for 4 are assigned as
shown in Table 1. Compound 4 exhibited a negative rotation,
therefore, it likely has the same configuration as that of its deriva-
tive, (ꢀ)-9-hydroxyhexylitaconic acid-1-methyl ester (Klemke
et al., 2004). However, based upon available spectroscopic data,
the configuration at C-2 in 4 could not be defined. Attempts to clar-
ify the configuration of the C-9 hydroxyl group in 4 were carried
out using Mosher’s method (Dale and Mosher, 1973). First, both
carboxylic acid groups in 4 were protected by methylation to yield
the dimethylated 4a, which was esterified with Mosher’s acid to
give (S)- and (R)-MTPA esters (4b and 4c). Unfortunately, this
method could not establish the C-9 configuration in 4 due to iden-
tical chemical shift differences at H3-10 and H2-8 for the S- and
R-Mosher ester derivatives. Similarly, the Mosher’s method
previously failed to clarify the C-9 configuration in (ꢀ)-9-hydroxy-
hexylitaconic acid-1-methyl ester (Klemke et al., 2004), which is a
closely related derivative of 4.
Compound 5 had a molecular formula C12H20O5, deduced from
APCI-TOF MS data. In general, the 1H and 13C NMR spectra of com-
pound 5 shared a great deal of similarity to those of (ꢀ)-9-
hydroxyhexylitaconic acid (4). One additional signal for a methoxy
group (dH 3.71 and dC 52.0) was observed in the 1H and 13C NMR
spectra of 5. Analysis of the 1H and 13C NMR spectra of compound
established that valine in (ꢀ)-aurantiamine (3) was
(Hayashi et al., 2000), therefore, pre-aurantiamine (1) should also
have -valine in its molecule. A cyclodipeptide synthase and prenyl-
L-amino acid
L
transferase are possibly involved in the biosynthesis of (ꢀ)-auranti-
amine (3). Cyclodipeptide synthase catalyzes the formation of a

818
B.S. Antia et al. / Phytochemistry 72 (2011) 816–820
Table 1
1H and 13C NMR spectroscopic data for compounds 1, 4 and 5.
Position
1 (Acetone-d6)
dH (J in Hz)
4 (Acetone-d6)
5 (CDCl3)
dC
dH (J in Hz)
dC
dH (J in Hz)
dC
1
2
3
4
5
6
7
8
–
–
–
174.1
46.7
139.9
167.3
31.5
27.9
25.7
39.4
67.0
23.3
126.0
–
–
–
–
–
–
–
–
–
175.0
47.5
140.2
167.2
31.9
28.2
26.2
39.8
67.2
23.8
126.2
52.0
–
–
–
–
–
–
–
7.88 (s)
–
–
7.44 (s)
6.60 (s)
–
–
136.6
–
3.49 (t, 7.3)
–
–
1.68 (m); 1.87 (m)
1.33 (m)
1.40 (m)
1.40 (m)
3.70 (m)
1.09 (d, 6.2)
5.79 (s); 6.32 (s)
–
–
–
–
–
–
–
–
3.48 (t, 7.2)
–
–
1.65 (m); 1.87 (m)
1.33 (m)
1.40 (m)
1.37 (m)
3.67 (m)
1.09 (d, 6.2)
5.80 (s); 6.27 (s)
3.71 (s)
–
–
–
–
–
–
–
138.0
118.4
103.9
125.8
–
165.3
61.4
–
9
–
10
11
OMe
12
13
14
15
1-NH
8-NH
11-NH
4.04 (d, 3.0)
–
–
–
–
160.3
34.2
18.3
16.5
–
2.31 (m)
1.05 (d, 7.1)
0.93 (d, 6.8)
11.75 (br s)
11.65 (br s)
7.41 (br s)
–
–
3. Experimental
3.1. General experimental procedures
Melting points were measured on a digital Electrothermal 9100
Melting Point Apparatus and reported without correction. Optical
rotations were measured using the sodium D line (590 nm) on a
JASCO DIP-370 digital polarimeter. UV–Vis spectra were obtained
using a Shimadzu UV-1700 PharmaSpec Spectrophotometer. FT-IR
data were obtained using a universal attenuated total reflectance
(UATR) attachment on a Perkin-Elmer Spectrum One spectrometer.
1H and 13C NMR spectra were recorded on a Bruker AM 400 NMR
instrument (operating at 400 MHz for 1H and 100 MHz for 13C)
and a Bruker AVANCE 600 NMR spectrometer (operating at
600 MHz for 1H and 150 MHz for 13C). APCI-TOF MS were deter-
mined using a Bruker MicroTOFLC spectrometer.
Fig. 2. ORTEP plot of pre-aurantiamine (1).
3.2. Fungal material and identification
5, together with the molecular formula, indicated that compound 5
was an O-methyl derivative of (ꢀ)-9-hydroxyhexylitaconic acid
(4). The HMBC spectrum of 5 indicated that the methoxy group
was attached to the C-4 carbonyl by the following correlations:
from OMe protons to C-4, and from H2-11 to C-2, C-3, and C-4.
The HMBC correlations from H2-5 to C-1, C-2, and C-3 unambigu-
ously assigned the position of C-1 carbonyl in 5. Compound
5 showed a negative rotation as did 4; therefore, it was identified
as (ꢀ)-9-hydroxyhexylitaconic acid-4-methyl ester. Again,
Mosher’s method failed to clarify the C-9 configuration in 5, be-
cause there were no differences in chemical shifts at H3-10 and
H2-8 of the S- and R-Mosher esters. Assignments of 1H and 13C
NMR resonances for 5 are in Table 1.
A. aculeatus CRI322-03 was isolated from a marine sponge, S.
flabelliformis (specimen No. CRI322), which was collected in
November 2006, by SCUBA diving at 35–40 feet, from Ton Sai
Bay, Phi Phi Islands, Krabi province, Thailand. The fungal isolate
was identified based on morphological characteristics and analysis
of sequences of the ITS1-5.8S-ITS2 ribosomal RNA gene region
and the calmodulin gene, and their DNA sequences were depos-
ited in GenBank under accession numbers of HM055488 and
HM055489, respectively. Culture of the CRI322-03 fungus grew
rapidly on Czapek solution agar at 25 °C reached a colony diameter
of 5.5 cm in 6 days. Morphological characteristics were only sug-
gestive of A. aculeatus which is very close to A. aculeatinus and A.
japonicus. Molecular phylogenetic analysis was required for a more
definite identification of this fungus.
2.2. Concluding remarks
3.2.1. DNA sequence-based identification
A new diketopiperazine, pre-aurantiamine (1), and two new ita-
conic acid derivatives, (ꢀ)-9-hydroxyhexylitaconic acid (4) and
(ꢀ)-9-hydroxyhexylitaconic acid-4-methyl ester (5), together with
two known compounds, paraherquamide E (6) and secalonic acid D
(7), were isolated from the marine-derived fungus, A. aculeatus
CRI322-03. While another marine-derived isolate of A. aculeatus
(CRI323-04) produced a tyrosine-derived metabolite, aspergillusol
A (Ingavat et al., 2009), A. aculeatus CRI322-03 produced different
classes of secondary metabolites (1 and 4–7).
The CRI322-03 fungus was cultured in potato dextrose broth for
4 days and total cellular DNA was extracted from the washed fun-
gal mycelium using FTAÒ Plant Kit (WhatmanÒ, USA) according to
the manufacturer’s instructions.
3.2.2. Identification based on ribosomal RNA gene sequence
The ITS1-5.8S-ITS2 of the ribosomal RNA gene region was
amplified from the fungal genomic DNA by PCR (GoTaqÒ Colorless

B.S. Antia et al. / Phytochemistry 72 (2011) 816–820
819
Master Mix, Promega) using the ITS5 (GGAAGTAAAAGTCGTAA-
CAAGG) and ITS4 (TCCTCCGCTTATTGATATGC) primers (White
et al., 1990) as previously described (Prachya et al., 2007). The
PCR amplified ITS1-5.8S-ITS2 fragment was purified and directly
subjected to DNA sequencing reactions on both strands using the
primers ITS5 and ITS4. The DNA sequence obtained was submitted
to BLASTN 2.2.23+ (Zhang et al., 2000) to search for similar se-
quences in GenBank. Sequence identities at 99–100% were found
with many reference strains of A. aculeatus and A. japonicus. A phy-
logenetic tree constructed from these analyses showed that the
CRI322-03 associated with the A. aculeatus cluster. However, since
the ITS1-5.8S-ITS2 region was so highly conserved, separation be-
tween A. aculeatus and A. japonicus was not well supported based
on these sequences.
fied by silica gel CC, eluting with MeOH:CH2Cl2 (0.5:9.5, v/v) to
yield (ꢀ)-9-hydroxyhexylitaconic acid-4-methyl ester (5)
(18.6 mg). Fractions B10 and B11 (144.0 mg) were combined and
further separated by Sephadex LH-20 CC (eluted with MeOH) to
yield (ꢀ)-9-hydroxyhexylitaconic acid (4) (42.3 mg). Fraction B14
(195.8 mg) was separated by Sephadex LH-20 CC, and nine frac-
tions (B14.1 to B14.9) were obtained. Fractions B14.6 and B14.7
were combined (74.0 mg) and further separated by Sephadex LH-
20 CC, eluted with MeOH, to obtain 12 fractions (B14.67.1 to
B14.67.12). Fractions B14.67.5 to B14.67.10 were combined
(58.0 mg) and subjected to silica gel CC using a mixture of
MeOH:CH2Cl2 (0.5:9.5, v/v) as eluent to furnish 12 mg of pre-aur-
antiamine (1).
The crude cell extract was suspended in MeOH (40 mL), and fil-
tered, giving soluble and insoluble portions. The insoluble residue
was extracted with acetone, and the acetone-soluble portion was
evaporated to yield secalonic acid D (7) (40.5 mg). The crude
MeOH-soluble extract was separated by Sephadex LH-20 CC to af-
ford eleven fractions (C1 to C11). Fraction C4 (164.0 mg) was further
purified by Sephadex LH-20 CC to yield eight fractions (C4.1 to C4.8).
Fractions C4.5 and C4.6 were combined (38.8 mg) and purified by
preparative TLC developed with a mixture of MeOH:CH2Cl2 (3:97,
3.2.3. Identification based on calmodulin (cmdA) gene sequence
DNA sequences of the calmodulin gene are more variable than
the ribosomal RNA gene and thus giving higher discriminative
power in separating closely related fungal species. The calmodulin
gene of the CRI322-03 fungus was amplified by PCR from genomic
DNA using the cmd5 (CCGAGTACAAGGAGGCCTTC) and cmd6
(CCGATAGAGGTCATAACGTGG) primers (Hong et al., 2006). The
amplified calmodulin fragments were purified and directly sub-
jected to DNA sequencing on both strands using the cmd5 and
cmd6 primers. BLASTN 2.2.23+ (Zhang et al., 2000) search against
GenBank established that the cmdA gene of the CRI322-03 fungus
was homologous with reference strains of A. aculeatus (95–100%
identity), A. aculeatinus (95% identity), and A japonicus (93% iden-
tity). Phylogenetic analysis was performed using the neighbor-
joining method with 1000 replications bootstrap. The CRI322-03
was placed in the same clade with A. aculeatus, well separated from
the A. aculeatinus and A. japonicus clusters.
v/v) to furnish paraherquamide
E (6) (10 mg). Fraction C6
(127.4 mg) was separated by Sephadex LH-20 CC, eluted with
MeOH, to give eight fractions (C6.1 to C6.8). Fractions C6.5 and
C6.6 were combined (40.0 mg) and further purified by silica gel
CC, eluted with a mixture of MeOH:CH2Cl2 (0.5:9.5, v/v), to afford
pre-aurantiamine (1) (10.3 mg).
3.4. Spectroscopic data of compounds
3.4.1. Pre-aurantiamine (1)
Based on macroscopic and microscopic morphological charac-
teristics, phylogenetic analyses of the ITS1-5.8S-ITS2, and calmod-
ulin gene sequences, this marine-derived fungus was identified as
A. aculeatus CRI322-03. DNA sequences of the ITS1-5.8S-ITS2 and
the partial cmdA gene of the CRI322-03 fungus have been submit-
ted to GenBank with the accession numbers of HM055488 and
HM055489, respectively. A subculture of CRI322-03 has been
deposited at Chulabhorn Research Institute (CRI) and MIM Labora-
tory, Department of Microbiology, Mahidol University, Thailand.
Colorless crystals (from MeOH:hexane, 9:1); m.p. 212–215 °C;
27
[a
]
ꢀ160 (c 0.24, MeOH); UV (MeOH) kmax (log
e) 307 (3.97)
D
and 230 (3.52) nm; IR (UATR) mmax 3193, 2963, 2926, 1660, 1634,
1551, 1432, 1378, 1276, 857 and 773 cmꢀ1; APCI-TOF MS: m/z
235.1183 [M+H]+ (calcd. for C11H15N4O2, 235.1195); for 1H and
13C NMR spectroscopic data, see Table 1.
3.4.2. (ꢀ)-9-Hydroxyhexylitaconic acid (4)
27
Pale brown viscous oil; [
a]
D ꢀ8.4 (c 0.39, MeOH); UV (MeOH)
kmax (log e) 219 (3.63) nm; IR (UATR) mmax 3401, 2933, 2860, 1702,
3.3. Extraction and isolation
1628, 1409, 1376, 1263, 1220, 1156, 958 and 825 cmꢀ1; APCI-TOF
MS: m/z 231.1228 [M+H]+ (calcd. for C11H19O5, 231.1232); for 1H
and 13C NMR spectroscopic data, see Table 1.
The fungus A. aculeatus CRI322-03 was grown on PDA agar and
then transferred to potato dextrose broth (PDB) constituted seawa-
ter instead of distilled H2O. The fungus was inoculated into 1 L
Erlenmeyer flasks (20 flasks), each containing 250 mL of PDB, and
incubated under static conditions for 30 days. The fermentation
culture (5 L) was separated into mycelia and broth by filtration.
The broth was extracted with an equal volume of EtOAc four times.
The EtOAc layers were combined and evaporated to yield a crude
broth extract (954 mg). The mycelia (cells) were extracted sequen-
tially in MeOH and CH2Cl2, each for two times at room temperature.
The MeOH and CH2Cl2 extracts were combined, suspended with
distilled H2O (600 mL), and partitioned with hexane (400 mL; 4
times) to remove fatty acids and triglycerides. The aqueous extract
obtained was further partitioned with an equal volume of EtOAc (4
times) and evaporated, yielding a crude cell extract (1.1 g).
The crude broth extract was separated by Sephadex LH-20 col-
umn chromatography (CC) eluting with MeOH. Thirty-six fractions
were combined on the basis of TLC pattern (developed with EtOAc:
CH2Cl2, 1:1, v/v), giving 22 fractions (B1 to B22). Fractions B5 to B7
(143 mg) were combined and subjected to Sephadex LH-20 CC,
eluting with MeOH to yield 11 fractions (B57.1 to B57.11). Frac-
tions B57.9 and B57.10 were combined (57.6 mg) and further puri-
3.4.3. (ꢀ)-9-Hydroxyhexylitaconic acid-4-methyl ester (5)
27
Pale brown viscous oil; [
a]
D ꢀ9.3 (c 0.38, MeOH); UV (MeOH)
kmax (log e) 219 (3.50) nm; IR (UATR) mmax 3406, 2929, 2853, 1709,
1575, 1405, 1220 and 820 cmꢀ1; APCI-TOF MS: m/z 245.1387
[M + H]+ (calcd. for C12H21O5, 245.1389); for 1H and 13C NMR spec-
troscopic data, see Table 1.
3.5. Methylation of pre-aurantiamine (1)
To a solution of pre-aurantiamine (1) (10.0 mg) in DMF (1.5 mL)
was added K2CO3 (118.0 mg) and MeI (0.5 mL). A reaction mixture
was left stirring at room temperature for 20 h, dried under vacuum.
The mixture was dissolved in EtOAc (30 mL) and subsequently
washed with distilled H2O (4 ꢁ 30 mL). The EtOAc layer was dried
to give a crude reaction mixture (15.8 mg), which was purified by
Sephadex LH-20 eluted with MeOH, to obtain the methylated
27
derivative 2 (7.0 mg). Methylated derivative 2: [
a
]
ꢀ65 (c
D
0.10, MeOH); 1H NMR (600 MHz, acetone-d6) d 11.54 (1H, br s,
11-NH), 11.50 (1H, br s, 8-NH), 7.73 (1H, s, H-2), 7.33 (1H, s, H-
5), 6.51 (1H, s, H-6), 4.14 (1H, d, J = 2.9 Hz), 3.79 (3H, s, 1-NCH3),

820
B.S. Antia et al. / Phytochemistry 72 (2011) 816–820
2.26–2.34 (1H, m, H-10), 1.04 (3H, d, J = 7.1 Hz), 0.92 (3H, d,
J = 6.8 Hz); 13C NMR (150 MHz, acetone-d6) d 165.4 (C, C-9),
160.2 (C, C-12), 139.1 (CH, C-2), 138.7 (C, C-4), 126.2 (C, C-7),
122.5 (CH, C-5), 103.6 (CH, C-6), 61.5 (CH, C-10), 34.3 (CH2, C-
13), 33.5 (C, 1-NCH3), 18.3 (CH3, C-14), 16.6 (CH3, C-15); APCI-
TOF MS: m/z 249.1353 [M+H]+ (calcd. for C12H17N4O2, 249.1352).
to the CCDC via www.ccdc.cam.ac.uk/conts/retrieving.html (or 12
Union Road, Cambridge CB2 1EZ, UK, fax: +44 1223 336033, e-
mail: deposit@ccdc.cam.ac.uk).
Acknowledgements
P.K. is grateful to The Thailand Research Fund (Grant No.
DBG5180014) and the Center for Environmental Health, Toxicology
and Management of Chemicals (ETM) for financial support. S.W. is
supported by a Mahidol University research grant. T.A. is grateful
to the Thai Government Stimulus Package 2 (TKK2555) and the
Centre for Petroleum, Petrochemicals and Advanced Materials,
Chulalongkorn University.
3.6. Methylation of 4
To a solution of compound 4 (23.1 mg) in DMF (2 mL) were
added K2CO3 (26.8 mg) and MeI (0.13 mL), and the mixture was
stirred for 20 h. The mixture was dried, dissolved in EtOAc
(8 mL), and washed with H2O (5 ꢁ 8 mL), to afford a dimethylated
derivative 4a (15.5 mg). 1H NMR (CDCl3, 400 MHz) d 6.38 (1H, s, H-
11a), 5.77 (1H, s, H-11b), 3.78 (4H, s, 4-OMe and H-9), 3.69 (3H, s,
1-OMe), 3.51 (1H, t, J = 8.0 Hz, H-2), 1.90–1.27 (8H, m, H2-5 to H2-
8), 1.20 (3H, d, J = 8.0 Hz, H3-10).
References
Andersen, R., Buechi, G., Kobbe, B., Demain, A.L., 1977. Secalonic acids D and F are
toxic metabolites of Aspergillus aculeatus. J. Org. Chem. 42, 352–353.
Aree, T., Antia, B.S., Ekpa, O.D., Kittakoop, P., 2010. Paraherquamide E. Acta
Crystallogr. E66, o2227.
3.7. Preparation of (R)- and (S)-MTPA esters of 4a
Dale, J.A., Mosher, H.S., 1973. Nuclear magnetic resonance enantiomer
reagents. Configurational correlations via nuclear magnetic resonance
chemical shifts of diastereomeric mandelate, O-methylmandelate, and a-
methoxy-a-trifluoromethylphenylacetate (MTPA) esters. J. Am. Chem. Soc. 95,
512–519.
Gondry, M., Sauguet, L., Belin, P., Thai, R., Amouroux, R., Tellier, C., Tuphile, K.,
Jacquet, M., Braud, S., Courcon, M., Masson, C., Dubois, S., Lautru, S., Lecoq, A.,
Hashimoto, S., Genet, R., Pernodet, J.L., 2009. Cyclodipeptide synthases are a
family of tRNA-dependent peptide bond-forming enzymes. Nat. Chem. Biol. 5,
414–420.
Hayashi, Y., Orikasa, S., Tanaka, K., Kanoh, K., Kiso, Y., 2000. Total synthesis of anti-
microtubule diketopiperazine derivatives: phenylahistin and aurantiamine. J.
Org. Chem. 65, 8402–8405.
Holzapfel, C.W., Marsh, J.J., 1977. Isolation and structure of viridamine, a new
nitrogenous metabolite of Penicillium viridicatum Westling. South Afr. J. Chem.
30, 197–204.
Hong, S.B., Cho, H.S., Shin, H.D., Frisvad, J.C., Samson, R.A., 2006. Novel Neosartorya
species isolated from soil in Korea. Int. J. Syst. Evol. Microbiol. 56, 477–486.
Ingavat, N., Dobereiner, J., Wiyakrutta, S., Mahidol, C., Ruchirawat, S., Kittakoop, P.,
2009. Aspergillusol A, an alpha-glucosidase inhibitor from the marine-derived
fungus Aspergillus aculeatus. J. Nat. Prod. 72, 2049–2052.
Kasettrathat, C., Ngamrojanavanich, N., Wiyakrutta, S., Mahidol, C., Ruchirawat, S.,
Kittakoop, P., 2008. Cytotoxic and antiplasmodial substances from marine-
derived fungi, Nodulisporium sp. and CRI247-01. Phytochemistry 69, 2621–
2626.
Klemke, C., Kehraus, S., Wright, A.D., Konig, G.M., 2004. New secondary metabolites
from the marine endophytic fungus Apiospora montagnei. J. Nat. Prod. 67, 1058–
1063.
Larsen, T.O., Frisvad, J.C., Jensen, S.R., 1992. Aurantiamine, a diketopiperazine from
two varieties of Penicillium aurantiogriseum. Phytochemistry 31, 1613–1615.
Li, S.M., 2009. Evolution of aromatic prenyltransferases in the biosynthesis of indole
derivatives. Phytochemistry 70, 1746–1757.
The reaction mixture containing compound 4a (6.5 mg), (R)-(+)-
-methoxy-a-(trifluoromethyl)phenylacetic acid (MTPA; 9.9 mg),
a
N,N0-dicyclohexylcarbodiimine (15.6 mg), and a catalytic amount
of N,N-(dimethylamino)pyridine was dissolved in CH2Cl2 (2 mL),
and stirred at room temperature for 20 h. The reaction mixture
was added to H2O (5 mL) and extracted with CHCl3 (5 mL). The
mixture was purified by preparative TLC, eluted with 10% EtOAc
in hexane, to give the (R)-MTPA ester (4c; 5.7 mg). The (S)-MTPA
ester was prepared in the same manner; compound 4a was reacted
with (S)-(ꢀ)-a-methoxy-a-(trifluoromethyl)phenylacetic acid
(MTPA), to give the (S)-MTPA ester (4b; 5.8 mg). (S)-MTPA ester
(4b); 1H NMR (CDCl3, 400 MHz) d 7.52 (2H, m, aromatic signals
of MTPA), 7.40 (3H, m, aromatic signals of MTPA), 6.35 (1H, s, H-
11a), 5.72 (1H, s, H-11b), 5.12 (1H, sext, J = 5.9 Hz, H-9), 3.77
(3H, s, 4-OMe), 3.68 (3H, s, 1-OMe), 3.55 (3H, br d, OMe of MTPA),
3.48 (1H, t, J = 7.2 Hz, H-2), 2.50–0.50 (8H, m, H2-5 to H2-8), 1.33
(3H, d, J = 6 Hz, H3-10). (R)-MTPA ester (4c); 1H NMR (CDCl3,
400 MHz) d 7.52 (2H, m, aromatic signals of MTPA), 7.40 (3H, m,
aromatic signals of MTPA), 6.35 (1H, s, H-11a), 5.72 (1H, s, H-
11b), 5.12 (1H, sext, J = 6.2 Hz, H-9), 3.77 (3H, s, 4-OMe), 3.68
(3H, s, 1-OMe), 3.55 (3H, br d, OMe of MTPA), 3.45 (1H, t, J = 7.4,
H-2), 2.00–0.90 (8H, m, H2-5 to H2-8), 1.33 (3H, d, J = 6.3, H3-10).
3.8. X-ray crystal structure of pre-aurantiamine (1)
Liesch, J.M., Wichmann, C.F., 1990. Novel antinematodal and antiparasitic agents
from Penicillium charlesii. II. Structure determination of paraherquamides B, C,
D, E, F, and G. J. Antibiot. 43, 1380–1386.
Crystals of pre-aurantiamine (1) were obtained from slow
solvent evaporation of MeOH–hexane solution (9:1 v/v) without
solvent of crystallization as C11H14N4O2 in the trigonal space group
P31 or P32 (No. 144 or 145) with unit cell constants a = 9.0535(3) Å,
c = 12.2765(4) Å, V = 871.44(5) Å3, Z = 3, Dcalc = 1.339 g/cm3, MW =
234.26. A colorless block-like single crystal of 1 with dimensions
0.20 ꢁ 0.25 ꢁ 0.42 mm3 was mounted with epoxy glue on the tip
of a glass fiber. The X-ray diffraction experiment was performed
at 298(2) K using a Bruker X8 APEX2 Kappa CCD area-detector dif-
Parvatkar, R.R., D’Souza, C., Tripathi, A., Naik, C.G., 2009. Aspernolides A and B,
butenolides from a marine-derived fungus Aspergillus terreus. Phytochemistry
70, 128–132.
Prachya, S., Wiyakrutta, S., Sriubolmas, N., Ngamrojanavanich, N., Mahidol, C.,
Ruchirawat, S., Kittakoop, P., 2007. Cytotoxic mycoepoxydiene derivatives from
an endophytic fungus Phomopsis sp. isolated from Hydnocarpus anthelminthicus.
Planta Med. 73, 1418–1420.
Prachyawarakorn, V., Mahidol, C., Sureram, S., Sangpetsiripan, S., Wiyakrutta, S.,
Ruchirawat, S., Kittakoop, P., 2008. Diketopiperazines and phthalides from a
marine derived fungus of the order Pleosporales. Planta Med. 74, 69–72.
Saleh, O., Haagen, Y., Seeger, K., Heide, L., 2009. Prenyl transfer to aromatic
substrates in the biosynthesis of aminocoumarins, meroterpenoids and
phenazines: the ABBA prenyltransferase family. Phytochemistry 70, 1728–
1738.
Trisuwan, K., Rukachaisirikul, V., Sukpondma, Y., Preedanon, S., Phongpaichit, S.,
Rungjindamai, N., Sakayaroj, J., 2008. Epoxydons and a pyrone from the marine-
derived fungus Nigrospora sp. PSU-F5. J. Nat. Prod. 71, 1323–1326.
Trisuwan, K., Rukachaisirikul, V., Sukpondma, Y., Preedanon, S., Phongpaichit, S.,
Sakayaroj, J., 2009. Pyrone derivatives from the marine-derived fungus
Nigrospora sp. PSU-F18. Phytochemistry 70, 554–557.
fractometer with MoKa radiation (k = 0.71073 Å). A total of 3914
reflections were collected, integrated, reduced by SAINT+, cor-
rected for Lorentz polarization and absorption effects, and scaled
by SADABS (Bruker Software Suite, APEX2, SAINT+ and SADABS.
Bruker AXS Inc., Madison, Wisconsin, USA, 2005) to yield 2191
independent reflections (Rint = 0.018). The structure was solved
by direct methods and refined with full-matrix least squares on
F2 using SHELXL-97 (Sheldrick, G.M., 1997. University of Gottingen,
Gottingen, Germany). The final R1(F2) = 0.055 and wR(F2) = 0.129
White, T.J., Bruns, T., Lee, S., Taylor, J., 1990. Amplification and direct sequencing of
fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A., Gelfand, D.H.,
Sninsky, J.J., White, T.J. (Eds.), PCR Protocols:
A Guide to Methods and
for 1644 data with F2 > 2 (F2). Data have been deposited with
r
the Cambridge Crystallographic Data Centre (CCDC 784196). Cop-
ies of these data can be obtained, free of charge, on application
Applications. Academic Press, San Diego, pp. 315–322.
Zhang, Z., Schwartz, S., Wagner, L., Miller, W., 2000. A greedy algorithm for aligning
DNA sequences. J. Comput. Biol. 7, 203–214.