Fluoride-mediated elimination of allyl sulfones: Application to the synthesis of a 2,4-dimethyl-A-ring vitamin D3 analogue

Article abstract of DOI:10.1021/jo300672a

A coupling strategy for the synthesis of 2,4-dimethyl-1α,25(OH) ₂D₃ is achieved which involves methylation of a pro-A ring vinyl sulfone and in situ traping of the allyl sulfonyl anion with a CD ring allyl chloride. TBAF-promoted 1,2-eliminative desulfonylation and concomitant silyl ether deprotection gives the vitamin D₃ analogue.

Full text of DOI:10.1021/jo300672a

Article
pubs.acs.org/joc
Fluoride-Mediated Elimination of Allyl Sulfones: Application to the
Synthesis of a 2,4-Dimethyl-A-ring Vitamin D3 Analogue
Vikas Sikervar,† James C. Fleet,‡ and Philip L. Fuchs*,†
‡
†Department of Chemistry and Department of Foods and Nutrition Chemistry, Purdue University, West Lafayette, Indiana 47907,
United States
S
* Supporting Information
ABSTRACT: A coupling strategy for the synthesis of 2,4-dimethyl-1α,25(OH)2D3 is achieved which involves methylation of a
pro-A ring vinyl sulfone and in situ traping of the allyl sulfonyl anion with a CD ring allyl chloride. TBAF-promoted 1,2-
eliminative desulfonylation and concomitant silyl ether deprotection gives the vitamin D3 analogue.
This paper describes a convergent approach for synthesis of a
variety of vitamin D analogues bearing A-ring modifications
with substitution at the 2- and 4-positions. The synthetic
strategy exploits cyclohexenyl sulfone chemistry8 in combina-
tion with a CD ring allyl chloride (Scheme 1). Since the β-chair
INTRODUCTION
■
1,25-Dihydroxyvitamin D3 [1α,25(OH)2D3], the biologically
most active metabolite of vitamin D3, is involved in the
regulation of calcium homeostasis and bone metabolism. In
addition, it suppresses the growth of numerous human cancer
cell lines by inhibiting cell cycle progression and inducing cell
death.1 Several studies have revealed that these biological
functions are mediated through binding of 1α,25(OH)2D3 to
the vitamin D receptor (VDR),2 a nuclear protein which belongs
to the nuclear receptor superfamily.3
Scheme 1. Widely Used Approaches for Making
1α,25(OH)2D3 and the Purdue Strategy for Dimethyl
1α,25(OH)2D3
More than 2000 analogues of vitamin D3 have been syn-
thesized because of the potential therapeutic application of
1α,25(OH)2D3 and its analogues in the treatment of cancer and
other proliferative diseases. Its properties in modulating cell
differentiation, inhibiting cell proliferation, and regulating
apoptosis make it an important candidate for the treatment
of cancer. 1α,25(OH)2D3 and some of its analogues are on the
market or are in clinical trials.4 Several laboratories over the last
three decades have worked on the development of different
pathways to generate analogues of 1α,25(OH)2D3. General
synthetic approaches for vitamin D can be categorized into
three types. The first pathway involves biogenetic photo-
chemical ring-opening of steroid precursors,5 which is not well-
suited for synthesis of analogues. A convergent approach
featuring formation of the triene via an ene−yne A-ring synthon
was developed by Trost and is widely employed for the
analogue synthesis.6 A classical approach involves coupling a
preformed A ring with the CD ring system. The most popular
A+CD strategy employs a Horner coupling developed by
Lythgoe,7 although this route suffers due to the number of steps
required for preparation of A-ring synthons.
is deemed responsible for biological activity of 1α,25(OH)2D3,9
two dimethyl analogues of 1α,25(OH)2D3 were desired for
evaluation (targets A and B), one with a conformationally fixed
β-chair and the other with an α-chair similarly locked by 1,3
diaxial methyl interactions.9
Received: April 9, 2012
Published: April 25, 2012
© 2012 American Chemical Society
5132
dx.doi.org/10.1021/jo300672a | J. Org. Chem. 2012, 77, 5132−5138

The Journal of Organic Chemistry
Article
Scheme 2. Synthesis of CD Allyl Chloride 7
RESULTS AND DISCUSSION
Scheme 3. Methylation of Vinyl Sulfones 6 and 14
■
CD segment 7 was synthesized from Grundman’s ketone 8,
which was obtained from the known oxidative cleavage of
vitamin D (Scheme 2).10 DMDO is known to effect the C-25
hydroxylation11 but is slow (48 h), whereas preformed TFDO12
requires 16 h for reaction and its synthetic preparation and
isolation is tedious considering the volatility of this dioxirane. In
situ TFDO generated from Oxone and 1,1,1-trifluoroacetone is
far more convenient, affording 9 in 6 h at 10 °C. The silyl ether
protection of 9 proceeds in high yield, and Peterson olefination
of ketone 1013 and reduction of vinyl ester using DIBAL-H
smoothly provided E-allyl alcohol 11. E-Allyl chloride 7 was
obtained from alcohol 11 using the Appel reaction.14
Conjugate methylation of vinyl sulfone 69 did not proceed
using mild reagents (Me2TiCl, AlMe3, LiAlMe4, MeMgBr,
MeMgCl, MeCeCl2) (Scheme 3). However, addition of 1.05
equiv of MeLi to the vinyl sulfone 6 at room temperature gave
allyl sulfone 12 in 66% yield.15 To establish the stereochemistry
of the methylation, hydroxy-directed methylation of vinyl
sulfone 149 using MeMgCl was also performed.16 Allyl sulfone
15 was obtained in 73% yield after silyl ether protection.15
Reductive desulfonylation of allyl sulfones 12 and 15 using
sodium in ethanolic THF17 gave the corresponding function-
alized cyclohexene derivatives 13 and 16, respectively. No
common peaks were seen in the NMR spectra of 13 and 16
establishing >95% diastereoselectivity in each of the individual
methylation reactions.
To effect the one-pot synthesis of target A, the following
procedure was established. Vinyl sulfone 6 was treated
with 1.05 equiv of MeLi which, as shown above, led to
the installation of a methyl group at the 4-position. The
allylsulfonyl anion 6a thus created was treated at room
temperature with 1.1 equiv of CD ring allyl chloride 7 to
give the coupled product 6b. In the same pot, 20 equiv of
commercial TBAF/THF was added, followed by heating at
60 °C for 6 h. Triene A was isolated through this procedure in
25% yield (Scheme 4).
There are numerous examples of fluoride-mediated 1,2- and
1,4-eliminations of β-silyl sulfones18 and β-silyl azides,19 which
proceed via fluorosiliconate intermediates. Similarly, formation
of 1,3-dienes and 1,3,5-trienes via Julia-type KO-t-Bu
elimination of phenylsulfinic acid is also well-known.20 TBAF
and related fluoride source have been used for the various
coupling reactions where they act as a source of catalytic
base21−23 and β-elimination of mesylates;24 Cl, Br, and I using
such reagents (KF, CsF, TEAF) also have been reported.23 It
was envisioned that the nucleophilic/basic nature of TBAF
could be used for the installation of triene unit and as well as
the deprotection of the silyl groups. In the event, using 20 equiv
of TBAF led to the β-elimination of phenylsulfinate and thus
completed the synthesis of the target A.
5133
dx.doi.org/10.1021/jo300672a | J. Org. Chem. 2012, 77, 5132−5138

The Journal of Organic Chemistry
Article
Scheme 4. Synthesis of Target A
Target B could similarly be prepared from A-ring vinyl
sulfone 17 following Schemes 3 and 4 (Scheme 5). The
synthesis of vinyl sulfone 17 has been previously reported from
our group.9
responsive vitamin D regulated gene is for the enzyme CYP24
(a cytochrome P450 family member called 25 hydroxyvitamin
D, 24 hydroxylase); this is expressed in both cell lines. In
SW480-ADH cells, calcitriol treatment also induces expression
of E-cadherin, a tight junction protein that is a marker of cell
differentiation. At 1 nM and 10 nM target A was found to be
less potent than 1,25 dihydroxyvitamin D3, but at 100 nM
target A had the same activity as 1α,25(OH)2D3 in Caco-2 cell
lines and was found to have twice the activity for cell
differentiation in SW480-ADH cell lines.
Scheme 5. Proposed Synthesis of Target B
In summary, we have reported a highly convergent synthesis
of target A which looks reasonable for the synthesis of Vitamin
D3 analogs with functionalization in the A-ring. Target A was
found to be twice as active as 1α,25(OH)2D3 in cell
differentiation in SW480-ADH cell lines.
EXPERIMENTAL SECTION
■
General Methods. Tetrahydrofuran (THF) was distilled from
benzophenone ketyl. Sodium sulfate (Na2SO4) was anhydrous. Unless
otherwise indicated, all reactions were carried out under in a positive
pressure of argon in anhydrous solvents and the reaction flasks were
fitted with rubber septa for the introduction of substrates and reagents
via syringe. Progress of reactions was monitored by thin-layer
chromatography (TLC) using silica gel plates. The TLC plates were
The impact target A on the expression of vitamin D-
responsive genes in two human colon cancer cell lines
was examined: Caco-2 cells and SW480-ADH (Figure 1).
These cells respond to 1,25-dihydroxyvitamin D3 treatment
by inducing the expression of various target genes. The most
Figure 1. Effect of target A on expression of two vitamin D responsive genes in the human colonic carcinoma cell lines, Caco-2 and SW-480ADH:
(A) CYP24 mRNA in Caco-2, (B) CYP24 mRNA in SW480-ADH, (C) E-cadherin mRNA in SW480-ADH. Cells were treated for 6 h with varying
doses of vitamin D compounds or with concentration matched ethanol vehicle (EtOH). RNA was isolated and analyzed by real time-PCR. Data are
normalized to the expression of the control gene RPLPO. Bars represent the mean SEM.
5134
dx.doi.org/10.1021/jo300672a | J. Org. Chem. 2012, 77, 5132−5138

The Journal of Organic Chemistry
Article
visualized with a UV lamp (254 nm) and/or with TLC visualizing
solutions activated with heat. The two commonly employed TLC
visualizing solutions were: (i) p-anisaldehyde solution (1350 mL
of absolute ethanol, 50 mL of concentrated H2SO4, 37 mL of
p-anisaldehyde) and (ii) permanganate solution (weight percents of
1% KMnO4 and 2% Na2CO3 in water).
27.3, 23.8, 20.4, 18.8, 18.4, 12.1, 6.8, 6.6; HRMS (EI/CI)
calculated for C24H46O2Si (M + H) 395.3345, found
395.3348.
Preparation of (E)-2-((1R,3aS,7aR)-7a-Methyl-1-((R)-6-methyl-6-
((triethylsilyl)oxy)heptan-2-yl)hexahydro-1H-inden-4(2H)-ylidene)-
ethanol (11).
1H NMR and 13C NMR spectra were recorded on 300−500 MHz
spectrometers. The NMR spectra were determined in CDCl3 solution.
Peak multiplicities in 1H NMR spectra, when reported, are abbreviated
as s (singlet), d (doublet), t (triplet), m (multiplet), and/or quint
(quintet). The mass analyzer instrument was calibrated to a resolution
on 10,000 with a 10% valley between peaks using the appropriate
perfluorokerosene standard. Electrospray ionization high resolution
mass measurements utilized the appropriate polypropylene glycol
standards. The mass analyzer used is a double-focusing sector mass
spectrometer.
BuLi (4.76 mmol, 1.9 mL) was added dropwise to a solution
of diisopropylamine (4.76 mmol, 0.67 mL) in THF (3 mL) at
0 °C, and the reaction mixture was stirred for 30 min and then
cooled to −78 °C. Ethyl (trimethylsilyl)acetate (7.20 mmol,
1.3 mL) was added dropwise, and the resulting yellow solution
was allowed to warm to −20 °C gradually over 1 h. The
solution was then cooled to −78 °C, ketone 10 (550 mg, 1.40
mmol) dissolved in THF (15 mL) was added, and the solution
was brought to room temperature and stirred for 8 h. The
reaction was quenched by addition of water (20 mL) and
extracted with ethyl acetate (30 mL). The organic layer was
separated, washed with brine, and dried over sodium sulfate.
The organic layer was filtered and concentrated on a rotovap to
give a dark orange oil. The oil was dissolved in toluene (30 mL)
and cooled to −78 °C. DIBAL-H (5.6 mmol, 3.7 mL) was
added and the reaction mixture stirred for 1.5 h and then
quenched by addition of water (20 mL). The solution was
diluted with EtOAc (30 mL) and the organic layer separated,
washed with brine, and dried over sodium sulfate. The organic
layer was filtered, concentrated, and purified on silica gel using
EtOAc/hexane (1:1) to give allyl alcohol 11 (425 mg, 72%) as
Preparation of (1R,3aR,7aR)-1-((R)-6-Hydroxy-6-methylheptan-
2-yl)-7a-methylhexahydro-1H-inden-4(2H)-one (9).
Grundman’s ketone 8 (60 mg, 0.23 mmol) was dissolved in
1 mL of CH3CN/H2O (10:1) and cooled to 8−10 °C. 1,1,1-
Trifluoroacetone (2.3 mmol, 0.2 mL) was added followed
by mixture of Oxone (424 mg, 0.69 mmol) and NaHCO3
(116 mg, 1.38 mmol) in small portions over a period of 6 h.
The reaction mixture was diluted with 5 mL of water and
extracted with dichloromethane (10 mL). The combined
extracts were washed with brine, dried over sodium sulfate,
filtered, and concentrated under vacuum. The residues were
purified on silica gel using ethyl acetate/hexane (1:1) to
1
give the ketone 9 as colorless oil in 65% yield: H NMR
(CDCl3, 300 MHz) 2.26 (2H, m), 2.10- 1.09 (17 H, m), 1.039
(6H, s), 0.79 (3H, d, J = 6 Hz), 0.46 (3H, s); 13C NMR
(CDCl3, 75 MHz) δ 211.7, 70.2, 61.4, 56.1, 49.5, 43.8, 40.4,
38.4, 35.8, 35.0, 28.9, 28.7, 27.0, 23.6, 20.3, 18.6, 18.2, 12.0;
HRMS (EI/CI) calcd for C18H32O2 (M − H2O)+ 262.2297,
found 262.2296.
Preparation of (1R,3aR,7aR)-7a-Methyl-1-((R)-6-methyl-6-
((triethylsilyl)oxy)heptan-2-yl)hexahydro-1H-inden-4(2H)-one (10).
1
a colorless oil: H NMR (CDCl3, 300 MHz) 5.20 (1H, t, J =
7 Hz), 4.22 (1H, s), 2.61 (1H, m), 2.03−1.87 (3H, m), 1.70−
0.92 (28H, m), 0.53 (6H, m); 13C NMR (CDCl3, 75 MHz) δ
143.4, 119.1, 73.3, 58.4, 56.5, 55.5, 45.4, 45.2, 40.3, 36.3, 36.0,
29.9, 29.7, 28.6, 27.5, 23.4, 22.1, 20.7, 18.7, 11.7, 7.0, 6.7;
HRMS (CI) calcd for C26H50O2Si (M + H − H2O) 405.3553,
found 405.3546.
Preparation of (((R)-6-((1R,3aS,7aR,E)-4-(2-Chloroethylidene)-7a-
methyloctahydro-1H-inden-1-yl)-2-methylheptan-2-yl)oxy)-
triethylsilane (7).
Ketone 9 (700 mg, 2.5 mmol) was dissolved in CH2Cl2 (200
mL) and cooled to −78 °C. 2,6-Lutidine (803 mg, 0.87 mL, 7.5
mmol) was added followed by TESOTf (0.79 mL, 3.5 mmol).
The reaction mixture was stirred for 25 min and then quenched
by adding water (30 mL). The organic layer was separated and
dried over sodium sulfate. The organic layer was filtered and
concentrated using a rotovap. The residue was purified on
silica gel using 15% ethyl acetate/hexane to give 886 mg (90%)
Allyl alcohol 11 (100 mg, 0.24 mmol) was dissolved in CCl4
(10 mL) and cooled to 0 °C. Pyridine (0.71 mmol, 57 μL) was
added followed by PBu3 (1.2 mmol, 0.3 mL) and the reaction
mixture stirred for 2 h. Pentane (10 mL) was then added
resulting in the formation of white precipitate which was
filtered and filtrate concentrated under vacuum. The residue
was purified on silica gel using pentane to give allyl chloride 7
(98%, 103 mg) as a colorless oil: 1H NMR (CDCl3, 300 MHz)
5.21 (1H, t, J = 8 Hz), 4.13 (1H, d, J = 8 Hz), 2.64 (1H, m)
1
of ketone 10 as a colorless oil: H NMR (CDCl3, 300 MHz)
2.31 (2H, dd, J = 8 Hz, 11 Hz), 2.20−1.16 (25 H, m),
1.09 (6H, s), 0.84 (4H, t, J = 8 Hz), 0.54 (3H, s), 0.42 (6H, q,
J = 7 Hz); 13C NMR (CDCl3, 75 MHz) δ 211.3, 73.0,
61.7, 56.5, 49.6, 45.2, 40.7, 38.8, 36.0, 35.3, 29.7, 29.5,
5135
dx.doi.org/10.1021/jo300672a | J. Org. Chem. 2012, 77, 5132−5138

The Journal of Organic Chemistry
Article
Preparation of (((1S,2S,3S,4R)-2,4-Dimethyl-6-methylene-5-
(phenylsulfonyl)cyclohexane-1,3-diyl)bis(oxy))bis(tert-butyldime-
thylsilane) (12).
Table 1. Caco-2 Summary
treatment
ethanol
1 nM
1.00
SEM
0.08
10 nM
0.92
SEM
0.10
100 nM
1.19
SEM
0.20
1,25D
233.31
1.19
57.10
0.07
1479.96
148.63
305.84
8.62
1417.24
1462.80
216.53
120.34
target A
2.04−1.19 (22H, m), 0.929 (16H, t, J = 8 Hz), 0.53 (12H, m);
13C NMR (CDCl3, 75 MHz) δ 146.7, 115.9, 73.3, 56.4, 55.5,
45.7, 45.4, 40.5, 40.1, 36.2, 35.9, 29.9, 29.7, 28.4, 27.5, 23.3,
21.9, 20.7, 18.7, 11.6, 7.0, 6.7; HRMS (EI) calcd for
C25H46ClOSi (M+) 425.3006, found 425.3002.
Preparation of (((1S,2S,3S,4S)-2,4-Dimethyl-6-methylene-5-
(phenylsulfonyl)cyclohexane-1,3-diyl)bis(oxy))bis(tert-butyldime-
thylsilane) (15).
Vinyl sulfone 6 (50 mg, 0.098 mmol) was dissolved in THF
(0.15 mL), and MeLi (0.103 mmol, 34 μL) was added dropwise
at room temperature. The reaction was quenched by addition
of water (30 μL) after 3 h and loaded directly on silica gel and eluted
with 1:10 ethyl acetate/hexane to give allyl sulfone 12 (34 mg)
1
in 66% yield as a colorless oil: H NMR (CDCl3, 300 MHz):
7.81 (2H, d, J = 6 Hz), 7.47 (3H, m), 5.28 (1H, s), 5.24 (1H, s),
4.37 (1H, s), 3.51 (1H, dd, J = 3 Hz, 6 Hz), 2.87 (1H, m), 2.00
(1H, m), 0.97 (9H, s), 0.94 (9H, s), 0.93 (3H, d, J = 6 Hz), 0.79
(3H, d, J = 6 Hz), 0.13 (6H, s), 0.10 (6H, s); 13C NMR (CDCl3,
75 MHz) δ 138.5, 133.1, 129.0, 128.5, 128.4, 117.6, 78.0, 74.4, 68.0,
44.5, 35.1, 25.8, 20.4, 18.1, 11.5, −4.7, −4.9, −5.1; HRMS (ESI)
calcd for C27H48O4SSi2 (M + Na) 547.2710, found 547.2707.
Reductive Desulfonylation of Allyl Sulfone 12.
Vinyl sulfone 14 (50 mg, 0.13 mmol) was dissolved in toluene
(0.2 mL) and cooled to −10 °C. MeMgCl (0.286 mmol, 95 μL),
3 M in THF, was added dropwise and the resulting dark
yellow solution warmed to room temperature and stirred for
4 h. The reaction was quenched by addition of water (3 mL)
and extracted with ether (10 mL). The organic layer was
washed with brine, dried over sodium sulfate, and concentrated
to give a colorless residue. The residue was dissolved in CH2Cl2
(1 mL) and triethylamine (0.195 mmol, 27 μL) followed by
TBSOTf (0.143 mmol, 33 μL) was added and the reaction
stirred for 1 h. The reaction mixture was quenched by addition
of water (3 mL) and diluted with CH2Cl2 (10 mL). The
combined extracts were washed with brine, dried over
magnesium sulfate, filtered, and concentrated under vacuum.
The residue was purified on silica gel using 1:5 ethyl acetate/
hexane to give the allyl sulfone 15 in 73% yield (48 mg) as a
Allyl sulfone 12 (30 mg, 0.057 mmol) was dissolved in THF/
EtOH (3 mL, 5:1). The solution was cooled to 0 °C, and Na
(13 mg, 0.57 mmol) was added. The reaction mixture was stirred
for 8 h at room temperature, and excess sodium was quenched
using CH3OH until the H2 evolution ceased. The solution was
concentrated and loaded on the silica gel column. Flash column
chromatography using hexane mixture gave the alkene 13 as a
colorless oil in 45% yield (10 mg): 1H NMR (CDCl3, 300 MHz)
5.14 (1H, dd, J = 2 Hz, 2.4 Hz), 4.02 (1H, d, J = 3 Hz), 3.47 (1H,
dd, J = 7 Hz, 8 Hz), 2.03(2H, m), 1.70 (3H, s), 1.04 (3H, d, J =
7 Hz), 0.94 (3H, d, J = 7 Hz), 0.91 (18 H, s), 0.08 (6H, s), 0.06
(6H, s); 13C NMR (CDCl3, 75 MHz) δ 134.3, 128.3, 75.6, 73.4,
42.4, 40.4, 26.0, 21.2, 19.6, 18.2, 14.4, −3.7, −3.9; HRMS (CI) calcd
for C21H44O2Si2 (M + ) 384.2880, found 384.2882.
1
colorless oil: H NMR (CDCl3, 300 MHz) 7.92 (2H, d, J = 6
Hz), 7.51 (3H, m), 4.36 (1H, dd, J = 3 Hz, 9 Hz), 4.22 (1H, d,
J = 3 Hz), 3.67 (1H, d, J = 3 Hz), 2.32 (1H, m), 1.77 (1H, m),
0.95 (9H, s), 0.92 (9H, s), 0.91 (3H, d, J = 6 Hz), 0.83
(3H, d, J = 6 Hz), 0.14 (3H, s), 0.12 (3H, s), 0.08 (3H, s),
0.07 (3H, s); 13C NMR (CDCl3, 75 MHz) δ 141.2, 138.5,
132.9, 128.9, 128.1, 121.1, 75.3, 72.5, 70.6, 39.5, 35.5, 26.0,
25.9, 18.3, 18.0, 13.9, 13.5, −4.1, −4.5, −4.6, −4.8; HRMS
(ESI) calcd for C27H48O4SSi2 (M + Na) 547.2710, found
547.2706.
Reductive Desulfonylation of Allyl Sulfone 15.
Table 2. SW480 ADH Summary
CYP24
E-cadherin
compd
ethanol
dose (nM)
mean
1.00
SD
SEM
mean
SD
SEM
1
10
100
1
0.15
0.19
0.08
0.09
1.00
1.07
1.07
6.57
11.36
4.97
2.43
0.07
0.43
0.37
0.99
2.65
1.16
0.57
0.03
0.22
0.18
0.50
1.32
0.58
0.28
1.03
1.12
0.71
0.35
1,25(OH)2 D
target A
653.35
1380.02
634.80
24.16
92.18
211.28
257.35
8.00
46.09
105.64
128.68
4.00
10
100
1
10
282.53
86.34
43.17
4.57
8.29
1.40
2.61
0.70
1.51
100
1214.95
451.17
260.48
5136
dx.doi.org/10.1021/jo300672a | J. Org. Chem. 2012, 77, 5132−5138

The Journal of Organic Chemistry
Article
the vitamin D compounds. Six hours after the treatment started, the
medium was removed and cells were harvested directly into TriReagent
(Molecular Research Center, Inc., Cincinnati, OH). RNA was isolated,
converted to cDNA, and analyzed by real-time PCR for mRNA levels for
the two target genes using methods previously described.26 Data were
normalized to the expression level of the control gene RPLP0. Primers for
human CYP24 and RPLPO have been described previously,27 and the
primers for E-cadherin are as follows: forward, 5′GATTGCAAA-
Allyl sulfone 15 (30 mg, 0.057 mmol) was dissolved in THF/
EtOH (3 mL, 5:1). The solution was cooled to 0 °C, and Na
(13 mg, 0.57 mmol) was added. The reaction mixture was
stirred for 8 h at room temperature, and excess sodium was
quenched using CH3OH until the H2 evolution ceased. The
solution was concentrated and loaded on the silica gel column.
Flash column chromatography using hexane mixture gave the
1
5
TTCCTGCCATT3′; reverse, ′GCTGGCTCAAGTCAAAGTCC3′.
alkene 16 as colorless oil in 76% yield (16 mg): H NMR
(CDCl3, 300 MHz) 5.08 (1H, s), 4.34 (1H, s), 3.76 (1H, t, J =
6 Hz), 2.30 (1H, m), 2.03 (1H, m), 1.69 (3H, s), 0.87 (m,
24H), 0.06 (12H); 13C NMR (CDCl3, 75 MHz) δ 134.1, 126.0,
74.4, 71.1, 40.2, 32.5, 25.9, 20.7, 18.2, 18.1, 16.2, 12.0, −4.1,
−4.5, −4.7; HRMS (CI) calcd for C21H44O2Si2 (M + H)
384.2880, found 384.2882.
ASSOCIATED CONTENT
■
S
* Supporting Information
1H/ 13C NMR spectra of all new compounds. This material is
available free of charge via the Internet at http://pubs.acs.org.
One-Pot Synthesis of (1S,2S,3R,4S,Z)-5-((E)-2-((1R,3aS,7aR)-1-
((R)-6-Hydroxy-6-methylheptan-2-yl)-7a-methylhexahydro-1H-
inden-4(2H)-ylidene)ethylidene)-2,4-dimethyl-6-methylenecyclo-
hexane-1,3-diol (Target A).
AUTHOR INFORMATION
■
Corresponding Author
*E-mail: pfuchs@purdue.edu.
Notes
The authors declare no competing financial interest.
REFERENCES
■
(1) (a) Vitamin D; Feldman, D., Glorieux, F. H., Pike, J. W., Eds.;
Academic Press: New York, 1997. (b) Bouillon, R.; Okamura, W. H.;
Norman, A. W. Endocr. Rev. 1995, 16, 200.
(2) Malloy, P. J.; Pike, J. W.; Feldman, D. Endocr. Rev. 1999, 20,
156−188.
(3) Evans, R. M. Science 1988, 240, 889−895.
(4) Plum, L. A.; DeLuca, H. F. Nature Rev. Drug Discovery 2010, 9,
941−955.
(5) Barton, D. H. R.; Hesse, R. H.; Pechet, M. M.; Rizzardo, E. J. Am.
Chem. Soc. 1973, 95, 2748−2749.
(6) Trost, B. M.; Dumas, J. J. Am. Chem. Soc. 1992, 114, 1924.
(7) Lythgoe, B.1; Moran, T. A.; Nambudhy, M. E. N.; Ruston, S.;
Tideswell, J.; Wright, P. W. Tetrahedron Lett. 1975, 3863−3866.
(8) El-Awa, A.; Noshi, M. N.; Jourdin, X. M.; Fuchs, P. L. Chem. Rev.
2009, 109, 2315.
Vinyl sulfone 6 (30 mg, 0.098 mmol) was dissolved in THF
(0.15 mL), and MeLi (0.103 mmol, 34 μL) was added dropwise
at room temperature. After the red solution was stirred for 3 h,
allyl chloride 7 (0.108 mmol, 47 mg) dissolved in 0.15 mL of
HMPA was added and reaction mixture stirred for another 6 h.
H2O (10 μL) and THF (3 mL) were added followed by TBAF
(2 mL, 0.98 mmol) and 1 M solution in THF, and the solution
was heated to 60 °C. After 8 h of heating, the reaction mixture
was diluted with NaHCO3 (1 mL) and extracted with CH2Cl2
(10 mL). The combined extracts were washed with brine, dried
over sodium sulfate, filtered, and concentrated under vacuum.
The residues were purified on silica gel using ethyl acetate/
hexane (1:1) to give target A as a colorless oil in 25%
(9) Sikervar, V.; Fuchs, P. L. Chem. Commun. 2011, 47, 3472.
(10) Sardina, F. J.; Mourino, A.; Castedo, L. J. Org. Chem. 1986, 51,
̃
1264−1268.
(11) Bovicelli, P.; Lupattelli, P.; Mincione, E. J. Org. Chem. 1992, 57,
5052−5054.
(12) Gomez-Reino, C.; Vitale, C.; Maestro, M.; Mourino, A. Org.
Lett. 2005, 7, 5885−5887.
(13) Yoshida, A.; Ono, K.; Suhara, Y.; Saito, N.; Takayama, H.;
Kittaka, A. Synlett 2003, 8, 1175−1179.
1
yield (9.5 mg): H NMR (CDCl3, 400 MHz) 6.46 (1H, d, J =
(14) Appel, R. Angew. Chem. Int. Ed 2003, 14, 201 The
corresponding allyl bromide is unstable and sufffers elimination to
the C4 exocyclic diene both during storage and attempted coupling
with α-sulfonyl anions.
12 Hz), 6.01 (1H, d, J = 12 Hz), 5.23 (1H, s), 4.89
(1H, s), 4.16 (1H, s), 3.25 (1H, t, J = 8 Hz), 2.84 (1H, dd,
J = 12 Hz, 4 Hz), 2.23−0.93 (35H, m), 0.53 (3H, s); 13C NMR
(CDCl3, 125 MHz) δ 147.6, 143.4, 137.5, 121.9, 117.2, 113.9,
77.7, 71.1, 56.5, 56.4, 46.1, 45.8, 44.8, 44.3, 40.5, 36.4, 36.1,
29.4, 29.2, 29.1, 27.7, 23.4, 22.2, 20.9, 18.8, 14.2, 13.9, 12.1;
HRMS (ESI) calcd for C29H48O3 (M + Na) 467.3501, found
467.3496.
Cell Culture Experiment. Cells were seeded in 12-well dishes
(100,000 cells/well for Caco-2; 50000 cells/well for SW480-ADH)
and studied when they reached 70−80% confluence (3 days in culture).
Cells were treated with 1,25-dihydroxyvitamin D or analogues in high
glucose DMEM supplemented with Pen/Strep but without fetal
bovine serum (FBS) (Tables 1 and 2). Cell culture conditions have
been previously described.25 Vitamin D compounds were diluted in
ethanol and used at three concentrations: 1, 10, and 100 nM. Ethanol
control groups were included for all of the three treatments but total
ethanol levels in the medium were 0.001, 0.01, and 0.1% for the three
treatment groups, respectively. Four replicate wells were used for each of
(15) The stereochemistry of the C-5 sulfone stereocenter in allyl
sulfone 12 and 15 is unknown but inconsequential in the synthesis.
(16) Noshi, M. N.; El-Awa, A. J. Org. Chem. 2008, 73, 3274−
3277.
(17) Masaki, Y.; Serizawa, Y.; Nagata, K.; Kaji, K. Chem. Lett. 1984,
2105−2108.
(18) (a) Kocienski, P. J. Tetrahedron Lett. 1979, 79, 2649−
2650. (b) Metz, P.; Seng, D.; Plietker, B. Tetrahedron Lett. 1996, 37,
3841−3844. (c) Meagher, T. P.; Yet, L.; Hsiao, C.-N.; Shechter, H. J.
Org. Chem. 1998, 63, 4181−4192. (d) Meagher, T. P.; Shechter, H. J.
Org. Chem. 1998, 63, 4193−4198.
(19) Chabaud, L.; Landais, Y. Tetrahedron Lett. 2003, 44, 6995−
6998.
(20) (a) du Penhoat, C. H.; Julia, M. Tetrahedron 1986, 42, 4807.
(b) Chemla, F.; Julia, M.; Uguen, D. Bull. Soc. Chim. Fr. 1993, 130,
200. (c) Sato, T.; Okura, S.; Otera, J.; Nozaki, H. Tetrahedron Lett.
5137
dx.doi.org/10.1021/jo300672a | J. Org. Chem. 2012, 77, 5132−5138

The Journal of Organic Chemistry
Article
1987, 28, 6299. (d) El-Awa, A.; Noshi, M. N.; Mollat du Jourdin, X.;
Fuchs, P. L. Chem. Rev. 2009, 109, 2315−2349.
(21) Fringuelli, F.; Lanari, D.; Pizzo, F.; Vaccaro, L. Eur. J. Org. Chem.
2008, 3928−3932.
(22) Wilkinson, J. A. Chem. Rev. 1992, 92, 505−519.
(23) Clark, J. H. Chem. Rev. 1980, 80, 429−452.
(24) Nakahara, Y.; Shimizu, M.; Yoshioka, H. Tetrahedron Lett. 1988,
29, 2325.
(25) Fleet, J. C.; DeSmet, M.; Johnson, R.; Li, Y. Biochem. J. 2012,
61−76.
(26) Cui, M.; Klopot, A.; Jiang, Y.; Fleet, J. C. J. Cell Physiol. 2009,
113.
(27) Kovalenko, P. L.; Zhang, Z.; Cui, M.; Clinton, S. K.; Fleet, J. C.
BMC Genomics 2009, 11, 26.
5138
dx.doi.org/10.1021/jo300672a | J. Org. Chem. 2012, 77, 5132−5138