Characterization of new potential anticancer drugs designed to overcome glutathione transferase mediated resistance

Article abstract of DOI:10.1021/mp2000692

Resistance against anticancer drugs remains a serious obstacle in cancer treatment. Here we used novel strategies to target microsomal glutathione transferase 1 (MGST1) and glutathione transferase pi (GSTP) that are often overexpressed in tumors and confer resistance against a number of cytostatic drugs, including cisplatin and doxorubicin (DOX). By synthetically combining cisplatin with a GST inhibitor, ethacrynic acid, to form ethacraplatin, it was previously shown that cytosolic GST inhibition was improved and that cells became more sensitive to cisplatin. Here we show that ethacraplatin is easily taken up by the cells and can reverse cisplatin resistance in MGST1 overexpressing MCF7 cells. A second and novel strategy to overcome GST mediated resistance involves using GST releasable cytostatic drugs. Here we synthesized two derivatives of DOX, 2,4-dinitrobenzenesulfonyl doxorubicin (DNS-DOX) and 4-mononitrobenzenesulfonyl doxorubicin (MNS-DOX) and showed that they are substrates for MGST1 and GSTP (releasing DOX). MGST1 overexpressing cells are resistant to DOX. The resistance is partially reversed by DNS-DOX. Interestingly, the less reactive MNS-DOX was more cytotoxic to cells overexpressing MGST1 than control cells. It would appear that, by controlling the reactivity of the prodrug, and thereby the DOX release rate, selective toxicity to MGST1 overexpressing cells can be achieved. In the case of V79 cells, DOX resistance proportional to GSTP expression levels was noted. In this case, not only was drug resistance eliminated by DNS-DOX but a striking GSTP-dependent increase in toxicity was observed in the clonogenic assay. In summary, MGST1 and GSTP resistance to cytostatic drugs can be overcome and cytotoxicity can be enhanced in GST overexpressing cells.

Full text of DOI:10.1021/mp2000692

ARTICLE
pubs.acs.org/molecularpharmaceutics
Characterization of New Potential Anticancer Drugs Designed To
Overcome Glutathione Transferase Mediated Resistance
Katarina Johansson,† Mika Ito,‡,§ Carolien M. S. Schophuizen,† Sherin Mathew Thengumtharayil,†
Vanina D. Heuser,† Jie Zhang,† Miyuki Shimoji,† Marie Vahter,† Wee Han Ang,|| Paul J. Dyson,^ Aya Shibata,‡
Satoshi Shuto,§ Yoshihiro, Ito,‡ Hiroshi Abe,‡ and Ralf Morgenstern*,†
†Institute of Environmental Medicine, Karolinska Institutet, SE-17177 Stockholm, Sweden
‡Nano Medical Engineering Laboratory Discovery Research Institute, RIKEN Advanced Science Institute, 2-1 Hirosawa, Wako-Shi,
Saitama 351-0198, Japan
§Faculty of Pharmaceutical Sciences, Hokkaido University, Kita-12, Nishi-6, Kita-ku, Sapporo 060-0812, Japan
Department of Chemistry, National University of Singapore, 3 Science Drive 3, Singapore 117543
^Institut des Sciences et Ingꢀenierie Chimiques, Ecole Polytechnique Fꢀedꢀerale de Lausanne (EPFL), CH-1015 Lausanne, Switzerland
ABSTRACT: Resistance against anticancer drugs remains a serious
obstacle in cancer treatment. Here we used novel strategies to target
microsomal glutathione transferase 1 (MGST1) and glutathione
transferase pi (GSTP) that are often overexpressed in tumors and
confer resistance against a number of cytostatic drugs, including
cisplatin and doxorubicin (DOX). By synthetically combining
cisplatin with a GST inhibitor, ethacrynic acid, to form ethacraplatin,
it was previously shown that cytosolic GST inhibition was improved
and that cells became more sensitive to cisplatin. Here we show that
ethacraplatin is easily taken up by the cells and can reverse cisplatin
resistance in MGST1 overexpressing MCF7 cells. A second and
novel strategy to overcome GST mediated resistance involves using
GST releasable cytostatic drugs. Here we synthesized two derivatives of DOX, 2,4-dinitrobenzenesulfonyl doxorubicin (DNS-DOX) and
4-mononitrobenzenesulfonyl doxorubicin (MNS-DOX) and showed that they are substrates for MGST1 and GSTP (releasing DOX).
MGST1 overexpressing cells are resistant to DOX. The resistance is partially reversed by DNS-DOX. Interestingly, the less reactive MNS-
DOX was more cytotoxic to cells overexpressing MGST1 than control cells. It would appear that, by controlling the reactivity of the prodrug,
and thereby the DOX release rate, selective toxicity to MGST1 overexpressing cells can be achieved. In the case of V79 cells, DOX resistance
proportional to GSTP expression levels was noted. In this case, not only was drug resistance eliminated by DNS-DOX but a striking GSTP-
dependent increase in toxicity was observed in the clonogenic assay. In summary, MGST1 and GSTP resistance to cytostatic drugs can be
overcome and cytotoxicity can be enhanced in GST overexpressing cells.
KEYWORDS: glutathione transferase, drug resistance, cytostatic drug
’ INTRODUCTION
are especially affected by anticancer drugs, in particular, cells in
the bone marrow, hair follicles and gastrointestinal mucosa.
There are also specific side effects for different kinds of cytostatic
drugs; doxorubicin (DOX), for example, is cardiotoxic,1 and
cisplatin has several known side effects, including nephrotoxicity,2
ototoxicity3 and neurotoxicity.4 These side effects could be
reduced by the use of prodrugs that have a higher degree of
tumor specificity. Prodrugs are derivatives of cytotoxic drugs that
are activated in vivo to release the parent drug to exert a desired
pharmacological effect.5 Since GSTs are often overexpressed in
Cancer is the second leading cause of premature death in privi-
leged countries. Failure of chemotherapy is a significant problem
often caused when malignant cells develop resistance against antic-
ancer drugs. Drug resistance is correlated to many different bio-
chemical changes, including decreased influx and increased efflux of
the cytotoxic drugs as well as altered expression of genes that control
the cell cycle and apoptosis. Cytostatic drugs can also be detoxified
by enzymes (e.g., glutathione transferases, GSTs that can be induced
during chemotherapy). Some cancer cells have intrinsic resistance
(before drug treatment) while others develop resistance during
chemotherapy. This acquired resistance frequently involves cross-
resistance to other drugs.
Received: February 11, 2011
Accepted: August 18, 2011
Another obstacle in cancer therapy is the severe side effects
that are induced by antineoplastic agents. Rapidly dividing cells
Revised:
Published: August 18, 2011
August 17, 2011
r
2011 American Chemical Society
1698
dx.doi.org/10.1021/mp2000692 Mol. Pharmaceutics 2011, 8, 1698–1708
|

Molecular Pharmaceutics
ARTICLE
cancer cells, these enzymes are potential (pro-)drug targets; for a
recent review see ref 6.
4-mononitrobenzenesulfonyl DOX (MNS-DOX; Figure 1). It
has previously been shown that GST enzymes display sulfona-
midase activity against other activated sulfonamides.31,32 The design
envisaged that the prodrugs enter the cells via passive diffusion
(facilitated by a large increase in lipophilicity) and are then converted
into the active parent drug (e.g., DOX) by overexpressed GSTs.
Since the mono- and dinitrobenzenesulfonamide moieties are
blocking an amino group on DOX suggested to be important
for toxicity, the prodrugs are predicted to be less toxic before
cleavage,33,34 achieving not only target specificity but potentially
lower side effects as well.
Both MGST1 and GSTP have been shown to be overexpressed
in tumor cells compared to nonmalignant tissues, suggested to be
early markers of tumorigenesis and connected to resistance against
several anticancer drugs.11,16ꢀ19,35 Thus, these enzymes are inter-
esting targets for developing improved anticancer strategies. Here
we show that GST inhibitor and GST prodrugs in combination
with established cytostatic drugs could be promising strategies
overcoming drug resistance at the cellular level. Further, we show
that a modification of the drug affecting reactivity and GST
turnover can have a large impact on toxicity.
Glutathione transferases are enzymes that are involved in the
cellular conjugation or reduction of hydrophobic, electrophilic
substances of both xenobiotic and endobiotic origin. Several
cytostatic drugs are detoxified by GSTs.7 In this study we have
used cell lines that overexpress the membrane bound microsomal
glutathione transferase 1 (MGST1) and glutathione transferase
pi (GSTP) respectively. Both MGST1 and GSTP can be over-
expressed in cancer cells compared to nonmalignant cells and
have also been linked to anticancer drug resistance.7ꢀ9 For
excellent reviews consult refs 7 and 10ꢀ12.
Microsomal GST1 is a membrane bound enzyme primarily
located in the outer membrane of mitochondria and in the endo-
plasmic reticulum (ER) membrane. We have previously shown
that cells that overexpress MGST1 are more resistant to several
common anticancer drugs.9 MGST1 is distinct from cytosolic
GST forms and displays unique features regarding enzymatic
properties and its activation by sulfhydryl reagents, such as
N-ethylmaleimide.13 It has been shown that several commonly
used anticancer drugs are substrates for MGST1 and can also
activate MGST1.14,15 MGST1 is upregulated in many different
malignant tissues compared to normal tissues (e.g., testicular,
brain, lung, Ewing sarcoma and colorectal tumors).8,16ꢀ20 Mi-
crosomal GST1 has also been suggested to be an early marker for
tumorigenesis.19 By performing a comprehensive gene expres-
sion analysis it was recently shown that a poor prognosis for
Ewing sarcoma patients, due to DOX resistance, is correlated to
higher MGST1 expression in tumors.8
’ MATERIALS AND METHODS
Chemicals. Dulbecco’s modified Eagle's medium (DMEM),
fetal bovine serum (FBS), phosphate-buffered saline and penicil-
lin/streptomycin were purchased from GIBCO; cisplatin, reduced
glutathione (GSH), 1-chloro-2,4-dinitrobenzene (CDNB), DOX
and EA, all reagents for SDSꢀpolyacrylamide gel electrophoresis
(SDSꢀPAGE) and Western blot analysis were purchased from
Sigma Aldrich. Ethacraplatin was synthesized as described.27,28
DNS-DOX and MNS-DOX were synthesized essentially as de-
scribed for ref 36.
GSTP is mainly located in the cytosol, but there are indications
that GSTP also can be translocated to the nucleus, especially
in cancer cells.21 GSTP has been suggested to have several roles
in drug resistance. The protein is involved in direct detoxifica-
tion, but also plays an indirect role in blocking apoptosis via c-Jun
N-terminal kinase 1 (JNK1) inhibition by direct proteinꢀ
protein interaction.22 Inturn, JNK1 has been shown to be involved
in cellular stress response, apoptosis and proliferation. Experi-
ments with the GSTP inhibitor Telintra (TLK199) indicated
that TLK199 is involved in dissociating GSTP from JNK.23 JNK
then initiates the signal transduction pathway by phosphorylating
c-Jun. TLK 199 is presently being used to stimulate the produc-
tion of blood cells in the bone marrow in phase II studies on
patients with myelodysplastic syndrome (MDS).24 Another
example of a prodrug is Telcyta (TLK-286), which releases toxic
phosphorodiamidate to spontaneously form alkylating aziridi-
nium species upon catalytic conversion by GSTP.25,26
Synthesis of Prodrug. Prodrug was synthesized as depicted in
Scheme 1.
DNS-DOX (1). N,N-Diisopropylethylamine (60 μL, 340 μmol)
was added to a solution of doxorubicin (15 mg, 26 μmol) in
dimethylformamide (520 μL) at 0 ꢀC. 2,4-Dinitrobenzensulfonyl
chloride (23 mg, 86 μmol) was added to the reaction mixture.
The mixture was stirred 35 min at the same temperature and then
warmed to room temperature. After stirring for 30 min, the
reaction mixture was diluted with ethyl acetate and washed with
saturated NaHCO3 aq. The organic layer was dried over Na2SO4
and evaporated in vacuo. The residue was purified by flash
column chromatography (chloroform: acetone = 3:1) to give
desired compound 1 (9.9 mg, 13 μmol, 49%).
In this article we have investigated three potential anticancer
drugs designed to overcome GST mediated resistance by distinct
mechanisms. The first drug, called ethacraplatin, is cisplatin
conjugated to ethacrynic acid (EA).27,28 Ethacrynic acid is a potent
GST inhibitor29 and a diuretic used in the clinic.30 Ethacraplatin is
more hydrophobic than cisplatin and is therefore suggested to have
a higher bioavailability. Ethacraplatin is thought to enter cells by
passive diffusion where it is cleaved to release cisplatin and GST
inhibiting EA. Ang et al. have previously shown that several cancer
cell lines are more sensitive to ethacraplatin compared to cisplatin.
In these same studies, adducts formed between ethacraplatin and
GSTA1-1 and GSTP were observed.27,28 Here we have further
investigated the mechanism of ethacraplatin, focusing on the ability
of ethacraplatin to overcome MGST1 mediated cisplatin resistance.9
We also tested the cytotoxicity of two different derivatives
of DOX, 2,4-dinitrobenzenesulfonyl DOX (DNS-DOX) and
1H NMR (400 MHz, DMSO): δ 8.73 (1H, s, DNs), 8.49ꢀ8.47
(1H, d, DNs, J = 8.7), 8.27ꢀ8.24 (1H, d, DNs, J = 8.7), 7.89 (2H,
S, dox), 7.64 (1H, s, dox), 5.17 (1H, s, dox), 4.89 (1H, s, dox), 4.54
(2H, s, dox), 4.21ꢀ4.02 (2H, m, dox), 3.99 (3H, s, dox),
3.62ꢀ3.59 (1H, d, dox, J = 12.1), 3.34 (1H, s, dox), 2.94 (2H, s,
dox, J = 6.3), 2.13ꢀ1.89 (2H, m, dox), 1.40ꢀ1.38 (1H, d, J = 8.7),
1.10ꢀ1.08 (3H, d, dox, J = 6.2). 13C NMR (125 MHz, DMSO):
δ 161.39, 156.56, 154.90, 149.85, 147.69, 139.55, 137.56, 136.74,
135.90, 135.14, 134.61, 133.79, 131.72, 127.61, 120.38, 120.19,
119.46, 111.18, 100.27, 75.41, 70.46, 69.27, 67.19, 64.14, 57.10,
50.97, 37.24, 32.61, 30.81, 17.45.
HR-ESI-MS (ESI) m/z: calcd for C33H30N3O17Sꢀ ([M ꢀ H]ꢀ)
772.12656, found 772.12833.
MNS-DOX (2). Synthesis of compound 2 was carried out in a sim-
ilar manner as described for compound 1 from doxorubicin (15 mg,
0.026 mmol), N,N-diisopropylethylamine (60 μL, 0.34 mmol), and
1699
dx.doi.org/10.1021/mp2000692 |Mol. Pharmaceutics 2011, 8, 1698–1708

Molecular Pharmaceutics
ARTICLE
Figure 1. Chemical structures and proposed conversion of DNS-DOX and MNS-DOX by GSTs. Conversion of DNS/MNS-DOX to free DOX, sulfur
dioxide and a di/mononitrobenzene moiety conjugated to GSH. DNS-DOX and MNS-DOX consist of DOX conjugated to a dinitrobenzene or
mononitrobenzene sulfonamide moiety. These two lipophilic prodrugs are hypothesized to enter the cell via passive diffusion. Within the cell GSTs are
able to activate the prodrugs to DOX via their sulfonamidase activity.
4-nitrobenzensulfonyl chloride (16 mg, 73 μmol). Desired
compound 2 was purified by reverse-phase HPLC (0ꢀ85%
acetonitrile/50 mM triethylammonium acetate gradient) to give
4.7 mg (6.4 μmol, 25%).
Scheme 1. Synthesis of Prodrug
1H NMR (400 MHz, DMSO): δ 8.73 (1H, s, DNs), 8.49ꢀ8.47
(1H, d, DNs, J = 8.7), 8.27ꢀ8.24 (1H, d, DNs, J = 8.7), 7.89 (2H,
S, dox), 7.64 (1H, s, dox), 5.17 (1H, s, dox), 4.89 (1H, s, dox), 4.54
(2H, s, dox), 4.21ꢀ4.02 (2H, m, dox), 3.99 (3H, s, dox),
3.62ꢀ3.59 (1H, d, dox, J = 12.1), 3.34 (1H, s, dox), 2.94 (2H, s,
dox, J = 6.3), 2.13ꢀ1.89 (2H, m, dox), 1.40ꢀ1.38 (1H, d, J = 8.7),
1.10ꢀ1.08 (3H, d, dox, J = 6.2). 13C NMR (100 MHz, DMSO):
δ 186.38, 181.02, 149.79, 164.65, 161.60, 160.78, 156.12, 154.46,
142.12, 139.18, 136.21, 135.50, 134.54, 134.17, 129.27, 126.20,
119.974, 119.01, 116.60, 110.62, 106.62, 99.98, 74.86, 69.83, 69.33,
66.91, 63.59, 56.53, 53.03, 49.67, 20.59, 16.97.
HR-ESI-MS (ESI) m/z: calcd for C33H31N2O15Sꢀ ([M ꢀ H]ꢀ)
727.14451, found 727.14734.
DNA Polymerase (Stratagene) and were carried out in 10 cycles,
each involving denaturation at 94 ꢀC, 30 s, annealing at 40 ꢀC,
60 s, elongation at 72 ꢀC, 2 min, plus 20 cycles with denaturation at
94 ꢀC, 5 s, annealing at 50 ꢀC, 60 s, elongation at 72 ꢀC, 2 min,
followed by a final 7 min elongation at 72 ꢀC. The PCR products
were isolated by low-melting agarose electrophoresis and subse-
quently purified from the gel using GenElute gel extraction kit
(Sigma).
Cell Lines. MCF7wt (human breast carcinoma cells) were trans-
fected with a vector for overexpressing rat-MGST1, or a vector
control with antisense against rat-MGST1 (for characterization
of the cell lines see refs 9 and 37). V79 cells (Chinese hamster
lung fibroblast cells) were purchased from the American Type
Culture Collection (ATCC) and transfected with vector over-
expressing GSTP1-1 or empty vector.
The cDNA for human GSTP1-1 (Val105, Ala114), subcloned
into pKKdeltaAcc vector, was used as template for PCR reactions
and generously provided by Professor Bengt Mannervik. Prior to
incorporation into the vector for cytosolic and nuclear localiza-
tion expression, the cDNA was modified by polymerase chain
reaction amplification to include HindIII and BamH1 endonu-
clease cleavage sites. For the nuclear expression the nuclear
localization signal (NLS) sequence (PKKKRKV)40 was included
in the lower primer, immediately 50 to the TGA stop codon
(Table 1).
The full-length GSTP1-1 was subcloned into the high-copy-
number pGEM-T Easy Vector (Promega), sequenced using the
SP6 and T7 primers (Promega), and expanded in transformed
competent Escherichia coli cells. The full-length GSTP1-1 sub-
cloned into pGEM was isolated by low-melting agarose electro-
phoresis and subsequently purified from the gel and then subcloned
into the modified pCEP4 delta vector, which had been linearized
with BamHI and HindIII.
Culture. MCF7 cells and V79 cells were cultured in Dulbecco’s
modified Eagle's medium (DMEM), without sodium pyruvate,
supplemented with 10% FBS, 100 units penicillin/mL, 100 μg
streptomycin/mL and 1 mM sodium pyruvate at 37 ꢀC and 5%
CO2 in a humidified environment. Transfected cells were main-
tained in the above media supplemented with 1 mg/mL Genet-
icin for MCF7 transfected cells and 100 μg/mL Hygromycin for
V79 transfected cells.
Stable Transfection of Cells Overexpressing GSTP. Con-
struction of Expression Vectors. The mammalian expression vector
pCEP4 (Invitrogen, Inc.) was modified (pCEP4delta) to remove
the sequence required for episomal replication in mammalian cells,
in order to allow for selection of clonal transfectant cell lines
expressing hygromycin resistance with the vector stably integrated
into cellular DNA; this was prepared by ClaI digestion as previ-
ously described.38,39
PCR reactions were performed in 1.5 mM MgCl2, 20 mM
dNTP, 10% DMSO, buffer provided and 1 unit of PfuTurbo
1700
dx.doi.org/10.1021/mp2000692 |Mol. Pharmaceutics 2011, 8, 1698–1708

Molecular Pharmaceutics
ARTICLE
Table 1. Sequences of Primers Used for PCR and Sequence Analysis
primer
sequencea,b
cytosolic expression
nuclear expression
U primer-30
L primer-24
U primer-30
L primer-45
5BamGSTp
GSTpBam3
aattcaaagcttgacaaaatgccgccctac
tctctcggatcctcactgtttccc
aattcaaagcttgacaaaatgccgccctac
tctctcggatcctcacacctttctcttcttcttgggctgtttccc
cgggatccaccggtcgccaccatgccgccctacacc
mitochondrial expression
cgggatcctcactgtttcccgttgccattgatggggaggtt cacgtact
a Restriction enzymes and the ATG start codon are bolded. b Nuclear and mitochondrial localization signal are underlined.
The sequence of mitochondria targeting double signals (MTS)
of cytochrome C oxidase subunit VIII precursor was obtained
from pKillerRed-dMito vector (Evrogen). pCEP4 delta vector and
pKillerRed d-Mito vector were digested with NheI and BamHI,
and the fragment coding MTS was ligated to the digested pCEP4
delta vector (MTS delta) that was digested again with BamHI
prior to dephosphorylation by alkaline phosphatase, calf intest-
inal (CIP) to avoid self-ligation. In parallel, site-directed muta-
genesis was performed to add BamHI sites to both 50 and 30 end
of GSTP1-1 Val105, Ala114 cDNA (see primers in Table 1). The
PCR product was subcloned into pGEM vector, and the se-
quence of PPVAT (overlapped with BamHI partially) from MTS
plus GSTP1-1 was verified by automated sequencing. The BamHI
fragment with correct sequence was then subcloned into MTS
delta digested with BamHI followed by incubation with CIP.
Before sequencing of the final expression plasmid the number and
direction of the insert were confirmed by key restriction enzyme
digestions StuI and KpnI.
Correct base sequence of each construct was confirmed by
sequencing (ABI model 377 DNA sequencer) using pCEP
Forward and EBV Reverse primers (Invitrogen) for nuclear and
cytosolic expressions vectors. For mitochondrial expression
vector sequencing LS-358 (50cgtataggcaggaggctttg30) was also
used to verify the MTS sequence prior to GSTP1-1. The DNA of
expression plasmid with correct sequence was prepared by
EndoFree Plasmid Maxi kit (Qiagen) for optimal transfection.
Transfection and Selection of Colonies. Transfections were
carried out in cells in suspension using Lipofectamine 2000
(Invitrogen) reagent diluted in Opti-MEM I Reduced Serum
Medium (GIBCO) according to the manufacturer’s instructions.
Hygromycin B was added 72 h after transfection (0.7 mg/mL of
growth medium), and resistant cell clones were isolated 2ꢀ3
weeks after transfection. These colonies were picked when they
reached a size visible to the naked eye, by using a pipet tip to
gently scrape the colony. The detached colony was then trans-
ferred into a drop of trypsin and incubated at 37 ꢀC for 5 min
before plating onto a 24-well plate. Once the colony had expanded
to a confluent 10 cm tissue cultureplate, the cells were harvested in
order to freeze aliquots and measure GST activity. Selection of
plasmid-containing V79 cells was maintained by the addition of
hygromycin (100 μg/mL). Colonies transfected with cytosolic
targeted expression vector were very few, and the expression was
unstable (declining after a few passages). Therefore in this paper
we use the nuclear and mitochondrial targeted GSTP1-1 expres-
sing cells only.
spectrophotometer (Philips Scientific & Analytical Equip-
ment, Cambridge, U.K.) by following the change in absorbance at
340 nm. All enzymatic measurements were performed at room
temperature (22 ꢀC). The cytosolic GSTs were assayed in 0.1 M
potassium phosphate buffer (pH 6.5), whereas MGST1 was
assayed in0.1 M potassium phosphate buffer (pH 6.5) containing
0.1% Triton X-100 (required for enzyme solubility). Enzyme
activities were calculated after correction for the nonenzymatic
reaction.
The fluorescence spectrophotometric measurements were
performed on a Shimadzu RF-510LC fluorescence spectrophot-
ometer (Analytical Instruments Division, Kyoto, Japan). Essen-
tially the same assay protocol as that described above and in ref
41 was used with 50 μM DNS-DOX and MNS-DOX substituting
for CDNB as second substrate. The excitation and emission
wavelengths used were 480 and 555 nm, respectively. Initial rates
were calculated from the relative increase in fluorescence in-
tensity when DOX was formed. Standard solutions of DOX were
used to quantify the signal and control for the inner filter effect.
The following amounts of enzyme were used: GSTP 13/130
milliunits in the DNS- and MNS-DOX assays; MGST1 4.7/9.4
milliunits in the DNS- and MNS-DOX assays, respectively. One
milliunit converts 1 nmol/min in the CDNB assay.
Enzyme Isolation. Isolation of MGST1 was performed ac-
cording to Morgenstern, 2005.42 Isolation of GSTP1-1 was achieved
according to Hegazy et al., 2004.43
Inhibition Studies. MGST1 enzyme activity toward CDNB
was measured as described above, and EA and ethacraplatin were
added at different concentrations to determine the degree of
inhibition. The IC50 value was determined by plotting data with
Graphpad Prism.
Cell Uptake of Cisplatin and Ethacraplatin. MCF7 cells
(sense and controls) were seeded at a density of 1 ꢁ 106 cells/
well in 6-well plates and cultured overnight before they were
exposed to 80 μM cisplatin or ethacraplatin for 90 min at 37 ꢀC.
After exposure cells were washed with PBS three times, trypsi-
nized and centrifuged 1200 rpm for 3 min, the supernatant was
removed and the pellet was stored at ꢀ20 ꢀC until platinum
determination.
Each sample was dissolved in 3 mL of deionized water, mixed
with 1 mL of concentrated nitric acid (67% OPTIMA, Fisher
Scientific) and digested under nitrogen (40*106 psi) at 250 ꢀC
for 30 min (Milestone ultraCLAVE II microwave digestion system,
EMLS, Leutkirch, Germany) to obtain carbon-free solutions.
The samples were brought to room temperature, transferred
to polyethylene tubes (SARSTEDT, N€umbrecht, Germany) and
diluted with deionized water to a final weight of 5.4 g. Platinum
(m/z 195) was measured using inductively coupled plasma mass
spectrometry (ICPMS; Agilent 7700x, Agilent Technologies,
Japan. Platinum external standard (CPI International,
Enzyme Assays. Enzymatic activities of homogenates, cyto-
solic, microsomal fractions and isolated GSTs were measured
using 5 mM GSH and 0.5 mM 1-chloro-2,4-dinitrobenzene
(CDNB, ε340 = 9.6 mMꢀ1 cmꢀ1) as second substrate in a 100 μL
cuvette with a single beam Philips PU8700 UV/visible
1701
dx.doi.org/10.1021/mp2000692 |Mol. Pharmaceutics 2011, 8, 1698–1708

Molecular Pharmaceutics
ARTICLE
Amsterdam, Netherlands) and iridium internal standard (High-
Purity Standards; Charleston, SC, USA) solutions were prepared
freshly in HNO3 (OPTIMA, Fisher Scientific, U.K.) before every
run. For quality control we used reference material (NIST SRM
2670a High, Toxic Elements in Urine, National Institute of
Standards and Technology, Gaithersburg, MD) with certified
concentration 51.5 ( 6.6 μg/L, for which we obtained 45.6 (
2 μg/L (n = 8). The limit of detection (LOD) was 0.001 μg/L
(n = 12).
Colony Forming Efficiency. Cells were seeded at a density of
1050 cells/well for MCF7 cells and 1500 cells/well for V79 cells
in a 6-well plate; after 24 h, the cells were exposed to cytotoxic
agents for 3 h in different concentrations; thereafter the medium
was changed to regular culture medium. After 7 days for MCF7
cells and 5 days for V79 cells, medium was removed and cells
were washed with 1ꢁ PBS, fixed with 10% formaldehyde for
20 min, and stained with 0.01% crystal violet. A colony was defined
as at least 16 cells, whereafter the colonies were counted with
help of a light microscope.
Cell Proliferation Assay (MTT-Assay). A cell proliferation
assay was used as a quantitative colorimetric assay for measure-
ments of cellular cytotoxicity as previously described by Mosman
with slight modifications.44 MGST1 overexpressing cells, vector
control cells and MCF7wt cells were run in parallel as well as V79
vector control, MIT and NLS. Briefly, cells were seeded at a density
of 1 ꢁ 104 cells/well for MCF7 transfected cells and 2 ꢁ 104 cells/
well for V79 transfected cells in a 96-well plate; after 24 h culturing,
the medium was changed to DMEM without phenol red and
serum containing cytotoxic drugs at different concentrations;
four replicates were used for each concentration. After 24 h the
medium was changed to medium supplemented with 0.5 mg/mL
MTT, incubated at 4 h. Formazan crystals were dissolved in
DMSO, and absorbance was read spectrophotometrically at
590 nm minus a reference at 650 nm.
Western Blot. Levels of MGST1 and GSTP in the cells were
estimated by Western blotting. Cells were lysed in 1% SDS, 1%
Triton X-100 in dH2O. 20 μg of protein from cell lysate was
separated by SDSꢀpolyacrylamide gel electrophoresis in a 15%
gel, transferred to a nitrocellulose membrane, and immunologi-
cally stained using polyclonal rabbit IgG against rat MGST1 or
human GSTP as the primary antibody and horseradish perox-
idase-labeled anti-rabbit IgG as the secondary antibody. Blots
were developed by enhanced chemiluminescence using the ECL
kit (Amersham Biosciences). Protein determination was per-
formed by Micro BCA protein assay kit in a 96-well plate
Statistical Analysis. Raw data was analyzed with help of Student’s
unpaired t test.
Figure 2. Characterization of the protein levels and enzyme activity in
MGST1 overexpressing cells. (a) Protein levels of rat-MGST1 in
isolated microsomes from MGST1 overexpressing cells (S) and vector
control cells (C). Standard curve of isolated rat-MGST1 with 5, 10, 20,
30, 50 ng of MGST1. (b) Specific activity of MGST1 in microsomes
isolated from MGST1 overexpressing cells (sense) and vector control
cells (control) ( activation with NEM.
To further clarify the role of MGST1 in cisplatin resistance, the
cytotoxicity of cisplatin, ethacraplatin, EA and the coincubation
of cisplatin and ethacrynic acid was investigated using MCF7
cells transformed to stably overexpress rat-MGST1. The protein
expression and activity of MGST1 were determined by Western
blot and activity measurements (Figure 2).
In Figure 3 the previous observation9 of strong MGST1 depen-
dent protection from cisplatin in the short term MTT toxicity assay
as well as with a clonogenic assay was demonstrated (Figure 3a and
Figure 3b respectively). When the cisplatin derivative ethacraplatin
is used, the MGST1 dependent protection is almost completely
eliminated (Figure 3c and Figure 3d).
The advantage of tethering EA and cisplatin into one molecule
is further demonstrated by less pronounced toxicity resulting
from adding corresponding concentrations of the two parent
drugs together (Figure 3e,f). Here, protection by MGST1 is still
evident, but compared to cisplatin alone, the coincubation shows
more marked decline in cell viability for the MGST1 overexpress-
ing line, relative to the control, reducing the differences between
the cell lines. These observations suggest that, while EA enhances
cisplatin activity in the control cell line, coadministration of this
complex reduces MGST1-induced cisplatin resistance. It is inter-
esting to note that the effects of coadministration are not equivalent
to tethering the complexes, suggesting there are additional factors
that contribute to the cytotoxic effect, for example, uptake, enhanced
MGST1 inhibition or the molecular mechanism. As yet, the molecular
mechanism of this complex remains to be elucidated, however it
is known that ethacraplatin is taken up effectively into the cells
where it is cleaved into the cisplatin and ethacrynic acid moieties.27,28
To investigate whether ethacraplatin is taken up efficiently also in
our cell system we performed uptake experiments. MGST1 over-
expressing cells took up 27 ( 2 and 930 ( 130 ng of Pt/106 cells
((SEM, n = 6 and 3) when exposed to cisplatin and ethacraplatin
respectively. The corresponding values for control cells were
17 ( 2 and 820 ( 60 ng of Pt/106 cells ((SEM, n = 6 and 3).
’ RESULTS
Ethacraplatin Reverses MGST1 Dependent Resistance
against Cisplatin. MGST1 overexpression confers robust pro-
tection from cisplatin.9 Similarly, other GST overexpression
systems have been linked to cisplatin resistance and have become
the target of investigations to develop new therapies. Such investiga-
tions include the design and synthesis of cisplatin derivatives that
include a releasable GST inhibitor.27,28 The EA derivative of cis-
platin was shown to be more toxic than cisplatin itself, possibly due
to the inhibition of GST enzymes. In this study, both EA and
ethacraplatin are shown to be inhibitors of MGST1 with IC50 values,
in the standard CDNB inhibition assay (see above), of 50 and
10 μM, respectively.
1702
dx.doi.org/10.1021/mp2000692 |Mol. Pharmaceutics 2011, 8, 1698–1708

Molecular Pharmaceutics
ARTICLE
Figure 3. Ethacraplatin reverses cisplatin resistance in MGST1 overexpressing cells. Cytotoxicity was determined by viability test (MTT; a, c, e, g) and a
clonogenic assay (CFE; b, d, f, h) where MGST1 overexpressing cells (filled line) and vector control (dashed line) were exposed to cisplatin (a, b),
ethacraplatin (c, d), cisplatin and ethacrynic acid (EA) (e, f) (with double concentration of EA to mimic ethacraplatin concentration in b, c) and EA alone
(g, h). The cells were exposed to cytotoxic drugs for 24 h for MTT (n = 4) and 3 h for CFE (n = 3). For CFE the cells were cultured for 7 days before
colonies were counted. The results are expressed as mean values ( SEM. Significance levels are *p < 0.05, **p < 0.01 and ***p < 0.001. Raw data was
analyzed with Student’s unpaired t test.
Ethacraplatin is clearly taken up much more efficiently than
cisplatin.
Incubation with EA alone exerts a toxic effect, as expected. It
has been shown that EA inhibits the Wnt/β-catenin signaling
pathways that are overexpressed in specific cancer cell lines45
including MCF7.46 In the MTT assay, the toxic effect follows a
similar profile to incubation of cisplatin with the sensitive cell
line. However, in contrast to the cisplatin incubation, little
difference in EA cytotoxicity is observed between the cisplatin-
sensitive and resistant cell types. In contrast, the clonogenic assay
discriminates between the two cell lines and the two complexes,
with EA being markedly less toxic than cisplatin and more
1703
dx.doi.org/10.1021/mp2000692 |Mol. Pharmaceutics 2011, 8, 1698–1708

Molecular Pharmaceutics
ARTICLE
Figure 4. Prodrugs could be used to reverse MGST1 responsible resistance. Short-term cytotoxicity test (MTT; a and b; n = 4) and long-term
clonogenic assay (CFE; c and d; n = 3) where MGST1 overexpressing cells (filled line) and vector control cells (dashed line) were exposed to DOX
(a and b), DNS-DOX (c and d) and MNS-DOX (e and f). The cells were exposed to the cytotoxic drugs for 24 and 3 h in the MTT and CFE assays
respectively. The results are expressed as mean values ( SEM. Significance levels are *p < 0.05, **p < 0.01 and ***p < 0.001.
effective against the cisplatin sensitive cell line, the latter ob-
servation suggesting a protective effect of MGST1 that could
account for the enhanced activity of cisplatin on coadministra-
tion with EA.
MGST1 Displays Sulfonamidase Activity toward DNS-DOX
and MNS-DOX. An alternate strategy to overcome drug resis-
tance and actually take advantage of GST overexpression in
tumors involves development of prodrugs that release toxic
entities as a result of GST-dependent conversion. With this
strategy in mind, two new prodrugs that are derivatives of DOX
(DNS-DOX and MNS-DOX) were synthesized. First we wanted
to find out if MGST1-sulfonamidase activity is able to activate the
two prodrugs to DOX. The sulfonamidase activity was probed
using fluorescence spectra of DOX, DNS-DOX and MNS-DOX
between 480 to 700 nm with excitation at 480 nm. Peaks were
observed at an emission wavelength of 550 nm for all three
compounds. The fluorescence intensity was approximately 3
times lower for the prodrugs compared to DOX, which made it
possible to measure the increase in fluorescence intensity as
MGST1 catalyzes the conversion of the prodrugs and releases
fluorescent DOX. By measuring this increase in fluorescence and
comparing the fluorescence intensity to a standard with known
concentrations of DOX we determined the rate of DOX forma-
tion. It could be shown that MGST1 was able to activate the
1704
dx.doi.org/10.1021/mp2000692 |Mol. Pharmaceutics 2011, 8, 1698–1708

Molecular Pharmaceutics
ARTICLE
prodrugs to DOX at a rate of 150 ( 20 nmol/(min mg) and
1.33 (0.09 nmol/(min mg) isolated rat MGST1 for DNS-DOX and
MNS-DOX respectively (n = 3).
Prodrugs Can Be Used To Sensitize MGST1 Overexpres-
sing Cells to DOX. Previously it has been shown that MGST1 is
involved in resistance against DOX in patients suffering from
Ewing sarcoma.47 In this study, we wanted to investigate if
MGST1 overexpressing cells are resistant to DOX and if this
resistance could be reversed using prodrugs of DOX. Both a
short-term toxicity assay (MTT) and a longer term clonogenic
assay were used to evaluate the toxicity of DOX, DNS-DOX and
MNS-DOX. A significant protection in MGST1 overexpressing
cells compared to vector control could be seen when cells were
incubated with DOX using the MTT test while no appreciable
protection could be seen in the clonogenic test (Figure 4a and
Figure 4b respectively). When we exposed the cells to DNS-
DOX (Figure 4c and Figure 4d), the protection by MGST1 was
diminished; however DNS-DOX was much more toxic to the
cells compared to DOX and MNS-DOX. In contrast, when cells
were exposed to MNS-DOX, the MGST1 resistance was totally
reversed and vector control cells were significantly less sensitive
compared to MGST1 overexpressing cells (in both the MTT test
and the clonogenic assay, Figure 4e and Figure 4f respectively).
Further, it was shown that MNS-DOX was less toxic to both cell
lines compared to DOX and DNS-DOX.
Figure 5. Characterization of GSTP overexpressing V79 cells. (a)
Protein detection in NLS (GSTP overexpression with nuclear target
construct), MIT (GSTP overexpression with mitochondrial target
construct) and vector control cells by Western blot (20 μg protein/
lane). (b) GST activity measurements of GSTP overexpressing and
control cells (cell homogenates) using the CDNB assay.
Cells Overexpressing GSTP Are Sensitive to DNS-DOX.
Since GSTP has been shown to confer DOX resistance, we tested
whether, in this case, DNS-DOX could reverse resistance or even
be more toxic to GSTP overexpressing cells. GSTP catalyzed the
conversion of DNS-DOX to activated DOX with a rate of 84 (
12 nmol/(min mg). We have generated cell lines that overexpress
GSTP in different cellular compartments. Although stable cytosolic
overexpression could not be achieved, there are reports of nuclear
and mitochondrial localization of GSTP,21,48,49 especially in cancer
cells. Therefore, our cell lines serve as model systems. The NLS cells
contain a nucleus targeted construct, and the MIT cells contain
mitochondrial targeted construct (see Materials and Methods).
The V79 cell lines generated were shown to express human GSTP
and higher GST activity than controls (Figure 5a and Figure 5b
respectively). Fractionation studies revealed enrichment of GSTP in
the nucleus and cytosol for the NLS cells and mitochondria and
cytosol for the MIT cells (data not shown). Figure 5a shows protein
expression of human GSTP in the cell homogenate of the different
cell lines used using a polyclonal anti-GSTP antibody. To determine
the cytotoxicity of DOX and DNS-DOX in these cells both the
MTT and CFE assay were used. Cells overexpressing GSTP were
protected against DOX in both the MTT and CFE assay compared
to control (Figure 6a and Figure 6b, respectively, show a significant
albeit modest protection). However, when we exposed the cells to
the prodrug DNS-DOX this protection was totally reversed. In the
clonogenic test, DNS-DOX was much more toxic to cells over-
expressing GSTP (Figure 6d). The rank order of protection against
DOX (Figure 6b) and increased sensitivity against DNS-DOX
(Figure 6d) logically follows the GSTP expression and activity
levels (Figure 5).
novel strategies to overcome drug resistance, using a combined
prodrug either to inhibit GST or to exploit GST overexpression as
a tool to activate prodrugs.
GSTs including MGST1 induce resistance against cisplatin.9,50 In
this study we used ethacraplatin in an attempt to reverse MGST1
resistance. Ethacraplatin consists of cisplatin conjugated to two EA
moieties, and Ang et al. have previously shown that ethacraplatin is
more toxic than cisplatin and a good GST inhibitor.27,28 Here we
show that ethacraplatin can reverse MGST1 dependent resistance.
Reversal of resistance was also achieved by coincubation of the cells
with cisplatin and ethacrynic acid, but the effect is not as pronounced
as when the complexes are tethered as in ethacraplatin. Ethacrynic
acid by itself displays toxicity to MCF7 cells regardless of the pres-
ence of MGST1 (Figure 1d), but this toxicity does not fully account
for the effects of ethacraplatin. We therefore conclude that the
covalent combination of EA and cisplatin does have the ability to
reverse MGST1 dependent drug resistance in our model system.
The mechanism most likely involved inhibition of MGST1, but
the toxic effects of EA and possible enhanced uptake of ethacra-
platin compared to the EA and cisplatin given together could also
be important.
It should be kept in mind that ethacrynic acid is a potent
diuretic agent,51,52 and, since cisplatin is also known to be
nephrotoxic, the coadministration of these two drugs is too
toxic for clinical use. On the other hand, the nephrotoxicity of
cisplatin is connected to a reactive platinumꢀglutathione
conjugate, a product suggested to be formed by GST catalysis.53
If the dose of cisplatin could be reduced due to higher potential
therapeutic index (in the case of ethacraplatin) together with
inhibition of GSTs by EA or other GST inhibitors, less reactive
conjugate will be formed that could result in decreased ne-
phrotoxic side effects.
’ DISCUSSION
Cisplatin and DOX are used to treat many types of cancer.
Nevertheless, the use of both drugs, as well as many others, is
limited by the appearance of serious side effects and the frequently
observed development of tumor drug resistance. Here we used
Taken together, cisplatin combined with a GST inhibitor might
reverse GST dependentdrugresistanceand lessenthe nephrotoxic
1705
dx.doi.org/10.1021/mp2000692 |Mol. Pharmaceutics 2011, 8, 1698–1708

Molecular Pharmaceutics
ARTICLE
Figure 6. DNS-DOX is more toxic to GSTP overexpressing cells compared with control cells. GSTP overexpressing V79 cells with nuclear target
construct (NLS; dashed line), mitochondrial target construct (MIT; dotted line) and vector control cells (filled line) were exposed to DOX (a and b)
and DNS-DOX (c and d) in a short-term cytotoxicity test (a and c, n = 4) and long-term clonogenic assay (b and d; n = 3) . The results are expressed as
mean values ( SEM. Significance levels for NLS vs control are *p < 0.05, **p < 0.01 and ***p < 0.001 and for MIT vs control #p < 0.05, ##p < 0.01 and
###p < 0.001.
effects of cisplatinꢀGSH conjugates. We propose that combina-
tions with other GST inhibitors, that do not have (nephro-)toxic
properties, would be interesting drug candidates, for instance,
indomethacin that has been used in combination with cisplatin in
vitro,54 with an IC50 for isolated MGST1 of 4 μM55 that contains a
carboxylate group for synthesizing a cisplatin adduct.
As many tumors overexpress GSTs, attempts have been made
to synthesize prodrugs that release cytotoxic moieties upon GST
catalysis, e.g., TLK-286.26 Here we use an alternate strategy to
derivatize an existing and well-characterized cytostatic drug DOX
such that it becomes less toxic (in the case of MNS-DOX also
partly due to limited solubility) and a GST substrate (DNS- and
MNS-DOX).
The MCF7 cell systems display low overall GST activity (both
basal and transfected where the latter activity is 10-fold lower
than in liver and comparable to many extrahepatic tissues56)
whereas the V79 cell system has a much higher basal GST level
(>10-fold). In MGST1 overexpressing cells DNS-DOX treat-
ment did not result in enhanced toxicity but rather an attenuation
of protection. One can speculate that nonenzymatic release of
DOX can contribute when GST activity is low, but this sugges-
tion needs to be investigated further. From our results it appears
that DNS-DOX is more effective when high GST levels are
present. Importantly, inasmuch as the clonogenic assay is more
relevant to tumor treatment, the most pronounced GST-
dependent cytotoxicity enhancement occurs in this assay
(MNS-DOX for MGST1 and DNS-DOX for GSTP).
The different character of DOX, DNS-DOX and MNS-DOX
was logically reflected in cellular uptake and distribution as
studied in living cells using fluorescence microscopy for two
hours (data not shown). DOX was rapidly transported to the
nucleus. In contrast, the DNS-DOX fluorescence appeared first
in the cytosol, whereafter it slowly accumulated in the nucleus. In
the case of MNS-DOX, the signal remained solely in the cytosol.
As both DOX and its derivatives are fluorescent (with DOX three
times stronger), we interpret cytosolic staining as representing
prodrug and nuclear accumulation resulting from released DOX.
Our finding of increased toxicity of the DOX derivatives
dependent on GST overexpression in cells is an important first
step toward realization of drugs based on this principle. Pre-
viously, sulfonamide GST substrate derivatives31,57 have been
synthesized, but these examples did not include cytostatics. Our
work represents the first description of a GST releasable sulfon-
amide coupled cytostatic drug. The ease of synthesis opens the
possibility that this strategy could be employed for amino group
containing compounds in general (e.g., mitomycin). Further-
more, it could be extrapolated that from the limited range of
complexes assayed in this report by suitable derivatization of the
benzene ring with electron withdrawing groups the GST cata-
lyzed release rate of the cytostatic drug could be controlled. This
1706
dx.doi.org/10.1021/mp2000692 |Mol. Pharmaceutics 2011, 8, 1698–1708

Molecular Pharmaceutics
ARTICLE
derivatization is an important feature that allows fine-tuning for
optimal selectivity (e.g., ref 58). In addition, the lipophilic character
of the prodrug (and thereby the GSH conjugate formed) can also be
altered in a systematic fashion (e.g., ref 59) allowing optimization of
GST and drug efflux pump inhibitory properties.
(9) Johansson, K.; Ahlen, K.; Rinaldi, R.; Sahlander, K.; Siritantikorn,
A.; Morgenstern, R. Microsomal glutathione transferase 1 in anticancer
drug resistance. Carcinogenesis 2007, 28, 465–70.
(10) McIlwain, C. C.; Townsend, D. M.; Tew, K. D. Glutathione
S-transferase polymorphisms: cancer incidence and therapy. Oncogene
2006, 25, 1639–48.
(11) Townsend, D.; Tew, K. Cancer drugs, genetic variation and the
glutathione-S-transferase gene family. Am. J. Pharmacogenomics 2003, 3,
157–72.
(12) Hayes, J. D.; Pulford, D. J. The glutathione S-transferase super-
gene family - regulation of GST and the contribution of the isoenzymes to
cancer chemoprotection and drug resistance. Crit. Rev. Biochem. Mol. Biol.
1995, 30, 445–600.
(13) Morgenstern, R.; DePierre, J. W. Microsomal glutathione transfer-
ase, Purification in unactivated form and further characterization of the
activation process, substrate specificity and amino acid composition. Eur. J.
Biochem. 1983, 134, 591–7.
(14) Zhang, J.; Lou, Y. J. Relationship between activation of micro-
somal glutathione S-transferase and metabolism behavior of chloram-
bucil. Pharmacol. Res. 2003, 48, 623–30.
(15) Zhang, J.; Ye, Z.; Lou, Y. Metabolism of melphalan by rat liver
microsomal glutathione S-transferase. Chem.-Biol. Interact. 2005, 152, 101–6.
(16) Chaib, H.; Cockrell, E. K.; Rubin, M. A.; Macoska, J. A. Profiling
and verification of gene expression patterns in normal and malignant human
prostate tissues by cDNA microarray analysis. Neoplasia 2001, 3, 43–52.
(17) Futschik, M.; Jeffs, A.; Pattison, S.; Kasabov, N.; Sullivan, M.;
Merrie, A.; Reeve, A. Gene Expression Profiling of Metastatic and
NonmetastaticColorectalCancer CellLines.Genome Lett. 2002, 1, 26–34.
(18) Lal, A.; Lash, A. E.; Altschul, S. F.; Velculescu, V.; Zhang, L.;
McLendon, R. E.; Marra, M. A.; Prange, C.; Morin, P. J.; Polyak, K.;
Papadopoulos, N.; Vogelstein, B.; Kinzler, K. W.; Strausberg, R. L.;
Riggins, G. J. A public database for gene expression in human cancers.
Cancer Res. 1999, 59, 5403–7.
’ AUTHOR INFORMATION
Corresponding Author
*Institute of Environmental Medicine, Division of Biochemical
Toxicology, Karolinska Institutet, SE-17177 Stockholm, Sweden.
Tel: +46-8-5248 7574. Fax: +46-8-343849. E-mail: ralf.morgenstern@
ki.se.
’ ACKNOWLEDGMENT
These studies were supported by the Swedish Research Coun-
cil, AstraZeneca and funds from Karolinska Institutet. The Ligue
Suisse Contre le Cancer (Swiss Cancer League) and the EPFL are
thanked for financial support (P.J.D.). H.A. was financially sup-
ported by MEXT (Ministry of Education, Culture, Sports, Science
and Technology of Japan) and NEDO (New Energy and Industrial
Technology Development Organization of Japan). We gratefully
acknowledge the expert assistance of Brita Palm and Margaretha
Grander in the Pt measurements.
’ ABBREVIATIONS USED
BSA, bovineserum albumin; CDNB, 1-chloro-2,4-dinitrobenzene;
CFE, colony forming efficiency; DNS-DOX, 2,4-dinitrobenzene-
sulfonyl doxorubicin; DOX, doxorubicin; EA, ethacrynic acid;
FBS, fetal bovine serum; G418, Geneticin; GSH, glutathione;
GST, glutathione transferase; MGST1, microsomal glutathione
transferase1; GSTP, glutathione transferase pi; NEM, N-ethyl-
maleimide; MNS-DOX, 4-mononitrobenzenesulfonyl doxorubi-
cin; MTS, mitochondria targeting signal; MTT, 3-[4,5-dimethyl-
thiazol-2yl]-2,5-diphenyltetrazolium bromide
(19) Linnerth, N. M.; Sirbovan, K.; Moorehead, R. A. Use of a
transgenic mouse model to identify markers of human lung tumors. Int.
J. Cancer 2005, 114, 977–82.
(20) Tsunoda, T.; Koh, Y.; Koizumi, F.; Tsukiyama, S.; Ueda, H.;
Taguchi, F.; Yamaue, H.; Saijo, N.; Nishio, K. Differential gene expres-
sion profiles and identification of the genes relevant to clinicopathologic
factors in colorectal cancer selected by cDNA array method in combina-
tion with principal component analysis. Int. J. Oncol. 2003, 23, 49–59.
(21) Goto, S.; Ihara, Y.; Urata, Y.; Izumi, S.; Abe, K.; Koji, T.; Kondo,
T. Doxorubicin-induced DNA intercalation and scavenging by nuclear
glutathione S-transferase pi. FASEB J. 2001, 15, 2702–14.
(22) Burg, D.; Riepsaame, J.; Pont, C.; Mulder, G.; van de Water, B.
Peptide-bond modified glutathione conjugate analogs modulate GSTpi
function in GSH-conjugation, drug sensitivity and JNK signaling.
Biochem. Pharmacol. 2006, 71, 268–77.
(23) Adler, V.; Yin, Z.; Fuchs, S. Y.; Benezra, M.; Rosario, L.; Tew, K. D.;
Pincus, M. R.; Sardana, M.; Henderson, C. J.; Wolf, C. R.; Davis, R. J.; Ronai,
Z. Regulation of JNK signaling by GSTp. EMBO J. 1999, 18, 1321–34.
(24) Raza, A.; Galili, N.; Callander, N.; Ochoa, L.; Piro, L.; Emanuel,
P.; Williams, S.; Burris, H., 3rd; Faderl, S.; Estrov, Z.; Curtin, P.; Larson,
R. A.; Keck, J. G.; Jones, M.; Meng, L.; Brown, G. L. Phase 1-2a
multicenter dose-escalation study of ezatiostat hydrochloride liposomes
for injection (Telintra(R), TLK199), a novel glutathione analog prodrug
in patients with myelodysplastic syndrome. J. Hematol. Oncol. 2009, 2, 20.
(25) Morgan, A. S.; Sanderson, P. E.; Borch, R. F.; Tew, K. D.; Niitsu,
Y.; Takayama, T.; Von Hoff, D. D.; Izbicka, E.; Mangold, G.; Paul, C.;
Broberg, U.; Mannervik, B.; Henner, W. D.; Kauvar, L. M. Tumor
efficacy and bone marrow-sparing properties of TER286, a cytotoxin
activated by glutathione S-transferase. Cancer Res. 1998, 58, 2568–75.
(26) Tew, K. D. TLK-286: a novel glutathione S-transferase-acti-
vated prodrug. Expert Opin. Invest. Drugs 2005, 14, 1047–54.
(27) Ang, W. H.; Khalaila, I.; Allardyce, C. S.; Juillerat-Jeanneret, L.;
Dyson, P. J. Rational design of platinum(IV) compounds to overcome
glutathione-S-transferase mediated drug resistance. J. Am. Chem. Soc.
2005, 127, 1382–3.
’ REFERENCES
(1) Simunek, T.; Sterba, M.; Popelova, O.; Adamcova, M.; Hrdina, R.;
Gersl, V. Anthracycline-induced cardiotoxicity: overview of studies examining
the roles of oxidative stress and free cellular iron. Pharmacol. Rep. 2009, 61,
154–71.
(2) Pabla, N.; Dong, Z. Cisplatin nephrotoxicity: mechanisms and
renoprotective strategies. Kidney Int. 2008, 73, 994–1007.
(3) Rybak, L. P. Mechanisms of cisplatin ototoxicity and progress in
otoprotection. Curr. Opin. Otolaryngol. Head Neck Surg. 2007, 15, 364–9.
(4) McWhinney, S. R.; Goldberg, R. M.; McLeod, H. L. Platinum
neurotoxicity pharmacogenetics. Mol. Cancer Ther. 2009, 8, 10–6.
(5) Rautio, J.; Kumpulainen, H.; Heimbach, T.; Oliyai, R.; Oh, D.;
Jarvinen, T.; Savolainen, J. Prodrugs: design and clinical applications.
Nat. Rev. Drug Discovery 2008, 7, 255–70.
(6) Sau, A.; Pellizzari Tregno, F.; Valentino, F.; Federici, G.; Caccuri,
A. M. Glutathione transferases and development of new principles to
overcome drug resistance. Arch. Biochem. Biophys. 2010, 500, 116–22.
(7) Townsend, D. M.; Tew, K. D. The role of glutathione-S-transfer-
ase in anti-cancer drug resistance. Oncogene 2003, 22, 7369–75.
(8) Scotlandi, K.; Remondini, D.; Castellani, G.; Manara, M. C.;
Nardi, F.; Cantiani, L.; Francesconi, M.; Mercuri, M.; Caccuri, A. M.;
Serra, M.; Knuutila, S.; Picci, P. Overcoming resistance to conventional
drugs in Ewing sarcoma and identification of molecular predictors of
outcome. J. Clin. Oncol. 2009, 27, 2209–16.
1707
dx.doi.org/10.1021/mp2000692 |Mol. Pharmaceutics 2011, 8, 1698–1708

Molecular Pharmaceutics
ARTICLE
(28) Ang, W. H.; Pilet, S.; Scopelliti, R.; Bussy, F.; Juillerat-Jeanneret,
L.; Dyson, P. J. Synthesis and characterization of platinum(IV) anticancer
drugs with functionalized aromatic carboxylate ligands: influence of the
ligands on drug efficacies and uptake. J. Med. Chem. 2005, 48, 8060–9.
(29) Ploemen, J. H.; van Ommen, B.; van Bladeren, P. J. Inhibition of
rat and human glutathione S-transferase isoenzymes by ethacrynic acid
and its glutathione conjugate. Biochem. Pharmacol. 1990, 40, 1631–5.
(30) Molnar, J.; Somberg, J. C. The Clinical Pharmacology of Etha-
crynic Acid. Am. J. Ther. 2009, 16 (1), 86–92.
(31) Zhao, Z.; Koeplinger, K. A.; Peterson, T.; Conradi, R. A.; Burton,
P. S.;Suarato, A.;Heinrikson, R. L.; Tomasselli, A. G. Mechanism, structure-
activity studies, and potential applications of glutathione S-transferase-
catalyzed cleavage of sulfonamides. Drug Metab. Dispos. 1999, 27, 992–8.
(32) Koeplinger, K. A.; Zhao, Z.; Peterson, T.; Leone, J. W.; Schwende,
F. S.; Heinrikson, R. L.; Tomasselli, A. G. Activated sulfonamides are cleaved
by glutathione-S-transferases. Drug Metab. Dispos. 1999, 27, 986–91.
(33) van Brakel, R.; Vulders, R. C.; Bokdam, R. J.; Grull, H.; Robillard,
M. S. A doxorubicin prodrug activated by the staudinger reaction. Bioconju-
gate Chem. 2008, 19, 714–8.
(34) Yoo, H.; Rill, R. L. Single-strand DNA binding of actinomycin
D with a chromophore 2-amino to 2-hydroxyl substitution. J. Biochem.
Mol. Biol. 2003, 36, 305–11.
(35) Habig, W. H.; Pabst, M. J.; Jakoby, W. B. Glutathione S-trans-
ferases. The first enzymatic step in mercapturic acid formation. J. Biol.
Chem. 1974, 249, 7130–7139.
(36) Shibata, A.; Furukawa, K.; Abe, H.; Tsuneda, S.; Ito, Y. Rhoda-
mine-based fluorogenic probe for imaging biological thiol. Bioorg. Med.
Chem. Lett. 2008, 18, 2246–9.
(37) Siritantikorn, A.; Johansson, K.; Ahlen, K.; Rinaldi, R.;
Suthiphongchai, T.; Wilairat, P.; Morgenstern, R. Protection of cells
from oxidative stress by microsomal glutathione transferase 1. Biochem.
Biophys. Res. Commun. 2007, 355, 592–6.
(38) Bunting, K. D.; Townsend, A. J. De novo expression of
transfected human class 1 aldehyde dehydrogenase (ALDH) causes
resistance to oxazaphosphorine anti-cancer alkylating agents in hamster
V79 cell lines. Elevated class 1 ALDH activity is closely correlated with
reduction in DNA interstrand cross-linking and lethality. J. Biol. Chem.
1996, 271, 11884–90.
(39) Sundberg, K.; Seidel, A.; Mannervik, B.; Jernstrom, B. Detox-
ication of carcinogenic fjord-region diol epoxides of polycyclic aromatic
hydrocarbons by glutathione transferase P1ꢀ1 variants and glutathione.
FEBS Lett. 1998, 438, 206–10.
(40) Cogoi, S.; Codognotto, A.; Rapozzi, V.; Meeuwenoord, N.; van
der Marel, G.; Xodo, L. E. Transcription inhibition of oncogenic KRAS by
a mutation-selective peptide nucleic acid conjugated to the PKKKRKV
nuclear localization signal peptide. Biochemistry 2005, 44, 10510–9.
(41) Alander, J.; Johansson, K.; Heuser, V. D.; Farebo, H.; Jarvliden,
J.; Abe, H.; Shibata, A.; Ito, M.; Ito, Y.; Morgenstern, R. Characterization
of a new fluorogenic substrate for microsomal glutathione transferase 1.
Anal. Biochem. 2009, 390, 52–6.
Serra, M.; Knuutila, S.; Picci, P. Overcoming resistance to conventional
drugs in Ewing sarcoma and identification of molecular predictors of
outcome. J. Clin. Oncol. 2009, 27, 2209–16.
(48) Kamada, K.; Goto, S.; Okunaga, T.; Ihara, Y.; Tsuji, K.; Kawai,
Y.; Uchida, K.; Osawa, T.; Matsuo, T.; Nagata, I.; Kondo, T. Nuclear
glutathione S-transferase pi prevents apoptosis by reducing the oxidative
stress-induced formation of exocyclic DNA products. Free Radical Biol.
Med. 2004, 37, 1875–84.
(49) Goto, S.; Kawakatsu, M.; Izumi, S.; Urata, Y.; Kageyama, K.;
Ihara, Y.; Koji, T.; Kondo, T. Glutathione S-transferase pi localizes in
mitochondria and protects against oxidative stress. Free Radical Biol.
Med. 2009, 46, 1392–403.
(50) Goto, S.; Iida, T.; Cho, S.; Oka, M.; Kohno, S.; Kondo, T.
Overexpression of glutathione S-transferase pi enhances the adduct
formation of cisplatin with glutathione in human cancer cells. Free
Radical Res. 1999, 31, 549–58.
(51) Lacreta, F. P.; Brennan, J. M.; Nash, S. L.; Comis, R. L.; Tew,
K. D.; O’Dwyer, P. J. Pharmakokinetics and bioavailability study of
ethacrynic acid as a modulator of drug resistance in patients with cancer.
J. Pharmacol. Exp. Ther. 1994, 270, 1186–91.
(52) O’Dwyer, P. J.; LaCreta, F.; Nash, S.; Tinsley, P. W.; Schilder,
R.; Clapper, M. L.; Tew, K. D.; Panting, L.; Litwin, S.; Comis, R. L.; et al.
Phase I study of thiotepa in combination with the glutathione transferase
inhibitor ethacrynic acid. Cancer Res. 1991, 51, 6059–65.
(53) Townsend, D. M.; Tew, K. D.; He, L.; King, J. B.; Hanigan,
M. H. Role of glutathione S-transferase Pi in cisplatin-induced nephro-
toxicity. Biomed. Pharmacother. 2009, 63, 79–85.
(54) Byun, S. S.; Kim, S. W.; Choi, H.; Lee, C.; Lee, E. Augmentation
of cisplatin sensitivity in cisplatin-resistant human bladder cancer cells by
modulating glutathione concentrations and glutathione-related enzyme
activities. BJU Int. 2005, 95, 1086–90.
(55) Mosialou, E.; Morgenstern, R. Inhibition studies on rat liver
microsomal glutathione transferase. Chem.-Biol. Interact. 1990, 74, 275–80.
(56) Morgenstern, R.; Lundqvist, G.; Andersson, G.; Balk, L.;
DePierre, J. W. The distribution of microsomal glutathione transferase
among different organelles, different organs and different organisms.
Biochem. Pharmacol. 1984, 33, 3609–14.
(57) Axarli, I.; Labrou, N. E.; Petrou, C.; Rassias, N.; Cordopatis, P.;
Clonis, Y. D. Sulphonamide-based bombesin prodrug analogues for
glutathione transferase, useful in targeted cancer chemotherapy. Eur. J.
Med. Chem. 2009, 44, 2009–16.
(58) Morgenstern, R.; Lundqvist, G.; Hancock, V.; DePierre, J. W.
Studies on the activity and activation of rat liver microsomal glutathione
transferase, in particular with a substrate analogue series. J. Biol. Chem.
1988, 263, 6671–5.
(59) Morgenstern, R. A simple alternate substrate test can help
determine the aqueous or bilayer location of binding sites for hydro-
phobic ligands/substrates on membrane proteins. Chem. Res. Toxicol.
1998, 11, 703–7.
(42) Morgenstern, R. Microsomal glutathione transferase 1. Methods
Enzymol. 2005, 401, 136–46.
(43) Hegazy, U. M.; Mannervik, B.; Stenberg, G. Functional role of
the lock and key motif at the subunit interface of glutathione transferase
p1-1. J. Biol. Chem. 2004, 279, 9586–96.
(44) Mosmann, T. Rapid colorimetric assay for cellular growth and
survival: application to proliferation and cytotoxicity assays. J. Immunol.
Methods 1983, 65, 55–63.
(45) Lu, D.; Liu, J. X.; Endo, T.; Zhou, H.; Yao, S.; Willert, K.;
Schmidt-Wolf, I. G.; Kipps, T. J.; Carson, D. A. Ethacrynic acid exhibits
selective toxicity to chronic lymphocytic leukemia cells by inhibition of
the Wnt/beta-catenin pathway. PLoS One 2009, 4, e8294.
(46) Nath, N.; Vassell, R.; Chattopadhyay, M.; Kogan, M.; Kashfi, K.
Nitro-aspirin inhibits MCF-7 breast cancer cell growth: effects on COX-
2 expression and Wnt/beta-catenin/TCF-4 signaling. Biochem. Pharma-
col. 2009, 78, 1298–304.
(47) Scotlandi, K.; Remondini, D.; Castellani, G.; Manara, M. C.;
Nardi, F.; Cantiani, L.; Francesconi, M.; Mercuri, M.; Caccuri, A. M.;
1708
dx.doi.org/10.1021/mp2000692 |Mol. Pharmaceutics 2011, 8, 1698–1708