Conicasterol E, a small heterodimer partner sparing farnesoid X receptor modulator endowed with a pregnane X receptor agonistic activity, from the marine sponge Theonella swinhoei

Article abstract of DOI:10.1021/jm201004p

We report the isolation and pharmacological characterization of conicasterol E isolated from the marine sponge Theonella swinhoei. Pharmacological characterization of this steroid in comparison to CDCA, a natural FXR ligand, and 6-ECDCA, a synthetic FXR agonist generated by an improved synthetic strategy, and rifaximin, a potent PXR agonist, demonstrated that conicasterol E is an FXR modulator endowed with PXR agonistic activity. Conicasterol E induces the expression of genes involved in bile acids detoxification without effect on the expression of small heterodimer partner (SHP), thus sparing the expression of genes involved in bile acids biosynthesis. The relative positioning in the ligand binding domain of FXR, explored through docking calculations, demonstrated a different spatial arrangement for conicasterol E and pointed to the presence of simultaneous and efficient interactions with the receptor. In summary, conicasterol E represents a FXR modulator and PXR agonist that might hold utility in treatment of liver disorders.

Full text of DOI:10.1021/jm201004p

Article
pubs.acs.org/jmc
Conicasterol E, a Small Heterodimer Partner Sparing Farnesoid X
Receptor Modulator Endowed with a Pregnane X Receptor Agonistic
Activity, from the Marine Sponge Theonella swinhoei
Valentina Sepe,† Raffaella Ummarino,† Maria Valeria D’Auria,† Maria Giovanna Chini,‡ Giuseppe Bifulco,‡
Barbara Renga,§ Claudio D’Amore,§ Cecile Debitus,∥ Stefano Fiorucci,§,⊥ and Angela Zampella*,†,⊥
́
†Dipartimento di Chimica delle Sostanze Naturali, Universita
̀
di Napoli “Federico II”, Via D. Montesano 49, 80131 Napoli, Italy
di Salerno, Via Ponte don Melillo, 84084 Fisciano (SA), Italy
di Medicina e Chirurgia, Universita di Perugia, Via Gerardo Dottori
‡Dipartimento di Scienze Farmaceutiche e Biomediche, Universita
̀
§Dipartimento di Medicina Clinica e Sperimentale, Nuova Facolta
1, S. Andrea delle Fratte, 06132 Perugia, Italy
̀
̀
∥Institut de Recherche pour le Dev
̀
eloppement (IRD), Polynesian Research Center on Island Biodiversity, BP529, 98713 Papeete,
Tahiti, French Polynesia
S
* Supporting Information
ABSTRACT: We report the isolation and pharmacological characterization
of conicasterol E isolated from the marine sponge Theonella swinhoei.
Pharmacological characterization of this steroid in comparison to CDCA, a
natural FXR ligand, and 6-ECDCA, a synthetic FXR agonist generated by
an improved synthetic strategy, and rifaximin, a potent PXR agonist,
demonstrated that conicasterol E is an FXR modulator endowed with PXR
agonistic activity. Conicasterol E induces the expression of genes involved
in bile acids detoxification without effect on the expression of small
heterodimer partner (SHP), thus sparing the expression of genes involved
in bile acids biosynthesis. The relative positioning in the ligand binding
domain of FXR, explored through docking calculations, demonstrated a
different spatial arrangement for conicasterol E and pointed to the presence
of simultaneous and efficient interactions with the receptor. In summary,
conicasterol E represents a FXR modulator and PXR agonist that might hold utility in treatment of liver disorders.
activation in mammalian cells and tissues inhibits biosynthesis
of endogenous bile acids by indirect transrepression of
cholesterol 7α-hydroxylase (CYP7A1), a gene encoding for
the first and rate limiting enzyme involved in their biosynthesis.
This effect is indirect and mediated by activation of SHP, small
heterodimer partner, an atypical nuclear receptor that lacks the
DNA binding domain and that binds to liver X receptor (LXR),
causing its displacement from a positive regulatory element in
the CYP7A1 promoter.1,3 Despite the effect of SHP, which has
been shown to be dispensable in some settings, it is well
recognized that SHP activation amplifies the effects of FXR on
bile acids uptake and biosynthesis, strongly suggesting that
identification of SHP-sparing FXR modulators might have the
potential to promote bile acid detoxification without interfering
with the biosynthesis (Figure 1).
INTRODUCTION
■
Among nuclear receptors, farnesoid X receptor (FXR) has
emerged as a valuable pharmacological target1−5 because of its
role in regulating bile acids (BAs), lipid, and glucose
homeostasis. Activation of FXR, highly expressed in the liver,
intestine, kidney, and adrenals, leads to complex responses, the
most relevant of which is the inhibition of bile acids synthesis
through the indirect repression of the expression of cytochrome
7A1 (CYP7A1), the rate limiting enzyme of this pathway. After
its deorphanization6−8 a number of nonsteroidal9−14 and
steroidal compounds,15−17 have been shown to interact with
the ligand binding domain (LBD) of the receptor and to
promote FXR mediated gene transcription. Among these, 6-
ECDCA has emerged as a potent, orally bioavailable FXR
agonist,18 and ongoing clinical trials have shown its utility in the
treatment of type 2 diabetes.19
Besides the significant contribution derived from high-
throughput screenings of chemical libraries and chemical
strategy based on extensive modifications of the BAs body
and side chain, only few natural FXR modulators have been
In this scenario the discovery of FXR modulators represents
an important answer to the urgent demand of new drugs for the
treatment of relevant human diseases including dyslipidemia,
cholestasis, nonalcoholic steatohepatitis (NASH), and type 2
diabetes. Nevertheless the use of potent FXR ligands holds
some potential risk. Indeed, it has been shown that FXR
Received: July 27, 2011
Published: November 29, 2011
© 2011 American Chemical Society
84
dx.doi.org/10.1021/jm201004p | J. Med. Chem. 2012, 55, 84−93

Journal of Medicinal Chemistry
Article
analysis and docking calculations, we have demonstrated that
the steroidal molecules shown in Figure 2 are potent PXR
agonists and FXR antagonists able to antagonize the effect of
CDCA on human FXR. Importantly, even if the junction
between A/B rings is trans and the OH group at position 3 is in
the β position with respect to the natural ligand CDCA, our
docking studies demonstrated that all these compounds could
be accommodated in the ligand binding domain of FXR,
establishing hydrophobic and hydrogen bond contacts with the
catalytic triad.33 Furthermore, within this series, we have
demonstrated that a methyl group at position 24 (conicasterols
B−D in Figure 2) allows stronger interactions with a shallow
groove on the FXR molecular surface with respect to the ethyl
group in theonellasterol-like compounds (theonellasterols B−H
in Figure 2).
In this paper we report the isolation and the molecular
characterization of conicasterol E (1), a 7α,15β-dihydroxyco-
nicasterol analogue (Figure 3), as the first example of an SHP-
sparing FXR modulator endowed with PXR agonistic activity
from the same specimens of Theonella swinhoei. Furthermore, in
order to prove its efficiency in transactivation assays in
comparison to a well validated FXR agonist, we have generated
a novel synthetic strategy to obtain 6-ECDCA (2), a widely
used derivative of endogenus CDCA (3) (Figure 3).
Figure 1. Schematic representation of the activity of FXR and PXR on
target genes. For abbreviations, see list in the paper.
described. Guggulsterone, the active component of the resin
extract of the tree Commiphora mukul,20−23 and xanthohumol,24
the principal prenylated chalcone from beer hops, are two well
characterized examples of FXR modulators isolated from the
vegetal realm. Recently the marine environment has also
emerged as a source of human nuclear receptor ligands, and
several molecules, including scalarane sesterterpenes,25 iso-
prenoids,26 and polyhydroxylated sulfated steroids,27 have been
shown to act as FXR antagonists, whereas to the best of our
knowledge, no examples of marine derived FXR agonists are
known.
As part of our systematic study on the chemical diversity and
bioactivity of secondary metabolites from marine organisms
collected at Solomon Islands,28 we have found a single
specimen of the sponge Theonella swinhoei as an extraordinary
source of NRs steroidal ligands (Figure 2). Analysis of the polar
extracts afforded solomonsterols A and B,29 two potent PXR
agonists and new leads in the treatment of immune-driven
inflammatory bowel diseases,30 whereas analysis of the apolar
extracts allowed the isolation of a small library of 4-methylene
steroids.31,32 By means of a deep in vitro pharmacological
CHEMISTRY. ISOLATION AND STRUCTURAL
CHARACTERIZATION OF CONICASTEROL E (1)
■
The initial processing of the Theonella swinhoei (R3159) was
conducted according to procedures described previously.34 The
n-hexane extract from a solvent partitioning Kupchan
procedure was chromatographed by silica gel, and the fraction
that eluted with CH2Cl2/MeOH (96:4) was further purified by
reverse phase HPLC to give 2.1 mg of conicasterol E (1) as a
colorless amorphous solid ([α]D25 +59.6).
Figure 2. Nuclear receptors ligands previously isolated from the marine sponge Theonella swinhoei.
85
dx.doi.org/10.1021/jm201004p | J. Med. Chem. 2012, 55, 84−93

Journal of Medicinal Chemistry
Article
Figure 3. Conicasterol E (1), the first example of SHP-sparing marine FXR modulator, 6α-ethyl-chenodeoxycholic acid (2), a synthetic FXR agonist
and chenodeoxycholic acid (3), the endogenus FXR ligand.
The molecular formula of C29H48O3, established by HR
ESIMS ([M + Li]+ at m/z 451.3769 (calculated 451.3763)) and
NMR data (Table 1), were compatible with a steroidal
a
Table 1. NMR Data (700 MHz, C6D6) for 1
position
δH
δC
key HMBC
1
1.11 m, 1.52 ovl
1.30 ovl, 1.82 m
3.77 m
36.7
33.4
73.4
153.3
43.2
31.7
66.6
136.7
45.5
40.0
20.3
38.1
43.8
151.5
70.1
39.5
53.4
19.8
12.7
34.6
19.1
33.7
30.6
39.3
32.8
18.6
20.4
15.7
103.3
Figure 4. COSY connectivities (bold bonds) and HMBC (blue
arrows) and ROESY correlations (red arrows) for conicasterol E (1).
2
3
The configuration at C-24 was determined by comparison of
13C NMR data (Table 1) with literature data for epimeric
steroidal side chains.35
Retrospective analysis of NMR data of theonellasterol F
(Figure 2), previously isolated from the same sponge,31
indicated a strong resemblance with conicasterol E (see
Supporting Information). The difference between 1 and
theonellasterol F lies in the side chain with a methyl group
(δH 0.88, 3H, d, J = 6.7 Hz) replacing the C-24 ethyl group
present in all theonellasterol-like compounds.
4
5
2.41 m
6
1.65 ovl, 1.91 ovl
4.63 br t (2.9)
7
8
9
2.40 m
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
1.54 ovl
1.31 ovl, 1.92 ovl
4.57 br d (4.8)
1.50 ovl, 1.66 ovl
1.64 ovl
C13, C14, C17
NEW SYNTHETIC STRATEGY OF 6-ECDCA (2)
■
C13, C14, C15, C17
C13, C14, C15
So far, two synthetic procedures of 6-ECDCA (2) have been
reported. The first process was based on the alkylation of the 3-
tetrahydropyranyloxy derivative of 7-ketolithocholic acid with
lithium diisopropylamide and ethyl bromide followed by
standard reduction and hydrolysis steps.16,18
0.79 s
C12, C13, C14, C17
C1, C5, C9, C10
0.59 s
1.43 m
1.00 d (6.3)
1.20 m, 1.48 m
1.16 m, 1.47 m
1.33 m
Our preliminary screening of this synthesis revealed low-
yielding steps, especially in the alkylation of 7-ketolithocholic
acid, and the need for chromatographic purification of every
step.
1.59 m
Recently, an alternative procedure36 via aldol-type addition of
a silyl enol ether derivative of 7-ketolithocholic acid methyl
ester with acetaldehyde followed by hydrogenation with PtO2,
alkaline hydrolysis (10% NaOH in refluxing methanol), and
selective reduction of the C7-ketone with sodium borohydride
has been reported (58% overall yield from methyl 7-keto-
lithocholate).
0.88 d (6.7)
0.94 d (6.7)
0.87 d (6.8)
4.72 br s, 5.32 br s
C24, C25
C24, C25
C23, C24, C25
C3, C4, C5
a
Coupling constants are in parentheses and given in hertz. 1H and 13
assignments are aided by COSY, TOCSY, ROESY, HSQC, and
HMBC experiments. Ovl: signals overlapped.
C
Despite our extensive effort, we faced several problems in
reproducing the reported high yield in the hydrolysis and
reduction steps. In fact the hydrolysis of methyl ester in alkaline
condition proceeded with low yields and extensive epimeriza-
tion at C-6 position due to the presence of the carbonyl group
at C-7.
Alternatively we tested the possibility of inverting the last
two steps of the reported protocol and of performing first the
C-7 reduction followed by methyl ester hydrolysis. Despite the
reported regio- and stereoselectivity of NaBH4 reduction, in our
hands the reduction of methyl 3α-hydroxy-6α-ethyl-7-keto-5β-
cholan-24-oate proceeded with the formation of a large amount
of the over-reduced product with the primary alcoholic function
tetracyclic nucleus, two double bonds, and three hydroxyl
groups in the molecule. COSY correlations delineated the spin
system H-1 through H-7 and the spin system H-15/H-17 with
OH substitutions at C-7 (δH 4.63) and at C-15 (δH 4.57),
whereas the presence of a Δ8(14) double bond was inferred
from careful analysis of HMBC data reported in the Table 1
and in Figure 4. The small vicinal coupling constant of H-7 (br
t, J = 2.9 Hz) allowed us to establish an equatorial disposition
for this proton, thereby placing the hydroxyl group in an axial
α-orientation, while the ROE effect H-15/H-17α (Figure 3)
was indicative of a β-orientation of the hydroxy group at C-15.
86
dx.doi.org/10.1021/jm201004p | J. Med. Chem. 2012, 55, 84−93

Journal of Medicinal Chemistry
Article
a
Scheme 1
a
Reagents and conditions: (a) NaClO/Bu4N+Br−, NaBr, 0 °C; (b) BnBr, Cs2CO3, CH3CN, reflux, 60% over two steps; (c) DIPA, n-BuLi, TMSCl,
Et3N, THF, −78 °C; (d) MeCHO, BF3·OEt2, CH2Cl2, −60 °C, 70% over two steps; (e) NaBH4/CeCl3, THF/MeOH (4:1), 95%; (f) H2, Pd/C,
THF/MeOH (1:1), 80%.
Figure 5. (A) Relative potency of FXR activation by CDCA (3), 10 μM, conicasterol E (1), 10 μM, and 6-ECDCA (2), 1 μM, as measured by
transactivation assay in HepG2 cells. (B) Conicasterol E (1), 50 μM, does not revert the effect of CDCA (3), 10 μM, on FXR transactivation in
HepG2 cells. (C) Relative potency of PXR activation by rifaximin, 10 μM, and conicasterol E (1) alone, 10 μM, or in combination, 50 μM. Data are
the mean SE of four experiments: (∗) P < 0.05 versus untreated cells (NT).
at C-24 and with scarce stereoselectivity in the introduction of
hydroxyl group at C-7 with the required α-configuration.
To overcome the inconvenience of the coexistence of C-7
ketone and C-24 methyl ester, we initially attempted to
perform the generation of silyl enol ether on the 7-
ketolithocholic acid without the protection of the carboxyl
function at C-24, but despite our several efforts,37 no
transformation occurred.
At this point we decided to protect the carboxyl function at
C-24 as benzyl ester. The choice of benzyl as protecting group
addressed two essential demands: reduction of synthetic steps
in order to achieve better chemical yield and, importantly,
improvement of regio- and stereoselectivity of the entire
process. The synthesis of 2, starting from commercially
available chenodeoxycholic acid (4), is outlined in Scheme 1.
Oxidation with sodium hypochlorite solution/NaBr and
tetrabutylammonium bromide in a mixture of methanol/acetic
acid/water/ethyl acetate as solvent, followed by benzylation of
C-24 carboxylic acid, afforded benzyl ester of 7-ketolithocholic
acid (5) in 60% chemical yield (two steps) and without traces
of 3-keto regioisomer and dioxidated product. Generation of
silyl enol ether (6) and subsequent aldol addition with
acetaldehyde in the presence of BF3·OEt2 gave the desired
benzyl 3α-hydroxy-6-ethylidene-7-keto-5β-cholan-24-oate (7)
in 70% yield over two steps.
High selective reduction of the C7-ketone with NaBH4/
CeCl3 in a mixture of THF/MeOH at room temperature gave
diol 8 (95% chemical yield, >98% de). Hydrogenation (H2 on
Pd/C Degussa type) of exocyclic double bond and concomitant
removal of the benzyl-protecting group afforded 6-ECDCA (2)
in six steps with a 32% overall yield.
The identity of 2 was secured by comparison of its NMR and
MS spectra with those previously reported.16,18 In a reporter
assay we demonstrated that the so obtained 6-ECDCA (2) is a
potent FXR agonist (Figure 5).
BIOLOGICAL ACTIVITY
■
Conicasterol E (1) was tested in vitro using an hepatocarci-
noma cell line (HepG2 cells) transfected with FXR, RXR, β-
galactosidase expression vectors (pSG5FXR, pSG5RXR, and
pCMV-βgal) and with p(hsp27)TKLUC reporter vector that
contains the promoter of the FXR target gene heat shock
protein 27 (hsp27) cloned upstream the luciferase gene.
As shown in Figure 5, conicasterol E (1) activates FXR in
transactivation assay. However, in contrast to CDCA (3), the
results of these experiments demonstrate that conicasterol E
(1) activates FXR with a bell shaped concentration−response
curve, the agonistic activity being partially reduced at 50 μM. At
10 μM, 1 was as effective as CDCA (3) in transactivation assay
87
dx.doi.org/10.1021/jm201004p | J. Med. Chem. 2012, 55, 84−93

Journal of Medicinal Chemistry
Article
Figure 6. RT-PCR analysis of effects of CDCA (3), 10 μM, and conicasterol E (1), 10 μM, on expression of FXR and PXR-regulated genes in
HepG2 cells. Conicasterol E (1) does not induce SHP, whereas it induces the expression of CYP7A1. Data are the mean SE of four experiments:
(∗) P < 0.05 versus untreated cells (NT); (∗∗) P < 0.05 versus CDCA alone.
Figure 7. RT-PCR analysis of effects of CDCA (3), 10 μM, alone or in combination with conicasterol E (1), 10 μM, on expression of FXR-regulated
genes in HepG2 cells. Conicasterol E (1) does not induce SHP even when cells were co-incubated with 3, while the association of the two agents
partially attenuated the expression of OSTα but increased the expression of BSEP. Data are the mean SE of four experiments: (∗) P < 0.05 versus
untreated (NT).
but significantly less potent than the synthetic FXR ligand 6-
ECDCA (2) and GW4064 (data not shown). We then tested
whether conicasterol E (1) exerted any antagonistic activity
against FXR. Because the above-mentioned results revealed a
bell-shaped curve in the concentration−response effect of
compound 1 in transactivating FXR, we tested the effects of
this agent at 10 μM (data not shown) and 50 μM and found
that compound 1 was devoid of any antagonistic activity when
coadministered with CDCA (3) (Figure 5B) and 6-ECDCA
(data not shown) to HepG2 cells. In addition to an FXR
agonistic activity, conicasterol E (1) effectively induced PXR
expression, being as effective as rifaximin in inducing PXR
transactivation (Figure 5C). Thus, conicasterol E (1) is a dual
FXR and PXR agonist.
To further characterize the biological activity of the
conicasterol E (1), we have examined the effect of this agent
on the expression of canonical FXR and PXR target genes in
hepatocytes, and as shown in Figure 6, we found that exposure
to conicasterol E slightly increased the expression of OSTα and
BSEP mRNAs (two FXR regulated genes) and the expression
of CYP3A4 mRNA (a PXR-regulated gene), while no effect was
observed on SHP mRNA expression.
evidence that in HepG2 cells repression of CYP7A1 by FXR is
indirect and requires induction of SHP.
Further on, when administered in combination with a
concentration of CDCA of 10 μM, conicasterol E exerted an
additive effect with CDCA on the expression of OSTα and
BSEP while no further changes were observed in the expression
of SHP (Figure 7). Taken together, these data highlight that
conicasterol E (1) is a FXR modulator whose potency on
selective target genes is very close to that of the endogenous
mammalian ligand CDCA (3) and lower than that of the
synthetic agonist 6-ECDCA (2). Interestingly, conicasterol E
(1) failed to stimulate SHP even when coadministered in
combination with CDCA (3).
Finally, analysis of CYP3A4 expression, shown in Figure 8,
demonstrated that conicasterol E (1) has no antagonistic effects
on expression of CYP3A4 mRNA induced by rifaximin, a
potent PXR agonist.
DOCKING STUDIES
■
As reported in previous studies,31 4-methylene sterols isolated
from Theonella swinhoei are able to modulate in different ways
the FXR activity depending on the steroid skeleton
substitutions. On this basis and in order to describe at atomic
level the interactions of 1 with FXR macromolecule, we
performed a molecular docking calculations using Autodock 4.2
software.38 As shown in Figure 9A, the FXR binding site,
located between helixes 2, 3, 5−7, and 10/11, is occupied by 1,
In addition, in contrast to CDCA, 1 failed to repress
CYP7A1. Thus, while the expression of this gene was reduced
by 30% by CDCA, exposure to conicasterol E (1) increased
CYP7A1 mRNA by 2- to 3-fold. These data are further
88
dx.doi.org/10.1021/jm201004p | J. Med. Chem. 2012, 55, 84−93

Journal of Medicinal Chemistry
Article
additional interactions with the receptor binding site might
be responsible for its agonist activity on FXR. Further on, the
exclusive amino acid interactions exerted by conicasterol E (1)
might support the notion that the compound is an FXR
modulator endowed with the ability to activate OSTα and
BSEP without effect on SHP expression.
CONCLUSION
■
In this paper, we have identified a micromolar potent FXR
modulator that induces both BSEP and OSTα. These studies
pave the way to further elaborating on the critical interactions
on the FXR-LBD aimed at the identification of a site specific
ligand that could be used to specifically induce selective genes.
Because activation of BA transporters along with induction of
detoxification pathways (CYP3A4) might hold potential in the
treatment of nonobstructive cholestasis, a clinical condition
associated with intake of many drugs including, among others,
estrogens, these results support the notion that the develop-
ment of selective FXR modulators represents a feasible strategy
for treating these disorders. In addition the lack of activity on
SHP is of interest and further supports a functional role for
differential amino acid interactions in comparison with 6-
ECDCA shown by our docking studies. Indeed, it is recognized
that SHP induction mediates transrepression of CYP7A1 by
FXR. In the present study we have shown that conicasterol E
(1) enhances CYP7A1 expression. This effect is likely PXR
dependent39 because liver expression of this gene increases
significantly in PXR−/− mice in comparison to wild type mice,
further highlighting the dual nature of FXR and PXR ligands of
this agent. Because inhibition of CYP7A1 impairs bile acid
synthesis, our data strongly support the notion that conicasterol
E (1) is acting mainly on the BAs excretion from hepatocytes
without impacting bile acid synthesis. Inhibition of BAs
synthesis is a well recognized drawback of FXR agonism,
raising concern on clinical use of its ligands.
Figure 8. Activation of CYP3A4 by the PXR agonist rifaximin, 10 μM,
is not modulated by conicasterol E (1), 50 μM. Data are the mean
SE of four experiments: (∗) P < 0.05 versus untreated (NT).
and as previously reported,31 the β-OH groups at positions 3
and 15 and the trans junction between A/B rings cause a
different positioning with respect to the cocrystallized molecule
6-ECDCA (2). In particular (Figure 9B) conicasterol E (1),
compared to the synthetic agonist 6-ECDCA (2), is able to
interact with two amino acids of the catalytic triad formed by
Tyr358 in helix 7, His444 in helix 10/11, Trp466 helix 12,
responsible for the activation of FXR.33 Specifically, the 3-OH
group at β position forms a hydrogen bond with Tyr358 in
helix 7, while the trans junction between the A/B ring allows a
hydrophobic interaction with His444 (helix 10/11). In our
previous study,31 we have described the influence of the side
chain on the FXR binding. In fact, the methyl at position 24 of
conicasterol E (1) (yellow, Figure 9B) relating to 6-ECDCA
(2) (red, Figure 9B) is able to simultaneously interact with the
Met262 (coil 2), His291 (helix 3), and Met287 (helix 3)
present on the shallow groove of the FXR molecular surface
protruding toward the solvent.
Moreover, the OH at position 15β in 1 forms an additional
hydrogen bond with the CO of Leu284 (helix 3), and the
steroid skeleton is in close contact with Leu345, Ala288,
Met447, Phe326, and Trp451 relating to the 6-ECDCA (2).
On the other hand, the OH at 7α position does not seem to
exert further polar interactions with the FXR binding site.
In summary, conicasterol E (1) presents a different spatial
arrangement relating to the cocrystallized molecule 6-ECDCA;
however, our docking calculations point out that its
simultaneous and efficient hydrophobic and hydrophilic
The SHP sparing activity shown by conicasterol E (1) is of
particular interest. The lack of effects of this sterol on SHP
likely explains the lack of inhibition of CYP7A1 we have
observed in hepatocytes. SHP is an orphan nuclear receptor
that lacks the DNA-binding domain, whose activation by FXR
is responsible for some unwanted effects seen with potent FXR
agonists including inhibition of bile acids synthesis which leads
to bile acid pool shrinking. Because a reduction of bile acid pool
holds potential for side effects including cholestasis and
Figure 9. (A) Superimposition of 1 (yellow) with 6-ECDCA (2) (red) in the binding pocket of FXR (PDB code 1OSV). (B) Amino acids
interacting with 6-ECDCA (red) are depicted in purple. Amino acids interacting with 1 (yellow) are depicted in green, and amino acids interacting
with both molecules are depicted in light blue.
89
dx.doi.org/10.1021/jm201004p | J. Med. Chem. 2012, 55, 84−93

Journal of Medicinal Chemistry
Article
The purities of compounds were determined to be greater than 95%
by HPLC.
impaired glucose and lipid homeostasis, present findings
provide SAR insights for development of SHP-sparing FXR
agonists.
Sponge Material and Separation of Conicasterol E (1).
Theonella swinhoei (order Lithistida, family Theonellidae) was
collected at a depth of 22 m, on an isolated reef off the western
coast of Malaita Island, Solomon Islands, in July 2004, and reference
specimens are on file (R3159) at the ORSTOM, Centre of Noumea.
The samples were frozen immediately after collection and lyophilized
to yield 207 g of dry mass. Taxonomic identification was performed by
Dr. John Hooper at Queensland Museum, Brisbane, Australia.
The lyophilized material (207 g) was extracted with methanol (3 ×
1.5 L) at room temperature, and the crude methanolic extract was
subjected to a modified Kupchan’s partitioning procedure as follows.
The methanol extract was dissolved in a mixture of MeOH/H2O
containing 10% H2O and partitioned against n-hexane (4.5 g). The
water content (% v/v) of the MeOH extract was adjusted to 30% and
partitioned against CHCl3 (6.0 g). The aqueous phase was
concentrated to remove MeOH and then extracted with n-BuOH
(10.3 g).
In addition, we have shown that conicasterol E (1) is a
potent PXR agonist. PXR is an essential regulator of hepatic
detoxification of endo- and xenobiotics,40 and the ability of
conicasterol E (1) to transactivate PXR was confirmed by the
ability of this agent to induce the expression of CYP7A1 and
CYP3A4 mRNAs. Because CYP3A4 is a canonical PXR
responsive gene, these data strongly support the notion that
1 is a PXR agonist. Activation of PXR along with FXR
modulation holds some potent benefit. Thus, induction of
endobiotic clearance, including excretion of bilirubin, a typical
PXR-dependent effect, might help to prevent accumulation of
toxic intermediates, a condition that occurs in several liver
diseases.
We have previously reported the isolation and character-
ization of theonellasterol derivatives endowed with FXR
antagonism and PXR agonism.31 The further decodification
of this family of steroidal metabolites has now allowed the
identification of a SHP-sparing FXR modulator (i.e., an FXR
agonist that modulates the expression of FXR’s target genes in a
different manner in comparison to CDCA) endowed with a
potent PXR activity, indicating that detailed characterization of
these unusual steroids from Theonella swinhoei could be an
important tool in deciphering the biology of nuclear receptors
in mammals.
The hexane extract was chromatographed in two runs by silica gel
MPLC using a solvent gradient system from CH2Cl2 to CHCl2/
MeOH, 1:1.
Fractions eluted with CH2Cl2/MeOH, 96:4 (18.5 mg), were further
purified by HPLC on a Nucleodur 100-5 C18 (5 μm, 10 mm i.d. ×
250 mm) with MeOH/H2O (92:8) as eluent (flow rate of 5 mL/min)
to give 2.1 mg of conicasterol E (1) (tR = 14.5 min).
Conicasterol E (1). White amorphous solid; [α]D25 +59.6 (c 0.06,
MeOH); 1H and 13C NMR data in C6D6 given in Table 1. ESI-MS: m/
z 451.4 [M + Li]+. HRMS (ESI): calcd for C29H48LiO3, 451.3763;
found, 451.3769 [M + Li]+.
Total Synthesis of 6-ECDCA (2). Benzyl 3α-Hydroxy-7-keto-
5β-cholan-24-oate (5). An oven-dried 250 mL flask was charged
with chenodeoxycholic acid 4 (2.00 g, 5.1 mmol), sodium bromide (30
mg, 0.25 mmol), tetrabutylammonium bromide (5.4 g, 16.8 mmol),
and 43 mL of a solution of MeOH/CH3COOH/H2O/AcOEt,
3:1:0.25:6.5 v/v. The mixture was stirred at room temperature until
a homogeneous solution formed and then cooled at 0 °C. Sodium
hypochlorite solution (10%, 5 mL, 5.6 mmol) was added, until the test
for hypochlorite (peroxide test paper) was positive, and the yellow
suspension was stirred. The mixture was stirred at room temperature
for 6 h. Aqueous sodium bisulfite (3.3%) was added to afford a white
suspension (negative test for peroxide). Water (50 mL) was added and
the mixture stirred at 15 °C for 5 min. Aqueous solution was extracted
with AcOEt (3 × 50 mL). The combined organic layer was washed
with aqueous sodium bisulfite (50 mL) and water (50 mL) and then
dried over anhydrous MgSO4 and evaporated in vacuo to give 2.0 g of
3α-hydroxy-7-keto-5β-cholan-24-oic acid, which was subjected to the
next step without any purification. To a solution of this latter
intermediate (2.0 g, 5.1 mmol) in CH3CN dry (30 mL), Cs2CO3 (2.5
g, 7.6 mmol) was added. The solution was heated to 150 °C, and BnBr
(3.0 mL, 25.5 mmol) was added under reflux. The solution was stirred
at this temperature for 24 h and then afterward cooled to room
temperature and, after removal CH3CN in the rotavapor, poured into
saturated NaHCO3 solution (50 mL) and extracted with AcOEt (3 ×
30 mL). The combined organic layer was washed with water (30 mL)
and then dried over anhydrous MgSO4 and evaporated in vacuo.
Purification on silica gel column, eluting with hexane/AcOEt (7:3) and
0.5% Et3N, afforded pure 5 (1.5 g, 60% over two steps). [α]D25 −10.9 (c
In summary, we have provided evidence that conicasterol E
(1), a marine steroid isolated from the sponge Theonella
swinhoei, is a dual FXR and PXR agonist that triggers bile acid
detoxification without impairing uptake or biosynthesis. This
compound selectively activates BSEP and OSTα without
inducing SHP. In addition we have reported a novel synthetic
pathway to generate 6-ECDCA (2), a potent FXR agonist.
Present data might be exploited for further designing of
multilevel regulators of nuclear receptors.
EXPERIMENTAL PROCEDURES
■
General Procedures. Specific rotations were measured on a
Perkin-Elmer 243 B polarimeter. High-resolution ESI-MS spectra were
performed with a QTOF Micromass spectrometer. ESI-MS experi-
ments were performed on an Applied Biosystem API 2000 triple−
quadrupole mass spectrometer. NMR spectra on conicasterol E were
obtained on Varian Inova 700 NMR spectrometer (1H at 700 MHz,
13C at 175 MHz) equipped with Sun hardware, with δ (ppm), J in Hz,
and spectra referenced to C6HD5 as internal standard (δH 7.16, δC
128.4). Through-space 1H connectivities were evidenced using a
ROESY experiment with mixing times of 200 ms. NMR spectra on all
synthetic intermediates were obtained on Varian Inova 400 and Varian
Inova 500 NMR spectrometers (1H at 400 and 500 MHz, 13C at 100
and 125 MHz, respectively) and recorded in CDCl3 (δH =7.26 and δC
=77.0 ppm) and CD3OD (δH = 3.30 and δC = 49.0 ppm).
1
HPLC was performed using a Waters model 510 pump equipped
with Waters Rheodine injector and a differential refractometer, model
401.
0.99, CHCl3). H NMR (400 MHz, CDCl3): δ 7.33 (5H, m), 5.09
(2H, dd, J = 12.9, 15.6 Hz), 3.57 (1H, m), 2.83 (1H, m), 2.37 (1H, m,
ovl), 2.26 (1H, m), 2.15 (1H, m), 1.37 (3H, s), 0.89 (3H, d, J = 6.0
Hz), 0.61 (3H, s). 13C NMR (100 MHz, CDCl3): δ 212.0 (s), 174.0
(s), 136.2 (s), 128.5 (2C) (d), 128.2 (2C) (d), 128.1 (d), 70.7 (d),
66.0 (t), 54.7 (d), 49.4 (d), 48.8 (d), 46.0 (d), 45.3 (t), 42.7 (s), 42.5
(t), 38.9 (d), 37.3 (s), 35.1 (d), 34.1 (t), 31.2 (t), 30.9 (t), 29.8 (2C)
(t), 28.2 (t), 24.7 (t), 23.0 (t), 21.6 (q), 18.3 (q), 11.9 (q). HRMS-ESI
m/z 480.3240 ([M + H]+, C31H44O4 requires 480.3235.
Reaction progress was monitored via thin-layer chromatography
(TLC) on Alugram silica gel G/UV254 plates. Silica gel MN Kieselgel
60 (70−230 mesh) from Macherey-Nagel Company was used for
column chromatography. All chemicals were obtained from Sigma-
Aldrich, Inc. Solvents and reagents were used as supplied from
commercial sources with the following exceptions. Tetrahydrofuran,
toluene, dichloromethane, ether, and triethylamine were distilled from
calcium hydride immediately prior to use. All reactions were carried
out under argon atmosphere using flame-dried glassware.
Benzyl 3α,7-Trimethylsilyloxy-5β-cholan-6-en-24-oate (6).
To a solution of diisopropylamine (5.5 mL, 39 mmol) in dry THF (50
mL) was added dropwise a solution of n-butyllithium (15 mL, 2.5 M in
90
dx.doi.org/10.1021/jm201004p | J. Med. Chem. 2012, 55, 84−93

Journal of Medicinal Chemistry
Article
hexane, 37.2 mmol) at −78 °C under nitrogen atmosphere. After 30
min, trimethylchlorosilane (3.9 mL, 31 mmol) was added, and the
resulting mixture was reacted for an additional 20 min. A solution of
benzyl 3α-hydroxy-7-keto-5β-cholan-24-oate (5) (1.5 g, 3.1 mmol) in
dry THF (20 mL) was added dropwise in 10 min. The mixture was
stirred at −78 °C for an additional 45 min, and then triethylamine (7.8
mL, 56 mmol) was added. After 1 h, the reaction mixture was allowed
to warm to −20 °C, treated with aqueous saturated solution of
NaHCO3 (10 mL), and brought up to room temperature in 2 h. The
organic phase was separated, and the aqueous phase was extracted with
ethyl acetate (3 × 50 mL). The combined organic phases were washed
several times with a saturated solution of NaHCO3, water, and brine.
After the mixture was dried over anhydrous Na2SO4, the residue was
evaporated under vacuum to give 1.8 g of 6 as a yellow residue, which
was subjected to next step without any purification. [α]D25 +4.3 (c 0.58,
CHCl3). 1H NMR (400 MHz, CDCl3): δ 7.35 (5H, m), 5.10 (1H, dd,
J = 15.8, 12.4 Hz), 4.72 (1H, d, J = 6.1 Hz), 3.50 (1H, m), 2.40 (1H,
m), 2.28 (1H, m), 0.90 (3H, d, J = 6.3 Hz), 0.81 (3H, s), 0.64 (3H, s),
0.18−0.001 (18H, ovl). 13C NMR (100 MHz CDCl3): δ 174.0 (s),
151.7 (s), 136.2 (s), 128.5 (2C) (d), 128.2 (2C) (d), 128.1 (d), 108.8
(d), 71.5 (d), 66.1 (t), 54.8 (d), 54.1 (d), 44.3 (t), 42.6 (s), 41.0 (d),
40.9 (t), 40.3 (d), 40.1 (s), 35.2 (d), 34.6 (t), 32.9 (d), 31.4 (t), 31.0
(t), 30.7 (t), 28.6 (t), 27.0 (t), 22.5 (t), 20.9 (q), 18.4 (q), 12.4 (q),
1.4 (3C) (q), 0.4 (2C) (q), 0.2 (q). HRMS-ESI m/z 624.4030 ([M +
H]+, C37H60O4Si2 requires 624.4047.
and the flask was evacuated and flushed with argon. Absolute methanol
(10 mL) and dry THF (10 mL) were added, and the flask was flushed
with hydrogen. The mixture was stirred at room temperature under H2
for 4 h. The mixture was filtered through Celite, and the recovered
filtrate was evaporated under vacuum to give pure 6α-ethyl-
chenodeoxycholic acid 2 (630 mg, 80%). [α]D25 +5.11 (c 1.8,
1
CH3OH). H NMR (400 MHz, CD3OD): δ 3.60 (1H, br s), 3.32
(1H, m), 2.33 (1H, m), 2.20 (1H, m), 0.97 (3H, d, J = 6.2 Hz), 0.91
(3H, s), 0.90 (3H, t, J = 7.0 Hz), 0.69 (3H, s). 13C NMR (100 MHz,
CD3OD): δ 178.4 (s), 73.3 (d), 71.2 (d), 57.4 (d), 51.7 (d), 46.9 (d),
43.8 (t), 43.2 (s), 41.6 (d), 41.1 (d), 36.8 (2C) (d, s), 36.6 (d), 34.5
(t), 34.4 (t), 32.4 (t), 32.2 (t), 31.2 (t), 29.3 (t), 24.6 (t), 23.7 (t), 23.5
(t), 21.9 (q), 18.8 (q), 12.2 (q), 12.0 (q). HRMS-ESI m/z 420.3240
([M + H]+, C26H44O4 requires 420.3237.
Plasmids, Cell Culture, Transfection, and Luciferase Assays.
All transfections were made using Fugene HD transfection reagent
(Roche). For FXR mediated transactivation, HepG2 cells, plated in a
six-well plate at 5 × 105 cells/well, were transfected with 100 ng of
pSG5-FXR, 100 ng of pSG5-RXR, 200 ng of pCMV-β-galactosidase
and 500 ng of the reporter vector p(hsp27)-TK-LUC containing the
FXR response element IR1 cloned from the promoter of heat shock
protein 27 (hsp27). At 48 h after transfection, cells were stimulated 18
h with 10 μM CDCA or with 1 alone (10 μM) or in combination (50
μM) with CDCA.
For PXR mediated transactivation, HepG2 cells, plated in a six-well
plate at 5 × 105 cells/well, were transfected with 100 ng of pSG5-PXR,
100 ng of pSG5-RXR, 200 ng of pCMV-β-galactosidase, and 500 ng of
the reporter vector containing the PXR target gene promoter
(CYP3A4 gene promoter) cloned upstream of the luciferase gene
(pCYP3A4promoter-TKLuc). At 48 h after transfection, cells were
stimulated 18 h with 10 μM rifaximin or with 1 alone (10 μM) or in
combination (50 μM) with rifaximin.
Cells were lysed in 100 μL of diluted reporter lysis buffer
(Promega), and 0.2 μL of cellular lysates was assayed for luciferase
activity using the luciferase assay system (Promega). Luminescence
was measured using an automated luminometer. Luciferase activities
were normalized for transfection efficiencies by dividing the relative
light units by β-galactosidase activity expressed from cells
cotransfected with pCMV-βgal.
Benzyl 3α-Hydroxy-6-ethyliden-7-keto-5β-cholan-24-oate
(7). To a cooled (−60 °C) and stirred solution of acetaldehyde
(328 μL, 5.86 mmol) and benzyl 3α,7-trimethylsilyloxy-5β-cholan-6-
en-24-oate (6) (1.8 g, 2.93 mmol) in dry CH2Cl2 (30 mL) was added
dropwise BF3·OEt2 (3.7 mL, 29.3 mmol). The reaction mixture was
stirred for 2 h at −60 °C and allowed to warm to room temperature.
The mixture was quenched with saturated aqueous solution of
NaHCO3 and extracted with CH2Cl2. The combined organic phases
were washed with brine, dried over anhydrous MgSO4, and
concentrated under vacuum. Purification on silica gel column, eluting
with hexane/AcOEt (9:1) and 0.5% Et3N, afforded pure 7 (1.09 g,
70% over two steps). [α]D25 −42.5 (c 0.12, CHCl3). H NMR (400
1
MHz, CDCl3): δ 7.34 (5H, m), 6.16 (1H, q, J = 6.7 Hz), 5.10 (2H, dd,
J = 13.0, 17.8 Hz), 3.64 (1H, m), 2.56 (1H, m), 2.38 (1H, m), 2.27
(1H, m), 1.67 (3H, d, J = 6.7 Hz), 0.99 (3H, s), 0.91 (3H, d, J = 6.0
Hz), 0.60 (3H, s). 13C NMR (100 MHz, CDCl3): δ 215.2 (s), 174.0
(s), 143.3 (s), 140.9 (s), 129.8 (d), 128.5 (2C) (d), 128.2 (2C) (d),
128.1 (d), 70.5 (d), 66.1 (t), 54.5 (d), 50.6 (d), 48.6 (d), 45.5 (d),
43.5 (t), 39.1 (s), 38.9 (t), 37.5 (s), 35.1 (d), 34.4 (t), 31.2 (t), 30.9
(t), 29.6 (2C) (d, t), 28.4 (t), 25.9 (t), 22.8 (t), 21.3 (q), 18.4 (q),
12.6 (q), 12.0 (q). HRMS-ESI m/z 506.3396 ([M + H]+, C33H46O4
requires 506.3378.
Quantitative Real-Time PCR. Template (50 ng) was added to
the PCR mixture (final volume of 25 μL) containing the following
reagents: 0.2 μM each primer and 12.5 μL of 2× SYBR Green qPCR
master mix (Invitrogen, Milan, Italy). All reactions were performed in
triplicate, and the thermal cycling conditions were 2 min at 95 °C,
followed by 40 cycles of 95 °C for 20 s, 55 °C for 20 s, and 72 °C for
30 s in iCycler iQ instrument (Biorad, Hercules, CA). The mean value
of the replicates for each sample was calculated and expressed as cycle
threshold (CT, cycle number at which each PCR reaction reaches a
predetermined fluorescence threshold, set within the linear range of all
reactions). The amount of gene expression was then calculated as the
difference (ΔCT) between the CT of the sample for the target gene and
the mean CT of that sample for the endogenous control (GAPDH).
Relative expression was calculated as the difference (ΔΔCT) between
the ΔCT of the test sample and of the control sample (not treated) for
each target gene. The relative quantization value was expressed and
Benzyl 3α,7α-Dihydroxy-6-ethyliden-5β-cholan-24-oate
(8). Compound 7 (1.00 g, 1.97 mmol) was dissolved in a solution
of dry tetrahydrofuran/dry methanol (50 mL, 4/1 v/v) and treated
with CeCl3 (1.46 g, 5.93 mmol) and NaBH4 (667 mg, 2.36 mmol).
After 3 h, water and MeOH were added. Then after evaporation of the
solvents, the residue was diluted with water and extracted with ether (3
× 50 mL). The combined organic phases were washed with brine,
dried over anhydrous Na2SO4, and evaporated under reduced pressure.
The crude residue was purified by flash chromatography on silica gel,
using dichloromethane/methanol (7:3 v/v) and 0.5% Et3N as eluent,
shown as 2−ΔΔC . All PCR primers were designed with PRIMER3-
T
OUTPUT software using published sequence data from the NCBI
database. The primer sequences were as follows: hGAPDH,
gaaggtgaaggtcggagt and catgggtggaatcatattggaa; hBSEP, gggccattgtac-
gagatcctaa and tgcaccgtcttttcactttctg; hCYP7A1, caccttgaggacggttccta
and cgatccaaagggcatgtagt; hOSTα, tgttgggccctttccaatac and
ggctcccatgttctgctcac; hSHP, gctgtctggagtccttctgg and ccaatgatagggc-
gaaagaagag; hCYP3A4, caagacccctttgtggaaaa and cgaggcgactttctttcatc.
Computational Details. We performed molecular docking
calculations by Autodock 4.2 software38 on quad-core Intel Xeon 3.4
GHz, using a grid box size of 94 × 96 × 68, with spacing of 0.375 Å
between the grid points and centered at 20.689 (x), 39.478 (y), 10.921
(z), covering the active site of the FXR.33 To achieve a representative
conformational space during the docking studies and for taking into
account the variable number of active torsions, 10 calculations
1
to afford 950 mg of 8 (95% yield). [α]D25 + 18.0 (c 0.06, CHCl3). H
NMR (400 MHz, CDCl3): δ 7.34 (5H, m), 5.64 (1H, q, J = 6.2 Hz),
5.10 (2H, dd, J = 12.5, 17.3 Hz), 3.98 (1H, m), 3.64 (1H, m), 2.47
(1H, m), 2.39 (1H, m), 2.27 (1H, m), 1.60 (3H, d, J = 6.6 Hz), 0.91
(3H, d, J = 6.2 Hz), 0.77 (3H, s), 0.61 (3H, s). 13C NMR (100 MHz,
CDCl3): δ 174.0 (s), 141.6 (s), 136.1 (s), 128.5 (2C) (d), 128.3 (2C)
(d, d), 128.2 (d), 114.4 (d), 73.3 (d), 71.2 (d), 66.1 (t), 56.0 (d), 55.0
(d), 45.5 (d), 44.0 (t), 40.0 (s), 39.5 (d), 36.3 (s), 35.4 (d), 35.2 (d),
34.7 (t), 31.3 (t), 31.0 (t), 30.2 (t), 29.6 (t), 28.6 (t), 27.1 (t), 22.8 (t),
21.2 (q), 18.4 (q), 12.4 (q), 12.2 (q). HRMS-ESI m/z 508.3553 ([M +
H]+, C33H48O4 requires 508.3565.
6-ECDCA (2). An oven-dried 50 mL flask was charged with 10%
palladium on carbon (50 mg) and compound 8 (950 mg, 1.87 mmol),
91
dx.doi.org/10.1021/jm201004p | J. Med. Chem. 2012, 55, 84−93

Journal of Medicinal Chemistry
Article
consisting of 256 runs were performed, obtaining 2560 structures for
the ligand. The Lamarckian genetic algorithm (LGA) was employed
for docking calculations, choosing an initial population of 600
randomly placed individuals. The maximum number of energy
evaluations and of generations was set up to 5 × 106 and to 6 ×
106, respectively. Results differing by less than 3.5 Å in positional root-
mean-square deviation (rmsd) were clustered together and repre-
sented by the result with the most favorable free energy of binding.
Illustrations of the 3D models were generated using the Chimera41 and
the Python software.42
(6) Wang, H.; Chen, J.; Hollister, K.; Sowers, L. C.; Forman, B. M.
Endogenous bile acids are ligands for the nuclear receptor FXR/BAR.
Mol. Cell 1999, 3, 543−553.
(7) Makishima, M.; Okamoto, A. Y.; Repa, J. J.; Tu, H.; Learned, R.
M.; Luk, A.; Hull, M. V.; Lustig, K. D.; Mangelsdorf, D. J.; Shan, B.
Identification of a nuclear receptor for bile acids. Science 1999, 284,
1362−1365.
(8) Parks, D. J.; Blanchard, S. G.; Bledsoe, R. K.; Chandra, G.;
Consler, T. G.; Kliewer, S. A.; Stimmel, J. B.; Willson, T. M.; Zavacki,
A. M.; Moore, D. D.; Lehmann, J. M. Bile acids: natural ligands for an
orphan nuclear receptor. Science 1999, 284, 1365−1368.
(9) Maloney, P. R.; Parks, D.; Haffner, C. D.; Fivush, A. M.; Chandra,
G.; Plunket, K. D.; Creech, K. L.; Moore, L. B.; Wilson, J. G.; Lewis,
M. C.; Jones, S. A.; Willson, T. M. Identification of a chemical tool for
the orphan nuclear receptor FXR. J. Med. Chem. 2000, 43, 2971−2974.
(10) Nicolaou, K. C.; Evans, R. M.; Roecker, A. J.; Hughes, R.;
Downes, M.; Pfefferkorn, J. A. Discovery and optimization of non-
steroidal FXR agonists from natural product-like libraries. Org. Biol.
Chem. 2003, 1, 908−920.
(11) Deng, G.; Li, W.; Shen, J.; Jiang, H.; Chen, K.; Liu, H.
Pyrazolidine-3,5-dione derivatives as potent non-steroidal agonists of
farnesoid X receptor: virtual screening, synthesis, and biological
evaluation. Bioorg. Med. Chem. Lett. 2008, 18, 5497−5502.
(12) Flatt, B.; Martin, R.; Wang, T. L.; Mahaney, P.; Murphy, B.; Gu,
X. H.; Foster, P.; Li, J.; Pircher, P.; Petrowski, M.; Schulman, I.;
Westin, S.; Wrobel, J.; Yan, G.; Bischoff, E.; Daige, C.; Mohan, R.
Discovery of XL335 (WAY-362450), a highly potent, selective, and
orally active agonist of the farnesoid X receptor (FXR). J. Med. Chem.
2009, 19, 904−907.
ASSOCIATED CONTENT
■
S
* Supporting Information
NMR spectra of 1, theonellasterol F, and 2. This material is
available free of charge via the Internet at http://pubs.acs.org.
AUTHOR INFORMATION
■
Corresponding Author
*Phone: (0039) 081-678525. Fax: (0039) 081-678552. E-mail:
angela.zampella@unina.it.
Author Contributions
⊥These authors contributed equally to this work.
ACKNOWLEDGMENTS
■
This work is part of the CRISP (Coral Reef Initiative in the
South Pacific) project and is supported by a grant from the
(13) Feng, S.; Yang, M.; Zhang, Z.; Wang, Z.; Hong, D.; Richter, H.;
Benson, G. M.; Bleicher, K.; Grether, U.; Martin, R. E.; Plancher, J. M.;
Kuhn, B.; Rudolph, M. G.; Chen, L. Identification of an N-oxide
pyridine GW4064 analog as a potent FXR agonist. Bioorg. Med. Chem.
Lett. 2009, 19, 2595−2598.
́
Agence Franca̧ ise de Developpement. We thank the Solomon
Islands Government for allowing us to collect there and their
Fisheries Departments for their help and assistance. We thank
the IRD diving team for the collection of the sponges and Dr.
John Hooper for the identification of the sponges. NMR
spectra were provided by the CSIAS, Centro Interdipartimen-
tale di Analisi Strumentale, Faculty of Pharmacy, University of
Naples, Italy.
(14) Abel, U.; Schluter, T.; Schulz, A.; Hambruch, E.; Steeneck, C.;
̈
́
Hornberger, M.; Hoffmann, T.; Perovic-Ottstadt, S.; Kinzel, O.;
Burnet, M.; Deuschle, U.; Kremoser, C. Synthesis and pharmacological
validation of a novel series of non-steroidal FXR agonists. Bioorg. Med.
Chem. Lett. 2010, 20, 4911−4917.
(15) Fujino, T.; Une, M.; Imanaka, T.; Inoue, K.; Nishimaki-Mogami,
T. Structure−activity relationship of bile acids and bile acid analogs in
regard to FXR activation. J. Lipid Res. 2004, 45, 132−138.
(16) Pellicciari, R.; Costantino, G.; Camaioni, E.; Sadeghpour, B. M.;
Entrena, A.; Willson, T. M.; Fiorucci, S.; Clerici, C.; Gioiello, A. Bile
acid derivatives as ligands of the farnesoid X receptor. Synthesis,
evaluation, and structure−activity relationship of a series of body and
side chain modified analogues of chenodeoxycholic acid. J. Med. Chem.
2004, 47, 4559−4569.
(17) Pellicciari, R.; Gioiello, A.; Costantino, G.; Sadeghpour, B. M.;
Rizzo, G.; Meyer, U.; Parks, D. J.; Entrena-Gaudix, A.; Fiorucci, S.
Back door modulation of the farnesoid X receptor: design, synthesis,
and biological evaluation of a series of side chain modified
chenodeoxycholic acid derivatives. J. Med. Chem. 2006, 49, 4208−
4215.
(18) Pellicciari, R.; Fiorucci, S.; Camaioni, E.; Clerici, C.; Costantino,
G.; Maloney, P. R.; Morelli, A.; Parks, D. J.; Willson, T. M. 6α-Ethyl-
chenodeoxycholic acid (6-ECDCA), a potent and selective FXR
agonist endowed with anticholestatic activity. J. Med. Chem. 2002, 45,
3569−3572.
(19) Fiorucci, S; Cipriani, S; Mencarelli, A; Baldelli, F; Bifulco, G;
Zampella, A. Farnesoid X receptor agonist for the treatment of liver
and metabolic disorders: focus on 6-ethyl-CDCA. Mini-Rev. Med.
Chem. 2011, 11, 753−762.
ABBREVIATIONS USED
■
BAs, bile acids; BSEP, bile salt export pump; CDCA,
chenodeoxycholic acid; CYP7A1, cytochrome 7A1; CYP3A4,
cytochrome 3A4; 6-ECDCA, 6-ethylchenodeoxycholic acid;
FXR, farnesoid X receptor; HepG2, human hepatocarcinoma
cell line; HR ESIMS, high-resolution electrospray ionization
mass spectrometry; LBD, ligand binding domain; LXR, liver X
receptor; NASH, nonalcoholic steatohepatitis; NTCP, Na+
taurocholate co-transporting polipeptide; NR, nuclear receptor;
OSTα, organic solute transporter α; PDB, Protein Data Bank;
PXR, pregnane X receptor; RT PCR, real time polymerase
chain reaction; SHP, small heterodimer partner
REFERENCES
■
(1) Fiorucci, S.; Mencarelli, A.; Distrutti, E.; Palladino, G.; Cipriani,
S. Targeting farnesoid-X-receptor: from medicinal chemistry to disease
treatment. Curr. Med. Chem. 2010, 17, 139−159.
(2) Fiorucci, S.; Cipriani, S.; Baldelli, F.; Mencarelli, A. Bile acid-
activated receptors in the treatment of dyslipidemia and related
disorders. Prog. Lipid Res. 2010, 49, 171−185.
(3) Fiorucci, S.; Mencarelli, A.; Palladino, G.; Cipriani, S. Bile-acid-
activated receptors: targeting TGR5 and farnesoid-X-receptor in lipid
and glucose disorders. Trends Pharmacol. Sci. 2009, 30, 570−580.
(4) Fiorucci., S.; Baldelli, F. Farnesoid X receptor agonists in biliary
tract disease. Curr. Opin. Gastroenterol. 2009, 25, 252−259.
(5) Fiorucci, S.; Rizzo, G.; Donini, A.; Distrutti, E.; Santucci, L.
Targeting farnesoid X receptor for liver and metabolic disorders.
Trends Mol. Med. 2007, 13, 298−309.
(20) Singh, R. B.; Niaz, M. A.; Ghosh, S. Hypolipidemic and
antioxidant effects of Commiphora mukul as an adjunct to dietary
therapy in patients with hypercholesterolemia. Cardiovasc. Drugs Ther.
1994, 4, 659−664.
(21) Sinal, C. J.; Gonzalez, F. J. Guggulsterone: an old approach to a
new problem. Trends Endocrinol. Metab. 2002, 13, 275−276.
92
dx.doi.org/10.1021/jm201004p | J. Med. Chem. 2012, 55, 84−93

Journal of Medicinal Chemistry
Article
(22) Urizar, N. L.; Liverman, A. B.; Dodds, D. T.; Silva, F. V.;
Ordentlich, P.; Yan, Y.; Gonzalez, F. J.; Heyman, R. A.; Mangelsdorf,
D. J.; Moore, D. D. A natural product that lowers cholesterol as an
antagonist ligand for FXR. Science 2002, 296, 1703−1706.
(23) Wu, J.; Xia, C.; Meier, J.; Li, S.; Hu, X.; Lala, D. S. The
hypolipidemic natural product guggulsterone acts as an antagonist of
the bile acid receptor. Mol. Endocrinol. 2002, 16, 1590−1597.
(24) Nozawa, H. Xanthohumol, the chalcone from beer hops
(Humulus lupulus L.), is the ligand for farnesoid X receptor and
ameliorates lipid and glucose metabolism in KK-Ay mice. Biochem.
Biophys. Res. Commun. 2005, 336, 754−761.
(39) He, J.; Nishida, S.; Xu, M.; Makishima, M.; Xie, W. PXR
prevents cholesterol gallstone disease by regulating biosynthesis and
transport of bile salts. Gastroenterology 2011, 140, 2095−2106.
(40) Mencarelli, A.; Migliorati, M.; Barbanti, M.; Cipriani, S.;
Palladino, G.; Distrutti, E.; Renga, B.; Fiorucci, S. Pregnane-X-receptor
mediates the anti-inflammatory activities of rifaximin on detoxification
pathways in intestinal epithelial cells. Biochem. Pharmacol. 2010, 80,
1700−1707.
(41) Pettersen, E. F.; Goddard, T. D.; Huang, C. C.; Couch, G. S.;
Greenblatt, D. M.; Meng, E. C.; Ferrin, T. E. UCSF Chimeraa
visualization system for exploratory research and analysis. J. Comput.
Chem. 2004, 25, 1605−1612.
(42) Sanner, M. F. Python: a programming language for software
integration and development. J. Mol. Graphics Modell. 1999, 17, 57−
61.
(25) Nam, S. J.; Ko, H.; Shin, M.; Ham, J.; Chin, J.; Kim, Y.; Kim, H.;
Shin, K.; Choi, H.; Kang, H. Farnesoid X-activated receptor
antagonists from a marine sponge Spongia sp. Bioorg. Med. Chem.
Lett. 2006, 16, 5398−5402.
(26) Choi, H.; Hwang, H.; Chin, J.; Kim, E.; Lee, J.; Nam, S. J.; Lee,
B. C.; Rho, B. J.; Kang, H. Tuberatolides, potent FXR antagonists from
the Korean marine tunicate Botryllus tuberatus. J. Nat. Prod. 2011, 74,
90−94.
(27) Sepe, V.; Bifulco, G.; Renga, B.; D’Amore, C.; Fiorucci, S.;
Zampella, A. Discovery of sulfated sterols from marine invertebrates as
a new class of marine natural antagonists of farnesoid-X-receptor. J.
Med. Chem. 2011, 54, 1314−1320.
(28) Coral Reef Initiative in The South Pacific CRISP.
(29) Festa, C.; De Marino, S.; D’Auria, M. V.; Bifulco, G.; Renga, B.;
Fiorucci, S.; Petek, S.; Zampella, A. Solomonsterols A and B from
Theonella swinhoei. The first example of C-24 and C-23 sulfated sterols
from a marine source endowed with a PXR agonistic activity. J. Med.
Chem. 2011, 54, 401−405.
(30) Sepe, V.; Ummarino, R.; D’Auria, M. V.; Mencarelli, A.;
D’Amore, C.; Renga, B.; Zampella, A.; Fiorucci, S. Total synthesis and
pharmacological characterization of solomonsterol A, a potent marine
pregnane-X-receptor agonist endowed with anti-inflammatory activity.
J. Med. Chem. 2011, 54, 4590−4599.
(31) De Marino, S.; Ummarino, R.; D’Auria, M. V.; Chini, M. G.;
Bifulco, G.; Renga, B.; D’Amore, C.; Fiorucci, S.; Debitus, C.;
Zampella, A. Theonellasterols and conicasterols from Theonella
swinhoei. Novel marine natural ligands for human nuclear receptors.
J. Med. Chem. 2011, 54, 3065−3075.
(32) De Marino, S.; Sepe, V.; D’Auria, M. V.; Bifulco, G.; Renga, B.;
Petek, S.; Fiorucci, S.; Zampella, A. Towards new ligands of nuclear
receptors. Discovery of malaitasterol A, an unique bis-secosterol from
marine sponge Theonella swinhoei. Org. Biomol. Chem. 2011, 9, 4856−
4862.
(33) Mi, L. Z.; Devarakonda, S.; Harp, J. M.; Han, Q.; Pellicciari, R.;
Willson, T. M.; Khorasanizadeh, S.; Rastinejad, F. Structural basis for
bile acid binding and activation of the nuclear receptor FXR. Mol. Cell
2003, 11, 1093−1100.
(34) Festa, C.; De Marino, S.; Sepe, V.; Monti, M. C.; Luciano, P.;
D’Auria, M. V.; Debitus, C.; Bucci, M.; Vellecco, V.; Zampella, A.
Perthamides C and D, two new potent anti-inflammatory
cyclopeptides from a Solomon Lithistid sponge Theonella swinhoei.
Tetrahedron 2009, 65, 10424−10429.
(35) Wright, J. L. C.; Mclnnes, A. G.; Shimizu, S.; Smith, D. G.;
Walter, J. A.; Idler, D.; Khalil, W. Identification of C-24 alkyl epimers
of marine sterols by carbon-13 nuclear magnetic resonance
spectroscopy. Can. J. Chem. 1978, 56, 1898−1903.
(36) Gioiello, A.; Macchiarulo, A.; Carotti, A.; Filipponi, P.;
Costantino, G.; Rizzo, G.; Adorini, L.; Pellicciari, R. Extending SAR
of bile acids as FXR ligands: discovery of 23-N-(carbocinnamyloxy)-
3α,7α-dihydroxy-6α-ethyl-24-nor-5β-cholan-23-amine. Bioorg. Med.
Chem. 2011, 19, 2650−2658.
(37) DIPA, BuLi, TMSCl, Et3N, THF, −78 °C one pot procedure;
generation of 3α-silyl ether with Et3N and TMSCl followed by LDA/
TMSCl formation of enolether.
(38) Morris, G. M.; Huey, R.; Lindstrom, W.; Sanner, M. F.; Belew,
R. K.; Goodsell, D. S.; Olson, A. J. AutoDock4 and AutoDockTools4:
automated docking with selective receptor flexibility. J. Comput. Chem.
2009, 30, 2785−2791.
93
dx.doi.org/10.1021/jm201004p | J. Med. Chem. 2012, 55, 84−93