2-Aminopyridine Derivatives as Potential σ2 Receptor Antagonists

Article abstract of DOI:10.1002/cmdc.201200246

σ₂ Receptor research is receiving increasing interest with regard to the potential of σ₂ proteins as targets for tumor therapy and diagnosis. Nevertheless, knowledge about the σ₂ receptor is far from conclusive. The paucity and modest affinity of known σ₂ antagonists represent one of the limitations to σ₂ receptor research. Previous studies of the high-affinity σ₂ agonist 1-cyclohexyl-4-[3-(5-methoxy-1,2,3,4-tetrahydronaphthalen-1-yl)-n-propyl]piperazine 4 (PB28) suggested that a decrease in lipophilicity might lead to σ₂ ligands devoid of antiproliferative activity (potential σ₂ antagonists). With the aim of producing σ₂ receptor antagonists, we replaced the tetralin nucleus of compound 4 with a 2-aminopyridine moiety. A series of compounds with high affinity for both σ subtypes and with no antiproliferative activity in various cells (mouse HT-22, human SK-N-SH, MCF-7wt, and MCF-7σ₁) were obtained. The effect on Ca²⁺ mobilization was investigated for high-affinity compounds 18 and 4, which showed opposite effects. All of the data support the new 2-aminopyridines as high-affinity σ ligands with σ₂ antagonist and σ₁ agonist activity, and, despite the lack of significant σ₂ versus σ₁ selectivity, these novel compounds may be better tools for σ receptor research than the known low-affinity σ₂ antagonists.

Full text of DOI:10.1002/cmdc.201200246

MED
DOI: 10.1002/cmdc.201200246
2-Aminopyridine Derivatives as Potential s2 Receptor
Antagonists
Carmen Abate,*[a] Savina Ferorelli,[a] Mauro Niso,[a] Cesarea Lovicario,[a] Vittoria Infantino,[b]
Paolo Convertini,[c] Roberto Perrone,[a] and Francesco Berardi[a]
s2 Receptor research is receiving increasing interest with
regard to the potential of s2 proteins as targets for tumor ther-
apy and diagnosis. Nevertheless, knowledge about the s2 re-
ceptor is far from conclusive. The paucity and modest affinity
of known s2 antagonists represent one of the limitations to s2
receptor research. Previous studies of the high-affinity s2 ago-
nist 1-cyclohexyl-4-[3-(5-methoxy-1,2,3,4-tetrahydronaphthalen-
1-yl)-n-propyl]piperazine 4 (PB28) suggested that a decrease in
lipophilicity might lead to s2 ligands devoid of antiproliferative
activity (potential s2 antagonists). With the aim of producing
s2 receptor antagonists, we replaced the tetralin nucleus of
compound 4 with a 2-aminopyridine moiety. A series of com-
pounds with high affinity for both s subtypes and with no an-
tiproliferative activity in various cells (mouse HT-22, human SK-
N-SH, MCF-7wt, and MCF-7s1) were obtained. The effect on
Ca2+ mobilization was investigated for high-affinity com-
pounds 18 and 4, which showed opposite effects. All of the
data support the new 2-aminopyridines as high-affinity s li-
gands with s2 antagonist and s1 agonist activity, and, despite
the lack of significant s2 versus s1 selectivity, these novel com-
pounds may be better tools for s receptor research than the
known low-affinity s2 antagonists.
Introduction
The two subtypes of sigma (s) receptors, namely s1 and s2,
represent potential and interesting targets for the diagnosis
and therapy of different kinds of tumors and a number of cen-
tral nervous system (CNS) diseases.[1,2] Since their discovery, im-
pressive progress has been made in s receptor research, al-
though several pieces of information are still missing for com-
prehensive knowledge about their mechanisms of action. Of
the two subtypes, only s1 has been cloned from different sour-
ces.[3] Increasing evidence links this protein to neuroprotective
and neuroregulatory functions and to CNS pathologies such as
schizophrenia, depression, and Alzheimer’s and Parkinson’s dis-
eases.[4–6] Recently, it has been shown that juvenile amyotro-
phic lateral sclerosis is caused by a mutation to the gene en-
coding the s1 receptor.[7] Diverse mechanisms of action have
been proposed for the s1 protein, which has been assigned
a chaperone function for cross-talk between the endoplasmic
reticulum (ER) and the mitochondrion through Ca2+ signaling,
as well as a role in lipid compartmentalization.[8] The lesser-
known s2 subtype has yet to be cloned. Attempts to isolate s2
receptors led to the hypothesis that they are related to histone
proteins.[9,10] Nevertheless, later studies showed accumulation
of s2 fluorescent ligands in diverse organelles except the nu-
cleus.[11,12] Very recently, the s2 receptor has been identified as
emission tomography (PET) imaging of three kinds of
tumors.[14] In addition, diverse fluorescent s2 receptor ligands
have been employed to clarify the pathways activated by s2
proteins in tumor cells.[11,12] As for therapeutic potential, s2 li-
gands are under investigation for cancer treatment, as activa-
tion of s2 receptors leads to tumor cell death, and encouraging
results have been shown for in vivo studies with s2 agonists
for the treatment of tumors.[15,16]
On the other hand, it has been suggested that s2 antago-
nists mitigate many cocaine induced behaviors.[17] However,
only a few s2 receptor antagonists are known in the literature,
such as 1-(2-phenylethyl)piperidine (1, AC927, Figure 1),[18] 1-(2-
phenylethyl)-4-(2-pyridyl)piperazine (2, UMB24, Figure 1),[17]
and (ꢀ)-3a-tropanyl-2-(4-chlorophenoxy)butyrate (3, (ꢀ)-SM21,
Figure 1).[19] In addition, these antagonists display low affinity
for the s2 receptor (Ki values ꢁ100 nm), so results obtained
[a] Dr. C. Abate, Prof. S. Ferorelli, Dr. M. Niso, Dr. C. Lovicario,
Prof. Dr. R. Perrone, Prof. Dr. F. Berardi
Dipartimento Farmaco-Chimico
Universitꢀ degli Studi di Bari ALDO MORO
Via Orabona 4, 70125 Bari (Italy)
E-mail: carmen.abate@uniba.it
[b] Dr. V. Infantino
the
progesterone
receptor
membrane
component
Dipartimento di Chimica, Universitꢀ della Basilicata
Viale dell’Ateneo Lucano 10, 85100 Potenza (Italy)
1 (PGRMC1).[13] Increasing interest in s2 receptor research is
mostly due to the diagnostic and therapeutic potentials that
s2 ligands possess. This subtype is overexpressed in a number
of cancer tissues, thus s2 radioligands and fluorescent ligands
have been developed for the imaging of these proteins as bio-
markers of tumors. Recently, a s2 receptor 18F-labeled radioli-
gand entered a phase I clinical trial for application in positron
[c] Dr. P. Convertini
Dipartimento Farmaco-Biologico
Laboratorio di Biochimica e Biologia Molecolare
Universitꢀ degli Studi di Bari ALDO MORO
Via Orabona 4, 70125 Bari (Italy)
Supporting information for this article is available on the WWW under
http://dx.doi.org/10.1002/cmdc.201200246.
ChemMedChem 0000, 00, 1 – 12
ꢀ 2012 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
&
1
&
ÞÞ
These are not the final page numbers!

C. Abate et al.
MED
Figure 1. Known s2 receptor antagonists and agonist PB28.
with these ligands are hardly conclusive.[20,21] Therefore, there
is a need for higher-affinity s2 antagonists as pharmacological
tools to clarify the role of the s2 subtype in both in vitro and
in vivo studies. In our previous work, we studied several ana-
logues of 1-cyclohexyl-4-[3-(5-methoxy-1,2,3,4-tetrahydronaph-
thalen-1-yl)-n-propyl]piperazine (4, PB28, Figure 1),[18] which is
one of the highest-affinity s2 receptor ligands known, display-
ing potent agonist activity in diverse tumor cells.[22,23] Accord-
ing to these structure–affinity relationship (SAfiR) studies, the
N-cyclohexylpiperazine moiety was confirmed as an important
feature for conferring high s2 receptor affinity.[24–26] Moreover,
the s2-mediated antiproliferative activity of several analogues
of compound 4 appeared to be correlated to lipophilicity. In
fact, less lipophilic compounds do not exert antiproliferative
activity and may therefore have an antagonist effect at the s2
receptor.[27,28] Keeping this hypothesis in mind, we developed
a series of N-cyclohexylpiperazines linked to a less lipophilic
nucleus than tetralin with the aim of producing high-affinity
potential s2 receptor antagonists. A tetrahydro-1,8-naphthyri-
dine nucleus was used, in spite of the tetralin, to keep the bi-
cyclic structure while the lipophilicity of the ligands was de-
creased. The corresponding monocyclic structure was also in-
vestigated, and a series of N-cyclohexylpiperazine derivatives
in which the tetralin was replaced by the N-(pyridin-2-yl)ethyla-
mino moiety was obtained. Both in the bicycle-bearing and
monocycle-bearing cyclohexylpiperazine derivatives, the alkyl
chain length was varied from three to five methylene moieties.
Also, the effect of the insertion of an oxygen atom was investi-
gated both in the bicyclic and monocyclic rings, generating
the pyrido-oxazine and the 4-methoxy-2-aminopyridine moiet-
ies, respectively. The nitrogen atom adjacent to the pyridine
was made into an amide to provide diverse electron lone pair
availabilities.
Scheme 1. Synthesis of final bicyclic 2-aminopyridine derivatives. Reagents
and conditions: a) H3COOCCH2COOCH3, NaOCH3, CH3OH, RT, 18 h; b) NaOH,
CH3OH, reflux, 4 h; c) HCl, CH3OH, reflux, 18 h; d) NaH, DMF, RT, 48 h;
e) BH3·THF, THF, reflux, 3 h.
lation, provided key intermediate 3,4-dihydro-1,8-naphthyridin-
2-(1H)-one (7). N-cyclohexylpiperazine moieties 8–10 were pre-
pared by alkylation of N-cyclohexylpiperazine with 1-bromo-3-
chloro-propane to afford intermediate 8, and by acylation with
4-chlorobutanoyl chloride and 5-chloropentanoyl chloride to
afford, respectively, intermediates 9 and 10. Treatment of com-
pound 7, as well as of the commercially available 2H-pyrido-
[3,2-b]-1,4-oxazin-3-(4H)-one 11, with NaH and chloropropylpi-
perazine 8 afforded final compounds 12 and 13, respectively.
These amide compounds were reduced with borane–tetrahy-
drofuran (BH3·THF) complex to afford final compounds 14 and
15, respectively. Treatment of compound 7 with NaH and inter-
mediates 9 or 10 furnished intermediate 16 or 17 which, upon
reduction with BH3·THF complex, provided final compounds 18
and 19 (Scheme 1).
The preparation of final compounds 22, 23, and 26–29 is de-
picted in Scheme 2. Acetamides 20 and 21, respectively ob-
tained by acetylation of 2-aminopyridine and 4-methoxy-2-ami-
nopyridine,[30] were reacted with intermediate 8 in the pres-
ence of NaH to afford compounds 22 and 23, respectively. In-
termediate 20 was reacted with chloroalkylpiperazine deriva-
tives 9 and 10 to afford compounds 24 and 25, respectively.
Reduction with BH3·THF complex of the amidic functionalities
of compounds 22–25 provided final amine compounds 26–29.
The synthesis of final compounds 35 and 36 is depicted in
Scheme 3. Key intermediate pyridine-1-oxide derivatives 30
and 31 were commercially available. However, the latter was
synthesized through a previously reported synthesis[31] starting
from 2-chloro-4-nitropyridine-1-oxide via 2-chloro-4-methoxy-
pyridine.[31] Compounds 30 and 31 underwent nucleophilic
Results and Discussion
Chemistry
The syntheses of final compounds 12–15, 18, 19, 22, 23, 26–
29, 35, and 36 are depicted in Schemes 1–3. The preparation
of final compounds 12–15, 18, and 19 is depicted in
Scheme 1. 2-Amino-3-(bromomethyl)pyridine hydrobromide
(5), obtained by bromination of 2-amino-3-hydroxymethylpyri-
dine,[29] was reacted with dimethylmalonate and NaOCH3 to
afford intermediate 6. Ester hydrolysis, followed by decarboxy-
&2
&
www.chemmedchem.org
ꢀ 2012 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
ChemMedChem 0000, 00, 1 – 12
ÝÝ
These are not the final page numbers!

Potential s2 Receptor Antagonists
MED
Scheme 3. Synthesis of final monocyclic 2-aminopyridine derivatives. Re-
agents and conditions: a) Et3N, n-butanol, 1208C, 20 h; b) PCl3, CHCl3, 808C,
1 h.
Scheme 2. Synthesis of final monocyclic 2-aminopyridine derivatives. Re-
agents and conditions: a) NaH, DMF, RT, 48 h; b) BH3·THF, THF, reflux, 3 h.
none of the newly synthesized 2-aminopyridine derivatives dis-
played sub-nanomolar binding affinities similar to that of 4 at
both s receptors, appreciable affinity values were reached. No
selectivity between the two s subtypes was obtained, and
most of the new compounds displayed a slight preference for
the s1 receptor (14, 15, 19, 26, 27, 35, and 36). On the other
hand, compounds 12, 18, 22, and 23 displayed slight s2 selec-
tivity, with only 12 and 18 characterized by appreciable s affini-
ty.
substitution with 3-(4-cyclohexylpiperazin-1-yl)propanamine[32]
32 to afford intermediates 33 and 34, which were converted
with PCl3 to the final amine compounds 35 and 36, respective-
ly.
All of the final amine compounds were converted into their
hydrochloride or oxalate salts with gaseous HCl or oxalic acid,
respectively, in anhydrous diethyl ether. Physical properties of
these salts are listed in the Table of Physical Properties of Novel
Compounds in the Supporting Information, along with the
values of the calculated logarithm of distribution coefficient
(ClogD) for the corresponding free bases.[33]
Binding values displayed by bicyclic 1,8-naphthyridine com-
pounds (14, 18, and 19) and by corresponding open monocy-
clic 2-aminopyridine analogues (26, 28, and 29) were similar
(Ki: 2.06–5.66 nm for s1; Ki: 1.64–14.6 nm for s2), demonstrating
that a decrease in conformational freedom does not affect the
affinity at s receptors. In addition, no significant effect of chain
As 2-aminopyridine is endowed with fluorescence proper-
ties, the fluorescence spectra of
all compounds were recorded to
evaluate whether fluorescence
of these new compounds could
be exploited in biological assays.
Fluorescence spectra of final
compounds as free bases (at
Table 1. Binding data of final 2-aminopyridine derivatives.
10ꢂ5–10ꢂ7
m
concentrations)
Ki [nm][a]
were recorded in organic sol-
vents (CHCl3 and EtOH) and in
aqueous buffer (pH 7.4), but the
quantum yields (calculated using
2-aminopyridine as the reference
compound) were too low for
imaging purposes, so the fluo-
rescence properties of these
molecules were no longer con-
sidered.
Compd
Z
n
R1
R2
X
Y
s1
s2
4[20]
12
13
14
15
18
19
22
23
26
27
28
29
35
36
0.38ꢀ0.10
68.0ꢀ7.1
12.0ꢀ3.1
2.06ꢀ0.71
4.19ꢀ0.75
4.87ꢀ1.26
3.44ꢀ0.91
353ꢀ14
0.68ꢀ0.20
16.1ꢀ7.4
16.0ꢀ1.1
9.87ꢀ0.13
18.5ꢀ4.1
1.64ꢀ0.3
6.53ꢀ1.23
246ꢀ53
A
A
A
A
A
A
B
B
B
B
B
B
B
B
3
3
3
3
4
5
3
3
3
3
4
5
3
3
CH2
O
CH2
O
CH2
CH2
O
O
H
COCH3
COCH3
CH2CH3
CH2CH3
CH2CH3
CH2CH3
H
OCH3
H
OCH3
H
402ꢀ10
309ꢀ3
3.65ꢀ1.46
7.68ꢀ0.24
2.27ꢀ1.09
5.66ꢀ0.32
16.4ꢀ1.6
35.5ꢀ3.7
3.31ꢀ0.39
14.6ꢀ3.2
30.1ꢀ0.7
3.54ꢀ1.01
6.70ꢀ1.55
70.5ꢀ13.0
59.8ꢀ7.3
H
H
Radioligand binding and s1
and s2 receptor affinities
OCH3
H
(+)-pentazocine
DTG
Results from binding assays are
expressed as inhibition constants
(Ki values) in Table 1. Although
32.0ꢀ1.7
[a] Values are the means ꢀSEM of nꢁ2 separate experiments.
ChemMedChem 0000, 00, 1 – 12
ꢀ 2012 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.chemmedchem.org
&
3
&
ÞÞ
These are not the final page numbers!

C. Abate et al.
MED
length (3–5 methylene groups) on s receptor affinity was re-
corded. The three-methylene chain analogues were further in-
vestigated both in the bicyclic and in the monocyclic series. In
the latter series, the insertion of a methoxy group in the 4-po-
sition of the pyridine (compound 27) left affinity at both s sub-
types almost unchanged (Ki values of 7.68 and 30.1 nm for s1
and s2, respectively). The importance of the ethyl group on
the 2-aminopyridine moiety was investigated with pyridine
and 4-methoxypyridine analogues. Elimination of the ethyl resi-
due resulted in a two- to fivefold decrease in affinity at both
s subtypes (comparison of 35 with 26 and 36 with 27). Re-
placement of the ethyl with an acetyl group (compounds 22
and 23) in both pyridine and 4-methoxypyridine analogues led
to a dramatic decrease in affinity at the s receptors (Ki: 353–
402 nm for the s1 receptor; Ki: 246–309 nm for the s2 receptor).
This evidence suggests that a certain availability of the elec-
tron lone pair in the 2-aminopyridine portion is important for
a high-affinity interaction with s receptors. In addition, the
small decrease in s binding that was recorded for secondary
amines 35 and 36 suggests that, besides the lone pair availa-
bility, a certain bulk is useful for binding s proteins.
Table 2. Antiproliferative activity of 4 and final 2-aminopyridine deriva-
tives.
EC50 [mm]
[d]
Compd
HT-22[a]
SK-N-SH[b]
MCF-7wt[c]
MCF-7s1
4
30.0ꢀ5.0
>100
12.4ꢀ1.2[e]
>100
27.4ꢀ4.1[f]
>100
31.2ꢀ4.2
>100
12–15, 18, 19,
22, 23, 26–29,
35, 36
Antiproliferative effect measured in: [a] mouse HT-22 hippocampal cells,
[b] human SK-N-SH neuroblastoma cells, [c] human MCF-7 breast adeno-
carcinoma cells, and [d] human MCF-7s1 cells. [e] Other results for com-
pound 4 previously reported in references [20] and [22]. [f] Other results
for compound 4 previously reported in reference [23]. Values are the
means ꢀSEM of nꢁ2 separate experiments.
antiproliferative activity, as s1 receptors were reported to be
present in a low affinity state.[22] HT-22 cells have been used as
a model for s1 receptor-mediated neuroprotection.[34] Scatch-
ard analysis, which we performed on HT-22 cells to determine
the content of both s subtypes, surprisingly revealed a low s1
receptor density (Bmax =0.169 pmolmgꢂ1 of protein), and a sev-
enfold higher s2 receptor content (Bmax =1.23 pmolmgꢂ1 of
protein, Figure 2). Therefore, this cell line was also mainly used
for evaluation of s2 receptor-mediated action. To have a cell
To study the effect of decreasing lone pair availability in the
bicyclic series as well, 1,8-naphthyridin-2-one derivative 12 was
produced. Apparently, the electron lone pair availability in the
2-aminopyridine moiety is not a strict requirement for the in-
teraction of bicyclic derivatives with s2 receptors. In fact, 12
showed an insignificant decrease in s2 affinity (Ki =16.1 nm) rel-
ative to the non-amidic counterpart 14 (Ki =9.87 nm). On the
other hand, 12 showed a 30-fold lower s1 receptor affinity
than 14. The bicyclic series was extended with the synthesis of
two isosteres in which the 1,8-naphthyridine nucleus was re-
placed by a pyrido-oxazine in derivative 15 and by a pyrido-ox-
azinone in 13. Insertion of an oxygen atom (15) did not lead
to pharmacodynamic changes at s receptors relative to 1,8-
naphthyridine derivative 14. Presence of an amidic functionali-
ty (13) led to a decrease in s1 receptor affinity but not as sig-
nificant as the decrease recorded for 1,8-naphthyridin-2-one
12. Conversely, no difference was recorded at the s2 receptor
between the amidic (13) and non-amidic (15) derivatives, as in
the 1,8-naphthyridine series. Overall, the bicyclic amide deriva-
tives (12 and 13) did not show the same decrease in affinity as
the monocyclic derivatives (22 and 23), particularly at s2 recep-
tors, suggesting the hypothesis that diverse binding modes for
the bicyclic and monocyclic series may be possible.
Functional assays: antiproliferative activity in human neuro-
blastoma, human breast cancer, and mouse hippocampal
cells
The antiproliferative activities of compound 4 and the newly
synthesized compounds are reported as EC50 values in Table 2.
Four cell lines, HT-22 hippocampal mouse cells, SK-N-SH
human neuroblastoma cells, and MCF-7 wild-type human
breast adenocarcinoma cells (MCF-7wt) and MCF-7 cells trans-
fected with s1 receptor (MCF-7s1) were selected for activity
assays. As previously reported, the SK-N-SH cell line proved to
be a good model for the evaluation of s2 receptor-mediated
Figure 2. Saturation analysis of A) s1 [Kd =4.25 nm,
B
B
max =0.169 pmol(mg protein)ꢂ1] and B) s2 [Kd =7.032 nm,
max =1.23 pmol(mg protein)ꢂ1] receptors in membrane preparations from
~
!
&
HT-22 cells: total binding; nonspecific binding; specific binding.
&4
&
www.chemmedchem.org
ꢀ 2012 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
ChemMedChem 0000, 00, 1 – 12
ÝÝ
These are not the final page numbers!

Potential s2 Receptor Antagonists
MED
line expressing the s1 receptor with an appreciable density,
transfection of MCF-7wt cells with the s1 receptor gene was
conducted according to the literature.[35] The density of both
subtypes was determined before transfection, and the increase
in s1 receptor content in the newly created MCF-7s1 cell line
was evaluated after transfection (Figure 3). Therefore, MCF-7s1
was mainly used for the evaluation of s1-mediated action,
whereas MCF-7wt was used for evaluation of s2 receptor-medi-
ated action. Reference compound 4, which was previously de-
fined as a s2 receptor agonist and a s1 receptor antago-
nist,[22,23] was studied in the four cell lines where it showed an-
tiproliferative activity (Table 2), as expected for a s2 receptor
agonist and a s1 receptor antagonist. On the other hand, all of
the new 2-aminopyridine derivatives did not display antiproli-
ferative activity, with EC50 values >100 mm in all of the cell
lines studied. Although the involvement of other proteins in
the overall action of these s receptor ligands cannot be ruled
out, these data are in agreement with previous results ob-
tained with s2 ligands less lipophilic than 4, leading to the hy-
pothesis that lower lipophilicity values lead to lower s2-mediat-
ed antiproliferative activity.[27] In addition, compound 18, which
represents the highest s2 affinity compound among the novel
2-aminopyridines, was further investigated in an antiprolifera-
tive assay in co-administration with 4. At the concentration
used, 18 partially reversed the antiproliferative effect exerted
by compound 4 in MCF-7wt cells (see the figure in the Sup-
porting Information), showing that 18 is able to antagonize
the s2-mediated antiproliferative action exerted by the s2 re-
ceptor agonist 4.
s Receptor effect on intracellular Ca2+ mobilization
Effects on intracellular Ca2+ mobilization were evaluated for
representative 2-aminopyridine 18 and for reference com-
pound 4 with the aim of understanding whether the opposite
effect exerted on cell proliferation corresponds to differences
in intracellular Ca2+ mobilization. Therefore, bradykinin-trig-
gered Ca2+ response was measured for 4, 18, and the proto-
typical s1 agonist (+)-pentazocine ((+)-[2S-(2a,6a,11R)]-
1,2,3,4,5,6-hexahydro-6,11-dimethyl-3-(3-methyl-2-butenyl)-2,6-
methano-3-benzazocine-8-ol) in SK-N-SH, MCF-7wt, and MCF-
7s1 cells (Figure 4); none of the ligands affected intracellular
Ca2+ concentration when administered alone.
Although 4 and 18 do not display s selectivity, results ob-
tained through experiments in the cell lines selected should
allow retrieval of compound effects on each s subtype: SK-N-
SH cells express both s receptors, with s1 subtype in a low af-
finity state; MCF-7s1 cells overexpress s1 receptors; MCF-7wt
cells overexpress s2 receptors. As previously reported, the se-
lective s1 agonist (+)-pentazocine increased bradykinin-in-
duced Ca2+ mobilization in SK-N-SH and MCF-7s1 cells, where-
as no effect was exerted in MCF-7wt cells where the s1 density
is too low (Figure 3A).[35,36] Compound 4, as previously shown
with carbachol in SK-N-SH cells,[37] inhibited bradykinin-trig-
gered Ca2+ response in all of the cell lines studied, whereas it
did not exert any effect in LoVo colon adenocarcinoma cells in
which none of the s subtypes were detected through Scatch-
ard analysis.[36] These results support the idea that effects ex-
erted by compound 4 in bradykinin-triggered Ca2+ response
are s-mediated and suggest that agonist activity at s2 (from
SK-N-SH and MCF-7wt) and antagonist activity at s1 (from
MCF-7s1) decrease such response. On the other hand, 2-amino-
pyridine derivative 18, increased bradykinin-triggered Ca2+ re-
sponse in SK-N-SH and MCF-7s1 cells, similar to (+)-pentazo-
cine, implying agonist activity at the s1 receptor. No effect was
exerted by 18 in MCF-7wt cells, where the action may be
mediated by the s2 receptor.
Figure 3. Saturation analysis of A) s1 [Kd =2.97 nm,
B
B
max =0.172 pmol(mg protein)ꢂ1] and B) s2 [Kd =9.3 nm,
max =0.323 pmol(mg protein)ꢂ1] receptors in membrane preparations from
MCF-7wt cells, and saturation analysis of C) s1 [Kd =7.6 nm,
max =3.45 pmol(mg protein)ꢂ1] in membrane preparations from MCF-7s1
B
Together, these data show that compounds 4 and 18 have
opposite behavior and suggest that while agonist activity at
~
!
&
cells: total binding; nonspecific binding; specific binding.
ChemMedChem 0000, 00, 1 – 12
ꢀ 2012 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.chemmedchem.org
&
5
&
ÞÞ
These are not the final page numbers!

C. Abate et al.
MED
tivities, these new compounds may represent better
tools for s receptor research than the low affinity
and poorly selective s2 receptor antagonists known.
Experimental Section
Chemistry
Both column chromatography and flash column chro-
matography were performed with 60 ꢁ pore size silica
gel as the stationary phase (1:30 w/w, 63–200 mm parti-
cle size from ICN and 1:15 w/w, 15–40 mm particle size
from Merck, respectively). Melting points were deter-
mined in open capillaries on a Gallenkamp electrother-
mal apparatus. Purity of tested compounds was estab-
lished by combustion analysis, confirming purity ꢁ98%.
Elemental analyses (C, H, N) were performed on an Eu-
rovector Euro EA 3000 analyzer; the analytical results
were within ꢀ0.4% of theoretical values. 1H NMR
(300 MHz) and 13C NMR (75 MHz) spectra were recorded
on a Mercury Varian spectrometer using CDCl3 and
CH3OD, respectively, as solvent. The following data were
reported: chemical shift (d) in ppm, multiplicity (s=sin-
glet, d=doublet, t=triplet, m=multiplet), integration,
Figure 4. s Receptor ligand effects on intracellular Ca2+ mobilization induced by bradyki-
nin. Cells were pretreated with s receptor ligands before the addition of bradykinin. Bk:
bradykinin (1 mm); +Ptz: 10 min pretreatment with (+)-pentazocine (1 mm); +4: 3 min
pretreatment with compound 4 (1 mm); +18: 3 min pretreatment with compound 18
(1 mm); *p<0.05. In SK-N-SH and MCF-7s1 cells, the Ca2+ response induced by bradykinin
was inhibited by 4 and stimulated by 18. In MCF-7wt cells, the Ca2+ response induced
by bradykinin was inhibited by 4 and unaffected by 18.
the s2 receptor decreases bradykinin-induced Ca2+ response,
antagonist activity may not alter such response. Therefore,
compound 18 may be proposed as a s2 receptor antagonist
and a s1 receptor agonist.
and coupling constant(s) in Hertz. Recording of mass spectra was
done on an Agilent 6890-5973 MSD gas chromatograph/mass
spectrometer and on an Agilent 1100 series LC–MSD trap system
VL mass spectrometer; only significant m/z peaks, with their per-
centage of relative intensity in parentheses, are reported. Chemi-
cals were from Sigma–Aldrich and Alfa Aesar and were used with-
out any further purification.
Conclusions
General procedure for the synthesis of compounds 12, 13, 16,
17, and 22–25: NaH (1.2 mmol, 0.29 g, 60% w/w) was added to
a stirred solution of the corresponding amide compound (7, 11,
20, or 21; 1.0 mmol) in dry DMF (10 mL) under N2. After 1 h, a solu-
tion of the appropriate chloride (1.0 mmol) in DMF was added to
the suspension under N2. The reaction mixture was stirred at room
temperature for 48 h. Then, water was added to the reaction mix-
ture, and the organic layer was separated. The aqueous phase was
extracted with EtOAc (3ꢂ10 mL). The collected organic layers were
dried over Na2SO4 and evaporated under reduced pressure to
afford a crude residue, which was purified as reported below for
each target compound.
A certain number of s2 receptor ligands with considerable s2
versus s1 selectivities are known,[26,32,38] but no selective and
high-affinity s2 antagonist has been reported yet, thus there is
a need for s2 antagonists as tools for s receptor research.
Therefore, with the aim of compensating for the paucity of s2
antagonists, we based the development of s2 ligands with po-
tential antagonist activity on previous studies. Less lipophilic
analogues than s2 receptor agonist 4 were obtained by re-
placement of the tetralin nucleus with a 2-aminopyridine
moiety. Compounds with high affinity for both s receptor sub-
types were obtained, and most were characterized by ClogD
values within the optimal range for entry into cells, as demon-
strated for s2 PET radiotracers by other authors.[38] None of the
new compounds displayed antiproliferative activity in the four
cell lines selected (mouse HT-22 and human SK-N-SH, MCF-
7wt, and MCF-7s1 cells), in contrast with lead compound 4,
which consistently showed micromolar antiproliferative activity.
The highest-affinity s2 ligand 18 was co-administered with 4 in
MCF-7wt cells and partially decreased the antiproliferative
effect exerted by 4. To investigate whether the lack of antipro-
liferative action of the newly synthesized compounds corre-
sponds to a different effect on Ca2+ mobilization, representa-
tive compounds 18 and 4 were evaluated in three tumor cell
lines with diverse s subtype content. Actually, compound 18
displayed an opposite effect than compound 4 on bradykinin-
induced Ca2+ response. All of the results together suggest a s2
receptor antagonist and a s1 receptor agonist activity for com-
pound 18. In conclusion, despite the lack of s2 versus s1 selec-
1-[3-(4-Cyclohexylpiperazin-1-yl)propyl]-3,4-dihydro-1,8-naph-
thyridin-2(1H)-one (12): The yellow semi-solid was purified by
column chromatography with CH2Cl2/CH3OH (98:2) as eluent to
1
afford the title compound as a yellow oil (0.125 g, 35%): H NMR
d=1.06–1.38 [m, 5H, cyclohexyl NCH(CHH)5], 1.58-1.70 (m, 1H, cy-
clohexyl),
1.72-2.05
[m,
6H,
cyclohexyl
NCH(CHH)4,
CONCH2CH2CH2N], 2.30–2.48 (m+t, 3H, CHN, J=7.55 Hz,
CONCH2CH2CH2N), 2.54-2.80 (m, 10H, piperazine and CH2CH2CO),
2.86 (t, 2H, J=7.9 Hz, ArCH2CH2CO), 4.17 (t, 2H, J=7.4 Hz,
CONCH2CH2CH2N), 6.87-6.92 (m, 1H, aromatic), 7.42 (d, 1H, aromat-
ic), 8.20 ppm (d, 1H, aromatic); GC–MS m/z 358 (M++2, 0.4), 357
(M++1, 4), 356 (M+, 13), 232 (52), 218 (100), 189 (95), 181 (63), 133
(45); LC–MS (ESI+) m/z 357 [M+H]+, 379 [M+Na]+; LC–MS–MS 357:
161, 188; Anal. (C21H32N4O·2HCl·5/4H2O) C, H, N.
4-[3-(4-Cyclohexylpiperazin-1-yl)propyl]-2H-pyrido[3,2-b]-[1,4]-
oxazin-3-(4H)-one (13): The brown semi-solid was purified by
a flash column chromatography using CH2Cl2/CH3OH (95:5) as
eluent to afford the title compound as a yellow oil (0.093 g, 26%):
1H NMR d=1.06–1.36 [m, 5H, cyclohexyl, NCH(CHH)5], 1.58-1.70 (m,
&6
&
www.chemmedchem.org
ꢀ 2012 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
ChemMedChem 0000, 00, 1 – 12
ÝÝ
These are not the final page numbers!

Potential s2 Receptor Antagonists
MED
1H, cyclohexyl), 1.72–1.98 [m, 6H, cyclohexyl NCH(CHH)4,
CONCH2CH2CH2N], 2.24–2.38 (m, 1H, CHN), 2.44 (t, 2H, J=7.10 Hz,
CONCH2CH2CH2N), 2.48–2.75 (m, 8H, piperazine), 4.17 [t, 2H, J=
7.40 Hz, CONCH2(CH2)2], 4.64 (s, 2H, OCH2CO), 6.87–6.92 (m, 1H, ar-
omatic), 7.18–7.25 (m, 1H, aromatic), 7.98–8.05 ppm (m, 1H, aro-
matic); GC–MS m/z 360 (M++2, 1), 359 (M++1, 7), 358 (M+, 31),
248 (50), 234 (59), 220 (92), 191 (100), 181 (81), 133 (42); Anal.
(C20H30N4O2·2HCl·H2O) C, H, N.
) m/z 375 [M+H]+, 397 [M+Na]+; LC–MS–MS 375: 137, 165, 207,
333; Anal. (C21H34N4O2·2C2H2O4·3/2H2O) C, H, N.
1-(4-Cyclohexylpiperazin-1-yl)-N-acetyl-N-(2-pyridyl)-4-aminobu-
tan-1-one (24): The brown semi-solid was purified by flash column
chromatography using CH2Cl2/CH3OH (95:5) as eluent, affording
1
the title compound as a yellow oil (0.026 g, 7%): H NMR d=1.08–
1.48 [m, 5H, cyclohexyl, NCH(CHH)5], 1.50–2.04 [m, 10H, cyclohexyl
NCH(CHH)5, CONCH2CH2CH2N and CH3CO], 2.05–2.25 (m, 1H, NCH),
2.39 (t, 2H, J=7.1 Hz, CH2CON), 2.65–3.10 (m, 4H, CH2NCH2 pipera-
zine), 3.70–4.10 [m, 6H, CH3CONCH2 and (CH2)2NCO piperazine],
7.19–7.34 (m, 2H, aromatic), 7.72–7.85 (m, 1H, aromatic), 8.48–
8.58 ppm (m, 1H, aromatic); LC–MS–MS (ESI+) m/z 373 [M+H]+,
395 [M+Na]+; LC–MS–MS 373: 163, 237, 331.
1-(4-Cyclohexylpiperazin-1-yl)-4-[2(1H)-oxo-3,4-dihydro-1,8-
naphthyridin-1-yl]butan-1-one (16): The yellow solid was purified
by column chromatography with CH2Cl2/CH3OH (98:2) as eluent to
give the target compound as a white semi-solid (0.123 g, 32%):
1H NMR d=1.06–1.32 [m, 5H, cyclohexyl NCH(CHH)5], 1.58–1.70 (m,
1H, cyclohexyl), 1.75-1.90 [m, 4H, cyclohexyl, NCH(CHH)4], 1.98 (m,
2H, CONCH2CH2CH2CO), 2.23–2.32 (m, 1H, CHN), 2.38 [t, 2H, J=
7.4 Hz, CON(CH2)2CH2CO], 2.5–2.56 [m, 4H, piperazine, CHN(CH2)2],
2.66 (t, 2H, J=8.2 Hz, ArCH2CH2CO), 2.87 (t, 2H, J=8.2 Hz,
ArCH2CH2CO), 3.42 (t, 2H, piperazine, J=4.8 Hz, CONCH2), 3.58 (t,
2H, piperazine, J=4.8 Hz, CONCH2), 4.20 [t, 2H, J=7.1 Hz, CON-
(CH2)2CH2N], 6.87–6.91 (m, 1H, aromatic), 7.41–7.44 (m, 1H, aromat-
ic), 8.20–8.22 ppm (m, 1H, aromatic); GC–MS m/z 386 (M++2, 1),
385 (M++1, 6), 384 (M+, 25), 341 (65), 217 (100), 175 (58).
1-(4-Cyclohexylpiperazin-1-yl)-N-acetyl-N-(2-pyridyl)-5-aminobu-
tan-1-one (25): The yellow residue was purified by column chro-
matography with CH2Cl2 as eluent to afford the title compound as
1
a yellow oil (0.12 g, 30%): H NMR d=1.02-1.32 [m, 5H, cyclohexyl
NCH(CHH)5], 1.52–1.68 [m, 5H, cyclohexyl NCH(CHH)5], 1.75–1.93
[m, 4H, CONCH2(CH2)2CH2CO], 1.97 (s, 3H, CH3CO), 2.18-2.38 [m,
3H, CHN, (CH2)3CH2CO], 2.47–2.58 (m, 4H, piperazine CH2NCH2),
3.38–3.48 (m, 2H, piperazine CH2NCO), 3.52–3.65 (m, 2H, pipera-
zine CH2NCO), 3.85 [t, 2H, J=6.8 Hz, CONCH2(CH2)3CON], 7.20–7.25
(m, 2H, aromatic), 7.72–7.78 (m, 1H, aromatic), 8.50 ppm (m, 1H,
aromatic); GC–MS m/z 386 (M+, 4), 343 (32), 219 (31), 177 (85), 138
(100), 126 (58), 107 (35); LC–MS (ESI+) m/z 409 [M+Na]+; LC–MS–
MS 409: 367.
1-(4-Cyclohexylpiperazin-1-yl)-5-[2(1H)-oxo-3,4-dihydro-1,8-
naphthyridin-1-yl]pentan-1-one (17): The yellow semi-solid was
purified by column chromatography with CH2Cl2/CH3OH (98:2) as
eluent to afford the title compound as a yellow semi-solid (0.179 g,
1
General procedure for the synthesis of compounds 14, 15, 18,
19, and 26–29: A solution of BH3·THF complex (1 m) in THF
(2.5 mL for 12, 13, 22, and 23, and 5 mL for 16, 17, 24, and 25)
was added to one of the appropriate amide compounds
(1.0 mmol) in anhydrous THF under N2. The solution was stirred at
reflux for 3 h. The reaction mixture was cooled, then MeOH was
added to destroy the excess hydride. The solvent was removed
under reduced pressure to give a white solid that was re-dissolved
in MeOH. A solution of iPrOH saturated with HCl(gas) was added to
this suspension, and the mixture was held at reflux for 30 min.
After cooling, the solvent was evaporated under reduced pressure.
The residue was re-dissolved with Na2CO3 (saturated solution), and
the mixture was extracted with CH2Cl2 (3ꢂ10 mL). The collected or-
ganic layers were dried over Na2SO4 and evaporated under re-
duced pressure to give crude residues which were purified as re-
ported below for each compound.
45%): H NMR d=1.07–1.36 [m, 5H, cyclohexyl, NCH(CHH)5], 1.56–
1.98 [m, 9H, cyclohexyl NCH(CHH)5 and CONCH2(CH2)2CH2CO],
2.28–2.43 [m, 3H, CHN and CON(CH2)3CH2CO], 2.45–2.70 [m+t, 6H,
J=8.2 Hz, piperazine N(CH2)2 and ArCH2CH2CO], 2.86 (t, 2H, J=
8.2 Hz, ArCH2CH2CO), 3.42–3.75 [m, 4H, piperazine CON(CH2)2], 4.16
[t, 2H, J=7.1 Hz, CONCH2(CH2)3CO], 6.87–6.91 (m, 1H, aromatic),
7.41–7.43 (m, 1H, aromatic), 8.20–8.22 ppm (m, 1H, aromatic); GC–
MS m/z 399 (M++1, 3), 398 (M+, 14), 355 (44), 231 (100), 138 (85),
126 (47).
N-[3-(4-Cyclohexylpiperazin-1-yl)propyl]-N-(2-pyridyl)acetamide
(22): The brown residue was purified by column chromatography
with CHCl3 as eluent to give the title compound as pale brown oil
(0.14 g, 40%): 1H NMR d=1.00-1.37 [m, 5H, cyclohexyl, NCH-
(CHH)5], 1.58–1.95 [m, 7H, cyclohexyl NCH(CHH)5 and
CONCH2CH2CH2N], 1.99 (s, 3H, CH3CO), 2.15–2.22 (m, 1H, NCH),
2.29–2.54 [m+t, 10H, J=7.1 Hz, CON(CH2)2CH2N and piperazine],
3.87 [t, 2H, J=7.4 Hz, CONCH2(CH2)2N], 7.19–7.21 (m, 2H, aromat-
ic), 7.71–7.77 (m, 1H, aromatic), 8.50 ppm (m, 1H, aromatic);
13C NMR (title compound as oxalate salt): d=21.79, 22.32, 24.34,
24.42, 26.60, 45.12, 45.62, 54.34, 66.37, 12299, 124.74, 141.24,
149.01, 153.17, 165.84, 174.25 ppm; GC–MS m/z 345 (M+ +1, 1),
344 (M+, 1), 219 (42), 206 (100), 181 (49), 177 (39), 135 (21); LC–MS
(ESI+) m/z 345 [M+H]+, 367 [M+Na]+; LC–MS–MS 345: 135, 177;
Anal. (C20H32N4O·2C2H2O4·H2O) C, H, N.
1-[3-(4-Cyclohexylpiperazin-1-yl)propyl]-1,2,3,4-tetrahydro-1,8-
naphthyridine (14): The yellow residue was purified by column
chromatography with CH2Cl2/CH3OH (95:5) as eluent to give the
1
final compound as a light yellow semi-solid (0.212 g, 62%): H NMR
d=1.07–1.38 [m, 5H, cyclohexyl NCH(CHH)5], 1.58–2.05 [m, 9H, cy-
clohexyl NCH(CHH)5 and ArCH2CH2CH2NCH2CH2CH2N], 2.28–2.50
[m+t, 3H, CHN, J=7.1 Hz, N(CH2)2CH2N], 2.55–2.88 (m+t, 10H, pi-
perazine, J=6.3 Hz, ArCH2), 3.36 [t, 2H, J=5.6 Hz, Ar(CH2)2CH2N],
3.59 [t, 2H, J=7.1 Hz, NCH2(CH2)2N], 6.38 (t, 1H, J=4.9 Hz, aromat-
ic), 7.04 (d, 1H, J=5.5 Hz, aromatic), 7.90 ppm (d, 1H, J=4.9 Hz, ar-
omatic); GC–MS m/z 342 (M+, 2), 204 (100), 161 (43), 147 (86);
Anal. (C21H34N4·3HCl·5/4H2O) C, H, N.
N-[3-(4-Cyclohexylpiperazin-1-yl)propyl]-N-(4-methoxy-2-pyridy-
l)acetamide (23): The brown residue was purified by column chro-
matography with CH2Cl2/CH3OH (9:1) as eluent to give the title
1
compound as a yellow oil (0.12 g, 31%): H NMR d=1.04–1.27 [m,
4-[3-(4-Cyclohexylpiperazin-1-yl)propyl]-3,4-dihydro-2H-pyrido-
[3,2-b]-[1,4]-oxazine (15): The yellow residue was purified by
column chromatography with CH2Cl2/CH3OH (9:1) as eluent to give
5H, cyclohexyl, NCH(CHH)5], 1.59–1.91 [m, 7H, cyclohexyl, NCH-
(CHH)5 and CONCH2CH2CH2N], 1.99 (s, 3H, CH3CO), 2.15–2.25 (m,
1H, NCH), 2.32 [t, 2H, J=7.4 Hz, CON(CH2)2CH2N], 2.34–2.54 (m,
8H, piperazine), 3.81–3.86 [m, 5H, CONCH2(CH2)2N and OCH3],
6.71–6.76 (m, 2H, aromatic), 8.31 ppm (d, 1H, aromatic); GC–MS
m/z 359 (2), 236 (88), 207 (40), 151 (55), 137 (100); LC–MS–MS (ESI+
1
the title compound as a light yellow oil (0.210 g, 61%): H NMR d=
1.05–1.38 [m, 5H, cyclohexyl NCH(CHH)5], 1.58–1.72 [m, 1H, cyclo-
hexyl NCH(CHH)], 1.75–1.94 [m, 4H, cyclohexyl NCH(CHH)4], 1.95–
2.12 [m, 2H, NCH2CH2CH2N], 2.42–2.59 (m, 3H, CHN, and
ChemMedChem 0000, 00, 1 – 12
ꢀ 2012 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.chemmedchem.org
&
7
&
ÞÞ
These are not the final page numbers!

C. Abate et al.
MED
NCH2CH2CH2N), 2.62–2.98 (m, 8H, piperazine), 3.47 (t, 2H, J=
4.54 Hz, OCH2CH2N), 3.62 [t, 2H, J=7.15 Hz, NCH2(CH2)2N], 4.19 (t,
2H, J=4.54 Hz, OCH2CH2N), 6.44–6.50 (m, 1H, aromatic), 6.86–6.92
(m, 1H, aromatic), 7.68–7.72 ppm (m, 1H, aromatic); GC–MS m/z
346 (M++2, 0.4), 345 (M++1, 3), 344 (M+, 13), 206 (100), 163 (41),
149 (59), 97 (38); Anal. (C20H32N4O·3HCl·1/2H2O) C, H, N.
3-(4-Cyclohexylpiperazin-1-yl)-N-Ethyl-N-(2-pyridyl)butanamine
(28): The yellow solid residue was purified by column chromatog-
raphy with CH2Cl2/CH3OH (95:5) as eluent to give the title com-
1
pound as a pale yellow semi-solid (0.248 g, 73%): H NMR d=0.98–
1.38 [m+t, 8H, J=7.1 Hz, CH3 and cyclohexyl NCH(CHH)5], 1.45–
1.64 [m, 5H, cyclohexyl NCH(CHH)5], 1.70–2.05 [m, 4H, NCH2-
(CH2)2CH2N], 2.22–2.44 [m, 3H, CHN and N(CH2)3CH2N)], 2.50–2.80
(m, 8H, piperazine), 3.35–3.56 [m, 4H, CH3CH2NCH2(CH2)3N], 6.38–
6.50 (m, 2H, aromatic), 7.32–7.45 (m, 1H, aromatic), 8.11 ppm (d,
1H, J=4.9 Hz, aromatic); LC–MS (ESI+) m/z 345 [M+H]+; LC–MS–
MS 345: 149, 177, 223; Anal. (C21H36N4·3C2H2O4·3/4H2O) C, H, N.
1-[4-(4-Cyclohexylpiperazin-1-yl)butyl]-1,2,3,4-tetrahydro-1,8-
naphthyridine (18): The yellow residue was purified by column
chromatography with CH2Cl2/CH3OH (98:2) as eluent, affording the
1
title compound as a light brown semi-solid (0.257 g, 72%): H NMR
d=1.02–1.36 [m, 5H, cyclohexyl NCH(CHH)5], 1.42–1.69 [m, 5H, cy-
clohexyl NCH(CHH)5], 1.72–2.00 [m, 6H, ArCH2CH2CH2NCH2-
(CH2)2CH2N], 2.21–2.78 [m+t, 13H, CHN, J=6.8 Hz, N(CH2)3CH2N, pi-
perazine, and ArCH2(CH2)2N], 3.35 [t, 2H, J=5.6 Hz, Ar(CH2)2CH2N],
3.57 [t, 2H, J=7.1 Hz, NCH2(CH2)3N], 6.36 (t, 1H, J=4.9 Hz, aromat-
ic), 7.04 (d, 1H, J=5.2 Hz, aromatic), 7.90 ppm (d, 1H, J=4.9 Hz, ar-
omatic); GC–MS m/z 358 (M++2, 0.1), 357 (M++1, 0.2), 356 (M+,
1), 218 (100), 147 (39); LC–MS (ESI+) m/z 357 [M+H] +; LC–MS–MS
357: 147, 189, 223; Anal. (C22H36N4·3HCl·5/2H2O) C, H, N.
3-(4-Cyclohexylpiperazin-1-yl)-N-Ethyl-N-(2-pyridyl)pentanamine
(29): The yellow solid residue was purified by column chromatog-
raphy with CH2Cl2/CH3OH (85:15) as eluent to give the title com-
1
pound as a yellow oil (0.194 g, 54%): H NMR d=1.06–1.38 [m+t,
10H, J=7.1 Hz, CH3CH2N, cyclohexyl NCH(CHH)5, and N(CH2)2CH2-
(CH2)2N], 1.44–1.69 [m, 5H, cyclohexyl NCH(CHH)5], 1.70–1.98 (m,
4H, NCH2CH2CH2CH2CH2N), 2.20–2.38 [m+t, 3H, J=7.9 Hz,
N(CH2)4CH2N and CHN], 2.43–2.78 (m, 8H, piperazine), 3.40 [t, 2H,
J=7.4 Hz, NCH2(CH2)4N], 3.49 (q, 2H, J=7.1 Hz, CH3CH2N), 6.40–
6.47 (m, 2H, aromatic), 7.35-7.41 (m, 1H, J=6,8 Hz, aromatic),
8.11 ppm (d, 1H, J=4,9 Hz, aromatic); GC–MS m/z 359 (M++1, 1),
358 (M+, 5), 220 (100), 181 (34), 135 (26), 125 (43); Anal.
(C22H38N4·2C2H2O4·1/2H2O) C, H, N.
1-[5-(4-Cyclohexylpiperazin-1-yl)pentyl]-1,2,3,4-tetrahydro-1,8-
naphthyridine (19): The yellow residue was purified by column
chromatography with CH2Cl2/CH3OH (98:2) as eluent to give the
title compound as an orange semi-solid (0.333 g, 90%): 1H NMR
d=1.06–1.42 [m, 7H, cyclohexyl NCH(CHH)5, N(CH2)2CH2(CH2)2N],
1.49–1.70 [m, 5H, cyclohexyl NCH (CHH)5], 1.78–2.04 [m, 7H,
ArCH2CH2CH2NCH2CH2CH2CH2CH2N, and CHN], 2.35 [t, 2H, J=
7.8 Hz, (CH2)4CH2N], 2.55–2.71 [m+t, 10H, J=6.0 Hz, piperazine,
ArCH2(CH2)2N], 3.35 [t, 2H, J=5.6 Hz, Ar(CH2)2CH2N], 3.55 [t, 2H, J=
7.4 Hz, NCH2(CH2)4N], 6.37 (t, 1H, J=4.9 Hz, aromatic), 7.05 (d, 1H,
J=5.5 Hz, aromatic), 7.91 ppm (d, 1H, J=4.9 Hz, aromatic);
13C NMR (title compound as hydrochloride salt): d=17.99, 21.44,
21.75, 23.12, 23.44, 24.69, 25.14, 36.89, 39.98, 42.03, 45.20, 49.55,
52.17, 64.17, 109.99, 122.51, 131.55, 138.69, 148.17 ppm; GC–MS
m/z 371 (M++1, 1), 370 (M+, 3), 232 (100), 147 (30); Anal.
(C23H38N4·3HCl·3H2O) C, H, N.
General procedure for the synthesis of intermediate compounds
33 and 34: Amine 32 (1.0 mmol, 0.22 g) was added to a solution
of pyridine-1-oxide derivative 30 or 31 (1.0 mmol) in n-butanol
(4 mL) in the presence of Et3N (1.0 mmol, 0.14 mL). The reaction
mixture was heated at 1208C for 20 h. After cooling, the solvent
was evaporated under reduced pressure to give a brown oil resi-
due.
3-(4-Cyclohexylpiperazin-1-yl)-N-(2-pyridyl-N-oxide)propanamine
(33): The brown oil was purified by column chromatography with
CH2Cl2/MeOH (9:1) as eluent affording the title compound as
a yellow semi-solid (0.178 g, 56%): 1H NMR d=1.10–1.74 (m, 7H,
cyclohexyl), 1.84–2.03 [m, 5H, 3H of cyclohexyl and NHCH2CH2],
2.16–2.29 (m, 1H, cyclohexyl CHN), 2.69 [t, 2H, J=5.7 Hz,
(CH2)2CH2N], 2.79–2.98 (m, 4H, piperazine), 3.26–3.37 (m, 6H, 4 pi-
perazine and NHCH2), 6.49–6.54 (m, 2H, aromatic), 7.15–7.24 (m,
1H, aromatic), 8.06–8.16 (m, 1H, aromatic), 8.26 ppm (broad s, 1H,
NH, D2O exchanged); LC–MS (ESI+) m/z 319 [M+H]+; LC–MS–MS
319: 135, 181, 237.
3-(4-Cyclohexylpiperazin-1-yl)-N-Ethyl-N-(2-pyridyl)propanamine
(26): The yellow residue was purified by column chromatography
with CH2Cl2/CH3OH (95:5) as eluent to give the title compound as
1
a light brown oil (0.248 g, 75%): H NMR d=1.02–1.30 [m+t, 8H,
J=7.1 Hz, CH3 and cyclohexyl NCH(CHH)5,], 1.58–1.94 [m, 7H, cy-
clohexyl NCH(CHH)5 and NCH2CH2CH2N], 2.20–2.30 (m, 1H, CHN),
2.37 (t, 2H, J=7.1 Hz, NCH2CH2CH2N), 2.40–2.71 (m, 8H, pipera-
zine), 3.43-3.55 [m, 4H, CH3CH2NCH2(CH2)2], 6.44-6.48 (m, 2H, aro-
matic), 7.35-7.41 (m, 1H, aromatic), 8.11 ppm (d, 1H, J=4.9 Hz, aro-
matic); 13C NMR (title compound as oxalate salt): d=10.91, 21.49,
24.43, 26.59, 44.97, 45.75, 46.28, 53.73, 66.34, 112.14, 135.89,
144.15, 151.13, 166.14 ppm; GC–MS m/z 331 (M++1, 2), 330 (M+,
4), 192 (100), 149 (37), 135 (73), 107 (33); Anal. (C20H34N4·3C2H2O4)
C, H, N.
3-(4-Cyclohexylpiperazin-1-yl)-N-(4-methoxy-2-pyridyl-N-oxide)-
propanamine (34): The brown oil was purified by column chroma-
tography with CHCl3/MeOH (9:1) as eluent affording the title com-
pound as an orange oil (0.30 g, 86%): 1H NMR d=1.11–1.78 (m,
7H, cyclohexyl), 1.90–2.16 (m, 5H, 3H of cyclohexyl and
NHCH2CH2), 2.16–2.35 (m, 1H, cyclohexyl CHN), 2.74 [t, 2H, J=
5.2 Hz, (CH2)2CH2N], 3.03–3.11 (m, 4H, piperazine), 3.30–3.40 [m,
6H, 4 piperazine and NHCH2(CH2)2], 3.84 (s, 3H, OCH3), 5.95–6.00
(m, 1H, aromatic), 6.15–6.20 (m, 1H, aromatic), 7.95–8.00 (m, 1H,
aromatic), 8.06 ppm (broad s, 1H, NH, D2O exchanged); LC–MS
(ESI+) m/z 349 [M+H]+; LC–MS–MS 349: 137, 165, 267.
3-(4-Cyclohexylpiperazin-1-yl)-N-Ethyl-N-(4-methoxy-2-pyridyl)-
propanamine (27): The yellow oil was purified by column chroma-
tography with CH2Cl2/CH3OH/NH4OH (9:1:0.1) as eluent to give the
title compound as a pale yellow oil (0.198 g, 55%): 1H NMR d=
1.07–1.29 [m+t, 8H, J=7.1 Hz, CH3 and cyclohexyl NCH(CHH)5],
1.60–1.99 [m, 7H, cyclohexyl NCH(CHH)5 and NCH2CH2CH2N], 2.30–
2.33 (m, 1H, CHN), 2.40 [t, 2H, J=7.1 Hz, (CH2)2CH2N], 2.56–2.67
(m, 8H, piperazine), 3.42–3.54 [m, 4H, CH3CH2NCH2(CH2)2N], 3.78 (s,
3H, OCH3), 5.93 (d, 1H, J=2.2 Hz, aromatic), 6.12–6.14 (dd, 1H, J=
5.7 Hz and J’=2.2 Hz, aromatic), 7.96 ppm (d, 1H, J=5.7 Hz, aro-
matic); GC–MS m/z 360 (M+, 1), 222 (100), 179 (50), 165 (83), 137
(48); Anal. (C21H36N4O·3C2H2O4) C, H, N.
General procedure for the synthesis of Final Compounds 35 and
36: To a suspension of intermediate 33 or 34 (1.0 mmol) in CHCl3
(15 mL) cooled at 08C, PCl3 (3.0 mmol, 0.26 mL) was added in
a dropwise manner, and the mixture was heated for 1 h at 808C.
After cooling, water was added, and the reaction mixture was
made alkaline by adding NaOH and extracted with CHCl3 (3ꢂ
70 mL). The collected organic solutions were dried (Na2SO4) and
the crude residue was purified as reported below.
&8
&
www.chemmedchem.org
ꢀ 2012 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
ChemMedChem 0000, 00, 1 – 12
ÝÝ
These are not the final page numbers!

Potential s2 Receptor Antagonists
MED
3-(4-Cyclohexylpiperazin-1-yl)-N-(2-pyridyl)propanamine
(35):
(50 mm Tris, pH 7.4), then the suspension was filtered through GF/
C presoaked in 0.5% polyethylenimine (PEI) for at least 30 min
prior to use. The filters were washed twice with 1 mL ice-cold
buffer. s2 Receptors were radiolabeled using [3H]-DTG concentra-
tions of 0.5–40 nm. Samples containing 200 mg membrane protein,
radioligand, 10 mm DTG (to determine nonspecific binding), and
1 mm (+)-pentazocine (to mask s1 receptors) were equilibrated in
a final volume of 500 mL (50 mm Tris, pH 8.0) for 120 min at 258C;
the subsequent manipulations were as described above for s1 re-
ceptors. Scatchard parameters (Kd and Bmax) were determined by
nonlinear curve fitting, using the Prism GraphPad software (ver-
sion 3.0).[40]
The crude yellow oil was purified by column chromatography with
CH2Cl2/CH3OH (9:1) as eluent to give the title compound as
a yellow semi-solid (0.142 g, 47%): 1H NMR d=1.02–1.36 [m, 5H,
cyclohexyl NCH(CHH)5,], 1.55–1.75 [m, 1H, cyclohexyl NCH(CHH)],
1.76–1.98 [m, 6H, cyclohexyl NCH(CHH)4 and NHCH2CH2CH2N],
2.17–2.30 (m, 1H, CHN), 2.37 [t, 2H, J=7.1 Hz, NH(CH2)2CH2N],
2.40–2.71 (m, 8H, piperazine), 3.33 [t, 3H, J=6.6 Hz, NHCH2(CH2)2],
5.28 (broad s, 1H, NH, D2O exchanged), 6.35 (d, 1H, J=8.2 Hz, aro-
matic), 6.50–6.54 (m, 1H, aromatic), 7.34–7.40 (m, 1H, aromatic),
8.04–8.07 ppm (m, 1H, aromatic); 13C NMR (title compound as oxa-
late salt): 22.75, 24.45, 26.62, 38.69, 45.78, 49.97, 54.15, 66.33,
113.02, 135.06, 135.26, 144.09, 152.09, 166.70; GC–MS m/z 303 (M+
+1, 0.2), 302 (M+, 0.8), 164 (100), 121 (52); Anal. (C18H30N4·5/
2C2H2O4·1/2H2O) C, H, N.
Cell culture: The human SK-N-SH neuroblastoma and the human
MCF-7 breast adenocarcinoma were obtained from Interlab Cell
Line Collection (ICLC, Genoa, Italy). The MCF-7s1 line was created
in our laboratory. The HT-22 cell line was a gift from Dr. Alessandra
Rossi, (Heinrich–Pette Institute, Leibniz Institute for Experimental
Virology, Hamburg, Germany). MCF-7wt, MCF-7s1, and HT-22 cells
were grown in DMEM high glucose supplemented with 10% fetal
bovine serum, 2 mm glutamine, 100 UmLꢂ1 penicillin, 100 mgmLꢂ1
streptomycin, in a humidified incubator at 378C with a 5% CO2 at-
mosphere. SK-N-SH cell line was routinely cultured in RPMI 1640
supplemented with 10% fetal bovine serum, 2 mm glutamine,
100 UmLꢂ1 penicillin, 100 mgmLꢂ1 streptomycin, 1 mm sodium pyr-
uvate, and 1% non-essential amino acids in a humidified incubator
at 378C with a 5% CO2 atmosphere. Cell culture reagents were
purchased from EuroClone (Milan, Italy). MTT (3-[4,5-dimethylthia-
zol-2-yl]-2,5-diphenyltetrazoliumbromide), G418 (geneticin), and
fura-2-acetoxymethyl ester (Fura-2-AM) were obtained from
Sigma–Aldrich (Milan, Italy); FuGENE HD transfection reagent was
purchased from Promega (Milan, Italy); Opti-MEM was obtained
from Invitrogen.
3-(4-Cyclohexylpiperazin-1-yl)-N-(4-methoxy-2-pyridyl)propana-
mine (36): The crude brown semi-solid was purified by column
chromatography with EtOAc and petroleum ether (8:2) as eluent
to give the title compound as a yellow semi-solid (0.160 g, 48%):
1H NMR d=1.06-1.29 [m, 5H, cyclohexyl NCH(CHH)5,], 1.59–1.63 [m,
1H, cyclohexyl NCH(CHH)], 1.73–1.91 [m, 6H, cyclohexyl NCH(CHH)4
and NHCH2CH2CH2N], 2.23–2.29 (m, 1H, cyclohexyl CHN), 2.42-2.65
[t+m, 10H, J=6.8 Hz, (CH2)2CH2N and piperazine), 3.02 (broad s,
1H, NH, D2O exchanged), 3.26–3.32 [m, 2H, NHCH2(CH2)2N], 3.77 (s,
3H, OCH3), 5.82 (d, 1H, J=2.2 Hz, aromatic), 6.15–6.17 (m, 1H, J=
5.7 Hz, aromatic), 7.88 ppm (d, 1H, J=5.7 Hz, aromatic); LC–MS
(ESI+) m/z 333 [M+H]+, 355 [M+Na]+; LC–MS–MS 333: 137, 165;
Anal. (C19H32N4O·3C2H2O4·1/2H2O) C, H, N.
Biology
Competition binding assays: All of the procedures for the binding
assays were previously described. s1 And s2 receptor binding were
carried out according to Matsumoto et al.[39] [3H]-DTG, 1,3-di-2-tolyl-
Cell viability: Determination of cell growth was performed using
the MTT assay at 48 h.[23] On day 1, 25000 cells per well were
seeded into 96-well plates in a volume of 100 mL. On day 2, the
various drugs at concentrations between 0.1–100 mm were added.
In all of the experiments, the various drug solvents (EtOH, DMSO)
were added in each control to evaluate a possible solvent cytotox-
icity. After the established incubation time with drugs, MTT
(0.5 mgmLꢂ1) was added to each well, and after 3-4 h incubation
at 378C, the supernatant was removed. The formazan crystals were
solubilized using 100 mL of DMSO/EtOH (1:1) and the absorbance
values at 570 and 630 nm were determined on a Victor 3 micro-
plate reader from PerkinElmer Life Sciences.
guanidine (30 Cimmolꢂ1) and (+)-[3H]-pentazocine (34 Cimmolꢂ1
)
were purchased from PerkinElmer Life Sciences (Zavantem, Bel-
gium). DTG was purchased from Tocris Cookson Ltd. (UK). (+)-Pen-
tazocine was obtained from Sigma–Aldrich-RBI s.r.l. (Milan, Italy).
Male Dunkin guinea pigs and Wistar Hannover rats (250–300 g)
were from Harlan (Italy). The specific radioligands and tissue sour-
ces were, respectively: (a) s1 receptor, (+)-[3H]-pentazocine, guinea
pig brain membranes without cerebellum; (b) s2 receptor,[3H]-DTG
in the presence of 1 mm (+)-pentazocine to mask s1 receptors, rat
liver membranes. The following compounds were used to define
the specific binding reported in parentheses: (a) (+)-pentazocine
(73–87%), (b) DTG (85–96%). Concentrations required to inhibit
50% of radioligand specific binding (IC50) were determined using
six to nine different concentrations of the drug studied in two or
three experiments with samples in duplicate. Scatchard parameters
(Kd and Bmax) and apparent inhibition constants (Ki values) were de-
termined by nonlinear curve fitting, using Prism GraphPad software
(version 3.0).[40]
Construction of expression vector harboring s1 receptor complete
coding sequence (CDS): Total RNA was extracted from 1ꢂ106 MCF-
7wt cells using a GenElute Mammalian Total RNA Miniprep kit
(Sigma–Aldrich) and reverse transcribed with GeneAmp RNA PCR
core kit (Applied Biosystems). The full-length coding region of the
human s1 receptor (GenBank accession number NM_005866.2) was
amplified from MCF-7wt cDNA using iProof High Fidelity DNA Poly-
merase (Bio-Rad), 10 pmol of each primer (Table 3) and 1 mL of
dNTPs (10 mm for each nucleotide) in a final volume of 50 mL of
regular buffer reaction mixture. PCR was run under the following
conditions: pre-incubation at 948C for 1 min, run for 30 cycles at
948C for 10 sec, 558C for 30 sec, and 728C for 1 min, extension at
728C for 7 min. The PCR amplification product was purified using
the High Pure PCR Product Purification kit (Roche) and digested
with HindIII and BamHI (Roche). The digested DNA fragment was li-
gated with purified HindIII- and BamHI-digested pcDNA3.1(+)
vector (Invitrogen) in the sense orientation. Top10 chemically com-
petent Escherichia coli cells (Invitrogen) were transformed with the
Saturation binding assay: Saturation experiments were carried out
as described by Vilner et al. with minor modifications.[41] Mem-
branes of human MCF-7wt and MCF-7s1 breast adenocarcinoma
cells and mouse HT-22 hippocampal cells were prepared according
to Colabufo et al.[22] s1 Receptors were radiolabeled using (+)-[3H]-
pentazocine concentrations of 0.4–40 nm. Samples contained
200 mg membrane protein, radioligand, and 10 mm (+)-pentazocine
to determine nonspecific binding. Samples were incubated in
a final volume of 500 mL (50 mm Tris, pH 8.0) for 120 min at 258C.
Incubations were stopped by addition of 1 mL ice-cold buffer
ChemMedChem 0000, 00, 1 – 12
ꢀ 2012 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.chemmedchem.org
&
9
&
ÞÞ
These are not the final page numbers!

C. Abate et al.
MED
Acknowledgements
Table 3. Primers used for amplification and sequencing of s1 receptor
CDS.
The authors thank Dr. Alessandra Rossi for kindly providing HT-
22 cells and Prof. Giuseppe Cassano and Giuseppe Gasparre (Di-
partimento di Bioscienze, Biotecnologie e Scienze Farmacologi-
che, Universitꢀ degli Studi di Bari ALDO MORO, Bari, Italy) for
support with experiments on Ca2+ response.
Name
Sequence 5’!3’
CGAAAGCTTATGCAGTGGGCCGTGGGC
CAGGGATCCTCAAGGGTCCTGGCCAAAGAGG
AATACGACTCACTATAGGGA
TCCGAGTATGTGCTGCTCTT
AGAAGGCACAGTCGAGGC
SIGMA1FOR
SIGMA1REV
pcDNAF
SIGMA1FOR300
pcDNAR
Keywords: 2-aminopyridines
·
calcium
·
N-
cyclohexylpiperazines · s receptors
construct described above and the vector amplified. The plasmid
DNA was isolated using High Pure Plasmid Isolation kit
a
(Roche).[42] The fidelity of the final human s1 receptor insert in
pcDNA3.1(+) plasmid was verified by DNA sequencing using
a BigDye Terminator kit (Applied Biosystems) and the primers
shown in Table 3.
[1] A. van Waarde, A. A. Rybczynska, N. Ramakrishnan, K. Ishiwata, P. H. El-
singa, R. A. Dierckx, Curr. Pharm. Des. 2010, 16, 3519–3537.
[2] E. J. Cobos, J. M. Entrena, F. R. Nieto, C. M. Cendan, E. Del Pozo, Curr.
Neuropharmacol. 2008, 6, 344–366.
MCF-7 transfection with s1 receptor: To develop stable MCF-7s1 cell
lines, MCF-7wt cells were plated at a density of 3ꢂ106 cells in
10 mL growth medium in 100 mm Petri dishes, and incubated at
378C overnight. Cells were transfected with 17 mg of pcDNA3.1(+)
vector containing the target s1 DNA sequence as per standard pro-
tocol, using FuGENE HD transfection reagent in Opti-MEM medium
without serum. Vector-expressing cells were selected using geneti-
cin (G418). After transfection, cells were placed in normal DMEM
growth medium. After 1 day, cells were detached with trypsin/
EDTA and replated into DMEM growth medium containing geneti-
cin (800 mgmLꢂ1) and cultured for 25 days. Surviving cell clones
were picked out and propagated separately in 60 mm Petri dishes
in the same medium with 800 mgmLꢂ1 geneticin. To suppress re-
version of the phenotype, all subsequent cell culture was carried
out in DMEM growth medium as described above, supplemented
with 800 mgmLꢂ1 geneticin.[35]
[3] M. Hanner, F. F. Moebius, A. Flandorfer, H. G. Knaus, J. M. Striessnig, E.
Kempner, H. Glossmann, Proc. Natl. Acad. Sci. USA 1996, 93, 8072–8077.
[4] K. L. Jansen, R. L. Faull, P. Storey, R. A. Leslie, Brain Res. 1993, 623, 299–
302.
[5] M. Mishina, K. Ishiwata, K. Ishii, S. Kitamura, Y. Kimura, K. Kawamura, K.
Oda, T. Sasaki, O. Sakayori, M. Hamamoto, S. Kobayashi, Y. Katayama,
Acta Neurol. Scand. 2005, 112, 103–107.
[6] M. Mishina, M. Ohyama, K. Ishii, S. Kitamura, Y. Kimura, K. Oda, K. Kawa-
mura, T. Sasaki, S. Kobayashi, Y. Katayama, K. Ishiwata, Ann. Nucl. Med.
2008, 22, 151–156.
[7] A. Al-Saif, F. Al-Mohanna, S. Bohlega, Ann. Neurol. 2011, 70, 913–919.
[8] S.-Y. Tsai, T. Hayashi, T. Mori, T.-P. Su, Cent. Nerv. Syst. Agents Med. Chem.
2009, 9, 184–189.
[9] N. A. Colabufo, F. Berardi, C. Abate, M. Contino, M. Niso, R. Perrone, J.
Med. Chem. 2006, 49, 4153–4158.
[10] C. Abate, J. Elenewski, M. Niso, F. Berardi, N. A. Colabufo, A. Azzariti, R.
Perrone, R. A. Glennon, ChemMedChem 2010, 5, 268–273.
[11] C. Zeng, S. Vangveravong, J. Xu, K. C. Chang, R. S. Hotchkiss, K. T. Wheel-
er, D. Shen, Z.-P. Zhuang, H. F. Kung, R. H. Mach, Cancer Res. 2007, 67,
6708–6716.
[12] C. Abate, J. R. Hornick, D. Spitzer, W. G. Hawkins, M. Niso, R. Perrone, F.
Berardi, J. Med. Chem. 2011, 54, 5858–5867.
[13] J. Xu, C. Zeng, W. Chu, F. Pan, J. M. Rothfuss, F. Zhang, Z. Tu, D. Zhou, D.
Zeng, S. Vangveravong, F. Johnston, D. Spitzer, K. C. Chang, R. S. Hotch-
kiss, W. G. Hawkins, K. T. Wheeler, R. H. Mach, Nat. Commun. 2011, 2,
380.
[14] Phase I clinical trial, Assessment of Cellular Proliferation in Tumors by
Positron Emission Tomography (PET) Using [18F]ISO-1 (FISO PET/CT),
http://ClinicalTrials.gov ID: NCT00968656.
[15] H. Kashiwagi, J. E. McDunn, P. O. Simon, P. S. Goedegebuure, J. Xu, L.
Jones, K. Chang, F. Johnston, K. Trinkaus, R. S. Hotchkiss, R. H. Mach,
W. G. Hawkins, Mol. Cancer 2007, 6, 48.
[16] J. R. Hornick, J. Xu, S. Vangveravong, Z. Tu, J. B. Mitchem, D. Spitzer, P.
Goedegebuure, R. H. Mach, W. G. Hawkins, Mol. Cancer 2010, 9, 298.
[17] R. R. Matsumoto, B. Pouw, A. L. Mack, A. Daniels, A. Coop, Pharmacol.
Biochem. Behav. 2007, 86, 86–91.
[18] F. Berardi, S. Ferorelli, C. Abate, N. A. Colabufo, M. Contino, R. Perrone,
V. Tortorella, J. Med. Chem. 2004, 47, 2308–2317.
Fluorescence measurements for intracellular Ca2+ response detection:
Cells were seeded onto glass cover-slips at a density of 20,000 cm2
and used for fluorescence measurements after 5 days. Intracellular
[Ca2+] was estimated using the dual-wavelength ratiometric probe
Fura-2; protocols have been described elsewhere (Galiano et al.,
2004).[43] A HEPES buffer was used containing 120 mm NaCl,
5.4 mm KCl, 1.8 mm CaCl2, 1.6 mm MgCl2, 11 mm glucose, and
25 mm HEPES (pH 7.4). Agonists or other drugs were directly pipet-
ted into the chamber without perfusion. The experiment was run
at 228C. Each trace shown is the mean of values from at least
eight representatives and at least 50 total cells from four experi-
ments, performed with different cell batches; only one in four
S.E.M. values was plotted. In Figure 3, “(RꢂR0) in 60 s” is the differ-
ence between the mean value of 12 and 10 fluorescence ratio
values, measured every 5 s before and after addition of the drug
under investigation. Where indicated, data were statistically ana-
lyzed with Student’s t-test for unpaired values.[36]
[19] C. Ghelardini, N. Galeotti, A. Bartolini, Pharmacol. Biochem. Behav. 2000,
67, 659–662.
[20] F. Berardi, C. Abate, S. Ferorelli, N. A. Colabufo, R. Perrone, Cent. Nerv.
Syst. Agents Med. Chem. 2009, 9, 205–219.
[21] C. Mꢃsangeau, S. Narayanan, A. M. Green, J. Shaikh, N. Kaushal, E. Viard,
Y. T. Xu, J. A. Fishback, J. H. Poupaert, R. R. Matsumoto, C. R. McCurdy, J.
Med. Chem. 2008, 51, 1482–1486.
[22] N. A. Colabufo, F. Berardi, M. Contino, M. Niso, C. Abate, R. Perrone, V.
Tortorella, Naunyn-Schmiedeberg’s Arch. Pharmacol. 2004, 370, 106–113.
[23] A. Azzariti, N. A. Colabufo, F. Berardi, L. Porcelli, M. Niso, M. G. Simone,
R. Perrone, A. Paradiso, Mol. Cancer Ther. 2006, 5, 1807–1816.
[24] C. Abate, P. D. Mosier, F. Berardi, R. A. Glennon, Cent. Nerv. Syst. Agents
Med. Chem. 2009, 9, 246–257.
Supporting Information
Elemental analyses of the novel end products; formulas of hydro-
chloride and oxalate salts, crystallization solvents, melting points
and ClogD values, antiproliferative effects in MCF-7wt cells of com-
pound 4 alone and in co-administration with 18, description of the
preparation and spectroscopy data for the intermediate com-
pounds 6–10, 20, and 21.
&10
&
www.chemmedchem.org
ꢀ 2012 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
ChemMedChem 0000, 00, 1 – 12
ÝÝ
These are not the final page numbers!

Potential s2 Receptor Antagonists
MED
[25] C. Abate, M. Niso, M. Contino, N. A. Colabufo, S. Ferorelli, R. Perrone, F.
Berardi, ChemMedChem 2011, 6, 73–80.
[36] G. Gasparre, C. Abate, F. Berardi, G. Cassano, Eur. J. Pharmacol. 2012,
684, 59–63.
[26] C. Abate, R. Perrone, F. Berardi, Curr. Pharm. Des. 2012, 18, 938–949.
[27] C. Abate, M. Niso, E. Lacivita, P. D. Mosier, A. Toscano, R. Perrone, J. Med.
Chem. 2011, 54, 1022–1032.
[28] F. Berardi, C. Abate, S. Ferorelli, V. Uricchio, M. Niso, N. A. Colabufo, R.
Perrone, J. Med. Chem. 2009, 52, 7817–7828.
[29] A. A. Thomas, Y. Le Huerou, J. De Meese, I. Gunawardana, T. Kaplan, T. T.
Romoff, S. S. Gonzales, K. Condroski, S. A. Boyd, J. Ballard, B. Bernat, W.
DeWolf, M. Han, P. Lee, C. Lemieux, R. Pedersen, J. Pheneger, G. Poch,
D. Smith, F. Sullivan, S. Weiler, S. K. Wright, J. Lin, B. Brandhuber, G.
Vigers, Bioorg. Med. Chem. Lett. 2008, 18, 2206–2210.
[30] R. J. Sundberg, S. Jiang, Org. Prep. Proced. Int. 1997, 29, 117–122.
[31] S. J. Connon, A. F. Hegarty, Eur. J. Org. Chem. 2004, 3477–3483.
[32] C. Abate, S. Ferorelli, M. Contino, R. Marottoli, N. A. Colabufo, R. Per-
rone, F. Berardi, Eur. J. Med. Chem. 2011, 46, 4733–4741.
[33] ACD Labs, version 7.07, Advanced Chemistry Development Inc., Toron-
to, ON (Canada), 2003.
[37] G. Cassano, G. Gasparre, M. Contino, M. Niso, F. Berardi, R. Perrone, N. A.
Colabufo, Cell Calcium 2006, 40, 23–28.
[38] R. H. Mach, K. T. Wheeler, Cent. Nerv. Syst. Agents Med. Chem. 2009, 9,
230–245.
[39] R. R. Matsumoto, W. D. Bowen, M. A. Tom, D. D. Truong, B. R. De Costa,
Eur. J. Pharmacol. 1995, 280, 301–310.
[40] Prism Software, version 3.0 for Windows, GraphPad Software Inc., San
Diego, CA (USA), 1998.
[41] B. J. Vilner, C. S. John, W. D. Bowen, Cancer Res. 1995, 55, 408–413.
[42] V. Infantino, P. Convertini, F. Iacobazzi, I. Pisano, P. Scarcia, V. Iacobazzi,
Biochem. Biophys. Res. Commun. 2011, 412, 86–91.
[43] M. Galiano, G. Gasparre, C. Lippe, G. Cassano, Cell Calcium 2004, 35,
123–130.
Received: May 11, 2012
[34] J. A. Schetz, E. Perez, R. Liu, S. Chen, I. Lee, J. W. Simpkins, Brain Res.
2007, 1181, 1–9.
Revised: July 20, 2012
[35] Z. Wu, W. D. Bowen, J. Biol. Chem. 2008, 283, 28198–28215.
Published online on && &&, 0000
ChemMedChem 0000, 00, 1 – 12
ꢀ 2012 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.chemmedchem.org
&
11
&
ÞÞ
These are not the final page numbers!

FULL PAPERS
C. Abate,* S. Ferorelli, M. Niso,
C. Lovicario, V. Infantino, P. Convertini,
R. Perrone, F. Berardi
A reduced fat option: N-Cyclohexylpi-
perazine derivatives linked to a 2-ami-
nopyridine moiety were generated as
less lipophilic analogues of the s2 ago-
nist PB28. The new N-cyclohexylpipera-
zines, which display high affinity for
s subtypes, are devoid of antiprolifera-
tive activity and may be proposed as s2
receptor antagonists.
&& – &&
2-Aminopyridine Derivatives as
Potential s2 Receptor Antagonists
&12
&
www.chemmedchem.org
ꢀ 2012 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
ChemMedChem 0000, 00, 1 – 12
ÝÝ
These are not the final page numbers!