Increased selectivity toward cytoplasmic versus mitochondrial ribosome confers improved efficiency of synthetic aminoglycosides in fixing damaged genes: A strategy for treatment of genetic diseases caused by nonsense mutations

Article abstract of DOI:10.1021/jm3012992

Compelling evidence is now available that gentamicin and Geneticin (G418) can induce the mammalian ribosome to suppress disease-causing nonsense mutations and partially restore the expression of functional proteins. However, toxicity and relative lack of efficacy at subtoxic doses limit the use of gentamicin for suppression therapy. Although G418 exhibits the strongest activity, it is very cytotoxic even at low doses. We describe here the first systematic development of the novel aminoglycoside (S)-11 exhibiting similar in vitro and ex vivo activity to that of G418, while its cell toxicity is significantly lower than those of gentamicin and G418. Using a series of biochemical assays, we provide proof of principle that antibacterial activity and toxicity of aminoglycosides can be dissected from their suppression activity. The data further indicate that the increased specificity toward cytoplasmic ribosome correlates with the increased activity and that the decreased specificity toward mitochondrial ribosome confers the lowered cytotoxicity.

Full text of DOI:10.1021/jm3012992

Article
pubs.acs.org/jmc
Increased Selectivity toward Cytoplasmic versus Mitochondrial
Ribosome Confers Improved Efficiency of Synthetic Aminoglycosides
in Fixing Damaged Genes: A Strategy for Treatment of Genetic
Diseases Caused by Nonsense Mutations
Jeyakumar Kandasamy,†,‡ Dana Atia-Glikin,† Eli Shulman,† Katya Shapira, Michal Shavit, Valery Belakhov,
and Timor Baasov*
The Edith and Joseph Fischer Enzyme Inhibitors Laboratory, Schulich Faculty of Chemistry, Technion - Israel Institute of
Technology, Haifa 32000, Israel
S
* Supporting Information
ABSTRACT: Compelling evidence is now available that gentamicin and Geneticin
(G418) can induce the mammalian ribosome to suppress disease-causing nonsense
mutations and partially restore the expression of functional proteins. However,
toxicity and relative lack of efficacy at subtoxic doses limit the use of gentamicin for
suppression therapy. Although G418 exhibits the strongest activity, it is very cytotoxic
even at low doses. We describe here the first systematic development of the novel
aminoglycoside (S)-11 exhibiting similar in vitro and ex vivo activity to that of G418,
while its cell toxicity is significantly lower than those of gentamicin and G418. Using
a series of biochemical assays, we provide proof of principle that antibacterial activity
and toxicity of aminoglycosides can be dissected from their suppression activity. The
data further indicate that the increased specificity toward cytoplasmic ribosome
correlates with the increased activity and that the decreased specificity toward mitochondrial ribosome confers the lowered
cytotoxicity.
INTRODUCTION
■
Nonsense mutations are in-frame premature termination
codons (PTCs) that convert a sense codon of mRNA to
UAA, UAG, or UGA stop codon and lead to the production of
truncated, nonfunctional proteins.1 PTCs are responsible for
more than 1800 inherited human diseases, including cystic
fibrosis (CF), Duchenne muscular dystrophy (DMD), Usher
syndrome (USH), Hurler syndrome (HS), and numerous types
of cancer.2 For many of those diseases there is presently no
effective treatment, and the only treatment widely used is
symptomatic.
One potential approach to treatment considers the use of
small molecule drugs to selectively suppress the normal
proofreading function at PTCs but not at normal termination
codons.1 This leads to a favorable competition of near-cognate
aminoacyl-tRNAs with the release factor and to the insertion of
a near-cognate amino acid at PTCs, allowing continued
translation to full-length proteins. This approach, also called
“translational readthrough” or “suppression therapy”, was first
validated by using aminoglycoside (AG) antibiotics. Numerous
in vitro and in vivo experiments including clinical trials have
demonstrated the ability of selected structures of AGs (namely
gentamicin, paromomycin and G418, Figure 1) to induce
readthrough at PTCs and partially restore functional
proteins.1,3,4 However, severe side effects of AGs, including
high human toxicity, along with the reduced readthrough
Figure 1. Chemical structures of standard aminoglycosides including
gentamicin, paromomycin, and G418 that were investigated in this
study.
efficiency at subtoxic doses, have limited their clinical benefit
for suppression therapy.5
Received: September 9, 2012
Published: November 13, 2012
© 2012 American Chemical Society
10630
dx.doi.org/10.1021/jm3012992 | J. Med. Chem. 2012, 55, 10630−10643

Journal of Medicinal Chemistry
Article
AGs selectively bind to the decoding A site on the 16S
subunit of bacterial rRNA and kill bacteria by disturbing the
fidelity of the decoding process.6 Although prokaryotic
selectivity is critical to their utility as antibiotics, they are not
perfectly selective for the bacterial ribosome; they also bind to
the eukaryotic A site7 resulting in PTC readthrough.3
Gentamicin and paromomycin are 3 orders of magnitude
more selective to the prokaryotic versus the eukaryotic
ribosome.8 For suppression therapy, this necessitates their use
in high quantity, which in turn causes deleterious toxic side
effects and, hence, largely limits their utility.
A noteworthy exception is G418. In addition to its strong
antibacterial activity, it also exhibits the highest readthrough
activity among all AGs tested to date.9,10 G418 is however very
cytotoxic to mammalian cells.11 It has not been clear whether
its high cytotoxicity is due to higher specificity to the
mammalian ribosome or to some other feature.12 Although
the mitochondrial protein synthesis machinery is very similar to
the prokaryotic machinery and the AG-induced cytotoxicity
may, at least in part, be connected to drug-mediated
dysfunction of the mitochondrial ribosome,13 the direct impact
of synthetic AGs to the human mitochondrial ribosome has not
yet been studied in detail.14,15 The molecular mechanism of
AG-induced toxicity to mammalian cells is still mostly obscure.
Clearly, a systematic search for new structures with improved
PTC suppression activity and lower toxicity, along with a
deeper understanding of the structure−activity−toxicity
relationship, are required to extrapolate the approach to the
point where it can actually help patients suffering from genetic
diseases caused by nonsense mutations.
Toward these ends, we hypothesized that by separating the
structural elements of AGs that induce readthrough from those
that affect toxicity, we might obtain potent AG derivatives with
improved readthrough activity and reduced toxicity. By
systematically fine-tuning the structure−activity−toxicity rela-
tionship, we recently reported a series of structures, 1−8
(Figure 2), exhibiting significantly reduced toxicity and higher
PTC suppression activity than either gentamicin or paromo-
mycin.16−19 Protein translation inhibition studies along with
antibacterial tests indicated that 1−8 have increased selectivity
in their action toward eukaryotic cells than toward prokaryotic
cells in comparison to gentamicin and paromomycin. However,
none of those leads were able to outreach G418’s peak
suppression potency nor its elevated eukaryotic specificity.
The observed increased selectivity of action of 1−8 toward
eukaryotic versus prokaryotic ribosome along with their
reduced toxicity drew our attention and prompted us to ask
several fundamental questions: what structural and mechanistic
features are responsible for the observed selectivity increase and
toxicity decrease of these synthetic derivatives? Can a general
molecular principle for their structure−activity−toxicity
relationship be devised? Using this principle, can a synthetic
variant with similar or higher PTC suppression activity and
lowered toxicity than those of G418 be generated?
Figure 2. Structures of the synthetic aminoglycosides 1−12 that were
investigated in this study. The identity of each pharmacophore and its
attachment site are highlighted: (S)-4-amino-2-hydroxybutanoyl
(AHB, i, red), (R)-6′-Me (ii, blue), (S)-5″-Me (iii, green), and (R)-
5″-Me (iv, green).
that the decreased specificity toward mitochondrial ribosome
confers, at least in part, the lowered cell toxicity. These
observations provide proof of principle that AG-induced
inhibition of cytoplasmic ribosome is a key determinant for
PTC suppression activity and that the inhibition of
mitochondrial ribosome is key to AG-induced cell toxicity.
These results are therefore beneficial for further research on the
development of AG-based drugs for the treatment of genetic
diseases caused by nonsense mutations.
RESULTS AND DISCUSSION
■
Design Hypothesis and Synthesis. Our previously
reported lead compounds 1−816−19 (Figure 2) preserve the
pseudotrisaccharide scaffold 1 as a main recognition element
for the rRNA. The extended side-chain structural elements of
each structure, including the (S)-4-amino-2-hydroxybutanoyl
(AHB) group at N-1 position (N1-AHB, pharmacophore-i),
the (R)-6′-Me (pharmacophore-ii), and the (S)-5″-Me
(pharmacophore-iii) or (R)-5″-Me (pharmacophore-iv), are
four pharmacophores that we identified as key functionalities
allowing an efficient discrimination between the eukaryotic and
prokaryotic ribosomes, with preference toward the eukaryotic
target.17−19 Whereas the first-generation lead, compound 1,
exhibited significantly reduced cytotoxicity in comparison to
gentamicin and paromomycin20 and promoted dose-dependent
To address these questions, here we report on the design,
synthesis, and evaluation of a new set of structures, 9−12
(Figure 2) that perform better than G418 by the above criteria
while exhibiting lower toxicity. Furthermore, by using a series of
comparative readthrough, protein translation inhibition, anti-
bacterial, and toxicity assays between standard and the entire
set of designer aminoglycosides 1−12, we demonstrate that the
increased specificity toward human cytoplasmic ribosome
correlates with the increased PTC suppression activity and
10631
dx.doi.org/10.1021/jm3012992 | J. Med. Chem. 2012, 55, 10630−10643

Journal of Medicinal Chemistry
Article
a
suppression of nonsense mutations of the PCDH15 gene, one
of the underlying causes of type 1 Usher syndrome (USH1),20
its suppression potency was significantly lower than that of
gentamicin and paromomycin. Installation of each of the four
pharmacophores on compound 1 generated the structures 2, 3,
(S)-5, and (R)-6, respectively, exhibiting substantially greater
suppression activity than those of gentamicin and the parent
compound 1. In attempts to further improve the suppression
efficiency and reduce the toxicity of the developed leads, we
then tested the combination of two different pharmacophores
on scaffold 1. We combined N1-AHB with (R)-6′-Me to
generate 4,18 and the combination of N1-AHB with either (S)-
5″-Me or (R)-5″-Me gave (S)-7 and (R)-8, respectively.19
Comparative PTC suppression and translation inhibition tests
clearly indicated that the compounds with two pharmaco-
phores, 4, (S)-7, and (R)-8, exhibit substantially increased
readthrough activity and eukaryotic specificity than those of
their parent structures with only one pharmacophore, 3, (S)-5,
and (R)-6, respectively. The observed gradual increase in
readthrough efficiency with an increased number of the
pharmacophores on scaffold 1 also indicated that these
pharmacophores can operate in an additive manner.
Scheme 1
Encouraged from the observed data with compounds 1−8,
especially from the additive impact of different pharmacophores
on the readthrough activity, we sought to explore the effect of
further combinations of these pharmacophores on scaffold 1.
We anticipated that the remaining four possible combinations
of either two or three pharmacophores to generate a new set of
structures 9−12 could allow us, for the first time, to surpass the
peak readthrough activity of the natural antibiotic G418. To
test this hypothesis, we combined (R)-6′-Me with either (S)-
5″-Me or (R)-5″-Me to yield (S)-9 and (R)-10, respectively.
Addition of N1-AHB to the latter two structures gave (S)-11
and (R)-12 and thus completed all twelve possible combina-
tions of these pharmacophores.
The synthesis of compounds 9−12 was accomplished from
the corresponding selectively protected acceptors 13 and 14,18
and the donors (S)-15 and (R)-16,19 previously reported by us,
by using essentially the same chemical transformations as
illustrated in Scheme 1. Lewis acid (BF3·Et2O) promoted
glycosylation furnished the protected pseudotrisaccharides 17−
20 in 73−86% isolated yields, exclusively as β-anomers at the
newly generated glycosidic linkage. Two sequential depro-
tection steps: treatment with methylamine to remove all the
ester protection, and the Staudinger reaction (Me3P, THF/
NaOH) to convert azides to corresponding amines, then
afforded the target derivatives 9−12 in 79−84% isolated yields
for two steps. The structures of all new compounds (9−12)
were confirmed by a combination of various 1D and 2D NMR
techniques, along with mass spectral analysis (see the
Supporting Information).
Comparative in Vitro PTC Suppression Tests To
Evaluate the Additive Effect Impact of Different
Pharmacophores in 9−12. Previous studies have shown
that the efficiency of aminoglycoside-induced readthrough is
highly dependent on (i) the identity of stop codon (UGA >
UAG > UAA), (ii) the identity of the first nucleotide
immediately downstream from the stop codon (C > U > A
≥ G), and (iii) the local sequence context around the stop
codon.9,21 Therefore, for broader understanding of the
structure−activity relationship of the designed structures, we
used a series of constructs containing different sequence
contexts around premature stop codons derived from the
a
́
Reagents and conditions: (a) BF3·Et2O, CH2Cl2, 4 Å MS, −20° C;
(b) MeNH2−EtOH, rt; (c) Me3P, NaOH, THF, rt.
PCDH15, CFTR, dystrophin, and IDUA genes that underlie
USH1, CF, DMD, and HS, respectively. The prevalent
nonsense mutations of these diseases that we chose were
R3X and R245X for USH1,20 G542X and W1282X for CF,22,23
R3381X for DMD,24 and Q70X for HS.25 Briefly, DNA
fragments containing the nonsense mutation or the corre-
sponding wild-type codon, in their natural context, were cloned
in frame between the Renilla and the firefly luciferase genes of
the p2luc vector as described previously by us.17 The resulting
six nonsense mutation-carrying plasmids were transcribed and
translated in the presence of varying concentrations of the
tested compound, and the stop codon suppression efficiency
was calculated as previously reported.17,26 Inhibition of
translation was monitored as the ratio of Renilla luciferase
activity with and without the presence of aminoglycosides.26 In
all the constructs tested, the highest concentrations of G418, 4,
(S)-9, (S)-11, and (R)-12 resulted in approximately 50%
reduction in overall translation, whereas the effects of 3, (R)-10,
and gentamicin on translation were significantly milder
resulting in approximately 20−40% reduction in overall
translation. Initially, we tested the effect of combination of
two pharmacophores [two chiral methyl groups, (R)-6′-Me
with either (S)-5″-Me or (R)-5″-Me] by evaluating the
comparative readthrough potential of (S)-9 and (R)-10 versus
that of compound 3, which consists of only one pharmaco-
phore [(R)-6′-Me, pharmacophore-ii], and the observed data
are shown in Figure 3.
As seen from the data in Figure 3, in all the mutations tested,
installation of (S)-5″-methyl group (compound (S)-9) on
compound 3 dramatically increases its in vitro readthrough
activity, whereas the effect of the (R)-5″-methyl group
(compound (R)-10) is comparatively small. In addition, in all
mutations tested, the readthrough activity of (S)-9 was
significantly greater than that of the clinical drug gentamicin.
The observed stereochemical preference of (S)-5″-Me group in
compound (S)-9 over that of (R)-5″-Me group in (R)-10 on
readthrough activity is in accordance to our earlier observations
10632
dx.doi.org/10.1021/jm3012992 | J. Med. Chem. 2012, 55, 10630−10643

Journal of Medicinal Chemistry
Article
Figure 3. In vitro stop codon suppression levels induced by
Figure 4. In vitro stop codon suppression levels induced by
◇
□
◆
□
●
○
▲
compounds (S)-9 ( ), (R)-10 ( ), 3 ( ), G418 ( ) and gentamicin
compounds (S)-11 ( ), (R)-12 (Δ), 4 ( ), G418 ( ) and
■
■
( ) in a series of nonsense mutation context constructs representing
gentamicin ( ) in a series of nonsense mutation context constructs
various genetic diseases (shown in parentheses): (A) R3X (USH1),
(B) R245X (USH1), (C) G542X (CF), (D) W1282X (CF), (E)
Q70X (HS), and (F) R3381X (DMD). Readthrough activity was
measured as previously described by us.17 The results are the average
of at least three independent experiments.
representing various genetic diseases (shown in parentheses): (A) R3X
(USH1), (B) R245X (USH1), (C) G542X (CF), (D) W1282X (CF),
(E) Q70X (HS), and (F) R3381X (DMD). Readthrough activity was
measured as previously described by us.17 The results are the average
of at least three independent experiments.
with the compounds (S)-5 and (R)-6.19 In the latter study, a
very similar preference of (S)-5 over that of (R)-6 was observed
when the activities of these two were compared with that of
their parent compound 1.
UGA C tetracodon sequence (R3X) showed the best
translational readthrough compared with UGA A and UGA
G, with the UAG C tetracodon least efficient, in agreement
with earlier observations.9,17,21 Nevertheless, in all mutations
tested (except Q70X, Figure 4E) compound (S)-11 induced
the highest level of readthrough among the synthetic
derivatives, and the observed efficacy followed the order (S)-
11 ≥ (R)-12 > 4. Thus, the impact of three pharmacophores in
(S)-11 and (R)-12 is significantly greater than that of two
pharmacophores (pharmacophores i + ii) in compound 4. Both
(S)-11 and (R)-12 were drastically more active than
gentamicin. The most impressive observation, however, was
that of six different mutations tested, in three of them, including
W1282X, G542X, and Q70X, (S)-11 or (R)-12 or both
exhibited similar or greater activity than G418. To our
knowledge, this is the first demonstration that a synthetic
derivative exhibits similar or greater stop codon readthrough
activity than G418.
Comparative PTC Suppression Tests in Mammalian
Cell Line. To further evaluate the readthrough potential of
compounds (S)-11 and (R)-12, their activity was assayed in
cultured mammalian cells using four different dual luciferase
reporter plasmids harboring the PCDH15-R3X and PCDH15-
R245X nonsense mutation of USH1, and the CFTR-WG542X
and CFTR-W1282X nonsense mutation of CF. These reporter
constructs were the same ones that we used in the in vitro study
and have the distinct advantage to control for differences in
mRNA levels between normal and nonsense-containing
Even though we were encouraged from the data observed
with the compound (S)-9, its readthrough potency was still
significantly lower than that of G418 (note that G418 is
strongly active already at very low concentrations, Figure 3).
Therefore, we decided to explore the possibility of further
potency enhancement. In particular, we were intrigued whether
the same potency enhancement due to addition of the (S)-5″-
methyl group would apply in compound 4 as well. It is
noteworthy that compound 4 contains two pharmacophores,
(R)-6′-Me and N1-AHB, and was considered the best
readthrough inducers among our entire designer AGs until
the current work. To evaluate the impact of the stereochemistry
at C5″-position, we constructed and tested both C5″-
diastereomers (S)-11 and (R)-12. Comparative in vitro
suppression tests of the pseudotrisaccharides 4, (S)-11, (R)-
12, gentamicin, and G418 were performed under the same
experimental conditions as above, and the observed data are
shown in Figure 4.
From the data in Figure 4, it can be seen that all the tested
compounds induced readthrough in a dose-dependent manner.
However, the efficacy of readthrough is substantially different
between different constructs and compounds tested, with no
obvious dependence of readthrough effectiveness on the
introduced type of modification on aminoglycoside. The
10633
dx.doi.org/10.1021/jm3012992 | J. Med. Chem. 2012, 55, 10630−10643

Journal of Medicinal Chemistry
Article
sequences over those of single reporter or direct protein
analysis, as previously noted.21,26 The constructs were trans-
fected into a human embryonic kidney cell line (HEK-293) and
incubated with varying concentrations of (S)-11, (R)-12, 4,
gentamicin, and G418 (Figure 5). In order to ensure suitable
both Gram-negative and Gram-positive bacteria. To assess
whether the compounds 9−12 retain similar properties, we
conducted comparative translation inhibition of compounds 3,
4, 9−12, G418, and gentamicin in a prokaryotic system, by
using an in vitro luciferase assay (Table 1). The measured half-
maximal inhibitory concentration (ICP50ro) values show that the
efficacy with which 9−12 inhibit the prokaryotic ribosome is
significantly lower (high IC50 values) than that of gentamicin
and G418. These data are in accordance with the observed
antibacterial data of this set of compounds (Table 1 and Table
S1; note that for clarity part of the data appear in Supporting
Information). Thus, while gentamicin and G418 exhibit
excellent antibacterial activities against both Gram-negative
Escherichia coli (R477-100) (Table 1) and Gram-positive
Bacillus subtilis (ATCC-6633) (Table S1 in Supporting
Information), compounds 9−12 lack significant antibacterial
activity. The observed data with 9−12 is similar to that
observed for 3 and 4, along with for the entire set of 1−8, and
further support the previously reported correlation in amino-
Pro
glycosides between prokaryotic antitranslational activity (IC
)
50
and MIC values: decreased inhibition of prokaryotic translation
is associated with the decrease in antibacterial activity.27
We have previously reported that compounds 1−8 exhibit
significantly reduced cytotoxicity compared with that of
gentamicin, as measured in a variety of kidney-derived
cells.17−19 To assess whether our novel compounds 9−12
retain similar properties, we determined comparative cell
toxicity of 3, 4, 9−12, G418, and gentamicin in HEK-293
cells (Table 1). All the tested compounds exhibited lower
toxicity than that of gentamicin. Among all aminoglycosides
tested, the aminoglycoside antibiotic, G418, which is known as
one of the most cytotoxic aminoglycosides,11 exhibited the
lowest LC50 value (1.3 mM). A very similar trend to that in
HEK-293 cells (Table 1) was observed when such comparative
cell toxicity was determined in human foreskin fibroblasts
(HFF) cells (Table S1 in Supporting Information).
Comparison of the observed cell toxicity data in Table 1 with
the readthrough activity data in Figures 3−5 demonstrates that
compound 3, which contains only one pharmacophore, (R)-6′-
Me (pharmacophore ii), exhibits similar to better suppression
activity than that of gentamicin, while its cytotoxicity is about
10-fold lower than that of gentamicin. Introduction of a second
pharmacophore on 3, either the N1-AHB (pharmacophore i) to
give 4 (3 → 4) or the (S)-5″-Me (pharmacophore ii) to give
(S)-9 (3 → 9), results in about 4-fold increase in cytotoxicity of
the resulting structures (LC50 values of 5.8 and 5.4 mM for 4
and (S)-9 and 22.2 mM for 3), with a concomitant drastic
increase in the observed stop codon suppression activity ((S)-9
≥ 4 > 3). Additional increase in the number of
pharmacophores to three in compounds (S)-11 and (R)-12
(4 → (S)-11 and 4 → (R)-12) does not affect the cytotoxicity
(LC50 values of 5.1 and 5.4 mM, for (S)-11 and (R)-12, versus
5.8 for compound 4), while it greatly increases the observed
stop codon suppression activity of (S)-11 and (R)-12 compared
with that of compound 4 (Figures 4 and 5 and Table 1). Thus,
the combined structure−activity−toxicity data clearly indicate
that, whereas the gradual increase in the number of
pharmacophores is accompanied with a concomitant significant
increase in the suppression activity, the cell toxicity trend does
not really follow with this concept.
Figure 5. Ex vivo stop codon suppression levels induced by (S)-11
◆
□
■
▲
(
), (R)-12 (Δ), 4 ( ), G418 ( ) and gentamicin ( ) in a series of
nonsense mutation context constructs representing various genetic
diseases (shown in parentheses): (A) R3X (USH1), (B) R245X
(USH1), (C) G542X (CF), and (D) W1282X (CF). The results are
averages of at least three independent experiments.
cell viability for each of the tested compounds at the
concentrations tested, we determined cell toxicity for each
compound by measuring the half-maximal lethal concentration
value (LC50 values) in HEK-293 cells (Table 1).
In all the mutations tested, the observed efficacy of
aminoglycoside-induced readthrough was in the order G418
≥ (S)-11 ≥ (R)-12 > 4 > gentamicin (Figure 5). This trend for
(S)-11 and (R)-12 was similar to that observed for the
suppression of the same stop mutations in vitro (Figure 4), even
though the gap of potency difference between (S)-11 and (R)-
12 was smaller than the one observed for the suppression of the
same mutations in cell-free extracts. While these data may point
to a different cell permeability of (S)-11 and (R)-12, due to the
different stereochemistry at the 5″-methyl group, more
experiments are needed to understand this issue satisfactorily.
Nevertheless, the observed similar cell toxicity of the
compounds (S)-11, (R)-12, and 4 in HEK-293 cells (Table
1), along with substantially elevated suppression activities of
(S)-11 and (R)-12 over that of 4, both in vitro and ex vivo in
cultured cells, indicate that compounds (S)-11 and (R)-12 may
represent a superior choice to compound 4 in suppression
therapy.
Compounds 9−12 Inhibit Prokaryotic Protein Trans-
lation with Significantly Lower Potency and Exhibit
Markedly Reduced Bactericidal Activity and Cell
Toxicity than Those of Gentamicin and G418. In our
previous studies,18 we have shown that compounds 3 and 4 are
about 30-fold weaker inhibitors of prokaryotic translation than
gentamicin and exhibit almost no bactericidal activity against
The Increased Specificity of AGs toward Cytoplasmic
Ribosome Correlates with the Increased PTC Suppres-
sion Activity. The impact of the number of pharmacophores
10634
dx.doi.org/10.1021/jm3012992 | J. Med. Chem. 2012, 55, 10630−10643

Journal of Medicinal Chemistry
Article
Table 1. Comparative Cell Toxicity, Antibacterial Activity and Inhibition of Protein Translation in Eukaryotic, Prokaryotic and
a
Mitochondrial Systems of Gentamicin, G418, and Synthetic Compounds 1−12
pharmacophore
translation inhibition
b
c
d
d
e
Euk
50
Pro
50
Mit
Euk
Pro
50
i
ii
iii
iv
AG
LC50 (mM)
MIC (μM)
IC
(μM)
IC
(μM)
IC (μM)
IC /IC
50
50
X
gentamicin
paromomycin
G418
1
2.5 0.3
4.1 0.5
1.3 0.1
21.9 4.5
5.5 0.6
22.2 1.1
5.8 0.7
23.5 0.6
19.8 0.4
10.1 0.8
13.9 1.3
5.4 0.5
16.5 3.1
5.1 0.3
5.4 0.3
6
22
62.0 9.0
57.0 4.0
2.0 0.3
31.0 4.0
24.0 1.0
17.0 0.6
2.8 0.3
16.0 1.0
28.0 1.1
5.2 0.7
4.6 0.6
1.5 0.1
8.0 0.3
0.7 0.1
0.9 0.1
0.03 0.00
0.05 0.01
0.01 0.00
0.5 0.1
0.2 0.0
1.1 0.1
1.0 0.1
2.0 0.2
2.1 0.5
2.3 0.2
0.8 0.1
1.1 0.2
1.9 0.2
1.8 0.3
1.8 0.2
26
2
2214
1118
225
68
f
nd
13
X
9
1
790
588
680
556
2659
4989
1067
1057
768
1536
384
384
1785 133
492 12
965 155
404 26
1408 58
710 68
251 21
152 12
1493 28
681 30
506 50
400 38
X
X
2
151
15
X
X
3
4
2.9
7.9
13
X
X
X
X
(S)-5
(R)-6
(S)-7
(R)-8
(S)-9
(R)-10
(S)-11
(R)-12
X
X
X
X
X
X
2.3
5.7
1.3
4.3
0.4
X
X
X
X
X
X
0.5
a
In all biological tests, all tested AGs were in their sulfate salt forms and the concentrations reported refer to that of the free amine form of each AG.
The presence of pharmacophores i−iv in each compound is noted by “X”. All assays were performed in duplicate and analogous results were
b
obtained in at least three independent experiments. Cell toxicity was measured in human embryonic kidney (HEK-293) cells and calculated as a
ratio between the numbers of living cells in cultures grown in the presence of the tested compound and that in cultures grown without compound.
c
The minimal inhibitory concentration (MIC) values were measured in E. coli R477/100 and determined by using the double-microdilution method.
d
Pro
Euk
Prokaryotic (IC ) and eukaryotic (IC ) translation inhibition was quantified in coupled transcription/translation assays by using active luciferase
50
50
detection as previously described by us.8 For the mitochondrial translation inhibition (IC ) value measurements, the freshly isolated mitochondria
e
Mit
50
(2 mg protein/mL) from HeLa cells (Qproteome Mitochondria Isolation Kit, Qiagen, CA) were incubated in 93 μL of a protein synthesis medium
in the presence of emetine (5 μM, an inhibitor of 80S ribosome), [35S]methionine (150 μCi, Izotop), and a varied concentrations of AG. The
incorporation of [35S]methionine into mitochondrial protein was determined by a filter paper disk assay as described in the Experimental Section.
Euk
Pro
Mit
The LC50, IC , IC , and IC values were estimated from fitting concentration−response curves to the data of at least three independent
50
50
50
f
experiments, using GraFit5 software. The ICE50uk/IC ratio for (S)-11 and (R)-12 is italicized. Not determined.
Pro
50
on the elevated readthrough activities of the designer structures
is further supported from the observed eukaryotic antitransla-
Euk
50
tional data (Table 1). The efficacy with which (S)-11 (IC
=
0.7 μM) inhibits eukaryotic translation is greater than that of
Euk
(S)-9 (ICE50uk = 1.5 μM) and 3 (IC = 17 μM), a similar trend
50
to that observed for readthrough activity: (S)-11 (contains
three pharmacophores) > (S)-9 (contains two pharmaco-
phores) > 3 (contains one pharmacophore) (Figures 3 and 4).
Likewise, (R)-5″-diasteromers that were generally less active
than the corresponding (S)-5″-diasteromers also were less
Euk
specific to the eukaryotic ribosome: (R)-12 (IC = 0.9 μM)
50
Euk
50
and (R)-10 (IC = 8.0 μM) are 1.2-fold and 5.3-fold less
specific than (S)-11 and (S)-9, respectively. Finally, by plotting
Euk
50
the observed IC
values against the in vitro readthrough
activity data of all the standard and synthetic AGs tested, a close
correlation was observed: increased inhibition of cytoplasmic
protein synthesis is associated with the increased readthrough
activity (Figure 6 and Table S1). Since the readthrough activity
is dose dependent and is also affected by the various above-
mentioned factors, the data in Figure 6 was collected at a single
concentration, 1.4 μM, in which all the compounds were tested
on all six different nonsense constructs used in this study.
As seen from the data in Figure 6, among the synthetic
derivatives, compounds (S)-11, (R)-12, and (S)-9 (ICE50uk values
of 0.7, 0.9, and 1.5 μM, respectively), which exhibited
particularly strong inhibition of the eukaryotic ribosome, were
generally strongest readthrough inducers in all different
Figure 6. A semilogarithmic plot of the in vitro readthrough activity at
1.4 μM concentrations versus the eukaryotic inhibition of translation
Euk
50
(IC values) for gentamicin, paromomycin, G418, and 1−12, in a
series of PTC constructs representing the genetic diseases: USH (R3X
and R245X), CF (W1282X and G542X), DMD (R3381X), and HS
(Q70X). For the data points, see Table S2 in the Supporting
Information.
constructs tested. Three compounds, including 4, (R)-8, and
Euk
50
(S)-7, with IC values of 2.8, 4.6, and 5.2 μM, respectively,
induced readthrough with a lesser potency. Further decrease in
values of 8, 16, 17, 24, 28, and 31 μM, respectively) was
associated with a decrease in the observed readthrough activity.
Euk
eukaryotic inhibition by (R)-10, (S)-5, 3, 2, (R)-6, and 1 (IC
50
10635
dx.doi.org/10.1021/jm3012992 | J. Med. Chem. 2012, 55, 10630−10643

Journal of Medicinal Chemistry
Article
Thus, the impact of three pharmacophores in (S)-11 and (R)-
12 on the inhibition of eukaryotic ribosome and the subsequent
readthrough activity is significantly bigger than those by two
pharmacophores in (S)-9, 4, (R)-8, (S)-7, and (R)-10, with
preference of (S)-5″-Me over that of (R)-5″-Me. Interestingly,
among different combinations of two pharmacophores, the best
combination was (R)-6′-Me with (S)-5″-Me in the compound
(S)-9, while that of (R)-6′-Me with (R)-5″-Me in compound
(R)-10 was the least effective. A very similar trend with respect
to (S)-5″-Me and (R)-6′-Me was also observed in the
compounds with only one pharmacophore and was in the
order (S)-5 > 3 > 2 > (R)-6. In aggregate, the observed gradual
increase in readthrough efficacy with an increase in the number
of pharmacophores on the ligand indicates that these
pharmacophores can operate in an additive manner and that
the structural features of the ligand play an important role in
the proper recognition of mammalian rRNA.
Interestingly, a very similar correlation or trend to that of
synthetic AGs was also observed for the standard antibiotics
gentamicin, paromomycin, and G418, even though these three
antibiotics are structurally significantly different (Figure 1).
G418 and gentamicin belong to a class of 4,6-disubstitued 2-
deoxystreptamine (2-DOS, ring II) AGs, while paromomycin is
a 4,5-disubstituted 2-DOS-containing AG. Furthermore, while
both G418 and paromomycin contain a hydroxyl group at 6′
position of the ribosamine ring (ring I), gentamicin has an
amino group at the same position. Nevertheless, gentamicin
the molecular mechanism of readthrough should wait until the
crystal structure of an eukaryotic ribosome30 in complex with a
readthrough-inducing AG is available.
The Newly Designed Structures (S)-11 and (R)-12 Are
More Selective toward the Eukaryotic than Prokaryotic
Ribosome and Thus Show “Reversed” Selectivity in
Comparison to Standard AG Antibiotics. The comparative
translation inhibition data in Table 1 show that gentamicin and
paromomycin are 2214-fold and 1118-fold more selective
toward the prokaryotic versus the eukaryotic ribosome.
However, the difference in selectivity by G418 is only 225-
fold. This order of magnitude drop in selectivity is mainly due
Euk
50
to G418’s efficient inhibition of eukaryotic translation (IC
=
2 μM). Thus, one could consider this as the main reason for
both extraordinary features of G418: its high cytotoxicity and
its very strong readthrough activity. The results in Table 1,
however, suggest that while the elevated inhibition of
eukaryotic translation does indeed promote its strong read-
through activity, the inhibition of eukaryotic translation is not
the only toxic event of G418. Indeed, three out of the four new
structures, including (S)-9, (S)-11, and (R)-12, are similar or
greater inhibitors of eukaryotic translation, while at the same
time being significantly less toxic than G418. The notable
Euk
50
Pro
50
decrease in the IC /IC ratio of compounds 1−12 relative
to the reference AGs further demonstrates that the systematic
development of a comprehensive pharmacophore and its
installation on scaffold 1 could gradually increase the specificity
of the developed lead to the cytoplasmic ribosome while
decreasing its specificity to the prokaryotic ribosome; up till the
synthesis of (S)-11 and (R)-12 derivatives, wherein all the
pharmacophores are implemented, which instead exhibit
“reversed” selectivity toward the eukaryotic versus the
prokaryotic ribosome. To our knowledge, (S)-11 and (R)-12
represent the first examples of synthetic AGs that show such
high eukaryotic versus prokaryotic selectivity, while in parallel
exhibiting strong PTC suppression activity.
and paromomycin, which were very weak inhibitors of the
Euk
50
eukaryotic ribosome (IC
values of 62 and 57 μM,
respectively), also exhibited very poor readthrough activity.
Euk
50
And G418 (IC = 2 μM), which was a 30-fold more potent
inhibitor than both gentamicin and paromomycin, also was very
strong readthrough inducer. Thus the observed combined data
with standard and synthetic AGs broadly demonstrate that a
general feature of AGs with PTC suppression properties has the
ability to inhibit eukaryotic cytoplasmic protein synthesis and
that the increased specificity toward cytoplasmic ribosome
correlates with the increased PTC suppression activity.
Finally, we note that the observed correlation between the
PTC suppression activity and inhibition of cytoplasmic
ribosome in Figure 6 encompasses compounds that inhibit
translation through the same mechanism, namely, by
interference with the fidelity of decoding. As we have previously
reported,8 the compound NB33 (two pieces of paromamine,
ring I and ring II of paromomycin, are connected by methylene
Decreased Specificity of the Entire Set of Designer
AGs 1−12 toward Mitochondrial Ribosome Confers the
Lowered Cytotoxicity. As mentioned above in the
Introduction section, high similarity between the bacterial and
mitochondrial ribosome A sites may be connected at least
partially to the AG-induced cytotoxicity.13 Therefore, the
observed continuous inability of our previous leads, 1−8,
along with the current 9−12, to show significant antibacterial
activity, in conjunction with their decreased prokaryotic
ribosome specificity (Table 1), suggested that by reducing the
specificity of 1−12 to the prokaryotic ribosome, we might
reduce their action on the mitochondrial ribosome and
subsequently reduce their toxicity in humans. The observed
significantly reduced cytotoxicity of compounds 1−12 in
comparison to those of the standard AGs (Table 1) supported
this indication. In addition, it has recently been shown that the
high toxicity of oxazolidinone class of antibiotics is associated
with their ability to strongly inhibit mitochondrial protein
synthesis.14 The mode of action of these antibiotics is similar to
that of AGs because they bind to the bacterial ribosome and
inhibit protein translation. Based on these observations and our
attempts to further assess the veracity of the hypothesis in
connection to AGs, we examined the direct impact of AGs on
mitochondrial protein synthesis. Since an in vitro luciferase
assay analogous to the bacterial and cytoplasmic systems is not
available for mitoribosomes, we used a radioactive assay14,31 in
which the translation levels of endogenous polypeptides were
bridge at 3′ position) is a strong inhibitor of eukaryotic
Euk
50
translation (IC = 2.4 μM) but lacks readthrough activity.
This lack of readthrough by NB33 was explained by its different
mechanism of translation inhibition: NB33 binds to the Homo
sapiens 18S cytoplasmic A site rRNA and selectively stabilizes a
“non-decoding” conformational state; therefore, it does not
interfere with the decoding process and subsequently lacks
readthrough activity.8 Collectively, the observed data suggests
that the compounds studied here might induce readthrough by
selectively stabilizing a “decoding” conformation of the rRNA.
A recent 3D-structure of G418 complexed to the protozoal 16S
cytoplasmic A site construct28 supports this suggestion: G418
selectively stabilizes a “decoding” conformation, mainly because
of the pseudo-pair contact between the 6′-OH of G418 and the
N2-H of guanine at position 1408. Although similar pseudo-
pair interactions are also expected for the entire 1−12 series
possessing 6′-OH, the secondary structure of H. sapiens 18S
and protozoal 16S A sites are yet significantly different,29 and
10636
dx.doi.org/10.1021/jm3012992 | J. Med. Chem. 2012, 55, 10630−10643

Journal of Medicinal Chemistry
Article
measured in intact mitochondria isolated from HeLa cells
(Figure 7, Table 1 and Figure S1, Supporting Information).
scintillation counting of the radiolabeled proteins after acid
precipitation (panel B in Figure 7, for more details see
Experimental Section). Furthermore, to ensure the accuracy of
the observed data, we used chloramphenicol as a control in all
our experiments. The measured half-maximal inhibitory value
Mit
(ICM50it) of chloramphenicol in our study (IC = 7.4 0.8 μM,
50
Figure S1 in Supporting Information) was essentially the same
Mit
as that reported (IC = 9.8
0.8 μM) in the original
50
procedure.14,31
Mit
50
The measured IC values (Table 1) show that all the tested
compounds inhibit translation in mitochondria. The antibiotic
Mit
G418 is the most potent inhibitor of the mitoribosome (IC
=
50
Mit
13.1 μM) followed by gentamicin (IC = 25.8 μM), and the
50
entire synthetic library 1−12 exhibit a roughly 12−140-fold
reduced inhibition relative to that of G418.
We note that, by assessment of the relative hair cell toxicity
potential in ex vivo cultures of cochlear explants, we have
previously reported that compound 2, in addition to its
significantly reduced cell toxicity (Table 1), also exhibits
substantially reduced ototoxicity potential, relative to those of
gentamicin.17 Here we show that compound 2 (IC = 492
Mit
50
μM) exhibits 19-fold reduced inhibition of mitoribosome
relative to that of gentamicin (Table 1). This data therefore
suggests that the inhibition of mitoribosome by compound 2, in
addition to its cell toxicity, is probably, at least in part, also
responsible for its reduced ototoxicity potential. Interestingly,
as shown in Table 1, the new structures 9−12 exhibit very
similar or lower inhibition potency for mitoribosome relative to
that of compound 2, suggesting on the probability of their
reduced ototoxicity potential. This suggestion is in agreement
with the recently reported data on the AG apramycin15 in
cochlear explants and in the in vivo guinea pig model of
ototoxicity; apramycin caused little hair cell damage and
hearing loss, while in parallel, it exhibited significantly reduced
inhibition of mitochondrial protein synthesis than gentamicin.
Nevertheless, it is clear that further structure−toxicity studies
are required to understand whether the direct correlation
between the cytotoxicity and ototoxicity of AGs can be made.
These studies are currently underway and will be reported in
due course.
SUMMARY AND CONCLUSION
■
The results of this study show that the newly developed AGs,
9−12, exhibit both appreciably higher PTC suppression
efficiency and lower cytotoxicity than those of the clinical
drug gentamicin. Furthermore, the data also show that
compound (S)-11 exhibits similar activity to that of G418,
while its cell toxicity is significantly lower than those of
gentamicin and G418. Based on these findings, compound (S)-
11 can be considered the best AG for the potential use in
suppression therapy.
Figure 7. Dose−response effects of aminoglycosides on mitochondrial
protein synthesis. Isolated mitochondria from HeLa cells were
incubated with varied concentrations of G418, 3, and (R)-10 as
indicated. (A) After lysis, equal amounts of protein (Coomassie
staining) were fractionated on SDS-PAGE, and [35S]methionine-
labeled COX1 protein levels were determined by densitometry. (B)
Semilogarithmic plots of scintillation counting as a function of
aminoglycoside concentration. Radioactivity was measured on the
lysed mixture after acid precipitation as described in the Experimental
Section. The 50% inhibitory concentrations (ICM50it) were determined
by Grafit5 software.
The most compelling evidence for the superior PTC
suppression efficiency of compound (S)-11 over that of its
parent compound 4 and gentamicin was demonstrated in vitro
on six different DNA fragments derived from the mutant CFTR,
PCDH15, IDUA, and dystrophin genes carrying nonsense
mutations and representing the underlying causes for the
genetic diseases CF, USH1, HS, and DMD, respectively (Figure
4). Analogous advantage of (S)-11 was also demonstrated ex
vivo in cultured cell lines (Figure 5). Importantly, the
comparative in vitro and ex vivo PTC suppression study also
demonstrated the ability of (S)-11 to show comparable activity
to that of G418. This was demonstrated in vitro in three
As a representative example, the data in Figure 7 show the
comparative effects of the standard AG, G418, and the designer
structures 3 and (R)-10 on mitochondrial protein synthesis.
Dose-dependent inhibition of mitochondrial protein synthesis
was observed, and the observed data was consistent whether
the protein levels were quantified by densitometry (COX1
protein levels on SDS−PAGE, panel A in Figure 7) or by direct
10637
dx.doi.org/10.1021/jm3012992 | J. Med. Chem. 2012, 55, 10630−10643

Journal of Medicinal Chemistry
Article
TLC on silica gel 60 F254 (0.25 mm, Merck), and spots were visualized
by charring with a yellow solution containing (NH4)Mo7O24.4H2O
(120 g) and (NH4)2Ce(NO3)6 (5 g) in 10% H2SO4 (800 mL).
Column chromatography was performed on silica gel 60 (70−230
mesh). All reactions were carried out under an argon atmosphere with
anhydrous solvents, unless otherwise noted. All chemicals and
biochemicals, unless otherwise stated, were obtained from commercial
sources. G418 (Geneticin), paromomycin, and gentamicin were
purchased from Sigma. In all biological tests, all the tested
aminoglycosides were in their sulfate salt forms [Mw (g/mol) of the
sulfate salts were as follow: gentamicin 653.2; G418 692.7; compd 1
563.0; compd 2 652.8; compd 3 564.3; compd 4 695.5; compd (S)-5
577.7; compd (R)-6 615.7; compd (S)-7 719.5; compd (R)-8 726.2;
compd (S)-9 605.9; compd (R)-10 619.6; compd (S)-11 730.2;
compd (R)-12 730.5]. Purity of the new compounds 9−12 was
determined by using HPLC−ESI-MS analysis, which indicated 99.54%
((S)-9), 99.21% ((R)-10), 95.21% ((S)-11), and 97.30% ((R)-10)
purity (see Supporting Information).
different constructs and was further verified in four different
constructs ex vivo. Consistent with our previous findings, the
data observed here has also established that the joint presence
of three different pharmacophores in (S)-11 (Figure 2),
including N1-AHB, (pharmacophore i), (R)-6′-Me (pharma-
cophore ii) and (S)-5″-Me (pharmacophore iii), contributes to
its particularly enhanced readthrough efficiency. Here we show
that (S)-11 inhibits eukaryotic protein translation by 88-fold
and ∼3-fold stronger than gentamicin and G418, suggesting
that the enhanced readthrough activity of (S)-11 is probably
due to its correspondingly enhanced interaction with the
cytoplasmic ribosome (Table 1). The observed correlation
Euk
50
between the IC values and the in vitro readthrough activity
data, broadly showing that the increased inhibition of the
cytoplasmic protein synthesis is associated with the increased
readthrough activity (Figure 6), supports this suggestion.
The observed data on the eukaryotic translation inhibition
(Table 1) in conjunction with the cytotoxicity data (Table 1)
indicated that the strong inhibition of eukaryotic translation is
not the only toxic event of G418 and that other effect(s) of
G418 on the mammalian cells is critical to its extraordinarily
high cytotoxicity. Here we show that G418 is the most potent
inhibitor of the human mitochondrial ribosome; compound
(S)-11 is 38-fold less inhibitory, and the entire synthetic library
1−12 exhibit a roughly 12−140-fold reduced inhibition of
mitochondrial ribosome relative to that of G418. The
combined data thus suggest that the strong inhibition of both
cytoplasmic and mitochondrial ribosomes confers on G418 its
exceptionally high cytotoxicity and that the reduced cytotoxicity
of the entire 1−12 set of derivatives is mainly achieved through
their reduced inhibition of the mitoribosome.
In conclusion, the results presented here provide proof of
principle that, by using structure-based design, antibacterial
activity and toxicity of AGs can be dissected from their PTC
suppression activity. The data further indicate that the
increased specificity toward cytoplasmic ribosome correlates
with the increased PTC suppression activity and that the
decreased specificity toward mitochondrial ribosome confers
the lowered cytotoxicity. We have recently demonstrated the
ability of some of our developed lead compounds to partially
restore protein function in various clinically relevant cellular
and animal models of genetic diseases caused by nonsense
mutations: compound 2 in cellular and animal models of CF,32
and cellular models of Rett syndrome;33,34 compounds 1 and 2
in cellular in vivo models of USH1;17,35,36 compound 4 in
cellular and animal models of HS.37 These observations,
together with the relatively low toxicity and high degree of
potency of the new generation structures 9−12 in targeting all
six different nonsense constructs underlying USH1, CF, DMD,
and HS support the feasibility of testing these novel AGs in
treating these diseases in animal and human subjects. Finally,
this study provides a new strategy for the development of novel
AG-based structures by means of optimizing drug-induced
suppression efficacy and toxicity; further progress in this
direction may offer promise for the treatment of many genetic
diseases caused by nonsense mutations.
6′-(R)-Methyl-5-O-(5-azido-5,6-dideoxy-2,3-O-dibenzoyl-α-L-
talofuranosyl)-3′,4′,6′,6-tetra-O-acetyl-2′,1,3-triazidoparom-
amine, (S)-17. Anhydrous CH2Cl2 (15 mL) was added to a
powdered, flame-dried 4 Å molecular sieves (2.0 g), followed by the
addition acceptor 1318 (0.9 g, 0.0015 mol) and donor (S)-1519 (2.0 g,
0.0037 mol). The reaction mixture was stirred for 10 min at room
temperature and was then cooled to −20 °C. A catalytic amount of
BF3·Et2O (0.1 mL) was added, the mixture was stirred at −15 °C, and
the reaction progress was monitored by TLC, which indicated
completion after 120 min. The reaction mixture was diluted with ethyl
acetate and washed with saturated NaHCO3 and brine. The combined
organic layer was dried over MgSO4, evaporated, and subjected to
column chromatography (EtOAc/hexane) to obtain the title
compound (S)-17 (1.1 g) in 75% yield. 1H NMR (500 MHz,
CDCl3): ring I δH 1.27 (d, 3H, J = 6.0 Hz, CH3), 3.58 (dd, 1H, J1 =
5.5, J2 = 10.5 Hz, H-2′), 4.45 (d, 1H, J = 10.7 Hz, H-5′), 4.96−5.02
(m, 2H, H-4′ and H-6′), 5.42 (t, 1H, J = 9.6 Hz, H-3′), 5.95 (d, 1H, J
= 3.7 Hz, H-1′); ring II δH 1.51 (ddd, 1H, J1 = J2 = J3 = 12.5 Hz, H-
2ax), 2.41 (td, 1H, J1 = 4.5, J2 = 12.5 Hz, H-2eq), 3.55 (m, 2H, H-1 and
H-3), 3.76 (t, 1H, J = 9.4 Hz, H-4), 3.88 (t, 1H, J = 9.0 Hz, H-5), 5.03
(t, 1H, J = 9.1 Hz, H-6); ring III δH 1.27 (d, 3H, J = 5.6 Hz, CH3), 3.76
(m, 1H, H-5″), 4.35 (dd, 1H, J1 = 6.9, J2 = 10.9 Hz, H-4″), 5.45 (t, 1H,
J = 5.5 Hz, H-3″), 5.62 (m, 2H, H-2″ and H-1″). The additional peaks
in the spectrum were identified as follows: δH 2.08 (s, 3H, OAc), 2.09
(s, 6H, OAc), 2.38 (s, 3H, OAc), 7.37 (t, 2H, J = 7.8 Hz, Ar), 7.41 (t,
2H, J = 7.8 Hz, Ar), 7.53−7.60 (m, 2H, Ar), 7.89 (d, 2H, J = 8.0 Hz,
Ar), 7.93 (d, 2H, J = 8.2 Hz, Ar). 13C NMR (125 MHz, CDCl3): δC
13.3 (C-7′), 15.4 (C-6″), 20.6 (2C, OAc), 20.9 (OAc), 21.1 (OAc),
32.1 (C-2), 58.4, 58.8, 59.5, 61.7, 68.5, 69.0, 70.1, 70.8. 71.8, 73.6, 74.6,
77.3, 79.6, 84.4, 96.0 (C-1′), 107.6 (C-1″), 128.4 (Ar), 128.5 (Ar),
128.6 (Ar), 128.7 (Ar), 129.6 (Ar), 129.7 (Ar), 133.5 (Ar), 133.6 (Ar),
164.9 (CO), 165.3 (CO), 169.7 (CO), 169.9 (CO), 170.1
(CO), 170.2 (CO). MALDI TOF MS calculated for
C41H46N12O16 Na ([M + Na]+) m/e 985.3; measured m/e 985.4.
6′-(R)-Methyl-5-O-(5-azido-5,6-dideoxy-2,3-O-dibenzoyl-β-D-
allofuranosyl)-3′,4′,6′,6-tetra-O-acetyl-2′,1,3-triazidoparom-
amine, (R)-18. Anhydrous CH2Cl2 (15 mL) was added to a
powdered, flame-dried 4 Å molecular sieves (2.0 g), followed by the
addition acceptor 1318 (1.0 g, 0.0017 mol) and donor (R)-1619 (2.2 g,
0.004 mol). The reaction mixture was stirred for 10 min at room
temperature and was then cooled to −20 °C. A catalytic amount of
BF3·Et2O (0.1 mL) was added, the mixture was stirred at −15 °C, and
the reaction progress was monitored by TLC, which indicated
completion after 120 min. The reaction mixture was diluted with ethyl
acetate and washed with saturated NaHCO3 and brine. The combined
organic layer was dried over MgSO4, evaporated, and subjected to
column chromatography (EtOAc/hexane) to obtain the title
compound (R)-18 (1.2 g) in 75% yield. 1H NMR (500 MHz,
CDCl3): ring I δH 1.28 (d, 3H, J = 6.7 Hz, CH3), 3.46 (dd, 1H, J1 =
4.5, J2 = 10.4 Hz, H-2′), 4.47 (d, 1H, J = 10.7 Hz, H-5′), 4.96−5.02
(m, 2H, H-4′ and H-6′), 5.44 (t, 1H, J = 9.6 Hz, H-3′), 5.93 (d, 1H, J
= 3.3 Hz, H-1′); ring II δH 1.50 (ddd, 1H, J1 = J2 = J3 = 12.5 Hz, H-
EXPERIMENTAL SECTION
■
General Methods. One- and two-dimensional NMR spectra were
routinely recorded on a Bruker Avance 500 spectrometer. Mass spectra
analyses were obtained either on a Bruker Daltonix Apex 3 mass
spectrometer under electron spray ionization (ESI) or on a TSQ-70B
mass spectrometer (Finnigan Mat). Reactions were monitored by
10638
dx.doi.org/10.1021/jm3012992 | J. Med. Chem. 2012, 55, 10630−10643

Journal of Medicinal Chemistry
Article
2ax), 2.41 (td, 1H, J1 = 4.5 and J2= 12.5 Hz, H-2eq), 3.56 (m, 2H, H-1
and H-3), 3.76 (t, 1H, J = 10.0 Hz, H-4), 3.92 (t, 1H, J = 9.5 Hz, H-5),
5.04 (t, 1H, J = 9.6 Hz, H-6); ring III δH 1.42 (d, 3H, J = 6.9 Hz, CH3),
3.78 (m, 1H, H-5″), 4.40 (t, 1H, J = 4.6 Hz, H-4″), 5.50 (t, 1H, J = 5.0
Hz, H-3″), 5.59 (t, 1H, J = 3.7 Hz, H-2″), 5.64 (s, 1H, H-1″). The
additional peaks in the spectrum were identified as follows: δH 2.09 (s,
9H, OAc), 2.33 (s, 3H, OAc), 7.37−7.41 (m, 4H, Ar), 7.56 (m, 2H,
Ar), 7.92 (d, 4H, J = 8.0 Hz Ar). 13C NMR (125 MHz, CDCl3): δH
13.3 (C-7′), 15.0 (C-6″), 20.6 (OAc), 20.7 (OAc), 20.8 (OAc), 21.2
(OAc), 32.1 (C-2), 58.1, 58.2, 58.8, 61.5, 68.9, 70.2, 70.6, 71.4, 73.8,
74.6, 77.0, 77.1, 79.4, 83.9, 96.1 (C-1′), 107.0 (C-1″), 128.4 (2C, Ar),
128.7 (2C, Ar), 129.6 (2C, Ar), 133.5 (Ar), 133.6 (Ar), 164.9 (CO),
165.4 (CO), 169.8 (CO), 169.9 (2C, CO), 170.1 (CO).
MALDI TOF MS calculated for C41H46N12O16Na ([M + Na]+) m/e
985.3; measured m/e 985.4.
1H, J = 10.6 Hz, H-3′), 5.92 (d, 1H, J = 3.7 Hz, H-1′); ring II δH 1.42
(ddd, 1H, J1 = J2 = J3 = 12.5 Hz, H-2ax), 2.52 (td, 1H, J1 = 4.5, J2 = 12.5
Hz, H-2eq), 3.64 (m, 1H, H-3), 3.76 (t, 1H, J = 4.5 Hz, H-4), 4.05 (m,
2H, H-1 and H-5), 4.93 (t, 1H, J = 10.0 Hz, H-6); ring III δH 1.39 (d,
3H, J = 6.4 Hz, CH3), 3.85 (m, 1H, H-5″), 4.36 (dd, 1H, J1 = 4.3, J2 =
6.3 Hz, H-4″), 5.63 (m, 2H, H-2″ and H-3″), 5.67 (s, 1H, H-1″). The
additional peaks in the spectrum were identified as follows: δH 2.04−
2.10 (m, 2H, H-8 and H-8), 2.08 (s, 3H, OAc), 2.09 (s, 3H, OAc),
2.10 (s, 3H, OAc), 2.21 (s, 3H, OAc), 2.25 (s, 3H, OAc), 3.37 (t, 2H, J
= 6.7 Hz, H-9 and H-9), 5.18 (t, 1H, J = 5.0 Hz, H-7), 6.66 (d, 1H, J =
7.5 Hz, NH), 7.38−7.42 (m, 4H, Ar), 7.53−7.59 (m, 2H, Ar), 7.89−
7.92 (m, 4H, Ar). 13C NMR (125 MHz, CDCl3): δC 13.5 (C-7′), 15.2
(C-6″), 20.6 (3C, OAc), 20.8 (OAc), 21.1 (OAc), 30.4, 32.4 (C-1),
47.0, 48.4, 58.1, 58.7, 61.4, 68.6, 69.0, 70.3, 70.5, 70.8, 70.9, 73.4, 74.8,
77.2, 79.6, 83.3, 96.3 (C-1′), 106.9 (C-1″), 128.4 (2C, Ar), 128.7 (2C,
Ar), 129.5 (Ar), 129.6 (Ar), 133.5 (2C, Ar), 164.9 (CO), 165.2
(CO), 168.8 (CO), 169.7 (2C, CO), 169.9 (CO), 170.0
(CO), 172.3 (CO). MALDI TOF MS calculated for
C47H55N13O19 Na ([M + Na]+) m/e 1128.4; measured m/e 1128.4.
6′-(R)-Methyl-5-O-(5-amino-5,6-dideoxy-α-L-talofuranosyl)-
paromamine, (S)-9. The glycosylation product (S)-17 (1.0 g, 0.001
mol) was treated with a solution of MeNH2 (33% solution in EtOH,
50 mL), and the reaction progress was monitored by TLC (EtOAc/
MeOH 85:15), which indicated completion after 8 h. The reaction
mixture was evaporated to dryness, and the residue was dissolved in a
mixture of THF (5 mL) and aqueous NaOH (1 mM, 5.0 mL). The
mixture was stirred at room temperature for 10 min, after which PMe3
(1 M solution in THF, 5.0 mL, 5.0 mmol) was added. The reaction
progress was monitored by TLC [CH2Cl2/MeOH/H2O/MeNH2
(33% solution in EtOH) 10:15:6:15], which indicated completion
after 1 h. The product was purified by column chromatography on a
short column of silica gel. The column was washed with the following
solvents: THF (800 mL), CH2Cl2 (800 mL), EtOH (200 mL), and
MeOH (400 mL). The product was then eluted with a mixture of 20%
MeNH2 (33% solution in EtOH) in 80% MeOH. Fractions containing
the product were combined and evaporated to dryness. The residue
was redissolved in a small volume of water and evaporated again (2−3
repeats) to afford the free amine form of 3. The analytically pure
product was obtained by passing the above product through a short
6′-(R)-Methyl-5-O-(5-azido-5,6-dideoxy-2,3-O-dibenzoyl-α-L-
talofuranosyl)-3′,4′,6′,6-tetra-O-acetyl-2′,3-diazido-1-N-[(S)-4-
azido-2-O-acetyl-butanoyl]paromamine, (S)-19. Anhydrous
CH2Cl2 (15 mL) was added to a powdered, flame-dried 4 Å molecular
sieves (2.0 g), followed by the addition acceptor 1418 (1.0 g, 0.0014
mol) and donor (S)-1519 (2.5 g, 0.0046 mol). The reaction mixture
was stirred for 10 min at room temperature and was then cooled to
−20 °C. A catalytic amount of BF3·Et2O (0.1 mL) was added, the
mixture was stirred at −15 °C, and the reaction progress was
monitored by TLC, which indicated completion after 60 min. The
reaction mixture was diluted with ethyl acetate and washed with
saturated NaHCO3 and brine. The combined organic layer was dried
over MgSO4, evaporated, and subjected to column chromatography
(EtOAc/hexane) to obtain the title compound (S)-19 (1.1 g) in 73%
yield. 1H NMR (500 MHz, CDCl3): ring I δH 1.27 (d, 3H, J = 5.2 Hz,
CH3), 3.54 (dd, 1H, J1 = 4.3, J2 = 10.5 Hz, H-2′), 4.45 (dd, 1H, J1 =
1.8, J2 = 10.6 Hz, H-5′), 4.96−5.02 (m, 2H, H-4′ and H-6′), 5.43 (t,
1H, J = 9.4 Hz, H-3′), 5.94 (d, 1H, J = 3.7 Hz, H-1′); ring II δH 1.44
(ddd, 1H, J1 = J2 = J3 = 12.5 Hz, H-2ax), 2.52 (td, 1H, J1 = 4.5, J2 = 12.5
Hz, H-2eq), 3.60 (m, 1H, H-3), 3.66 (t, 1H, J = 4.5 Hz, H-4), 3.99 (t,
1H, J = 6.4 Hz, H-5), 4.05 (m, 1H, H-1), 4.94 (t, 1H, J = 9.2 Hz, H-6);
ring III δH 1.32 (d, 3H, J = 6.9 Hz, CH3), 3.72 (m, 1H, H-5″), 4.32
(dd, 1H, J1 = 5.85, J2 = 8.0 Hz, H-4″), 5.55 (dd, 1H, J1 = 4.7, J2 = 7.4
Hz, H-3″), 5.65 (m, 2H, H-2″ and H-1″). The additional peaks in the
spectrum were identified as follows: δH 2.04−2.10 (m, 2H, H-8 and H-
8), 2.11 (m, 9H, OAc), 2.22 (s, 3H, OAc), 2.30 (s, 3H, OAc), 3.37 (t,
2H, J = 6.8 Hz, H-9 and H-9), 5.20 (t, 1H, J = 4.85 Hz, H-7), 6.70 (d,
1H, J = 7.5 Hz, NH), 7.35 (t, 2H, J = 7.6 Hz, Ar), 7.43 (t, 2H, J = 7.8
Hz, Ar), 7.53−7.61 (m, 2H, Ar), 7.86 (dd, 2H, J1 = 1.1, J2 = 8.2 Hz,
Ar), 7.95 (dd, 2H, J1 = 1.2, J2 = 8.2 Hz, Ar). 13C NMR (125 MHz,
CDCl3): δC 13.5 (C-7′), 15.5 (C-6″), 20.6 (3C, OAc), 20.9 (OAc),
21.1 (OAc), 30.4, 32.2 (C-1), 47.0, 48.4, 58.6, 58.7, 61.6, 68.6, 69.0,
70.3, 70.8 (2C), 71.4, 73.1, 74.7, 77.5, 79.8, 83.6, 96.3 (C-1′), 107.4
(C-1″), 128.4 (Ar), 128.5 (Ar), 128.7 (2C, Ar), 129.6 (Ar), 129.7
(Ar), 133.5 (Ar), 133.6 (Ar), 165.0 (CO), 165.2 (CO), 168.8
(CO), 169.7 (2C, CO), 169.9 (CO), 170.0 (CO), 172.4
(CO). MALDI TOF MS calculated for C47H55N13O19 Na ([M +
Na]+) m/e 1128.4; measured m/e 1128.2.
6′-(R)-Methyl-5-O-(5-azido-5,6-dideoxy-2,3-O-dibenzoyl-β-D-
allofuranosyl)-3′,4′,6′,6-tetra-O-acetyl-2′,3-diazido-1-N-[(S)-4-
azido-2-O-acetyl-butanoyl]paromamine, (R)-20. Anhydrous
CH2Cl2 (15 mL) was added to a powdered, flame-dried 4 Å molecular
sieves (2.0 g), followed by the addition acceptor 1418 (1.0 g, 0.0014
mol) and donor (R)-1619 (2.5 g, 0.0046 mol). The reaction mixture
was stirred for 10 min at room temperature and was then cooled to
−20 °C. A catalytic amount of BF3·Et2O (0.1 mL) was added, the
mixture was stirred at −15 °C, and the reaction progress was
monitored by TLC, which indicated completion after 90 min. The
reaction mixture was diluted with ethyl acetate and washed with
saturated NaHCO3 and brine. The combined organic layer was dried
over MgSO4, evaporated, and subjected to column chromatography
(EtOAc/hexane) to obtain the title compound (R)-20 (1.15 g) in 76%
yield. 1H NMR (500 MHz, CDCl3): ring I δH 1.28 (d, 3H, J = 6.6 Hz,
CH3), 3.43 (dd, 1H, J1 = 4.3, J2 = 10.6 Hz, H-2′), 4.49 (dd, 1H, J1 =
2.2, J2 = 10.7 Hz, H-5′), 4.96−5.02 (m, 2H, H-4′ and H-6′), 5.45 (t,
+
column of Amberlite CG50 (NH4 form). The column was first
washed with a mixture of MeOH/H2O (3:2), then the product was
eluted with a mixture of MeOH/H2O/NH4OH (80:10:10) to afford
compound (S)-9 (0.400 g, 79% yield). For storage and biological tests,
compound was converted to its sulfate salt form: the free base was
dissolved in water, the pH was adjusted to around 7.0 with H2SO4 (0.1
1
N), and the product was lyophilized. H NMR (500 MHz, CD3OD):
ring I δH 1.21 (d, 3H, J = 5.8 Hz, CH3), 2.61 (dd, 1H, J1 = 3.5, J2 =
10.0 Hz, H-2′), 3.22 (t, 1H, J = 10.0 Hz, H-4′), 3.51 (t, 1H, J = 8.9 Hz,
H-3′), 3.81 (dd, 1H, J1 = 3.0, J2 = 10.0 Hz, H-5′), 4.12 (m, 1H, H-6′),
5.20 (d, 1H, J = 3.3 Hz, H-1′); ring II δH 1.18 (ddd, 1H, J1 = J2 = J3 =
12.5 Hz, H-2ax), 1.98 (td, 1H, J1 = 4.5, J2 = 12.5 Hz, H-2eq), 2.63 (m,
1H, H-1), 2.79 (m, 1H, H-3), 3.19 (t, 1H, J = 9.7 Hz, H-6), 3.38 (t,
1H, J = 9.3 Hz, H-4), 3.48 (t, 1H, J = 9.2 Hz, H-5); ring III δH 1.18 (d,
3H, J = 6.3 Hz, CH3), 2.95 (m, 1H, H-5″), 3.57 (t, 1H, J = 6.4 Hz, H-
4″), 4.03 (t, 1H, J = 5.6 Hz, H-3″), 4.07 (m, 1H, H-2″), 5.25 (d, 1H, J
= 2.5 Hz, H-1″). 13C NMR (125 MHz, CD3OD): δC 16.9 (C-7′), 19.3
(C-6″), 37.5 (C-1), 50.6, 52.3, 52.6, 57.8, 67.8, 72.2, 73.6, 75.5, 76.2,
76.7, 78.6, 84.6, 87.3, 88.6, 101.9 (C-1′), 109.6 (C-1″). MALDI TOF
MS calculated for C19H39N4O10 ([M + H]+) m/e 483.3; measured m/e
483.2.
6′-(R)-Methyl-5-O-(5-amino-5,6-dideoxy-β-D-allofuranosyl)-
paromamine, (R)-10. The glycosylation product (R)-18 (1.0 g, 0.001
mol) was treated with a solution of MeNH2 (33% solution in EtOH,
50 mL), and the reaction progress was monitored by TLC (EtOAc/
MeOH 85:15), which indicated completion after 8 h. The reaction
mixture was evaporated to dryness and the residue was dissolved in a
mixture of THF (5 mL) and aqueous NaOH (1 mM, 5.0 mL). The
mixture was stirred at room temperature for 10 min, after which PMe3
(1 M solution in THF, 5.0 mL, 5.0 mmol) was added. The reaction
progress was monitored by TLC [CH2Cl2/MeOH/H2O/MeNH2
10639
dx.doi.org/10.1021/jm3012992 | J. Med. Chem. 2012, 55, 10630−10643

Journal of Medicinal Chemistry
Article
(33% solution in EtOH) 10:15:6:15], which indicated completion
after 1 h. The product was purified by column chromatography on a
short column of silica gel. The column was washed with the following
solvents: THF (800 mL), CH2Cl2 (800 mL), EtOH (200 mL), and
MeOH (400 mL). The product was then eluted with a mixture of 20%
MeNH2 (33% solution in EtOH) in 80% MeOH. Fractions containing
the product were combined and evaporated to dryness. The residue
was redissolved in a small volume of water and evaporated again (2−3
repeats) to afford the free amine form of 4. The analytically pure
product was obtained by passing the above product through a short
2H, J = 5.7 Hz, H-9 and H-9), 4.13 (dd, 1H, J1= 4.2 and J2 = 7.6 Hz,
H-7). 13C NMR (125 MHz, CD3OD): δC 16.6 (C-7′), 19.2 (C-6″),
35.9, 37.8, 39.0, 50.8, 50.9, 52.3, 57.8, 67.8, 71.7, 72.4, 73.6, 75.5, 75.6,
76.3, 76.8, 84.8, 86.7, 88.6, 101.9 (C-1′), 110.0 (C-1″), 177.1 (CO).
MALDI TOF MS calculated for C23H45N5O12Na ([M + Na]+) m/e
606.3; measured m/e 606.6.
6′-(R)-Methyl-5-O-(5-amino-5,6-dideoxy-β-D-allofuranosyl)-
1-N-[(S)-4-amino-2-hydroxy-butanoyl]-paromamine, (R)-12.
The glycosylation product (R)-20 (1.12 g, 0.001 mol) was treated
with a solution of MeNH2 (33% solution in EtOH, 50 mL), and the
reaction progress was monitored by TLC (EtOAc/MeOH 85:15),
which indicated completion after 8 h. The reaction mixture was
evaporated to dryness, and the residue was dissolved in a mixture of
THF (5 mL) and aqueous NaOH (1 mM, 5.0 mL). The mixture was
stirred at room temperature for 10 min, after which PMe3 (1 M
solution in THF, 5.0 mL, 5.0 mmol) was added. The reaction progress
was monitored by TLC [CH2Cl2/MeOH/H2O/MeNH2 (33%
solution in EtOH) 10:15:6:15], which indicated completion after 1
h. The product was purified by column chromatography on a short
column of silica gel. The column was washed with the following
solvents: THF (800 mL), CH2Cl2 (800 mL), EtOH (200 mL), and
MeOH (400 mL). The product was then eluted with a mixture of 20%
MeNH2 (33% solution in EtOH) in 80% MeOH. Fractions containing
the product were combined and evaporated to dryness. The residue
was redissolved in a small volume of water and evaporated again (2−3
repeats) to afford the free amine form of 6. The analytically pure
product was obtained by passing the above product through a short
+
column of Amberlite CG50 (NH4 form). The column was first
washed with a mixture of MeOH/H2O (3:2), then the product was
eluted with a mixture of MeOH/H2O/NH4OH (80:10:10) to afford
compound (R)-10 (0.398 g, 79% yield). For storage and biological
tests, compound was converted to its sulfate salt form: the free base
was dissolved in water, the pH was adjusted to around 7.0 with H2SO4
(0.1 N), and the product was lyophilized. 1H NMR (500 MHz,
CD3OD): ring I δH 1.22 (d, 3H, J = 5.8 Hz, CH3), 2.61 (dd, 1H, J1 =
2.5, J2 = 9.6 Hz, H-2′), 3.22 (t, 1H, J = 9.8 Hz, H-4′), 3.50 (t, 1H, J =
9.9 Hz, H-3′), 3.83 (dd, 1H, J1 = 3.0, J2 = 10.1 Hz, H-5′), 4.12 (m, 1H,
H-6′), 5.20 (d, 1H, J = 3.3 Hz, H-1′); ring II δH 1.21 (ddd, 1H, J1 = J2
= J3 = 12.5 Hz, H-2ax), 1.98 (td, 1H, J1 = 4.5, J2 = 12.5 Hz, H-2eq), 2.65
(m, 1H, H-1), 2.78 (m, 1H, H-3), 3.18 (t, 1H, J = 9.3 Hz, H-6), 3.38
(t, 1H, J = 9.1 Hz, H-4), 3.46 (t, 1H, J = 9.2 Hz, H-5); ring III δH 1.17
(d, 3H, J = 6.4 Hz, CH3), 3.10 (m, 1H, H-5″), 3.71 (t, 1H, J = 5.0 Hz,
H-4″), 4.06 (t, 1H, J = 5.6 Hz, H-2″), 4.16 (t, 1H, J = 3.0 Hz, H-3″),
5.20 (d, 1H, J = 3.0 Hz, H-1″). 13C NMR (125 MHz, CD3OD): δC
16.6 (C-7′), 18.7 (C-6″), 37.6 (C-1), 49.5, 52.2, 52.5, 57.8, 67.8, 70.8,
73.6, 75.4, 76.1, 76.7, 78.4, 84.7, 87.5, 88.0, 101.9 (C-1′), 109.6 (C-1″).
MALDI TOF MS calculated for C19H39N4O10 ([M + H]+) m/e 483.3;
measured m/e 483.2.
+
column of Amberlite CG50 (NH4 form). The column was first
washed with a mixture of MeOH/H2O (3:2), and then the product
was eluted with a mixture of MeOH/H2O/NH4OH (80:10:10) to
afford compound (R)-12 (0.500 g, 84% yield). For storage and
biological tests, compound was converted to its sulfate salt form: the
free base was dissolved in water, the pH was adjusted around 7.0 with
H2SO4 (0.1 N), and the product was lyophilized. 1H NMR (500 MHz,
CD3OD): ring I δH 1.22 (d, 3H, J = 6.3 Hz, CH3), 2.63 (dd, 1H, J1 =
3.8, J2 = 10.0 Hz, H-2′), 3.22 (t, 1H, J = 9.8 Hz, H-4′), 3.52 (dd, 1H, J1
= 8.6, J2 = 10.3 Hz, H-3′), 3.83 (dd, 1H, J1 = 3.1, J2 = 10.2 Hz, H-5′),
4.13 (m, 1H, H-6′), 5.23 (d, 1H, J = 3.7 Hz, H-1′); ring II δH 1.34
(ddd, 1H, J1 = J2 = J3 = 12.5 Hz, H-2ax), 1.99 (td, 1H, J1 = 4.5 and J2 =
12.5 Hz, H-2eq), 2.85 (m, 1H, H-3), 3.39 (t, 1H, J = 8.8 Hz, H-4),
3.49−3.56 (m, 2H, H-5 and H-6), 3.82 (m, 1H, H-1); ring III δH 1.16
(d, 3H, J = 6.7 Hz, CH3), 3.08 (m, 1H, H-5″), 3.69 (t, 1H, J = 5.5 Hz,
H-4″), 4.07 (dd, 1H, J1 = 2.1, J2 = 5.2 Hz, H-2″), 4.14 (t, 1H, J = 5.7
Hz, H-3″), 5.21 (d, 1H, J = 3.7 Hz, H-1″). The additional peaks in the
spectrum were identified as follows: δH 1.82 (m, 1H, H-8), 1.95 (m,
1H, H-8), 2.84 (t, 2H, J = 7.2 Hz, H-9 and H-9), 4.13 (dd, 1H, J1 =
3.9, J2 = 7.5 Hz, H-7). 13C NMR (125 MHz, CD3OD): δH 16.6 (C-7′),
18.8 (C-6″), 36.0, 37.7, 38.9, 49.6, 50.8, 52.3, 57.8, 67.8, 71.0, 71.7,
73.6, 75.5 (2C), 76.2, 76.7, 85.0, 86.9, 87.9, 101.9 (C-1′), 110.0 (C-
1″), 177.1 (CO). MALDI TOF MS calculated for C23H45N5O12Na
([M + Na]+) m/e 606.3; measured m/e 606.6.
6′-(R)-Methyl-5-O-(5-amino-5,6-dideoxy-α-L-talofuranosyl)-
1-N-[(S)-4-amino-2-hydroxy-butanoyl]-paromamine, (S)-11.
The glycosylation product (S)-19 (1.05 g, 0.001 mol) was treated
with a solution of MeNH2 (33% solution in EtOH, 50 mL), and the
reaction progress was monitored by TLC (EtOAc/MeOH 85:15),
which indicated completion after 8 h. The reaction mixture was
evaporated to dryness, and the residue was dissolved in a mixture of
THF (5 mL) and aqueous NaOH (1 mM, 5.0 mL). The mixture was
stirred at room temperature for 10 min, after which PMe3 (1 M
solution in THF, 5.0 mL, 5.0 mmol) was added. The reaction progress
was monitored by TLC [CH2Cl2/MeOH/H2O/MeNH2 (33%
solution in EtOH) 10:15:6:15], which indicated completion after 1
h. The product was purified by column chromatography on a short
column of silica gel. The column was washed with the following
solvents: THF (800 mL), CH2Cl2 (800 mL), EtOH (200 mL), and
MeOH (400 mL). The product was then eluted with a mixture of 20%
MeNH2 (33% solution in EtOH) in 80% MeOH. Fractions containing
the product were combined and evaporated to dryness. The residue
was redissolved in a small volume of water and evaporated again (2−3
repeats) to afford the free amine form of 5. The analytically pure
product was obtained by passing the above product through a short
Dual Luciferase Readthrough Assays. DNA fragments derived
from PCDH15, CFTR, dystrophin, and IDUA cDNAs, including the
tested nonsense mutation or the corresponding wild-type codon and
four to six upstream and downstream flanking codons, were created
and inserted into the polylinker of the p2luc plasmid, as previously
described by us.17 The polylinkers inserted to p2luc vector were as
follows: Usher syndrome (PCDH15) p.R3X mut/wt 5′- CAGAAG-
ATGTTTT/CGACAGTTTTATCTCTGGACA-3′, p.R245 Xmut/wt
5′ AAAATCTGAATGAGAGGT/CGAACCACCACCACCACCC-
TC-3′; cystic fibrosis (CFTR) p.G542X mut/wt 5′-TCGACCAAT-
ATAGTTCTTT/GGAGAAGGTGGAATCGAGCT-3′, p.W1282X
mut/wt 5′-TCGACAACTTTGCAACAGTGA/GAGGAAAGCC-
TTTGAGCT-3′; Duchenne muscular dystrophy (dystrophin)
p.R3381X mut/wt 5′- TCGACAAAAAACAAATTTTGA/CACCAAA-
AGGTATGAGCT-3′; Hurler syndrome (IDUA) p.Q70X mut/wt 5′-
TCGACCCTCAGCTGGGACT/CAGCAGCTCAACCTCGAGCT-
3′.
+
column of Amberlite CG50 (NH4 form). The column was first
washed with a mixture of MeOH/H2O (3:2), and then the product
was eluted with a mixture of MeOH/H2O/NH4OH (80:10:10) to
afford compound (S)-11 (0.480 g, 86% yield). For storage and
biological tests, compound was converted to its sulfate salt form: the
free base was dissolved in water, the pH was adjusted around 7.0 with
H2SO4 (0.1 N), and the product was lyophilized. 1H NMR (500 MHz,
CD3OD): ring I δH 1.21 (d, 3H, J = 6.0 Hz, CH3), 2.63 (dd, 1H, J1 =
3.5, J2 = 10.0 Hz, H-2′), 3.23 (t, 1H, J = 8.9 Hz, H-4′), 3.52 (t, 1H, J =
9.9 Hz, H-3′), 3.82 (dd, 1H, J1 = 3.0, J2 = 10.0 Hz, H-5′), 4.13 (m, 1H,
H-6′), 5.22 (d, 1H, J = 3.3 Hz, H-1′); ring II δH 1.34 (ddd, 1H, J1 = J2
= J3 = 12.5 Hz, H-2ax), 1.99 (td, 1H, J1 = 4.5 and J2 = 12.5 Hz, H-2eq),
2.85 (m, 1H, H-3), 3.40 (t, 1H, J = 8.8 Hz, H-4), 3.50−3.59 (m, 2H,
H-5 and H-6), 3.83 (m, 1H, H-1); ring III δH 1.17 (d, 3H, J = 6.6 Hz,
CH3), 2.94 (m, 1H, H-5″), 3.56 (t, 1H, J = 7.1 Hz, H-4″), 4.01 (t, 1H,
J = 5.7 Hz, H-3″), 4.09 (dd, 1H, J1= 2.7 and J2 = 5.4 Hz, H-2″), 5.26
(d, 1H, J = 2.5 Hz, H-1″). The additional peaks in the spectrum were
identified as follows: δH 1.82 (m, 1H, H-8), 1.95 (m, 1H, H-8), 2.83 (t,
For in vitro readthrough assays, the obtained plasmids in the
presence of the tested AGs were transcribed and translated using the
10640
dx.doi.org/10.1021/jm3012992 | J. Med. Chem. 2012, 55, 10630−10643

Journal of Medicinal Chemistry
Article
TNT reticulocyte lysate quick coupled transcription/translation
system (Promega). Luciferase activity was determined 90 min
postincubation at 30 °C, using Dual luciferase reporter assay system
(Promega). Readthrough activity was calculated as previously
described26 (Figures 3 and 4).
For ex vivo readthrough assays, constructs harboring R3X, R245X,
G542X, and W1282X mutations were inserted into HEK-293 (human
embryonic kidney) cells using Lipofectamine 2000 (Invitrogen), and
the tested compounds were added 6 h post-transfection. The cells
were harvested following 16 h incubation with AG using passive lysis
buffer (Promega). Readthrough activity was calculated as previously
described26 (Figure 5).
Antibacterial and Cell Toxicity Assays. Comparative anti-
bacterial activities were determined in two representative strains of
Gram-negative (E. coli R477-100, Table 1) and Gram-positive (B.
subtilis ATCC-6633, Table S1, Supporting Information) bacteria, by
measuring the MIC values using the double-microdilution method
according to the National Committee for Clinical Laboratory
Standards (NCCLS)38 with two different starting concentrations of
384 μg/mL and 6144 μg/mL of the tested compound. All the
experiments were performed in triplicate, and analogous results were
obtained in three different experiments.
For the cytotoxicity assays, HEK-293 (Table 1) and HFF (Table S1,
Supporting Information) cells were grown in 96-well plates (5000
cells/well) in DMEM medium containing 10% FBS and 1% glutamine
(90 μL; Biological Industries) at 37 °C and 5% CO2. Following
overnight incubation, different concentrations of the tested AGs were
added (10 μL per well), and the cells were incubated for an additional
48 h. A cell proliferation assay (XTT based colorimetric assay,
Biological Industries) was performed by using a 3 h incubation
protocol, according to the manufacturer’s instructions. Optical density
(OD) was measured using an ELISA plate reader. Cell viability was
calculated as the ratio between the numbers of living cells in cultures
grown in the presence of the tested compounds and those in cultures
grown under the identical protocol without the tested compound. The
half-maximal lethal concentration (LC50) values were obtained from
fitting concentration−response curves to the data of at least three
independent experiments, using GraFit 5 software.39
Eukaryotic and Prokaryotic Protein Synthesis Assays.
Prokaryotic in vitro translation inhibition by different aminoglycosides
was quantified in coupled transcription/translation assays27 using E.
coli S30 extract for circular DNA with the pBESTluc plasmid
(Promega), according to the manufacturer's protocol. Variable
concentrations of tested AG were incubated along with translation
reaction (10 μL) at 37 °C for 60 min, ice cooled for 5 min, and diluted
with a dilution reagent (tris-phosphate buffer (25 mM, pH 7.8), DTT
(2 mM), 1,2-diaminocyclohexanetetraacetate (2 mM), glycerol (10%),
Triton X-100 (1%), and BSA (1 mg mL−1)) into 96-well plates.
Eukaryotic in vitro translation inhibition was quantified by using
TNT T7 Quick coupled transcription/translation system with the T7
control DNA plasmid (Promega), according to the manufacturer
protocol. Variable concentrations of the tested AG were incubated
along with translation reaction (10 μL) at 30 °C for 60 min, ice cooled
for 5 min, diluted with similar dilution reagent as described above, and
transferred into 96-well plates. In both prokaryotic and eukaryotic
systems, luminescence was measured immediately after the addition of
Luciferase Assay Reagent (50 μL; Promega), and light emission was
recorded with an FLx800 fluorescence microplate reader (Biotek).
Half-maximal inhibition concentration (IC50) values were obtained
from concentration−response fitting curves of at least three
independent experiments using Grafit5 software.39
with PBS twice and centrifuged again under the same conditions. The
pellet was resuspended in 1 mL of lysis buffer, incubated on ice for 10
min, and centrifuged at 1000g for 10 min at 4 °C. The pellet was
resuspended in 1.5 mL of ice-cold disruption buffer and centrifuged at
1000g for 10 min at 4 °C. The lysate was transferred into a
microcentrifuge tube following centrifugation at 6000g for 10 min at 4
°C. Finally, high mitochondrial purity was obtained according to
manufacturer’s protocol; the mitochondrial pellet was resuspeded in
MSE buffer (220 mM mannitol, 70 mM sucrose, 5 mM MOPS, 2 mM
EGTA, pH 7.0), and protein concentration was determined by the
method of Bradford using bovine serum albumin as standard.40
Mitochondrial protein synthesis was measured in a 93 μL total
volume containing KCl (90 mM), MgSO4 (4 mM), KH2PO4 (2.5
mM), MOPS (25 mM), pH 7.0, a mixture of the 19 L-amino acids
without L-methionine (AppliChem) to a final concentration of 0.1 mM
each, glutamate (20 mM), malate (0.5 mM), ADP (2 mM), BSA (1
mg/mL), emetine (5 μM, an inhibitor of 80S ribosome, Sigma), and
mitochondrial protein (2 mg/mL) in the presence of different
concentrations of AGs (G418 0, 0.3, 3.3, 33, 330, and 3300 μM;
gentamicin and compounds 1−4 0, 3.3, 33, 330, 3300, and 33000 μM;
compounds 5−12 0, 8.2, 82, 820, 8200, and 88000 μM). Pre-
incubation was carried out at 37 °C for 60 min followed by addition of
[35S]methionine (150 μCi) and additional incubation for 45 min.
Then the reaction mixture was centrifuged at 12000g for 15 min at 4
°C, washed with MSE buffer, and centrifuged again under the same
conditions. The mitochondrial pellet was resuspended in 30 μL of lysis
buffer (2% sodium dodecyl sulfate, 2 mM EDTA, 0.2% (v/v) 2-
mercaptoethanol, 0.05 M Tris (pH 6.8), and 10% (v/v) glycerol) and
heated for 2 min at 90 °C. The resulting mixture was then either
stored in a freezer or used immediately for electrophoresis or
scintillation measurements.31
Autoradiography. Radioactivity was measured by acid precipitation
of the labeled proteins: the lysed mixture from the above (15 μL) was
added with trichloroacetic acid (15%), methionine (1 mM) and BSA
(50 μg/mL) to a total volume of 1.9 mL. The resulting mixture was
incubated on ice for 60 min. The precipitated proteins were harvested
onto filter paper disks (Whatman 3 mm, 2.3 cm) using a Tomtec
harvester and washed twice with 2 mL of 5% trichloroacetic acid, and
the filters were dried at 60 °C for 30 min. The filters were then
inserted into the scintillation vials containing 5 mL of scintillation
solution: toluene (1 mL), Triton X 100 (0.5 mL), 2,2′-p-phenylene-
bis(5-phenyloxazole) (0.3 g), and 2,5-diphenyloxazole (3 g), followed
by counting on a scintillation counter.31 The half-maximal inhibitory
concentration (ICM50it) values of mitochondrial protein synthesis were
determined by Grafit5 software39 (Figure 7 and Figure S1, Supporting
Information). To verify the suitability of the entire protocol, we used
chloramphenicol (Sigma) as a control for each experiment as a routine
Mit
50
test. The IC value we observed for chloramphenicol was in the
range of 7.4 0.9 μM, which is very similar to that observed (9.8
0.5 μM) in the previous report.14 Resolution of labeled mitochondrial
proteins was also carried out by electrophoresis on 15% acrylamide gel.
After electrophoresis, the gel was fixed, stained with Coomassie blue,
dried, and visualized by autoradiography (Figure 7A).
ASSOCIATED CONTENT
* Supporting Information
■
S
Comparative cell toxicity (HFF cells) and antibacterial activity
(B. subtilis) data, tabular representation of the data points of
correlation in Figure 6, semilogarithmic plots representing
dose−response effect on the inhibition of intact mitochondrial
protein translation, purity determination, and 1H and 13C NMR
spectra of compounds 9−12. This material is available free of
charge via the Internet at http://pubs.acs.org.
Mitochondrial Protein Synthesis Inhibition Assays. Mito-
chondria were isolated from HeLa cells using Qproteome mitochon-
dria isolation kit (Qiagen, CA), according to the manufacture’s
protocol with slight modifications. Briefly, HeLa cells were grown in
10 cm dishes in Dulbecco’s modified Eagles medium (DMEM, Sigma)
supplemented with 10% fetal bovine serum, without the addition of
penicillin/streptomycin (Sigma), till cells reached 80% confluence.
Approximately 2 × 107 cells were trypsinized (Biological Industries)
and centrifuged at 500g for 10 min. The cellular pellet was washed
AUTHOR INFORMATION
Corresponding Author
*Phone: (972) 48292590. E-mail: chtimor@techunix.technion.
ac.il.
■
10641
dx.doi.org/10.1021/jm3012992 | J. Med. Chem. 2012, 55, 10630−10643

Journal of Medicinal Chemistry
Article
(10) Floquet, C.; Rousset, J. P.; Bidou, L. Readthrough of premature
termination codons in the adenomatous polyposis coli gene restores its
biological activity in human cancer cells. PLoS One 2011, 6 (8),
No. e24125.
(11) Chernikov, V. G.; Terekhov, S. M.; Krokhina, T. B.; Shishkin, S.
S.; Smirnova, T. D.; Kalashnikova, E. A.; Adnoral, N. V.; Rebrov, L. B.;
Denisov-Nikol’skii, Y. I.; Bykov, V. A. Comparison of cytotoxicity of
aminoglycoside antibiotics using a panel cellular biotest system. Bull.
Exp. Biol. Med. 2003, 135 (1), 103−105.
(12) Hainrichson, M.; Nudelman, I.; Baasov, T. Designer amino-
glycosides: The race to develop improved antibiotics and compounds
for the treatment of human genetic diseases. Org. Biomol. Chem. 2008,
6 (2), 227−239.
Present Address
‡Department of Biomolecular Systems, Max Planck Institute of
Colloids and Interfaces, Am Muhlenberg 1, D-14476 Postdam,
Germany.
Author Contributions
†Equal contribution.
Notes
The authors declare the following competing financial
interest(s): TB has proprietary and financial interests in the
treatment of genetic diseases with novel aminoglycosides (PCT
application # WO 2007113841 A2 20071011).
(13) Hobbie, S. N.; Bruell, C. M.; Akshay, S.; Kalapala, S. K.;
Shcherbakov, D.; Bottger, E. C. Mitochondrial deafness alleles confer
misreading of the genetic code. Proc. Natl. Acad. Sci. U.S.A. 2008, 105
(9), 3244−3249.
(14) McKee, E. E.; Ferguson, M.; Bentley, A. T.; Marks, T. A.
Inhibition of mammalian mitochondrial protein synthesis by
oxazolidinones. Antimicrob. Agents Chemother. 2006, 50 (6), 2042−
2049.
(15) Matt, T.; Ng, C. L.; Lang, K.; Sha, S. H.; Akbergenov, R.;
Shcherbakov, D.; Meyer, M.; Duscha, S.; Xie, J.; Dubbaka, S. R.; Perez-
Fernandez, D.; Vasella, A.; Ramakrishnan, V.; Schacht, J.; Bottger, E.
C. Dissociation of antibacterial activity and aminoglycoside ototoxicity
in the 4-monosubstituted 2-deoxystreptamine apramycin. Proc. Natl.
Acad. Sci. U.S.A. 2012, 109 (27), 10984−10989.
(16) Nudelman, I.; Rebibo-Sabbah, A.; Shallom-Shezifi, D.;
Hainrichson, M.; Stahl, I.; Ben-Yosef, T.; Baasov, T. Redesign of
aminoglycosides for treatment of human genetic diseases caused by
premature stop mutations. Bioorg. Med. Chem. Lett. 2006, 16, 6310−
6315.
(17) Nudelman, I.; Rebibo-Sabbah, A.; Cherniavsky, M.; Belakhov,
V.; Hainrichson, M.; Chen, F.; Schacht, J.; Pilch, D. S.; Ben-Yosef, T.;
Baasov, T. Development of novel aminoglycoside (NB54) with
reduced toxicity and enhanced suppression of disease-causing
premature stop mutations. J. Med. Chem. 2009, 52 (9), 2836−2845.
(18) Nudelman, I.; Glikin, D.; Smolkin, B.; Hainrichson, M.;
Belakhov, V.; Baasov, T. Repairing faulty genes by aminoglycosides:
development of new derivatives of Geneticin (G418) with enhanced
suppression of diseases-causing nonsense mutations. Bioorg. Med.
Chem. 2010, 18 (11), 3735−3746.
ACKNOWLEDGMENTS
■
This work was supported by the NIH/NIGMS Grant 1 R01
GM094792-01 A1 and GIF Research Grant G-1048-95.5/2009.
We thank John F. Atkins (University of Utah) for providing the
p2luc plasmid and Gadi Schuster (Technion) for helping us in
mitochondrial protein synthesis assays. We thank Mariana
Hainrichson of our group for her assistance at the initial steps
of mitochondrial protein synthesis assays. J.K. acknowledges the
Schulich Postdoctoral Fellowship; D.A.-G. acknowledges the
Miriam and Aaron Gutwirth Memorial Fellowship; V.B.
acknowledges the Ministry of Science and Technology, Israel
(Kamea Program).
ABBREVIATIONS USED
■
AG, Aminoglycoside; CF, cystic fibrosis; CFTR, cystic fibrosis
transmembrane conductance regulator; DMD, Duchenne
muscular dystrophy; USH, Usher syndrome; HS, Hurler
syndrome; PTC, premature termination codon; PCDH,
protocadherin; HFF, human foreskin fibroblasts; LC50, half-
maximal lethal concentration
REFERENCES
■
(1) Keeling, K. M.; Bedwell, D. M. Suppression of nonsense
mutations as a therapeutic approach to treat genetic diseases. Wiley
Interdiscip. Rev.: RNA 2011, 2 (6), 837−852.
(19) Kandasamy, J.; Atia-Glikin, D.; Belakhov, V.; Baasov, T.
Repairing faulty genes by aminoglycosides: Identification of new
pharmacophore with enhanced suppression of diseases-causing
nonsense mutations. MedChemComm 2011, 2, 165−171.
(20) Rebibo-Sabbah, A.; Nudelman, I.; Ahmed, Z. M.; Baasov, T.;
Ben-Yosef, T. In vitro and ex vivo suppression by aminoglycosides of
PCDH15 nonsense mutations underlying type 1 Usher syndrome.
Hum. Genet. 2007, 122 (3−4), 373−381.
(21) Howard, M. T.; Shirts, B. H.; Petros, L. M.; Flanigan, K. M.;
Gesteland, R. F.; Atkins, J. F. Sequence specificity of aminoglycoside-
induced stop condon readthrough: Potential implications for treat-
ment of Duchenne muscular dystrophy. Ann. Neurol. 2000, 48 (2),
164−169.
(2) Mort, M.; Ivanov, D.; Cooper, D. N.; Chuzhanova, N. A. A meta-
analysis of nonsense mutations causing human genetic disease. Human
Mutat. 2008, 29 (8), 1037−1047.
(3) Burke, J. F.; Mogg, A. E. Suppression of a nonsense mutation in
mammalian cells in vivo by the aminoglycoside antibiotics G-418 and
paromomycin. Nucleic Acids Res. 1985, 13 (17), 6265−6272.
(4) Zingman, L. V.; Park, S.; Olson, T. M.; Alekseev, A. E.; Terzic, A.
Aminoglycoside-induced translational read-through in disease: Over-
coming nonsense mutations by pharmacogenetic therapy. Clin.
Pharmacol. Ther. 2007, 81 (1), 99−103.
(5) Karpati, G.; Lochmuller, H. When running a stop sign may be a
good thing. Ann. Neurol. 2001, 49 (6), 693−694.
(6) Ogle, J. M.; Brodersen, D. E.; Clemons, W. M., Jr.; Tarry, M. J.;
Carter, A. P.; Ramakrishnan, V. Recognition of cognate transfer RNA
by the 30S ribosomal subunit. Science 2001, 292 (5518), 897−902.
(7) Bottger, E. C.; Springer, B.; Prammananan, T.; Kidan, Y.; Sander,
P. Structural basis for selectivity and toxicity of ribosomal antibiotics.
EMBO Rep. 2001, 2 (4), 318−323.
(22) The Cystic Fibrosis Genotype-Phenotype Consortium.
Correlation between genotype and phenotype in patients with cystic
fibrosis. N. Engl. J. Med. 1993, 329 (18), 1308−1313.
(23) Shoshani, T.; Kerem, E.; Szeinberg, A.; Augarten, A.; Yahav, Y.;
Cohen, D.; Rivlin, J.; Tal, A.; Kerem, B. Similar levels of mRNA from
the W1282X and the delta F508 cystic fibrosis alleles, in nasal
epithelial cells. J. Clin. Invest. 1994, 93 (4), 1502−1507.
(24) Tuffery-Giraud, S.; Chambert, S.; Demaille, J.; Claustres, M.
Point mutations in the dystrophin gene: Evidence for frequent use of
cryptic splice sites as a result of splicing defects. Hum. Mutat. 1999, 14
(5), 359−368.
(8) Kondo, J.; Hainrichson, M.; Nudelman, I.; Shallom-Shezifi, D.;
Barbieri, C. M.; Pilch, D. S.; Westhof, E.; Baasov, T. Differential
selectivity of natural and synthetic aminoglycosides towards the
eukaryotic and prokaryotic decoding A sites. ChemBioChem 2007, 8
(14), 1700−1709.
(9) Manuvakhova, M.; Keeling, K.; Bedwell, D. M. Aminoglycoside
antibiotics mediate context-dependent suppression of termination
codons in a mammalian translation system. RNA 2000, 6 (7), 1044−
1055.
(25) Keeling, K. M.; Brooks, D. A.; Hopwood, J. J.; Li, P.; Thompson,
J. N.; Bedwell, D. M. Gentamicin-mediated suppression of Hurler
syndrome stop mutations restores a low level of alpha-L-iduronidase
10642
dx.doi.org/10.1021/jm3012992 | J. Med. Chem. 2012, 55, 10630−10643

Journal of Medicinal Chemistry
Article
activity and reduces lysosomal glycosaminoglycan accumulation. Hum.
Mol. Genet. 2001, 10 (3), 291−299.
(26) Grentzmann, G.; Ingram, J. A.; Kelly, P. J.; Gesteland, R. F.;
Atkins, J. F. A dual-luciferase reporter system for studying recoding
signals. RNA 1998, 4 (4), 479−486.
(27) Greenberg, W. A.; Priestley, E. S.; Sears, P. S.; Alper, P. B.;
Rosenbohm, C.; Hendrix, M.; Hung, S. C.; Wong, C. H. Design and
synthesis of new aminoglycoside antibiotics containing neamine as an
optimal core structure: Correlation of antibiotic activity with in vitro
inhibition of translation. J. Am. Chem. Soc. 1999, 121, 6527−6541.
(28) Kondo, J. A structural basis for the antibiotic resistance
conferred by an A1408G mutation in 16S rRNA and for the
antiprotozoal activity of aminoglycosides. Angew. Chem., Int. Ed. 2011,
50, 465−468.
(29) Hobbie, S. N.; Kalapala, S. K.; Akshay, S.; Bruell, C.; Schmidt,
S.; Dabow, S.; Vasella, A.; Sander, P.; Bottger, E. C. Engineering the
rRNA decoding site of eukaryotic cytosolic ribosomes in bacteria.
Nucleic Acids Res. 2007, 35 (18), 6086−6093.
(30) Ben-Shem, A.; Garreau de Loubresse, N.; Melnikov, S.; Jenner,
L.; Yusupova, G.; Yusupov, M. The structure of the eukaryotic
ribosome at 3.0 Å resolution. Science 2011, 334 (6062), 1524−1529.
(31) McKee, E. E.; Grier, B. L.; Thompson, G. S.; McCourt, J. D.
Isolation and incubation conditions to study heart mitochondrial
protein synthesis. Am. J. Physiol. 1990, 258 (3 Pt 1), E492−502.
(32) Rowe, S. M.; Sloane, P.; Tang, L. P.; Backer, K.; Mazur, M.;
Buckley-Lanier, J.; Nudelman, I.; Belakhov, V.; Bebok, Z.; Schwiebert,
E.; Baasov, T.; Bedwell, D. M. Suppression of CFTR premature
termination codons and rescue of CFTR protein and function by the
synthetic aminoglycoside NB54. J. Mol. Med. 2011, 89 (11), 1149−
1161.
(33) Brendel, C.; Belakhov, V.; Werner, H.; Wegener, E.; Gartner, J.;
Nudelman, I.; Baasov, T.; Huppke, P. Readthrough of nonsense
mutations in Rett syndrome: Evaluation of novel aminoglycosides and
generation of a new mouse model. J. Mol. Med. 2011, 89 (4), 389−
398.
(34) Vecsler, M.; Ben Zeev, B.; Nudelman, I.; Anikster, Y.; Simon, A.
J.; Amariglio, N.; Rechavi, G.; Baasov, T.; Gak, E. Ex vivo treatment
with a novel synthetic aminoglycoside NB54 in primary fibroblasts
from Rett syndrome patients suppresses MECP2 nonsense mutations.
PLoS One 2010, 6 (6), No. e20733.
(35) Goldmann, T.; Rebibo-Sabbah, A.; Overlack, N.; Nudelman, I.;
Belakhov, V.; Baasov, T.; Ben-Yosef, T.; Wolfrum, U.; Nagel-Wolfrum,
K. Beneficial read-through of a USH1C nonsense mutation by
designed aminoglycoside NB30 in the retina. Invest. Ophthalmol. Vis.
Sci. 2010, 51 (12), 6671−6680.
(36) Goldmann, T.; Overlack, N.; Moller, F.; Belakhov, V.; van Wyk,
M.; Baasov, T.; Wolfrum, U.; Nagel-Wolfrum, K. A comparative
evaluation of NB30, NB54 and PTC124 in translational read-through
efficacy for treatment of an USH1C nonsense mutation. EMBO Mol.
Med. 2012, 4, 1186−1199.
(37) Wang, D.; Belakhov, V.; Kandasamy, J.; Baasov, T.; Li, S. C.; Li,
Y. T.; Bedwell, D. M.; Keeling, K. M. The designer aminoglycoside
NB84 significantly reduces glycosaminoglycan accumulation associated
with MPS I-H in the Idua-W392X mouse. Mol. Genet. Metab. 2011,
105 (1), 116−125.
(38) NCCLS, National Committee for Clinical Laboratory Standards,
Performance standards for antimicrobial susceptibility testing. Fifth
information supplement: Approved Standard M100-S5. NCCLS:
Villanova, Pa., 1994.
(39) Leatherbarrow, R. J. GraFit 5; Erithacus Software Ltd.: Horley,
U.K., 2001.
(40) Bradford, M. M. A rapid and sensitive method for the
quantitation of microgram quantities of protein utilizing the principle
of protein-dye binding. Anal. Biochem. 1976, 72, 248−254.
10643
dx.doi.org/10.1021/jm3012992 | J. Med. Chem. 2012, 55, 10630−10643