Selective G-quadruplex DNA recognition by a new class of designed cyanines

Article abstract of DOI:10.3390/molecules181113588

A variety of cyanines provide versatile and sensitive agents acting as DNA stains and sensors and have been structurally modified to bind in the DNA minor groove in a sequence dependent manner. Similarly, we are developing a new set of cyanines that have been designed to achieve highly selective binding to DNA G-quadruplexes with much weaker binding to DNA duplexes. A systematic set of structurally analogous trimethine cyanines has been synthesized and evaluated for quadruplex targeting. The results reveal that elevated quadruplex binding and specificity are highly sensitive to the polymethine chain length, heterocyclic structure and intrinsic charge of the compound. Biophysical experiments show that the compounds display significant selectivity for quadruplex binding with a higher preference for parallel stranded quadruplexes, such as cMYC. NMR studies revealed the primary binding through an end-stacking mode and SPR studies showed the strongest compounds have primary KD values below 100 nM that are nearly 100-fold weaker for duplexes. The high selectivity of these newly designed trimethine cyanines for quadruplexes as well as their ability to discriminate between different quadruplexes are extremely promising features to develop them as novel probes for targeting quadruplexes in vivo.

Full text of DOI:10.3390/molecules181113588

Molecules 2013, 18, 13588-13607; doi:10.3390/molecules181113588
OPEN ACCESS
molecules
ISSN 1420-3049
www.mdpi.com/journal/molecules
Article
Selective G-Quadruplex DNA Recognition by a New Class of
Designed Cyanines
Rupesh Nanjunda 1,2, Eric A. Owens 1,2, Leah Mickelson 1, Tyler L. Dost 1, Ekaterina M. Stroeva 1,
Hang T. Huynh 1, Markus W. Germann 1,3,*, Maged M. Henary 1,2,* and W. David Wilson 1,2,
*
1
Department of Chemistry, Georgia State University, 50 Decatur St., Atlanta, GA 30303, USA;
E-Mails: rnanjunda@gsu.edu (R.N.); eowens9@student.gsu.edu (E.A.O.);
lmickelson1@student.gsu.edu (L.M.); tdost1@student.gsu.edu (T.L.D.);
estroeva1@student.gsu.edu (E.M.S.); hhuynh8@student.gsu.edu (H.T.H.)
2
Center for Diagnostics and Therapeutics, Georgia State University, 100 Piedmont Ave SE,
Atlanta, GA 30303, USA
3
Department of Biology, Georgia State University, 495 Petit Science Center, 100 Piedmont Ave.,
Atlanta, GA 30303, USA
* Authors to whom correspondence should be addressed; E-Mails:
mwg@gsu.edu (M.W.G.); mhenary1@gsu.edu (M.M.H.); wdw@gsu.edu (W.D.W.);
Tel.: +1-404-413-5561 (M.W.G.); +1-404-413-5566 (M.M.H.); +1-404-413-5503 (W.D.W.);
Fax: +1-404-413-5505 (M.W.G.; M.M.H. & W.D.W.).
Received: 30 August 2013; in revised form: 26 October 2013 / Accepted: 29 October 2013 /
Published: 4 November 2013
Abstract: A variety of cyanines provide versatile and sensitive agents acting as DNA
stains and sensors and have been structurally modified to bind in the DNA minor groove in
a sequence dependent manner. Similarly, we are developing a new set of cyanines that
have been designed to achieve highly selective binding to DNA G-quadruplexes with much
weaker binding to DNA duplexes. A systematic set of structurally analogous trimethine
cyanines has been synthesized and evaluated for quadruplex targeting. The results reveal
that elevated quadruplex binding and specificity are highly sensitive to the polymethine
chain length, heterocyclic structure and intrinsic charge of the compound. Biophysical
experiments show that the compounds display significant selectivity for quadruplex
binding with a higher preference for parallel stranded quadruplexes, such as cMYC. NMR
studies revealed the primary binding through an end-stacking mode and SPR studies
showed the strongest compounds have primary KD values below 100 nM that are nearly
100-fold weaker for duplexes. The high selectivity of these newly designed trimethine

Molecules 2013, 18
13589
cyanines for quadruplexes as well as their ability to discriminate between different
quadruplexes are extremely promising features to develop them as novel probes for
targeting quadruplexes in vivo.
Keywords: G-quadruplex; cyanines; c-myc; telomere; end-stacking; halogenation;
nuclear magnetic resonance; surface plasmon resonance; thermal melting
1. Introduction
G-quadruplexes are higher order DNA structures formed by either intra- or intermolecular
association of guanine-rich sequences into a stacked array of G-tetrads and stabilized by Hoogsteen
hydrogen bonds as well as coordinated monovalent cations [1,2]. The formation and stabilization of
these unique structural motifs are implicated in diverse biological functions such as gene regulation
and chromosomal stability [3,4], therefore, these structures have garnered immense interest as a
viable platform for the development of quadruplex-specific small-molecule drugs for therapeutic
purposes [5,6]. Furthermore, with the recent exciting evidence showing the formation of
G-quadruplexes during various stages of mammalian cell cycle in vivo as well as convincing evidence
that small molecules can indeed induce and stabilize quadruplexes in vivo, these unique structures are
undoubtedly novel and promising targets for the design and development of anticancer therapeutic
agents using small molecules [7,8]. In fact, a wide range of quadruplex-specific small molecules have
been reported so far with some compounds showing very promising biological activities [9–11].
Cyanines are a class of small molecules that are being developed as potential G-quadruplex
targeting agents in addition to their wide-range of applications as cancer imaging agents and nucleic
acid stains [12,13]. The synthetic ability to structurally tailor cyanines as well as their many
therapeutically favorable features, such as low toxicity, also renders them ideal candidates for their
potential development as quadruplex targeting agents. In addition, the fluorescence properties of
cyanines have been extensively developed in understanding the structural transitions associated with
quadruplex folding/unfolding as well as in developing fluorescence agents for detecting different
quadruplex conformers in vitro [14–17]. Development of quadruplex-specific fluorescence probes with
reduced duplex affinity would significantly aid in targeting and visualization of quadruplex structures
in an otherwise duplex-enriched genomic content. Previously we had reported a new class of
indolenine scaffold based cyanine molecules with highly favorable quadruplex interactions [18]. The
pentamethine linker between the two indolenine rings provided the needed flexibility for efficient
stacking at the terminal tetrads of the quadruplex, whereas the dimethyl groups on the indolenine rings
considerably reduced the intercalation or stacking of the cyanines in the duplex minor groove. The
halogen substitutions at different positions on the aromatic core further increased their quadruplex
affinity. The highly promising results of the pentamethine cyanines as quadruplex specific agents
encouraged us to further explore the conformational space of cyanine molecules for increased
quadruplex affinity and selectivity. In the current study, a series of cyanine molecules (Figure 1) with
reduced methine linker length were synthesized to probe the effects on quadruplex binding while
maintaining the dimethyl and halogen substitutions. Using a series of powerful biophysical techniques,

Molecules 2013, 18
13590
we show that these newly designed trimethine cyanines exhibit more favorable quadruplex binding
while maintaining a very low duplex affinity. Furthermore, the compounds exhibit higher selectivity
for parallel-type quadruplex conformers. The results are highly promising and encouraging towards the
development of cyanine-based small molecules as highly specific quadruplex targeting agents.
Figure 1. Trimethine cyanine analogs used in the current study. The modifications
performed on the parent cyanine (24) are highlighted in different colors (compounds 25–32).
The detailed synthetic procedure is described in Section 4.1. All compounds have one
positive charge on the cyanine system and most have charged alkyl amine substituents. The
synthesis and characterization of the related pentamethine cyanine analogs (compounds 1–23)
are previously reported [18].
2. Results
2.1. UV-Thermal Melting Screening (Tm)
UV-Thermal melting is a rapid and robust screening technique to determine selectivity as well as to
rank the ligand-induced relative stability of quadruplex-ligand complexes [19,20]. Preliminary Tm
analysis of a synthetic set of symmetric trimethine cyanines containing different substituents on the
indolenine rings (Figure 1) were conducted with a well-characterized telomeric quadruplex sequence
(Tel22) and a control hairpin duplex sequence (AATT) that is quite favorable for detection of either
minor groove or intercalative binding to duplexes. The increase in the thermal stability of the
complexes upon ligand binding (∆Tm) at different ligand-DNA ratios is listed in Table 1. A range of
ligand-DNA mole ratios were employed to ensure saturation of binding sites on the quadruplex as well
as duplex motifs. Drug-DNA ratios beyond 6:1 resulted in inconsistent melting curves in some cases
due to possible aggregation. The trimethine-linked parent cyanine, compound 24, exhibited a favorable
increase in the thermal stability of the Tel22 sequence with increasing ratios. This increase in thermal
stability of 24 with Tel22 is slightly improved compared to the ∆Tm of a similar cyanine with a
pentamethine linker reported previously (Table 1: compare ∆ Tms of 24 and a) [18]. Replacing the

Molecules 2013, 18
13591
propyl-(trimethyl ammonium) groups on both indolenine rings of 24 with hydrophobic propyl-phenyl
groups, 26, slightly reduced the thermal stability of the Tel22 complex. A similar replacement with an
n-butyl group, 25, dramatically reduced the thermal stability of the complex compared to 24. This
suggests the importance of charge on the substituents to maintain favorable electrostatic interactions
with the backbone of the anionic quadruplex motif. While retaining the propyl-(trimethyl ammonium)
groups, various substitutions were made on the indolenine rings to probe their effect on quadruplex
binding. Substitutions with either a sulfonato (–SO3H, 27) or carboxylic acid (–COOH, 28), which
have negative charges under the experimental conditions, resulted in a minimal increase in the thermal
stability of Tel22, probably due to unfavorable electrostatic interactions with the negatively charged
backbone. In accordance with the design principles established in the previous studies to enhance
quadruplex interactions by halogenation of cyanines, systematic halogen substitutions on the
indolenine rings in the current trimethine series showed a highly favorable increase in the thermal
stability of the telomeric quadruplex (Table 1, compounds 29–32). Furthermore, the trimethine chloro
(30) and bromo (31, Figure S1) analogs showed a more favorable increase in the thermal stability of
Tel22 compared to the similar halogen-substituted pentamethine analogs (Table 1, compounds b and c).
The trimethine-linker scaffold might be a better optimized system than the pentamethine-linker
cyanines for more favorable interactions with a quadruplex unit. All the trimethine halogen derivatives,
however, exhibited very similar increases in the thermal stability of the quadruplex motif suggesting a
minimal effect of the size of the halogens.
Table 1. Tm changes of trimethine cyanine analogs with telomeric quadruplex (Tel22) and
a control duplex (AATT).
Tel22
4:1
AATT duplex
Compound/Drug:DNA Ratio
1:1
2
-
2:1
4
6:1
14
8.7
0
1:1
0
2:1
1
4:1
1
6:1
2
24
a
9
4.6
1
2.1
1
0
0
0
0
25
26
27
28
29
30
b
1
1
2
1
3
3
-
ND
ND
2
4
11
1
0
2
2
2
1
1
1
3
7
1
0
0
0
0
0
1
1
1
0
0
0
0
1
2
1
1
0
0
0
3
3
2
8
12
15
8.9
14
15.6
17
16
19
13.2
24
-
7
1
3.1
5
0.5
0
31
c
1
-
2.5
7
1.1
3
32
3
21
The thermal melting values reported are an average of two independent trials and are reproducible within
±0.5 °C. Tm values of free Tel22 and AATT are 61 °C and 66 °C respectively. ND = Not Determined.
a, b, c: ∆Tm values from previous studies for pentamethine analogs with the substitutions for a: X = H;
b: X = Cl; c: X = Br and R = TMAB in all cases [18].
One of the important features observed with these cyanine molecules is their very low binding to
duplex-DNA sequences (Table 1, ∆Tm values with a control sequence (AATT) that is quite favorable
for minor groove or intercalation binding mode). The trimethine cyanines exhibited a very

Molecules 2013, 18
13592
small-to-zero increase in the thermal stability with duplex-DNA even at relatively high ligand-DNA
ratios. Representative UV-thermal melting curves with the Tel22 quadruplex and the control duplex
are illustrated in Figure S1 for compound 31, as comparative examples of what is observed with all
compounds. The dimethyl substituents on the terminal indolenine rings, as predicted, provide the
necessary steric hindrance and reduce any possible interactions with duplex-DNA. In line with the
previous studies on pentamethine cyanines, these newly designed trimethine cyanines show an
important step in further expanding the cyanine scaffolds as a novel quadruplex-targeting class of
small molecules with reduced duplex-DNA selectivity.
2.2. Biosensor-Surface Plasmon Resonance Studies (SPR)
Biosensor-SPR is an effective technique to determine the equilibrium binding affinity and kinetics,
as well as the stoichiometry and cooperativity of biomolecular interactions in real-time [21,22]. To
determine the relative binding strength of the trimethine cyanine analogs, SPR experiments were
performed with biotinylated quadruplex and duplex sequences. In addition to the Tel22 quadruplex,
a well-characterized oncogenic promoter quadruplex sequence from c-myc, cMYC19, was also
employed to determine if the compounds can exhibit any selectivity for different quadruplex
architectures. Figure 2 shows representative SPR sensorgrams and the corresponding steady-state
affinity plots for the parent cyanine 24 and the brominated analog 31 with both quadruplex-forming
sequences. The sensorgrams show very fast association and dissociation of the compounds and were
characteristic of all the analogs, except for compound 25 which did not exhibit any binding with either
quadruplex sequences. The equilibrium binding affinities for all the analogs with both quadruplexes
and a control duplex (AATT) were determined using a two-site binding model and are listed in Table 2.
All the compounds exhibit reasonable binding to both quadruplex sequences with a primary strong
binding (K1) followed by a weaker binding affinity (K2), ca. 10X lower. The halogenated analogs
29–3 showed impressive 5–15 times stronger binding affinities with the telomeric quadruplex
compared to the parent compound (24, K1 = 3.9 × 105 M−1) in agreement with the Tm studies. With the
parallel cMYC19 quadruplex, compound 24 showed a more favorable 10 times increase in binding
affinity compared to the telomeric quadruplex, however, the brominated analogs exhibited only a
2‒5 fold increase in the binding affinity. The anionic substitution analogs 27 and 28 showed a 2-fold
increase in the binding affinity with Tel22 compared to the parent cyanine 24, a trend that was not
observed in Tm studies. In general, all high affinity ligands showed a higher preference for the parallel
c-myc quadruplex over the hybrid telomeric quadruplex. The binding affinities for the duplex sequence
were either too low (KA < 105 M−1) or could not be determined due to very low steady-state response
values for the same concentration range (Table 2, AATT; Figure 2, green data points). SPR results,
thus, conclusively show the selectivity of the trimethine analogs for quadruplex structures with
different folding topologies as well as the selectivity over duplex sequences and in agreement with
thermal melting studies. The two-site fitting model predicted two predominantly bound ligands per
quadruplex unit probably stacked at the terminal tetrads (discussed below in NMR section), a common
mode and stoichiometry of binding exhibited by a majority of quadruplex targeting ligands [9,23–28].

Molecules 2013, 18
13593
Figure 2. SPR sensorgrams and the steady-state binding plots for the parent cyanine
(24, panel a) and the brominated analog (31, panel b) with Tel22 and cMYC19
quadruplexes and a control duplex (AATT). The injected concentration range for 24 is
10 nM–10 µM and for 31 is 10 nM–1 µM. The binding plots were obtained by fitting the
steady-state response values (RU) as a function of free ligand concentration (Cfree) and fit
to a two-site binding model. The estimated equilibrium binding affinities (K1 and K2) are
reported in Table 2.
a
24
24 - Tel22
100
75
50
25
0
24 - cMYC19
Tel22
cMyc
AATT
0
2.0 4.0 6.0 8.0 10.0
C
[uM]
free
b
31
100
75
50
25
0
31 - cMYC19
31 - Tel22
Tel22
cMyc
AATT
0
200
400
600
0
200
400
600
0
0.2 0.4 0.6 0.8 1.0
Time (seconds)
Time (seconds)
C
[uM]
free
Table 2. Equilibrium binding constants of the trimethine cyanine analogs with Tel22 and
cMYC19 quadruplex sequences obtained from SPR studies.
Compound
Tel22 (K1; K2) M−1
3.9 × 105; 3.9 × 104
No Binding
1.3 × 105; 1.7 × 104
8.2 × 105; 5.8 × 104
8.3 × 105; 6.1 × 104
5.9 × 106; 3.9 × 105
2.7 × 106; 2.9 × 105
5.5 × 106; 4.5 × 105
2.1 × 106; 2.2 × 105
cMYC19 (K1; K2) M−1
3.8 × 106; 1.4 × 105
No Binding
1.2 × 106; 6.6 × 105
5.7 × 105; 4.5 × 104
5.0 × 106; 5.6 × 105
6.3 × 106; 4.3 × 105
8.4 × 106; 3.3 × 105
1.2 × 107; 2.7 × 106
7.8 × 106; 2.5 × 106
AATT (K1) M−1
<105
24
25
26
27
28
29
30
31
32
No Binding
<105
<105
<105
<105
<105
<105
<105
The steady-state response obtained as a function of free ligand concentration was fitted to a two-site binding
model to obtain K1 and K2 values. The binding constant values are reproducible with ±10%. No Binding:
No sensorgrams were observed in the concentration range that was tested. In all cases, no significant duplex
binding was observed suggesting a high selectivity of the ligands for quadruplexes.

Molecules 2013, 18
13594
2.3. Circular Dichroism Studies (CD)
CD studies were conducted to qualitatively evaluate the possible binding modes of the cyanine
analogs with the quadruplex structures. Upon complex formation with biomolecules, achiral ligands
exhibit an induced CD (ICD) signal which is generally indicative of the binding mode of the ligand [29].
Weak ICD signals are characteristic of quadruplex end-stackers or duplex intercalators, whereas,
strong ICD signals are characteristic of ligands with groove interactions [20,29]. Figure 3 shows CD
spectra for 24 and 31 with both the telomeric and c-myc quadruplex sequences titrated until no further
change in the ICD signal is observed. Compound 24 exhibits very weak ICD signals with both
quadruplex sequences suggesting very weak interactions possibly by stacking at the terminal tetrads of
the quadruplex. The lack of an ICD signal of 24 with Tel22 is in agreement with relatively weaker
binding affinity observed in SPR and moderate increase in ∆Tm of Tel22 in screening studies.
Compound 31, however, exhibits differential ICD signals with either quadruplex sequence (Figure 3b).
A large ICD signal is observed in the compound absorbance region (550–600 nm) upon complex
formation with Tel22 sequence, whereas, a weak ICD signal is observed with c-myc quadruplex. Such
large ICD signals have been observed with ligands shown to form stacked complexes in multiple
grooves of the telomeric quadruplex [20]. Therefore, the strong ICD signal of 31 is possibly due to
interactions in the grooves of the telomeric quadruplex. Small changes in the DNA CD signal pattern
(250–300 nm) are also observed with 31 upon complex formation with the telomeric quadruplex. This
is due to subtle conformational rearrangements undergone by the quadruplex structure to enhance the
stacking interactions due to the additional bromine atom, and to favorably accommodate the two
propyl-(trimethyl ammonium) groups in the quadruplex grooves, thereby, resulting in the strong ICD
signal upon complex formation. The weak ICD signals by 31 with c-myc quadruplex is suggestive of a
purely end-stacking mode. No change in the DNA CD signal of c-myc is observed suggesting that the
parallel fold of the c-myc quadruplex is the preferred binding topology of the ligands.
2.4. Nuclear Magnetic Resonance Studies (NMR)
NMR studies were carried out to locate the binding site(s) on the quadruplex structure and the
imino proton spectra of a modified c-myc variant, MYC22, with the parent and brominated analogs are
shown in Figure 4. The imino protons of MYC22 were previously assigned [30] and serve as a
convenient monitor to determine the mode of interaction and stoichiometry. Based on the imino proton
shifts on titration, the primary binding site for compound 24 is the 3ʹ-end tetrad of MYC22 (G9, G13,
G18, and G22; Figures 4a and 5b). A secondary binding site at the 5ʹ-end tetrad (G7, G11, G16, and
G20) is evident after the 3ʹ-end approaches saturation. Remarkably, no precipitation was observed
even at a 10-fold excess of either compound. With the exception of G8 imino proton, the middle tetrad
is less affected by the binding on either terminal tetrad. However, it is noted that the shift of G8 imino
proton parallels that of G16 imino proton which monitors binding to the 5ʹ-end tetrad. This suggests
that the binding to the 5ʹ-end tetrad causes the chemical shift change of G8 imino proton. A similar
binding sequence (first 3ʹ-end and then 5ʹ-end) is also observed for compound 31 (Figures 4b and 5c).
Interestingly, the presence of the bulkier bromine substituent results in a much smaller effect on the
central tetrad, as shown for G8 imino proton. This is in marked contrast to the result obtained for

Molecules 2013, 18
13595
compound 24 and indicates that there are differences in the binding orientation of 24 and 31 (on the
5ʹ-end tetrad). The NMR results, which demonstrate binding to the terminal tetrads of MYC22, are
consistent with the CD results for 24 and 31 which indicate end-stacking interactions as well as small
structural perturbations in the quadruplex upon complex formation. Detailed NMR studies of the
proposed groove binding mode of 31 with telomeric quadruplex as observed in CD studies are
currently under investigation and will be reported shortly.
Figure 3. CD spectra of the parent cyanine (24, panel a) and the brominated analog
(31, panel b) with Tel22 and cMYC19 quadruplex sequences. The ligands were titrated
into the quadruplex solutions (5 µM) until no further change in ICD signals were obtained.
The insets show the mole ratio of drug:DNA.
a
24 - Tel22
24 - cMYC19
40
30
20
10
0
cMYC19
2:1
4:1
6:1
8:1
Tel22
1:1
2:1
4:1
6:1
8:1
b
50
40
30
20
10
0
31 - Tel22
31 - cMYC19
cMYC19
1:1
2:1
4:1
6:1
Tel22
1:1
2:1
3:1
4:1
6:1
8:1
9:1
8:1
-10
300
400
500
600
300
400
500
600
Wavelength (nm)
Wavelength (nm)
Figure 4. Imino proton spectra of MYC22 quadruplex titrated with the parent cyanine 24
(a) and the brominated analogue 31 (b). Ligands were added to the quadruplex at the ratio
indicated on the plot. Selected imino protons of 3ʹ-end (9, red) middle (8, blue) and 5ʹ-end
(16, green) tetrads are marked.

Molecules 2013, 18
13596
Figure 5. (a) Schematic structure of the c-myc quadruplex MYC22 adopted from [30].
For clarity the imino protons of the guanine tetrads are color coded. Red: 3ʹ-end tetrad,
blue: center tetrad, and green: 5ʹ-end tetrad. Imino proton titration curves of 3ʹ-end, middle
and 5ʹ-end tetrad for the parent cyanine (24, b) and the brominated analog (31, c).
2.5. Fluorescence Studies
Development of fluorescence probes that are highly selective for quadruplex structures is an
additional promising area given the involvement of quadruplex motifs in several important
biochemical processes. The trimethine cyanines were tested for their fluorescence properties with both
Tel22 and cMYC19 quadruplex structures and the fluorescence spectra of the parent cyanine 24 and
the brominated analog 31 are shown in Figure 6. From the spectra, it can be readily seen that the
compounds exhibit enhancement in fluorescence intensities with both quadruplex structures with
increasing concentrations of DNA. However, it is strikingly apparent that the compounds exhibit very
different fluorescence enhancements with both sequences. The enhancement in fluorescence intensity
is significantly higher with the c-myc quadruplex compared to telomeric quadruplex. The preferential
signal enhancement with c-myc quadruplex was observed with all the trimethine cyanine analogs. It is
very clear that the ligands have a much stronger preference for the parallel over hybrid quadruplex.
A corresponding absorbance titration of 31 with Tel22 (Figure S2) shows the presence of a single
isosbestic point (~560 nm) indicating the presence of spectroscopically distinct free and bound species.

Molecules 2013, 18
13597
Figure 6. Fluorescence emission spectra of the parent cyanine (24, panel a) and the
brominated analog (31, panel b) with Tel22 and cMYC19 quadruplex sequences. The
arrow indicates increasing concentrations of DNA titrated into the ligand solution (1 µM)
until no further change in the fluorescence emission signal was detected.
a
24 - cMYC19
24 - Tel22
800
600
400
200
0
300
200
100
0
b
31 - Tel22
31 - cMYC19
800
600
400
200
0
300
200
100
0
550
600
650
700
550
600
650
700
Wavelength (nm)
Wavelength (nm)
3. Discussion
G-quadruplex structures are associated in many important biological processes such as gene
regulation and protection against chromosome degradation [3,31,32]. The recent and very exciting
evidence showing the formation of G-quadruplex structures in vivo as well as the small-molecule
mediated stabilization of these unique structures in vivo has further driven the need to develop potent
quadruplex-targeting agents [7]. Various classes of small molecules have been developed using a
G-quadruplex platform as a strategy for improved therapeutic potential as well as for enhancing
the fundamental understanding of quadruplex-ligand interactions. Cyanines are one class of small
molecules that have the potential as quadruplex-specific agents [33–35]. Previously, we have described
the binding specificity and affinity of various pentamethine cyanine dyes with the telomeric and the
c-myc oncogenic quadruplex forming sequences [18]. The pentamethine analogs exhibited a 2:1
binding stoichiometry with an end-stacking binding mode with a preferential binding for parallel
c-myc over hybrid telomeric G-quadruplexes. The dimethyl substitutions on both indolenine rings
considerably reduce their affinity for duplex systems. The 2:1 complex formation by pentamethine
analogs was shown to be entropically-driven [18], as is observed for many end-stacking quadruplex
binders. With the success in developing rationally designed pentamethine cyanine scaffolds for
quadruplex targeting, we have extended the study with the development of a new series of cyanine

Molecules 2013, 18
13598
molecules with reduced linker length between the aromatic cores of the cyanine scaffold. Herein, we
probe the sensitivity and selectivity of binding to the polymethine chain length by shortening the
distance between the heterocyclic nitrogen atoms by two carbon units.
Preliminary screening studies of the new trimethine cyanines showed considerable improvements in
the thermal stability of the Tel22 quadruplex compared to the pentamethine analogs. The compounds
also showed significant selectivity over duplex sequences in accord with the design principles
established by the introduction of dimethyl scaffolds to reduce duplex interactions. Effectively
targeting the relatively lower abundance quadruplex motifs in an essentially duplex-rich genome is a
challenging task, and therefore, appropriate scaffolds with reduced duplex-DNA interactions can
provide alternate platforms to develop further selective quadruplex-specific agents. This is especially
true if any weak duplex interactions, such as non-specific electrostatic bindings, do not generate
significant biological effects. Biosensor-SPR studies showed compound binding to different
quadruplex motifs with a 2:1 binding stoichiometry and a higher preference for parallel-type
quadruplex folds over hybrid quadruplexes. The more exposed terminal tetrad surface of the c-myc
quadruplex might be more conducive for favorable stacking interactions. NMR imino proton chemical
shifts provide specific evidence for cyanine stacking on both ends of the cMYC quadruplex structure.
In addition, the NMR results shows that the two ends are saturated with cyanines at different ratios in
agreement with the two binding affinity values (K1 and K2) observed in SPR studies. The NMR
spectral changes for the parent 24 and the brominated derivative 31 suggest different stacking
geometries by the two molecules. This is a very interesting result that will be very helpful in
compound design as more structural details are obtained in more detailed NMR analyses.
One of the attractive features of cyanine molecules is their highly favorable fluorescence properties
and their extensive application as dyes in the detection of biomolecules [36–38]. Benzothiazole based
cyanines have been generally developed as fluorescent dyes for duplex-DNA, however, their strong
interactions with duplex-DNA have limited their development as quadruplex-specific fluorescence
probes. Furthermore, given the different types of quadruplex structures formed by guanine-rich
sequences from various genomic regions, it is highly desirable to develop fluorescent probes that are
not only selective for quadruplex structures over duplex-DNA but also discriminate between different
quadruplex topologies. Very interestingly, the trimethine cyanines in the current study exhibit
differential fluorescence behavior with quadruplex sequences. The significantly favorable fluorescence
emission property of trimethine cyanine dyes with c-myc quadruplex is highly promising for their
development as potential biomarkers for oncogenic-quadruplex-mediated cellular processes. The
propensity of different guanine-rich sequences throughout the genome to fold into diverse quadruplex
conformations will require the design of improved ligands that can discriminate among quadruplex
topologies and show preferential binding with high selectivity [39–41]. The currently studied cyanine
analogs shows many of the desirable features for targeting quadruplex structures with reduced duplex
affinity as well as for discriminating different biologically important quadruplex conformations and
significantly enhances our knowledge about incorporating rational design principles for selective
quadruplex targeting.

Molecules 2013, 18
13599
4. Experimental
4.1. Synthesis of Cyanines
The chemical reagents used in the synthesis of cyanine dyes were obtained from Acros Organics
(Fair Lawn, NJ, USA), Alfa Aesar (Ward Hill, MA, USA) and Matrix Scientific (Columbia, SC,
USA). The reactions were followed using silica gel 60 F254 thin layer chromatography plates (Merck
EMD Millipore, Darmstadt, Germany) with 5% methanol in DCM as the mobile phase. Open column
chromatography was utilized for the purification of all final compounds using 60–200 µm, 60Å classic
1
column silica gel (Dynamic Adsorbents, Norcross, GA, USA). The H-NMR and 13C-NMR spectra
were obtained using high quality Kontes NMR tubes (Kimble Chase, Vineland, NJ, USA) rated to 500 MHz
and were recorded on a Bruker Avance (Billerica, MA, USA) 400 MHz spectrometer using D2O
containing tetramethylsilane (TMS) as an internal calibration standard. 19F-NMR spectra were
recorded using hexafluorobenzene as an internal standard. UV-Vis/NIR absorption spectra were
recorded on a Varian Cary 50 spectrophotometer (Palo Alto, CA, USA). High-resolution a.ccurate
mass spectra (HRMS) were obtained either at the Georgia State University Mass Spectrometry Facility
using a Waters Q-TOF micro (ESI-Q-TOF) mass spectrometer (Milford, MA, USA) or utilizing a
Waters Micromass LCT TOF ES+ Premier Mass Spectrometer. Liquid chromatography utilized a
Waters 2487 single wavelength absorption detector with wavelengths set between 640 and 700 nm
depending on the dye’s photophysical properties. The column used in LC was a Waters Delta-Pak
5 µm 100Å 3.9 × 150 mm reversed phase C18 column. Evaporative light scattering detection analyzes
trace impurities that cannot be observed by alternate methods; a SEDEX 75 ELSD (Olivet, France)
was utilized in tandem with liquid chromatography to confirm purity. The preparation of the
heterocyclic precursors 8–14 has been described by our laboratory and the compounds were used in the
synthesis of the charged salts 15–23.
4.1.1. General Synthesis for the Alkylated Indolenine Salts 15–23 (Scheme 1)
Individual 2,3,3-indolenine heterocyclic precursors 8–14 was dissolved in anhydrous acetonitrile
(50 mL) and was heated to 40 °C followed by the addition of the appropriate alkylating agent in
3 molar excess and was then heated to reflux for 72 h. The reaction progress was followed by TLC
eluting with DCM/methanol/acetic acid (40/58/2). The reaction mixture was allowed to cool and the
solvent was partially removed in vacuo. The final compounds were obtained by precipitation from
methanol by diluting with acetone, ethyl acetate and diethyl ether. The hygroscopic compounds were
allowed to dry for several hours under high vacuum.
4.1.2. General Synthesis for the Trimethine Cyanine Binding Agents 24–32 (Scheme 1)
Individual alkylated indolenine salts 15–23 were dissolved in acetic anhydride (50 mL) followed by
the addition of triethyl orthoformate in a 2:1 molar ratio. The reaction was heated at 110 °C for 30 min
and followed using UV-Vis spectroscopy diluted in methanol. The mixture was allowed to cool and
was crystallized using hexanes/ethyl acetate/diethyl ether. A colored precipitate was filtered, washed
and collected. Compounds 24–32 were dried for several hours under high vacuum.

Molecules 2013, 18
13600
Scheme 1. Synthetic route for the preparation of trimethine cyanine G-quadruplex binding agents.
2-((E)-3-((E)-3,3-dimethyl-1-(3-(trimethylammonio)propyl)indolin-2-ylidene)prop-1-en-1-yl)-3,3-
dimethyl-1-(3-(trimethylammonio)propyl)-3H-indol-1-ium bromide (24) was obtained in 89% yield.
MP 105–107 °C; 1H-NMR (400 MHz, D2O), δ: 1.62 (s, 12H), 2.27 (t, J = 7.6 Hz, 4H), 3.08 (s, 18H),
3.49–3.57 (m, 4H), 4.13 (t, J = 7.2 Hz, 4H), 6.52 (d, J = 13.2 Hz, 2H), 7.18–7.28 (m, 4H), 7.36 (d,
13
J = 7.6 Hz, 2H), 7.47 (d, J = 7.2 Hz, 2H), 8.47 (t, J = 13.2 Hz, 1H). C-NMR (100 MHz, D2O), δ:
21.0, 27.3, 40.5, 49.2, 53.1, 63.2, 102.7, 110.9, 122.5, 125.7, 128.8, 140.8, 141.3, 151.8, 175.1.
1-butyl-2-((E)-3-((E)-1-butyl-3,3-dimethylindolin-2-ylidene)prop-1-en-1-yl)-3,3-dimethyl-3H-indol-1-
ium iodide (25) and 2-((E)-3-((E)-3,3-dimethyl-1-(3-phenylpropyl)indolin-2-ylidene)prop-1-en-1-yl)-
3,3-dimethyl-1-(3-phenylpropyl)-3H-indol-1-ium bromide (26) have been previously reported by our
lab and were used directly in the quadruplex binding interaction studies without any additional
modifications.
2-((E)-3-((E)-3,3-dimethyl-5-sulfonato-1-(3-(trimethylammonio)propyl)indolin-2-ylidene)prop-1-en-1-
yl)-3,3-dimethyl-1-(3-(trimethylammonio)propyl)-3H-indol-1-ium-5-sulfonate bromide (27) was
obtained in 92% yield. MP 295–297 °C; 1H-NMR (400 MHz, D2O), δ: 1.66 (s, 12H), 2.26 (t, J = 6.0 Hz,
4H), 3.09 (s, 18H), 3.44–3.54 (m, 4H), 4.14 (t, J = 7.2 Hz, 4H), 6.44 (d, J = 13.2 Hz, 2H), 7.28 (d,
J = 8.4 Hz, 2H), 7.74 (d, J = 8.4 Hz, 2H), 7.83 (s, 2H), 8.50 (t, J = 13.2 Hz, 1H). 13C-NMR (100 MHz,
D2O), δ: 20.9, 21.2, 30.2, 40.8, 49.5, 53.2, 63.1, 103.7, 111.1, 120.0, 126.7, 139.9, 141.5, 143.6, 153.0,
176.4. Combustion C, H N analysis calculated for C35H51BrN4O6S2 (4H2O): C, 50.05; H, 7.08; N, 6.67.
Found: C, 50.30; H, 6.83; N, 6.56.
5-carboxy-2-((E)-3-((E)-5-carboxy-3,3-dimethyl-1-(3-(trimethylammonio)propyl)indolin-2-ylidene)prop-
1-en-1-yl)-3,3-dimethyl-1-(3-(trimethylammonio)propyl)-3H-indol-1-ium bromide (28) was obtained in

Molecules 2013, 18
13601
1
55% yield. MP more than 350 °C; H-NMR (400 MHz, D2O), δ: 1.64 (s, 12H), 2.22 (t, J = 6.0 Hz,
4H), 3.11 (s, 18H), 3.43–3.53 (m, 4H), 4.16 (t, J = 7.2 Hz, 4H), 6.46 (d, J = 13.2 Hz, 2H), 7.35 (d,
J = 8.4 Hz, 2H), 7.88 (d, J = 8.4 Hz, 2H), 7.93 (s, 2H), 8.55 (t, J = 13.2 Hz, 1H). 13C-NMR (100 MHz,
D2O), δ: 20.4, 21.3, 30.4, 41.8, 47.5, 54.6, 64.1, 106.7, 111.6, 122.1, 127.3, 134.9, 141.6, 147.2, 154.5,
177.4, 179.9.
5-fluoro-2-((E)-3-((E)-5-fluoro-3,3-dimethyl-1-(3-(trimethylammonio)propyl)indolin-2-ylidene)prop-1-
en-1-yl)-3,3-dimethyl-1-(3-(trimethylammonio)propyl)-3H-indol-1-ium bromide (29) was obtained in
33% yield MP > 260 °C; 1H-NMR (400 MHz, D2O), δ: 1.70 (s, 12H), 2.29 (t, J = 7.8 Hz, 4H), 3.08 (s,
18H), 3.48 (tt, J = 7.8 Hz, J = 7.8 Hz, 4H), 4.15 (t, J = 7.8 Hz, 4H), 6.34 (d, J = 13.6 Hz, 2H), 7.14 (t,
J = 9.2 Hz, 2H), 7.242–7.12 (m, 2H), 7.30 (d, 6.0 Hz, 2H), 8.49 (t, J = 13.6 Hz, 1H). 19F-NMR (135 MHz,
D2O, C6F6 standard), δ: −118.8. HR-MS calculated for [C35H51N4F2Br]+ 644.3265, found 644.3278.
5-chloro-2-((E)-3-((E)-5-chloro-3,3-dimethyl-1-(3-(trimethylammonio)propyl)indolin-2-ylidene)prop-
1-en-1-yl)-3,3-dimethyl-1-(3-(trimethylammonio)propyl)-3H-indol-1-ium bromide (30) was obtained in
77% yield. MP 255–257 °C; 1H-NMR (400 MHz, D2O), δ: 1.81 (s, 12H), 2.36 (t, J = 7.8 Hz, 4H), 3.29
(s, 18H), 3.95 (tt, J = 7.8 Hz, J = 7.8 Hz, 4H), 4.29 (t, J = 7.8 Hz, 4H), 7.21 (d, J = 13.4 Hz, 2H), 7.49
(d, J = 8.0 Hz, 2H), 7.59 (d, J = 8.0 Hz, 2H), 7.66 (s, 2H), 8.60 (t, J = 13.4 Hz, 1H). 13C-NMR (100 MHz,
D2O), δ: 22.4, 28.4, 42.4, 50.9, 54.2, 64.2, 105.7, 114.0, 124.4, 130.2, 132.6, 141.9, 144.2, 153.3,
176.1. Combustion C, H N analysis calculated for C35H51Br3Cl2N4 (2H2O): C, 48.07; H, 6.34; N, 6.41.
Found: C, 48.13; H, 6.31; N, 6.43.
5-bromo-2-((E)-3-((E)-5-bromo-3,3-dimethyl-1-(3-(trimethylammonio)propyl)indolin-2-ylidene)prop-
1-en-1-yl)-3,3-dimethyl-1-(3-(trimethylammonio)propyl)-3H-indol-1-ium bromide (31) was obtained in
87% yield. MP 245–247 °C; 1H-NMR (400 MHz, D2O), δ: 1.71 (s, 12H), 2.16 (t, J = 7.4 Hz, 4H), 3.16
(s, 18H), 3.83–3.93 (m, 4H), 4.13 (t, J = 7.6 Hz, 4H), 7.30 (d, J = 13.2 Hz, 2H), 7.57 (dd, J = 6.4 Hz,
J = 4.0 Hz, 2H), 7.69 (d, J = 6.4 Hz, 2H), 7.99 (d, J = 4.0 Hz, 2H), 8.38 (t, J = 13.2 Hz, 1H). 13C-NMR
(100 MHz, D2O), δ: 21.2, 31.1, 41.6, 49.5, 53.1, 62.5, 104.5, 113.9, 118.2, 126.3, 131.8, 141.4, 151.2,
172.4, 174.2. Combustion C, H N analysis calculated for C35H51Br5N4 (3H2O): C, 42.84; H, 5.85; N,
5.71. Found: C, 43.09; H, 5.65; N, 5.61.
5-iodo-2-((E)-3-((E)-5-iodo-3,3-dimethyl-1-(3-(trimethylammonio)propyl)indolin-2-ylidene)prop-1-en-
1-yl)-3,3-dimethyl-1-(3-(trimethylammonio)propyl)-3H-indol-1-ium bromide (32) was obtained in 92%
yield. MP 260–262 °C; 1H-NMR (400 MHz, D2O), δ: 1.69 (s, 12H), 2.15 (t, J = 7.8 Hz, 4H), 3.15 (s,
18H), 3.88 (tt, J = 7.8 Hz, J = 8.0 Hz, 4H), 4.11 (t, J = 8.0 Hz, 4H), 7.28 (d, J = 13.4 Hz, 2H), 7.44 (d,
J = 8.0 Hz, 2H), 7.82 (d, J = 8.0 Hz, 2H), 8.08 (s, 2H), 8.37 (t, J = 13.4 Hz, 1H). 13C-NMR (100 MHz,
D2O), δ: 20.7, 27.2, 41.0, 48.8, 52.6, 62.0, 89.8, 103.9, 113.7, 131.2, 137.1, 141.4, 143.0, 150.6, 173.2.
Combustion C, H N analysis calculated for C35H51Br3I2N4 (2H2O): C, 39.76; H, 5.24; N, 5.30. Found:
C, 39.83; H, 5.18; N, 5.38.

Molecules 2013, 18
13602
4.2. Nucleic Acids
The DNA oligonucleotides: Tel22 d[AGGG(TTAGGG)3], cMYC19 d[(AGGGTGGGG)2A], and
AATT hairpin duplex control d[CGAATTCGTTTTCGAATTCG] with and without 5’-biotin labels
were purchased from Integrated DNA Technologies (Coralville, IA, USA) with HPLC purification
and mass spectrometry characterization. For NMR studies, a modified c-myc sequence, MYC22,
d[TG(AGGGTGGGG)2AA] was used. The concentration of all the oligonucleotides was calculated
using the absorbance at 260 nm and the manufacturer provided extinction coefficients determined by
the nearest-neighbor method [42]. Stock solutions of the oligonucleotides and the dyes were prepared
in deionized water and diluted using appropriate experimental buffer prior to use. Experiments were
conducted in 10 mM TRIS, or 10 mM HEPES for SPR, containing 50 mM KCl and 3 mM EDTA
adjusted to pH 7.3.
4.3. UV-Thermal Melting
Thermal stability studies of the ligand-DNA complexes were performed with a Cary 300 BIO
UV-visible spectrophotometer in 1 cm pathlength quartz cuvettes. Samples of ligand-DNA complexes
were prepared in Tris buffer at different ratios (0:1 up to 6:1) and were mounted in a 6x6 Series II
thermal block. The change in the absorbance of the complexes was monitored (at 295 nm
for quadruplex samples and 260 nm for duplex samples) as a function of temperature with
computer-controlled heating and cooling rates of 0.5 °C/min. A total of four scans for each sample
were collected with automatic buffer correction. The buffer corrected scans were normalized and the
Tm values were determined by using a combination of the derivative function and graphical
estimation. The reported ∆Tm values are averaged over two independent experiments and are
reproducible within ±1 °C.
4.4. Biosensor-Surface Plasmon Resonance
Biosensor-SPR studies were performed with a four-channel Biacore 2000 optical biosensor system
(GE Healthcare, Stockholm, Sweden) using streptavidin-derivatized sensor chips (SA). The
biotinylated oligonucleotides were prepared in HEPES buffer and were immobilized using the
previously described procedure [21]. A series of ligand solutions (10 nM–10 µM) prepared in HEPES
buffer were injected over the DNA immobilized sensor chip at a flow rate of 25 µL/min for an
association and dissociation period of 5 min each. After the dissociation phase, the sensor-chip surface
was regenerated with 10 mM glycine solution (pH 2.5) for a short period and was followed by a series
of buffer injections to obtain a stable baseline for the next series of ligand injections. The equilibrium
steady-state response values (RUobs) at each injected ligand concentration (Cfree) were obtained and
the values were fitted to a two-site binding model by non-linear least squares method using the
following equation:
2
RUobs = RUmax/ligand(K1Cfree + 2K1K2Cfree2)/(1 + K1Cfree + K1K2Cfree
)
where RUmax/ligand is the predicted response for a single ligand binding. K1 and K2 are binding affinities
for two different binding sites.

Molecules 2013, 18
13603
4.5. Circular Dichroism
CD studies were conducted using a Jasco J-810 spectrophotometer with a 1 cm pathlength quartz
cuvette at 25 °C. Quadruplex-DNA solutions (4–5 µM) were annealed in Tris buffer overnight prior to
the collection of spectra. An appropriate amount of the ligands were sequentially titrated into the DNA
solution and the spectra were collected with a scanning speed of 50 nm/min and a response time of 1 s
over the wavelength range of 230 nm to 650 nm. The spectra were collected until no further change in
the induced CD signal was observed upon further ligand titration. The spectra were averaged over four
scans, and a buffer scan collected in the same cuvette was subtracted from the average scan of each
ratio. Data were processed and plotted using Kaleidagraph 4.0 software.
4.6. Fluorescence Titrations
A UV-Vis absorbance scan was obtained by scanning the ligand solutions (5 μM) in Tris buffer
over 800 nm to 200 nm at a rate of 60 nm/min with a 1 nm slit width to determine their maximum
excitation wavelength (λmax). Fluorescence experiments were performed with a Cary Eclipse
Fluorescence Spectrometer at 25 °C using an excitation and emission slit widths of 5 nm and the λmax
of each ligand. Preannealed quadruplex DNA solutions in Tris buffer were incrementally titrated
(0.05 µM) into the cuvettes containing 1 μM compound and the fluorescence emission was monitored
over 500–800 nm wavelength range. Scans of the quadruplex-ligand samples were collected until no
further change in the fluorescence intensity was observed upon further DNA titration. The spectra were
processed and plotted with Kaleidagraph 4.0 software.
4.7. Nuclear Magnetic Resonance
Samples for NMR (100 µM) were prepared in 90% H2O/10% D2O and 20 mM potassium
phosphate, pH 6.02. 4,4-dimethyl-4silapentane-1-sulphonic acid (DSS) was added as an internal
reference. NMR experiments were performed on a Avance 600 spectrometer, equipped with a 5 mm
QXI 1H{31P,13C,15N} probe (Bruker). Imino proton spectra (1024 scans) were collected at 35 °C using
a WATERGATE w5 pulse sequence and a sweep width of 24 ppm.
5. Conclusions
Herein we are reporting the design, synthesis and characterization of novel series of trimethine
carbocyanine molecules with different substituents on the indolenine rings to probe the effects on
quadruplex binding. Analogous to our previous studies with penthamethine-linked cyanines, current
molecules exhibit elevated quadruplex binding with considerably reduced duplex affinity. The halogen
substitutions significantly increase the thermal stability and binding affinity with the quadruplex
sequences with favorable preference for the parallel quadruplex motif. NMR and SPR studies show a
2:1 binding stoichiometry of the ligands while NMR and CD results support a stacking complex at the
terminal tetrads of the quadruplex. The significant fluorescence enhancement observed for the parallel
quadruplex over the hybrid type is a highly attractive feature of these ligands in discriminating
different quadruplex folds. In summary, the current study significantly advances our knowledge in

Molecules 2013, 18
13604
developing novel cyanine scaffolds for targeting quadruplex structures and their possible development
as novel probes for G-quadruplex detection in vivo.
Supplementary Materials
Supplementary materials can be accessed at: http://www.mdpi.com/1420-3049/18/11/13588/s1.
Acknowledgments
Biophysical studies on cyanine-DNA interactions were supported by NIH NIAID Grant AI-064200
(WDW). The synthetic part for this study was supported by a Georgia Research Alliance grant (MH)
and a Molecular Basis of Disease Grant from GSU (MH). NMR experiments were supported by a
Molecular Basis of Disease Grant from GSU (MWG). EAO was supported from a Research Initiation
and Mentor Grant as well as through the Center for Diagnostics and Therapeutics at GSU.
Conflicts of Interest
The authors declare no conflict of interest.
References
1. Neidle, S.; Balasubramanian, S. Quadruplex Nucleic Acids; RSC Publishers: Cambridge, UK,
2006; pp. 301–315.
2. Burge, S.; Parkinson, G.N.; Hazel, P.; Todd, A.K.; Neidle, S. Quadruplex DNA: Sequence,
topology and structure. Nucleic Acids Res. 2006, 34, 5402–5415.
3. Paeschke, K.; Simonsson, T.; Postberg, J.; Rhodes, D.; Lipps, H.J. Telomere end-binding proteins
control the formation of G-quadruplex DNA structures in vivo. Nat. Struct. Mol. Biol. 2005, 12,
847–854.
4. Schaffitzel, C.; Postberg, J.; Paeschke, K.; Lipps, H. Probing Telomeric G-Quadruplex DNA
Structures in Cells with in Vitro Generated Single-Chain Antibody Fragments. In G-Quadruplex
DNA; Baumann, P., Ed.; Humana Press: New York, NY, USA, 2010; Volume 608, pp. 159–181.
5. Neidle, S.; Parkinson, G.N. Quadruplex DNA crystal structures and drug design. Biochimie 2008,
90, 1184–1196.
6. Hurley, L.; Wheelhouse, R.; Sun, D.; Kerwin, S.; Salazar, M.; Fedoroff, O.; Han, F.; Han, H.;
Izbicka, E.; von Hoff, D. G-quadruplexes as targets for drug design. Pharmacol. Ther. 2000, 85,
141–158.
7. Biffi, G.; Tannahill, D.; McCafferty, J.; Balasubramanian, S. Quantitative visualization of DNA
G-quadruplex structures in human cells. Nat. Chem. 2013, 5, 182–186.
8. Balasubramanian, S.; Hurley, L.H.; Neidle, S. Targeting G-quadruplexes in gene promoters: A
novel anticancer strategy? Nat. Rev. Drug Discov. 2011, 10, 261–275.
9. Monchaud, D. A hitchhiker’s guide to G-quadruplex ligands. Org. Biomol. Chem. 2008, 6,
627–636.

Molecules 2013, 18
13605
10. Shin-ya, K.; Wierzba, K.; Matsuo, K.-i.; Ohtani, T.; Yamada, Y.; Furihata, K.; Hayakawa, Y.; Seto, H.
Telomestatin, a novel telomerase inhibitor from Streptomyces anulatus. J. Am. Chem. Soc. 2001,
123, 1262–1263.
11. Drygin, D.; Siddiqui-Jain, A.; O’Brien, S.; Schwaebe, M.; Lin, A.; Bliesath, J.; Ho, C.B.; Proffitt, C.;
Trent, K.; Whitten, J.P.; et al. Anticancer activity of CX-3543: A direct inhibitor of rRNA
biogenesis. Cancer Res. 2009, 69, 7653–7661.
12. Henary, M.; Mojzych, M. Stability and Reactivity of Polymethine Dyes in Solution. In
Heterocyclic Polymethine Dyes; Strekowski, L., Ed.; Springer: Berlin, Germany, 2008; Volume 14,
pp. 221–238.
13. Mojzych, M.; Henary, M. Synthesis of Cyanine Dyes. In Heterocyclic Polymethine Dyes;
Strekowski, L., Ed.; Springer: Berlin, Germany, 2008; Volume 14, pp. 1–9.
14. Datta, S.G.; Reynolds, C.; Goud, Y.K.; Datta, B. Interaction of YOYO-1 with guanine-rich DNA.
J. Biomol. Struct. Dyn. 2013, 31, 1–9.
15. Largy, E.; Granzhan, A.; Hamon, F.; Verga, D.; Teulade-Fichou, M.-P. Visualizing the
Quadruplex: From Fluorescent Ligands to Light-Up Probes. In Quadruplex Nucleic Acids;
Chaires, J.B., Graves, D., Eds.; Springer: Berlin/Heidelberg, Germany, 2013; Volume 330,
pp. 111–177.
16. Mohanty, J.; Barooah, N.; Dhamodharan, V.; Harikrishna, S.; Pradeepkumar, P.I.; Bhasikuttan, A.C.
Thioflavin T as an efficient inducer and selective fluorescent sensor for the human telomeric
G-quadruplex DNA. J. Am. Chem. Soc. 2012, 135, 367–376.
17. Vummidi, B.R.; Alzeer, J.; Luedtke, N.W. Fluorescent probes for G-quadruplex structures.
ChemBioChem 2013, 14, 540–558.
18. Nanjunda, R.; Owens, E.A.; Mickelson, L.; Alyabyev, S.; Kilpatrick, N.; Wang, S.; Henary, M.;
Wilson, W.D. Halogenated pentamethine cyanine dyes exhibiting high fidelity for G-quadruplex
DNA. Bioorg. Med. Chem. 2012, 20, 7002–7011.
19. Fox, K.R. Drug-DNA Interaction Protocols, 2nd ed.; Humana Press: New York, NY, USA, 2010;
pp. 318–329.
20. Nanjunda, R.; Musetti, C.; Kumar, A.; Ismail, M.A.; Farahat, A.A.; Wang, S.; Sissi, C.; Palumbo, M.;
Boykin, D.W.; Wilson, W.D. Heterocyclic dications as a new class of telomeric G-quadruplex
targeting agents. Curr. Pharm. Des. 2012, 18, 1934–1947.
21. Nanjunda, R.; Munde, M.; Liu, Y.; Wilson, W.D. Real-Time Monitoring of Nucleic Acid
Interactions with Biosensor-Surface Plasmon Resonance. In Methods for Studying Nucleic
Acid/Drug Interactions; Tor, Y., Wanunu, M., Eds.; CRC Press: Boca Raton, FL, USA, 2011;
pp. 91–134.
22. Munde, M.; Kumar, A.; Nhili, R.; Depauw, S.; David-Cordonnier, M.-H.; Ismail, M.A.;
Stephens, C.E.; Farahat, A.A.; Batista-Parra, A.; Boykin, D.W.; et al. DNA minor groove induced
dimerization of heterocyclic cations: Compound structure, binding affinity, and specificity for a
TTAA site. J. Mol. Biol. 2010, 402, 847–864.
23. Dai, J.; Carver, M.; Hurley, L.H.; Yang, D. Solution structure of a 2:1 quindoline–c-MYC
G-quadruplex: Insights into G-quadruplex-interactive small molecule drug design. J. Am.
Chem. Soc. 2011, 133, 17673–17680.

Molecules 2013, 18
13606
24. Barbieri, C.M.; Srinivasan, A.R.; Rzuczek, S.G.; Rice, J.E.; LaVoie, E.J.; Pilch, D.S. Defining the
mode, energetics and specificity with which a macrocyclic hexaoxazole binds to human telomeric
G-quadruplex DNA. Nucleic Acids Res. 2007, 35, 3272–3286.
25. Chung, W.J.; Heddi, B.; Tera, M.; Iida, K.; Nagasawa, K.; Phan, A.T. Solution structure of an
intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative. J. Am.
Chem. Soc. 2013, 135, 13495–13501.
26. Hounsou, C.; Guittat, L.; Monchaud, D.; Jourdan, M.; Saettel, N.; Mergny, J.-L.;
Teulade-Fichou, M.-P. G-quadruplex recognition by quinacridines: A SAR, NMR, and biological
study. ChemMedChem 2007, 2, 655–666.
27. Campbell, N.H.; Parkinson, G.N.; Reszka, A.P.; Neidle, S. Structural basis of DNA quadruplex
recognition by an acridine drug. J. Am. Chem. Soc. 2008, 130, 6722–6724.
28. Blankson, G.A.; Pilch, D.S.; Liu, A.A.; Liu, L.F.; Rice, J.E.; LaVoie, E.J. Macrocyclic biphenyl
tetraoxazoles: Synthesis, evaluation as G-quadruplex stabilizers and cytotoxic activity.
Bioorg. Med. Chem. 2013, 21, 4511–4520.
29. Rodger, A.; Norden, B. Circular Dichroism and Linear Dichroism; Oxford University Press:
New York, NY, USA, 1997.
30. Ambrus, A.; Chen, D.; Dai, J.; Jones, R.A.; Yang, D. Solution structure of the biologically
relevant G-quadruplex element in the human c-MYC promoter. Implications for G-quadruplex
stabilization. Biochemistry 2005, 44, 2048–2058.
31. Moyzis, R.K.; Buckingham, J.M.; Cram, L.S.; Dani, M.; Deaven, L.L.; Jones, M.D.; Meyne, J.;
Ratliff, R.L.; Wu, J.R. A highly conserved repetitive DNA sequence, (TTAGGG)n, present at the
telomeres of human chromosomes. Proc. Natl. Acad. Sci. USA 1988, 85, 6622–6626.
32. Makarov, V.L.; Hirose, Y.; Langmore, J.P. Long G tails at both ends of human chromosomes
suggest a C strand degradation mechanism for telomere shortening. Cell 1997, 88, 657–666.
33. Yang, Q.; Xiang, J.; Yang, S.; Zhou, Q.; Li, Q.; Tang, Y.; Xu, G. Verification of specific
G-quadruplex structure by using a novel cyanine dye supramolecular assembly: I. Recognizing
mixed G-quadruplex in human telomeres. Chem. Commun. 2009, 9, 1103–1105.
34. David, W.M.; Brodbelt, J.; Kerwin, S.M.; Thomas, P.W. Investigation of quadruplex
oligonucleotide-drug interactions by electrospray ionization mass spectrometry. Anal. Chem.
2002, 74, 2029–2033.
35. Kerwin, S.M.; Sun, D.; Kern, J.T.; Rangan, A.; Thomas, P.W. G-quadruplex DNA binding by a
series of carbocyanine dyes. Bioorg. Med. Chem. Lett. 2001, 11, 2411–2414.
36. Kovalska, V.; Losytskyy, M.; Yarmoluk, S.; Lubitz, I.; Kotlyar, A. Mono and trimethine cyanines
cyan 40 and cyan 2 as probes for highly selective fluorescent detection of non-canonical DNA
structures. J. Fluoresc. 2011, 21, 223–230.
37. Kanony, C.; Åkerman, B.; Tuite, E. Photobleaching of asymmetric cyanines used for fluorescence
imaging of single DNA molecules. J. Am. Chem. Soc. 2001, 123, 7985–7995.
38. Mohammed, H.S.; Delos Santos, J.O.; Armitage, B. Noncovalent binding and fluorogenic
response of cyanine dyes to DNA homoquadruplex and PNA-DNA heteroquadruplex structures.
Artif. DNA PNA XNA 2011, 2, 43–49.
39. Dai, J.; Carver, M.; Yang, D. Polymorphism of human telomeric quadruplex structures. Biochimie
2008, 90, 1172–1183.

Molecules 2013, 18
13607
40. Phan, A.T.; Kuryavyi, V.; Patel, D.J. DNA architecture: From G to Z. Curr. Opin. Struct. Biol.
2006, 16, 288–298.
41. Hamon, F.; Largy, E.; Guédin-Beaurepaire, A.; Rouchon-Dagois, M.; Sidibe, A.; Monchaud, D.;
Mergny, J.-L.; Riou, J.-F.; Nguyen, C.-H.; Teulade-Fichou, M.-P. An acyclic oligoheteroaryle
that discriminates strongly between diverse G-quadruplex topologies. Angew. Chem. 2011, 50,
8745–8749.
42. Fasman, G.D. Handbook of Biochemistry and Molecular Biology, Nucleic Acids; CRC Press:
Cleveland, OH, USA, 1975; Volume 1, pp. 589.
Sample Availability: Not available.
© 2013 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article
distributed under the terms and conditions of the Creative Commons Attribution license
(http://creativecommons.org/licenses/by/3.0/).