Exploiting an allosteric binding site of PRMT3 yields potent and selective inhibitors

Article abstract of DOI:10.1021/jm3018332

Protein arginine methyltransferases (PRMTs) play an important role in diverse biological processes. Among the nine known human PRMTs, PRMT3 has been implicated in ribosomal biosynthesis via asymmetric dimethylation of the 40S ribosomal protein S2 and in c

Full text of DOI:10.1021/jm3018332

Article
pubs.acs.org/jmc
Exploiting an Allosteric Binding Site of PRMT3 Yields Potent and
Selective Inhibitors
Feng Liu,†,§ Fengling Li,‡ Anqi Ma,† Elena Dobrovetsky,‡ Aiping Dong,‡ Cen Gao,† Ilia Korboukh,†
Jing Liu,† David Smil,‡ Peter J. Brown,‡ Stephen V. Frye,† Cheryl H. Arrowsmith,‡ Matthieu Schapira,‡
Masoud Vedadi,*,‡ and Jian Jin*,†
†Center for Integrative Chemical Biology and Drug Discovery, Division of Chemical Biology and Medicinal Chemistry, UNC
Eshelman School of Pharmacy, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599, United States
‡Structural Genomics Consortium, University of Toronto, Toronto, Ontario M5G 1L7, Canada
S
* Supporting Information
ABSTRACT: Protein arginine methyltransferases (PRMTs) play an important role in diverse
biological processes. Among the nine known human PRMTs, PRMT3 has been implicated in
ribosomal biosynthesis via asymmetric dimethylation of the 40S ribosomal protein S2 and in
cancer via interaction with the DAL-1 tumor suppressor protein. However, few selective
inhibitors of PRMTs have been discovered. We recently disclosed the first selective PRMT3
inhibitor, which occupies a novel allosteric binding site and is noncompetitive with both the
peptide substrate and cofactor. Here we report comprehensive structure−activity relationship studies of this series, which resulted
in the discovery of multiple PRMT3 inhibitors with submicromolar potencies. An X-ray crystal structure of compound 14u in
complex with PRMT3 confirmed that this inhibitor occupied the same allosteric binding site as our initial lead compound. These
studies provide the first experimental evidence that potent and selective inhibitors can be created by exploiting the allosteric
binding site of PRMT3.
dimethylation of rpS2 by PRMT3 results in stabilization of rpS2
and influences ribosomal biosynthesis.4,14−16 PRMT3 has also
been reported to methylate the recombinant mammalian
nuclear poly(A)-binding protein (PABPN1)17−19 and a histone
peptide (H4 1−24) in vitro.20 In addition, the protein complex
consisting of PRMT3, the von Hippel−Lindau (VHL) tumor
suppressor protein, and ARF (alternative reading frame)
methylates the tumor suppressor p53.21 Importantly, the
tumor suppressor DAL-1 (differentially expressed in adeno-
carcinoma of the lung-1) inhibits the methyltransferase activity
of PRMT3 via its interaction with PRMT3, suggesting that
DAL-1 may affect tumor growth by regulating PRMT3
function.22 Therefore, pharmacologic inhibition of PRMT3
may offer a potentially viable option for treating the tumors that
display epigenetic down-regulation of DAL-1. In addition,
PRMT3 expression levels are elevated in myocardial tissue from
patients with atherosclerosis,23 potentially implicating PRMT3
in this and related diseases. Lastly, PRMT3 function has been
reported to be essential for dendritic spine maturation in rats.24
Selective small-molecule inhibitors of PRMTs and PKMTs
are important tools for investigating the biology of this
emerging target class and testing disease and therapeutic
hypotheses regarding these enzymes.5,25−28 However, only a
limited number of selective inhibitors of PRMTs29−42,44,46 and
PKMTs43−56 have been reported. In particular, selective small-
molecule inhibitors of PRMT3 were lacking. We recently
INTRODUCTION
■
Among epigenetic writers, histone methyltransferases (HMTs,
also known as protein methyltransferases (PMTs)) are divided
into two categories: protein lysine methyltransferases (PKMTs)
and protein arginine methyltransferases (PRMTs), which
catalyze lysine and arginine methylation, respectively.1,2 Nine
human PRMTs have been identified to date and are further
divided into three subtypes.3−5 Type I PRMTs (PRMT1−
4,6,8) catalyze arginine monomethylation and asymmetric
dimethylation, while type II PRMTs such as PRMT5 catalyze
arginine monomethylation and symmetric dimethylation.
Recently, PRMT7 was characterized as a type III PRMT
which catalyzes only arginine monomethylation.6 In addition to
histone substrates, PRMTs also methylate many nonhistone
proteins.3,7 PRMTs usually methylate GAR (glycine- and
arginine-rich) motifs in their substrates,8,9 except for PRMT4,
which instead methylates PGM (proline-, glycine-, methionine-,
and arginine-rich) motifs.10,11 PRMT5 methylates both GAR
and PGM motifs.10,12 Protein arginine methylation catalyzed by
PRMTs plays a key role in various biological processes,
including gene expression, transcriptional regulation, signal
transduction, protein and RNA subcellular localization, RNA
splicing, and DNA damage repair.3−5 Dysregulation of PRMTs
has been implicated in a number of human conditions,
including cancer.3−5
PRMT3 (protein arginine methyltransferase 3), a type I
PRMT, was first reported in 199813 and subsequently shown to
catalyze asymmetric dimethylation of GAR motifs in its main
substrate: the 40S ribosomal protein S2 (rpS2).14,15 The
Received: December 12, 2012
© XXXX American Chemical Society
A
dx.doi.org/10.1021/jm3018332 | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
Figure 1. (A) Structure of PRMT3 inhibitors 1 and 2 and three regions explored for SAR. (B) X-ray crystal structure of the inhibitor 1−PRMT3
complex (PDB code 3SMQ). Key interactions include (1) a hydrogen bond between the 2-nitrogen of the benzothiadiazole and T466, (2) two
hydrogen bonds between the two amino groups of the middle urea moiety and E422, (3) a hydrogen bond between the oxygen of the urea moiety
and R396, and (4) hydrophobic interactions between the cyclohexenylethyl group and a nonpolar surface.
a
disclosed the first selective, allosteric inhibitor (compound 1 in
Figure 1A) of PRMT3.57 This inhibitor occupies neither the
substrate binding groove nor the cofactor binding site. Instead,
it occupies a novel allosteric binding site revealed by the X-ray
crystal structure of compound 1 in complex with PRMT3
(PDB code 3SMQ). Subsequent mechanism of action (MOA)
studies confirmed that this inhibitor is noncompetitive with
both the peptide substrate and the cofactor.57 Here we report
structure−activity relationship (SAR) studies that focused on
extensively exploring three regions of the scaffold represented
by compound 1. We describe the design, synthesis, and
biochemical evaluation of novel compounds, which resulted in
the discovery of potent and selective PRMT3 inhibitors. We
obtained an X-ray crystal structure of the compound 14u−
PRMT3 complex, which confirmed that this inhibitor occupied
the same allosteric binding site previously described. These
studies establish that the allosteric binding site of PRMT3 is
druggable and can be exploited to generate potent and selective
inhibitors.
Scheme 1. Synthesis of Compounds 3−7
a
Reagents and conditions: (a) CDI, THF, 2-cyclohexylethylamine, rt,
41−88%.
Table 1. SAR of the LHS Bicyclic Aromatic Moiety
RESULTS AND DISCUSSION
■
Design and Synthesis. To improve the potency of
compound 1 (PRMT3, IC50 = 2.5 μM)57 and demonstrate
that potent and selective inhibitors can be generated by
exploiting the allosteric binding site of PRMT3, we investigated
the following three regions of the chemical series represented
by compound 1: (1) the left-hand side (LHS) bicyclic aromatic
moiety, (2) the middle urea moiety, and (3) the right-hand side
(RHS) moiety (Figure 1A). We previously reported that the
uncommon cyclohexenylethyl group of compound 1 could be
replaced by a more common and potentially stable group, the
cyclohexylethyl group of compound 2 (PRMT3, IC50 = 1.0
μM), without any potency loss, and showed that the alkene
functionality was unnecessary (Figure 1A).57
Because the X-ray crystal structure of compound 1 in
complex with PRMT3 (PDB code 3SMQ) reveals that the LHS
benzothiadiazole moiety fits tightly in the allosteric pocket and
forms a hydrogen bond with T466 (threonine 466) (Figure
1B),57 we designed the compounds outlined in Scheme 1 and
Table 1 to determine whether the benzothiadiazole ring can be
replaced with other fused bicyclic aromatic groups. A
representative synthesis of these compounds (3−7) is shown
in Scheme 1. The desired compounds were prepared via a
standard urea formation reaction from commercially available
a
b
IC50 determination experiments were performed in triplicate. The
IC50 value was previously reported.57
anilines and 2-cyclohexylethylamine using 1,1′-carbonyldiimi-
dazole (CDI) as the coupling reagent.
B
dx.doi.org/10.1021/jm3018332 | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
a
Scheme 2. Synthesis of Compounds for Exploring the Middle Urea Moiety
a
Reagents and conditions: (a) N2H4·H2O, EtOH, reflux; (b) H2O2, rt, 87% over two steps; (c) KNO2/H2SO4, 0−10 °C, 62%; (d) SnCl2/HCl, 65
°C, 5 min, 61%; (e) 3,4-diethoxycyclobut-3-ene-1,2-dione, Zn(OTf)2, EtOH, rt, 92%; (f) 2-cyclohexylethylamine or 2-amino-1-phenylethanone, i-
PrOH, 120 °C, microwave, 78−85%; (g) diphenyl cyanocarbonimidate, i-PrOH, 100 °C, microwave; (h) 2-cyclohexylethylamine, i-PrOH, 100 °C,
microwave, 38% over two steps; (i) BrCN, THF, 40 °C; (j) 3-cyclohexylpropanehydrazide, HCl, i-PrOH, 160 °C, microwave, 32% over two steps.
a
We previously synthesized several analogues to confirm the
hydrogen bonds between the middle urea moiety of compound
1 and the R396 (arginine 396) and E422 (glutamate 422) of
PRMT3 (Figure 1B).57 To further investigate the middle urea
moiety, we designed and synthesized the urea bioisosteres and
more rigid analogues outlined in Scheme 2. The key
intermediate 8 was prepared according to published proce-
dures.58 Commercially available 6-nitrobenzothiazole was first
ring-opened to yield the disulfide intermediate, which was then
converted to the 6-nitrobenzothiadiazole intermediate. Sub-
sequent reduction of the nitro group afforded the intermediate
8. The nucleophilic substitution reaction of the intermediate 8
with 3,4-diethoxycyclobut-3-ene-1,2-dione59 formed the inter-
mediate 9a, which was then converted to the desired products
10 and 11 by a second nucleophilic substitution reaction with
2-cyclohexylethylamine or 2-amino-1-phenylethanone. Simi-
larly, nucleophilic substitution reaction of the intermediate 8
with diphenyl cyanocarbonimidate yielded the intermediate 9b,
which was subsequently converted to the desired product 12 by
a second substitution reaction. The aminotriazole 13 was
formed from 3-cyclohexylpropanehydrazide and the intermedi-
ate 9c, which was prepared from the intermediate 8.
In the X-ray crystal structure of the inhibitor 1−PRMT3
complex, the RHS cyclohexenylethyl moiety makes hydro-
phobic interactions with a surface formed from the two
subunits of the PRMT3 homodimer (Figure 1B). Because it
was not clear what was required for these hydrophobic
interactions and whether additional interactions could be
made, we extensively explored this region by introducing
functional groups with varying steric and electronic character-
istics to either an aliphatic or an aromatic moiety. Synthesis of
compounds 14a−v and 15 a−e (see structures in Table 3) is
outlined in Scheme 3. Compounds 14a−v were prepared via a
urea formation reaction from the intermediate 8 and various
Scheme 3. Synthesis of the Compounds Outlined in Table 3
a
Reagents and conditions: (a) CDI, DMF, various amines, rt, 35−
55%; (b) TFA, DCM, rt, 100%.
amines. Compounds 15a−e were obtained via a urea formation
reaction followed by the removal of the Boc protecting group.
To further investigate the benzoyl moiety of compound 14u,
the first PRMT3 inhibitor with submicromolar potency (see
below and Table 3), we designed and synthesized the
compounds outlined in Scheme 4 and Table 4. Compound
16 was prepared via a urea formation reaction followed by the
removal of the Boc protecting group, similar to the synthesis of
compounds 15a−e. Compounds 17−21 and 24 were
synthesized via a urea formation reaction from the intermediate
8 and various amines. Compounds 22 and 23 were obtained via
oxidation of respective alcohols 21 and 19 using the sulfur
trioxide−pyridine complex. Compounds 16, 17, 19, 20, and 21
were prepared as racemic mixtures.
These synthesized compounds were evaluated in a radio-
active biochemical assay which measures the transfer of the
tritiated methyl group from the cofactor [3H]-S-adenosylme-
thionine (SAM) to a peptide substrate. IC50 values of these
compounds in this assay are summarized in Tables 1−4.
SAR of the LHS Bicyclic Aromatic Moiety. We previously
reported that the replacement of the benzothiadiazole moiety
(compound 2) with the benzothiazole (compound 3), which
abolished the hydrogen bond with T466, resulted in complete
loss of potency.57 This SAR finding confirmed the key
hydrogen bond interaction between the middle nitrogen of
C
dx.doi.org/10.1021/jm3018332 | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
a
Scheme 4. Synthesis of the Compounds Outlined in Table 4
Table 2. Bioisosteres of the Middle Urea Moiety
a
Reagents and conditions: (a) CDI, DMF, various amines, rt, 35−
55%; (b) TFA, DCM, rt, 100%; (c) PySO3, Et3N, DCM/DMSO, rt,
76−78%.
the benzothiadiazole moiety and T466, revealed by the X-ray
crystal structure of compound 1 in complex with PRMT3.
Interestingly, the replacement of the benzothiadiazole moiety
(compound 2) with the benzotriazole (compound 4), indazole
(compound 5 or 6), or benzoxazolone (compound 7) moiety
also led to total loss of potency (Table 1), suggesting that, in
addition to making the hydrogen bond interaction with T466,
the benzothiadiazole moiety is particularly well accommodated
by the PRMT3 allosteric binding pocket due to its unique
electronic nature and steric fit. Because these relatively minor
modifications to the benzothiadiazole moiety were not
tolerated, we did not attempt to introduce more drastic
modifications such as substituted monocyclic aromatic or
nonaromatic groups and have kept this LHS moiety constant
during the subsequent SAR exploration of this hit series.
SAR of the Middle Urea Moiety. The X-ray crystal
structure of the inhibitor 1−PRMT3 complex reveals that the
carbonyl group of the middle urea moiety forms a hydrogen
bond with the guanidinium group of R396 and the two amino
groups of the urea moiety form two hydrogen bonds with the
carboxylate of E422 (glutamate 422) (Figure 1B).57 We
previously synthesized a number of analogues for probing
these hydrogen bond interactions and found that the
replacement of the oxygen of the urea moiety, which abolished
the hydrogen bond with R396, and N-methylation of either
nitrogen of the urea moiety, which impaired the hydrogen
bonds with E422, led to complete loss of potency.57 These SAR
results confirmed the key hydrogen bond interactions between
the urea moiety of inhibitor 1 and the allosteric binding site of
PRMT3.
We further investigated the middle urea moiety by design,
synthesis, and biological evaluation of the urea bioisosteres and
more rigid analogues outlined in Table 2. The diaminosquarate
10 displayed >100-fold potency loss compared with its urea
analogue (2). Similarly, the diaminosquarate 11 was >200-fold
less potent compared with its urea analogue (14u), which
contains a preferred RHS moiety (see below and Table 3). In
addition, the cyanoguanidine 12 and aminotriazole 13 showed
no inhibitory activity against PRMT3 (IC50 values >100 μM).
Taken together, these results suggest that the urea moiety is
ideal for interacting with the allosteric binding pocket of
PRMT3. We therefore held this moiety constant during
subsequent SAR exploration.
a
IC50 determination experiments were performed in triplicate.
SAR of the RHS Moiety. We previously reported that the
uncommon cyclohexenylethyl group of compound 1 could be
replaced by a more common and potentially stable group, the
cyclohexylethyl group of compound 2, without any potency
loss (Table 3).57 To improve potency, we extensively
investigated this region by introducing functional groups with
varying steric and electronic characteristics to either an aliphatic
or an aromatic moiety (Table 3). The replacement of the
cyclohexyl ring with a heterocycle such as tetrahydropyran
(compound 14a), 1-piperidine (compound 14b), morpholine
(compound 14c), 1-pyrrolidine (14e), and 4-piperidine
(compound 15a) generally resulted in a decrease in potency.
Similarly, compounds 15b−e, which contain a respective
terminal amino group to potentially form additional hydrogen
bond interaction(s) with backbone amides, were also less
potent than compound 2. A longer chain (three-carbon versus
two-carbon) was tolerated but did not lead to a significant
increase in potency (14d versus 14c, 15d versus 15c, and 15e
versus 15a). On the other hand, a shorter chain (one-carbon
versus two-carbon) resulted in a complete loss of potency (14f
versus 2). The replacement of the cyclohexyl group with a
hydrogen (compound 14g) or tert-butyl group (compound
14h) also led to a significant decrease in potency. We next
explored the replacement of the cyclohexylethyl group with a
motif containing an aromatic ring. Although the unsubstituted
benzyl group (compound 14i), three pyridinylmethyl groups
(compounds 14j−l), and two benzyl groups substituted with an
electron-donating group (compounds 14m,n) led to a
significant decrease in potency compared with the cyclo-
hexylethyl group (compound 2), we were pleased to find that
strong electron-withdrawing groups such as nitro (compound
14o) and methylsulfonyl (compound 14p) groups resulted in
similar or higher potency compared with the cyclohexylethyl
group (compound 2). Other electron-withdrawing groups such
D
dx.doi.org/10.1021/jm3018332 | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
a
Table 3. SAR of the RHS Moiety: Part I
a
IC50 determination experiments were performed in triplicate.
as cyano (compound 14q), trifluoromethyl (compound 14r),
and fluoro (compound 14s) groups gave either similar or
slightly lower potency compared with the cyclohexylethyl group
(compound 2) but significantly better potency compared with
the unsubstituted compound (14i) or electron-donating groups
(compounds 14m,n). Interestingly, moving the trifluoromethyl
group from the para-position (compound 14r) to the ortho-
position (compound 14t) resulted in a significant decrease in
potency. Further exploration of this aromatic moiety led to the
discovery of compound 14u, which contains a benzoyl group,
with an IC50 of 0.48 μM and good selectivity for PRMT3 over
other methyltransferases (see below). We also found that a
E
dx.doi.org/10.1021/jm3018332 | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
longer chain (three-carbon versus one-carbon) maintained
good potency (14v versus 14s), which is consistent with the
finding in the aliphatic subseries (see above).
17). Interestingly, compound 21, which possesses a cyclohexyl
group, was slightly more potent than compound 17, which
possesses a phenyl group instead. Although the ketone 22 had
potency similar to that of its alcohol analogue (compound 21),
the ketone 23 was about 10-fold more potent than its
corresponding alcohol (19). Further modifications of the
ketone 22 led to the discovery of the amide 24, which is the
most potent PRMT3 inhibitor to date with an IC50 of 0.23 μM.
Taken together, these results indicate that modifications to the
RHS moiety are well tolerated and can lead to a significant
increase in potency. These studies resulted in the discovery of
multiple PRMT3 inhibitors with submicromolar potencies.
Among them, compound 14u was further evaluated in
subsequent selectivity, X-ray crystallography, and computa-
tional modeling studies.
Encouraged by the discovery of the first PRMT3 inhibitors
with submicromolar potencies, we further investigated the
benzoyl moiety of compound 14u (Table 4). The replacement
of the carbonyl group (compound 14u) with an α-amino
(compound 16), α-hydroxyl (compound 17), or α,α-difluoro
(compound 18) group led to a decrease in potency. Adding a p-
or o-fluoro group to the phenyl group did not significantly
change the potency (compounds 19 and 20 versus compound
a
Table 4. SAR of the RHS Moiety: Part II
Selectivity Assessment of Compound 14u. We next
determined the selectivity of compound 14u against a number
of methyltransferases, including PRMTs, PKMTs, and DNMT1
(DNA methyltransferase 1). As shown in Figure 2, compound
14u was at least 40-fold selective for PRMT3 over G9a, GLP,
and SUV39H2 and completely inactive against PRMT5,
SETD7, PRC2, SETD8, SETDB1, SUV420H1, SUV420H2,
MLL1, SMYD3, SMYD2, DOT1L, and DNMT1. These results
are consistent with the selectivity results of compound 1
reported previously,57 suggesting that targeting the allosteric
binding site of PRMT3 can yield selective inhibitors.
X-ray Crystal Structure of the Compound 14u−
PRMT3 Complex. To better understand structural determi-
nants for the increased potency of compound 14u, we solved
the crystal structure of PRMT3 in complex with compound
14u. Similar to the binding mode of compound 1 reported
previously,57 compound 14u binds at the allosteric site located
at the interface between the two subunits of the PRMT3
homodimer (Figure 3A). The benzothiadiazole ring and urea
moiety engage hydrogen bonds with surrounding side chains
(Figure 3B). The benzoyl group is stacked against the
guanidinium group of R396, which may explain, in part, the
increased binding affinity over that of the parent compound.
Nevertheless, we were surprised to observe that the additional
carbonyl group is not better exploited in the crystal structure.
Modeling of Compound 14u Binding to PRMT3
Identifies a Potential Hydrogen Bond. Considering the
significant increase in potency accompanying the introduction
of a carbonyl group to the linker moiety, we were surprised by
the absence of a hydrogen bond at this position in the crystal
structure. We also noted that alternate rotameric states of K392
could bring its side chain within hydrogen-bonding distance of
compound 14u’s carbonyl oxygen. To see whether such a
conformation was energetically relevant, we ran a Monte Carlo-
based energy minimization of the K392 side chain and found
that the second lowest energy conformation was indeed
forming a hydrogen bond with compound 14u, within less
than 0.5 kcal/mol of the lowest energy state (Figure 4). This
suggests that K392 oscillates between two conformational states
that are nearly equivalent energetically, one forming a hydrogen
bond with compound 14u, the other not.
CONCLUSION
■
We designed, synthesized, and evaluated biochemically a series
of novel compounds that explore three regions of the scaffold
represented by compound 1. The key SAR results revealed by
these studies include the following: (1) Modifications to the
LHS benzothiadiazole moiety were not tolerated, which is
a
IC50 determination experiments were performed in triplicate.
F
dx.doi.org/10.1021/jm3018332 | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
Figure 2. Compound 14u was selective for PRMT3 over other PRMTs, PKMTs, and DNMT1. The effects of compound 14u on the activity of the
●
○
▼
◆
▼
■
following methyltransferases were assessed: (A) PRMT3 ( , IC50 = 0.48 0.01 μM), G9a ( , IC50 = 20 1 μM), GLP ( , IC50 = 25 8 μM),
□
△
●
○
△
and SUV39H2 ( , IC50 = 22 1 μM); (B) SETD7 ( ), PRC2 complex ( ), SETD8 ( ), SETDB1 ( ), SUV420H1 ( ), SUV420H2 ( ),
MLL1 complex ( ), SMYD3 ( ), SMYD2 (∇), DOT1L ( ), PRMT5−MEP50 complex ( ), and DNMT1 (⬢).
◇
□
▲
Figure 3. X-ray crystal structure of PRMT3 in complex with the inhibitor 14u (PDB code 4HSG). (A) Compound 14u binds at the allosteric site of
PRMT3 and contacts both subunits of the homodimer, as was observed with compound 1.57 (B) Critical interactions include hydrogen bonds with
T466, E422, and R396. The letter preceding the residue number indicates the PRMT3 chain (A or B).
Eclipse Plus, 4.6 × 50 mm, 1.8 μM, C18 column at room temperature.
consistent with the key finding revealed by the compound 1−
Method 1: A linear gradient from 50% to 100% B (MeOH + 0.1%
PRMT3 X-ray cocrystal structure that the benzothiadiazole ring
acetic acid) in 5.0 min was followed by pumping 100% B for another 2
fits tightly in the allosteric pocket. (2) Similarly, modifications
min with A being H2O + 0.1% acetic acid. Method 2: A linear gradient
to the middle urea moiety were not tolerated, again consistent
from 10% to 100% B (MeOH + 0.1% acetic acid) in 5.0 min was
with the findings by the X-ray cocrystal structure. (3) On the
followed by pumping 100% B for another 2 min with A being H2O +
other hand, modifications to the RHS cyclohexenylethyl moiety
0.1% acetic acid. The flow rate was 1.0 mL/min. Mass spectrometry
were well tolerated. Our extensive exploration of the RHS
(MS) data were acquired in positive ion mode using an Agilent 6110
cyclohexenylethyl group resulted in the discovery of multiple
PRMT3 inhibitors with submicromolar potencies. Among
them, compound 14u was selective for PRMT3 over 15 other
PRMTs, PKMTs, and DNMT1. The X-ray crystal structure of
the compound 14u−PRMT3 complex confirmed that this
inhibitor interacts with the same allosteric binding site. Taken
together, these studies provide the first experimental evidence
that the allosteric binding site of PRMT3 can be exploited to
generate potent and selective inhibitors.
single-quadrupole mass spectrometer with an electrospray ionization
(ESI) source. Nuclear magnetic resonance (NMR) spectra were
recorded on a Varian Mercury spectrometer at 400 MHz for proton
(1H NMR) and 100 MHz for carbon (13C NMR); chemical shifts are
reported in parts per million (δ). Preparative HPLC was performed on
an Agilent Prep 1200 series with a UV detector set to 254 nm. Samples
were injected onto a Phenomenex Luna, 75 × 30 mm, 5 μM, C18
column at room temperature. The flow rate was 30 mL/min. A linear
gradient was used with 10% (or 50%) MeOH (A) in 0.1% TFA in
H2O (B) to 100% MeOH (A). HPLC was used to establish the purity
of target compounds; all compounds had >95% purity using the
HPLC methods described above. High-resolution (positive ion) mass
spectrometry (HRMS) for compounds 14u and 24 was performed
using a Thermo LTqFT mass spectrometer under FT control at 100
000 resolution.
EXPERIMENTAL SECTION
■
Chemistry General Procedures. HPLC spectra for all com-
pounds were acquired using an Agilent 6110 series system with a UV
detector set to 254 nm. Samples were injected (5 μL) onto an Agilent
G
dx.doi.org/10.1021/jm3018332 | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
Figure 4. Monte Carlo energy minimization identifies a low-energy conformation of K392, which interacts with the carbonyl oxygen of compound
14u via a hydrogen bond. Three independent energy minimization simulations (conformational samplings 1−3) converge toward similar low-energy
conformations for K392. Conformational states placing the ε-nitrogen of K392 within hydrogen-bonding distance of 14u are listed in bold. The four
lowest energy states from sampling 1 (A−D) and the fourth state from sampling 2 (E) are shown.
Synthesis of compounds 1−3 was reported previously.57
compound 6. The title compound 6 was obtained as a white solid (78
mg, 47%): 1H NMR (400 MHz, d4-MeOH) δ 7.95 (d, J = 0.8 Hz, 1H),
7.78−7.75 (m, 1H), 7.45 (d, J = 8.9 Hz, 1H), 7.30 (dd, J = 8.9, 2.0 Hz,
1H), 3.26−3.21 (m, 2H), 1.83−1.62 (m, 5H), 1.47−1.13 (m, 6H),
1.02−0.91 (m, 2H); 13C NMR (100 MHz, d4-MeOH) δ 159.0, 138.7,
134.4, 134.2, 124.5, 123.5, 111.6, 111.3, 38.8, 38.6, 36.6, 34.4 (two
carbons), 27.7, 27.4 (two carbons); HPLC (method 2) 98%, tR 5.45
min; MS 287 [M + H]+.
1-(1H-Benzo[d][1,2,3]triazol-6-yl)-3-(2-cyclohexylethyl)urea
(4). To a solution of 6-amino-1,2,3-benzotriazole (72 mg, 0.538
mmol) in DMF (2.0 mL) was added N,N′-carbonyldiimidazole (CDI;
106 mg, 0.654 mmol), and the resulting mixture was stirred for 5 h at
rt. Cyclohexylethylamine (109 mg, 0.861 mmol) was then added. After
being stirred for 6 h at rt, the resulting mixture was purified by
preparative HPLC (50−100% methanol/0.1% TFA in H2O) to afford
1
the title compound 4 as a white solid (65 mg, 42%): H NMR (400
1-(2-Cyclohexylethyl)-3-(2-oxo-2,3-dihydrobenzo[d]oxazol-
6-yl)urea (7). The procedure used for preparation of compound 4
was followed for synthesis of compound 7. The title compound 7 was
MHz, d6-DMSO) δ 15.25 (s, 1H), 8.73 (s, 1H), 8.08 (s, 1H), 7.84 (d, J
= 9.2 Hz, 1H), 7.05 (d, J = 8.5 Hz, 1H), 6.16 (s, 1H), 3.17−3.08 (m,
2H), 1.81−1.55 (m, 5H), 1.42−1.05 (m, 6H), 0.97−0.81 (m, 2H);
HPLC (method 2) 95%, tR 5.51 min; MS (ESI) m/z 288 [M + H]+.
1-(2-Cyclohexylethyl)-3-(1H-indazol-6-yl)urea (5). The proce-
dure used for preparation of compound 4 was followed for synthesis of
compound 5. The title compound 5 was obtained as a white solid (122
1
obtained as a white solid (138 mg, 76%): H NMR (400 MHz, d6-
DMSO) δ 11.36 (s, 1H), 8.40 (s, 1H), 7.53 (d, J = 1.6 Hz, 1H), 7.00−
6.85 (m, 2H), 6.04 (t, J = 5.6 Hz, 1H), 3.15−3.03 (m, 2H), 1.75−1.54
(m, 5H), 1.38−1.06 (m, 6H), 0.97−0.80 (m, 2H); 13C NMR (100
MHz, d6-DMSO) δ 155.7, 155.1, 143.89, 136.1, 124.4, 113.5, 109.9,
100.8, 37.7, 37.2, 35.0, 33.1 (two carbons), 26.6, 26.2 (two carbons);
HPLC (method 1) 100%, tR 4.59 min; MS (ESI) m/z 304 [M + H]+.
6-Amino-1,2,3-benzothiadiazole (8). 6-Amino-1,2,3-benzothia-
diazole (8) was synthesized according to previously reported
procedures.57
1
mg, 51%): H NMR (400 MHz, d6-DMSO) δ 12.69 (s, 1H), 8.51 (s,
1H), 7.90 (s, 1H), 7.88 (s, 1H), 7.55 (d, J = 8.6 Hz, 1H), 6.81 (dd, J =
8.7, 1.7 Hz, 1H), 6.09 (t, J = 5.5 Hz, 1H), 3.19−3.06 (m, 2H), 1.86−
1.50 (m, 5H), 1.44−1.04 (m, 6H), 0.96−0.82 (m, 2H); HPLC
(method 2) 96%, tR 5.59 min; MS (ESI) m/z 287 [M + H]+.
1-(2-Cyclohexylethyl)-3-(1H-indazol-5-yl)urea (6). The proce-
dure used for preparation of compound 4 was followed for synthesis of
3-(Benzo[d][1,2, 3]thiadiazol-6-ylamino)-4-((2-
cyclohexylethyl)amino)cyclobut-3-ene-1,2-dione (10). To a
H
dx.doi.org/10.1021/jm3018332 | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
stirred solution of 3,4-diethoxycyclobut-3-ene-1,2-dione (0.26 g, 1.5
mmol, 1.2 equiv) and zinc trifluoromethanesulfonate (59 mg, 0.12
mmol) in ethanol (4.0 mL) at room temperature was added 8 (184
mg, 1.22 mmol). After the solution was stirred for 1 h, a white
precipitate was formed, which was centrifuged to remove the ethanol
and washed with ethanol (2 mL) twice, yielding the intermediate as a
white solid (309 mg, 92%). A mixture of the intermediate (67 mg,
0.244 mmol) and 2-cyclohexylethylamine (32 mg, 0.250 mmol) in 0.2
mL of i-PrOH was heated by microwave irradiation to 120 °C for 10
min in a sealed tube. After concentration in vacuo, the crude product
was purified by preparative HPLC with a gradient from 50% MeOH
(A) in 0.1% TFA in H2O (B) to 100% MeOH (A) to afford the title
compound 10 as a white solid (74 mg, 85%): 1H NMR (400 MHz, d6-
DMSO) δ 10.12 (s, 1H), 8.62 (d, J = 9.0 Hz, 1H), 8.25 (s, 1H), 7.93−
7.70 (m, 2H), 3.74−3.57 (m, 2H), 1.83−1.55 (m, 5H), 1.49 (q, J = 7.0
Hz, 2H), 1.43−1.28 (m, 1H), 1.29−1.05 (m, 3H), 1.01−0.82 (m, 2H);
13C NMR (100 MHz, d6-DMSO) δ 184.9, 180.1, 169.8, 162.6, 153.9,
(m, 2H), 1.66− 1.47 (m, 3H), 1.40 (q, J = 6.8 Hz, 2H), 1.23−1.07 (m,
2H); 13C NMR (100 MHz, d6-DMSO) δ 154.8, 153.2, 142.3, 142.2,
123.4, 119.1, 105.1, 67.0 (two carbons), 36.7, 36.3, 32.6 (two carbons),
31.9; HPLC (method 1) 99%, tR 3.23 min; MS (ESI) m/z 307 [M +
H]+.
1-(Benzo[d][1,2,3]thiadiazol-6-yl)-3-(2-(piperidin-1-yl)ethyl)-
urea (14b). The procedure used for preparation of compound 4 was
followed for synthesis of 14b. The title compound 14b was obtained as
a white solid (48 mg, 45%): 1H NMR (400 MHz, d6-acetone) δ 10.04
(s, 1H), 8.65 (d, J = 1.9 Hz, 1H), 8.48 (d, J = 9.1 Hz, 1H), 8.00 (s,
1H), 7.67 (dd, J = 9.1, 2.0 Hz, 1H), 3.92−3.83 (m, 2H), 3.77−3.68
(m, 2H), 3.50−3.42 (m, 2H), 3.20−3.06 (m, 2H), 2.03−1.93 (m, 4H),
1.92−1.83 (m, 1H), 1.66−1.52 (m, 1H); 13C NMR (100 MHz, d6-
acetone) δ 154.9, 143.5, 124.4, 120.1, 120.0, 106.2, 106.1, 59.6, 59.5,
54.6, 54.5, 35.3, 23.9, 22.5; HPLC (method 2) 98%, tR 3.08 min; MS
(ESI) m/z 306 [M + H]+.
1-(Benzo[d][1,2,3]thiadiazol-6-yl)-3-(2-morpholinoethyl)-
urea (14c). The procedure used for preparation of compound 4 was
followed for synthesis of compound 14c. The title compound 14c was
142.4, 140.6, 124.3, 119.3, 106.5, 41.6, 38.0, 34.1, 32.5 (two carbons),
26.0, 25.7 (two carbons); HPLC (method 1) 96%, tR 5.39 min; MS
(ESI) m/z 357 [M + H]+.
1
obtained as a white solid (53 mg, 47%): H NMR (400 MHz, d4-
MeOH) δ 8.51 (d, J = 1.9 Hz, 1H), 8.45 (d, J = 9.1 Hz, 1H), 7.56 (dd,
J = 9.1, 2.0 Hz, 1H), 4.15−4.00 (m, 2H), 3.81 (t, J = 11.6 Hz, 2H),
3.74−3.61 (m, 4H), 3.35 (t, J = 5.6 Hz, 2H), 3.20 (t, J = 10.4 Hz, 2H);
13C NMR (100 MHz, d4-MeOH) δ 158.4, 155.5, 144.0, 142.7, 124.5,
3-(Benzo[d][1,2,3]thiadiazol-6-ylamino)-4-((2-oxo-2-
phenylethyl)amino)cyclobut-3-ene-1,2-dione (11). The proce-
dure used for preparation of compound 10 was followed for synthesis
of compound 11. The title compound 11 was obtained as a white solid
(80 mg, 78%): 1H NMR (400 MHz, d6-DMSO) δ 10.53 (s, 1H), 8.66
(d, J = 9.0 Hz, 1H), 8.32 (s, 1H), 8.17 (s, 1H), 8.05−7.96 (m, 2H),
7.87 (d, J = 8.9 Hz, 1H), 7.77−7.68 (m, 1H), 7.60 (t, J = 7.7 Hz, 2H),
5.29 (d, J = 5.6 Hz, 2H); HPLC (method 1) 98%, tR 3.66 min; MS
(ESI) m/z 365 [M + H]+.
120.9, 107.4, 65.1 (two carbons), 59.4, 53.6 (two carbons), 35.6;
HPLC (method 2) 99%, tR 2.63 min; MS (ESI) m/z 308 [M + H]+.
1-(Benzo[d][1,2,3]thiadiazol-6-yl)-3-(3-morpholinopropyl)-
urea (14d). The procedure used for preparation of compound 4 was
followed for synthesis of compound 14d. The title compound 14d was
1
obtained as a white solid (42 mg, 39%): H NMR (400 MHz, d4-
(E)-1-(Benzo[d][1,2,3]thiadiazol-6-yl)-2-cyano-3-(2-
cyclohexylethyl)guanidine (12). A mixture of 8 (65 mg, 0.430
mmol) and diphenyl cyanocarbonimidate (82 mg, 0.344 mmol) in 0.4
mL of i-PrOH was heated by microwave irradiation to 100 °C for 60
min in a sealed tube. To the resulting mixture was added 2-
cyclohexylethylamine (109 mg, 0.86 mmol), and then the resulting
mixuture was heated by microwave irradiation to 100 °C for another
30 min. The resulting residue was purified by preparative HPLC with a
gradient from 50% MeOH (A) in 0.1% TFA in H2O (B) to 100%
MeOH (A) to afford the title compound 12 as a white solid (43 mg,
MeOH) δ 8.48−8.46 (m, 1H), 8.44 (d, J = 9.1 Hz, 1H), 7.55 (dd, J =
9.1, 2.0 Hz, 1H), 4.14−4.02 (m, 2H), 3.79 (t, J = 12.0 Hz, 2H), 3.58−
3.47 (m, 2H), 3.37 (t, J = 6.5 Hz, 2H), 3.29−3.23 (m, 2H), 3.16 (td, J
= 12.4, 3.3 Hz, 2H), 2.07−1.97 (m, 2H); 13C NMR (100 MHz, d4-
MeOH) δ 158.2, 155.4, 144.0, 142.9, 124.5, 120.8, 107.1, 65.1 (two
carbons), 56.0, 53.2 (two carbons), 37.6, 25.8; HPLC (method 2)
98%, tR 2.83 min; MS (ESI) m/z 322 [M + H]+.
1-(Benzo[d][1,2,3]thiadiazol-6-yl)-3-(2-(pyrrolidin-1-yl)-
ethyl)urea (14e). The procedure used for preparation of compound
4 was followed for synthesis of compound 14e. The title compound
14e was obtained as a white solid (48 mg, 45%): 1H NMR (400 MHz,
d4-MeOH) δ 8.50 (d, J = 2.0 Hz, 1H), 8.44 (d, J = 9.1 Hz, 1H), 7.56
(dd, J = 9.1, 2.0 Hz, 1H), 3.90−3.75 (m, 2H), 3.62 (t, J = 5.7 Hz, 2H),
3.39 (t, J = 5.7 Hz, 2H), 3.23−3.06 (m, 2H), 2.25−2.10 (m, 2H),
2.11−1.95 (m, 2H); 13C NMR (100 MHz, d4-MeOH) δ 158.0, 155.4,
143.9, 142.8, 124.5, 120.8, 107.2, 56.8, 55.6 (two carbons), 37.5, 23.9
(two carbons); HPLC (method 2) 100%, tR 2.69 min; MS (ESI) m/z
292 [M + H]+.
1
38% in two steps): H NMR (400 MHz, d6-DMSO) δ 9.50 (s, 1H),
8.61 (d, J = 9.0 Hz, 1H), 8.22 (s, 1H), 7.65 (t, J = 5.6 Hz, 1H), 7.57
(dd, J = 9.0, 1.9 Hz, 1H), 3.33−3.25 (m, 2H), 1.77−1.56 (m, 5H),
1.48−1.39 (m, 2H), 1.36−1.06 (m, 4H), 0.98−0.82 (m, 2H); HPLC
(method 1) 100%, tR 5.12 min; MS (ESI) m/z 329 [M + H]+.
N-(5-(2-Cyclohexylethyl)-4H-1,2,4-triazol-3-yl)benzo[d]-
[1,2,3]thiadiazol-6-amine (13). To a stirred solution of 8 (82 mg,
0.54 mmol) in THF (2 mL) was added cyanogen bromide solution
(0.11 mL, 5.0 M in CH3CN) at rt. The resulting mixture was stirred
overnight at 40 °C. After removal of the solvents, to the solution of the
residue in THF (1 mL) were added 2 drops of HCl solution in i-PrOH
(5 N) and 3-cyclohexylpropanehydrazide (184 mg, 1.08 mmol). The
resulting mixture was heated by microwave irradiation to 160 °C for
30 min. After being concentrated, the residue was purified by
preparative HPLC with a gradient from 50% MeOH (A) in 0.1% TFA
in H2O (B) to 100% MeOH (A) to afford the title compound 13 as a
1-(Benzo[d][1,2,3]thiadiazol-6-yl)-3-(cyclohexylmethyl)urea
(14f). The procedure used for preparation of compound 4 was
followed for synthesis of compound 14f. The title compound 14f was
1
obtained as a white solid (62 mg, 48%): H NMR (400 MHz, d6-
DMSO) δ 9.07 (s, 1H), 8.55−8.42 (m, 2H), 7.58 (dd, J = 9.0, 2.1 Hz,
1H), 6.43 (t, J = 5.8 Hz, 1H), 2.98 (t, J = 6.3 Hz, 2H), 1.73−1.64 (m,
4H), 1.64−1.54 (m, 1H), 1.47−1.35 (m, 1H), 1.26−1.07 (m, 3H),
0.97−0.85 (m, 2H); 13C NMR (100 MHz, d6-DMSO) δ 154.8, 153.2,
142.3, 142.2, 123.4, 119.1, 105.1, 45.3, 37.9, 30.3 (two carbons), 26.04,
25.4 (two carbons); HPLC (method 1) 98%, tR 5.28 min; MS (ESI)
m/z 291 [M + H]+.
1
white solid (57 mg, 32% in two steps): H NMR (400 MHz, d4-
MeOH) δ 8.50 (d, J = 2.1 Hz, 1H), 8.44 (d, J = 9.1 Hz, 1H), 7.59 (dd,
J = 9.1, 2.1 Hz, 1H), 2.87−2.79 (m, 2H), 1.86−1.71 (m, 4H), 1.71−
1.63 (m, 3H), 1.37−1.14 (m, 4H), 1.06−0.92 (m, 2H); 13C NMR
(100 MHz, d4-MeOH) δ 157.8, 157.3, 154.8, 144.6, 144.0, 124.6,
119.9, 104.6, 38.4, 36.06, 34.0 (two carbons), 27.6, 27.3 (two carbons),
24.3; HPLC (method 1) 97%, tR 5.76 min; MS (ESI) m/z 329 [M +
H]+.
1-(Benzo[d][1,2,3]thiadiazol-6-yl)-3-ethylurea (14g). The pro-
cedure used for preparation of compound 4 was followed for synthesis
of compound 14g. The title compound 14g was obtained as a white
1
solid (67 mg, 55%): H NMR (400 MHz, d6-DMSO) δ 9.13 (s, 1H),
1-(Benzo[d][1,2,3]thiadiazol-6-yl)-3-(2-(tetrahydro-2H-
pyran-4-yl)ethyl)urea (14a). The procedure used for preparation of
compound 4 was followed for synthesis of compound 14a. The title
compound 14a was obtained as a white solid (52 mg, 47%): 1H NMR
(400 MHz, d6-DMSO) δ 9.12 (s, 1H), 8.52 (d, J = 1.9 Hz, 1H), 8.50
(d, J = 9.1 Hz, 1H), 7.59 (dd, J = 9.1, 2.0 Hz, 1H), 6.41 (t, J = 5.6 Hz,
1H), 3.82 (dd, J = 11.3, 3.6 Hz, 2H), 3.30−3.21 (m, 2H), 3.21−3.11
8.52 (d, J = 1.8 Hz, 1H), 8.50 (d, J = 9.1 Hz, 1H), 7.59 (dd, J = 9.1, 2.0
Hz, 1H), 6.40 (t, J = 5.5 Hz, 1H), 3.22−3.09 (m, 2H), 1.08 (t, J = 7.2
Hz, 3H); 13C NMR (100 MHz, d6-DMSO) δ 154.7, 153.2, 142.3,
142.2, 123.4, 119.1, 105.2, 34.1, 15.3; HPLC (method 1) 100%, tR 2.03
min; MS (ESI) m/z 223 [M + H]+.
1-(Benzo[d][1,2,3]thiadiazol-6-yl)-3-(3,3-dimethylbutyl)urea
(14h). The procedure used for preparation of compound 4 was
I
dx.doi.org/10.1021/jm3018332 | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
followed for synthesis of compound 14h. The title compound 14h was
obtained as a white solid (54 mg, 49%): H NMR (400 MHz, d6-
(m, 2H), 7.08 (t, J = 6.0 Hz, 1H), 4.48 (d, J = 6.0 Hz, 2H); HPLC
(method 1) 97%, tR 3.59 min; MS (ESI) m/z 330 [M + H]+.
1-(Benzo[d][1,2,3]thiadiazol-6-yl)-3-(4-(methylsulfonyl)-
benzyl)urea (14p). The procedure used for preparation of
compound 4 was followed for synthesis of compound 14p. The title
compound 14p was obtained as a white solid (37 mg, 39%): 1H NMR
(400 MHz, d6-DMSO) δ 9.40 (s, 1H), 8.55 (d, J = 2.0 Hz, 1H), 8.52
(d, J = 9.1 Hz, 1H), 7.93−7.87 (m, 2H), 7.63 (dd, J = 9.1, 2.0 Hz, 1H),
7.58 (d, J = 8.3 Hz, 2H), 7.06 (t, J = 6.0 Hz, 1H), 4.46 (d, J = 6.0 Hz,
2H), 3.19 (s, 3H); 13C NMR (100 MHz, d6-DMSO) δ 154.9, 153.4,
146.4, 142.3, 141.9, 139.2, 127.8 (two carbons), 127.1 (two carbons),
123.5, 119.3, 105.6, 43.6, 42.5; HPLC (method 1) 100%, tR 1.92 min;
MS (ESI) m/z 363 [M + H]+.
1
DMSO) δ 9.13 (s, 1H), 8.52 (d, J = 1.7 Hz, 1H), 8.50 (d, J = 9.0 Hz,
1H), 7.59 (dd, J = 9.1, 2.0 Hz, 1H), 6.33 (t, J = 5.5 Hz, 1H), 3.20−3.07
(m, 2H), 1.45−1.32 (m, 2H), 0.92 (s, 9H); 13C NMR (100 MHz, d6-
DMSO) δ 155.1, 153.7, 142.8, 142.7, 123.9, 119.6, 105.6, 43.8, 36.3,
30.0, 29.7 (three carbons); HPLC (method 1) 97%, tR 5.01 min; MS
(ESI) m/z 279 [M + H]+.
1-(Benzo[d][1,2,3]thiadiazol-6-yl)-3-benzylurea (14i). 1-
(Benzo[d][1,2,3]thiadiazol-6-yl)-3-benzylurea (14i) was synthesized
according to previously reported procedures.57
1-(Benzo[d][1,2,3]thiadiazol-6-yl)-3-(pyridin-2-ylmethyl)urea
(14j). The procedure used for preparation of compound 4 was
followed for synthesis of compound 14j. The title compound 14j was
1-(Benzo[d][1,2,3]thiadiazol-6-yl)-3-(4-cyanobenzyl)urea
(14q). The procedure used for preparation of compound 4 was
followed for synthesis of compound 14q. The title compound 14q was
1
obtained as a white solid (57 mg, 46%): H NMR (400 MHz, d6-
DMSO) δ 9.83 (s, 1H), 8.74 (dd, J = 5.4, 0.8 Hz, 1H), 8.57−8.48 (m,
2H), 8.30 (td, J = 7.9, 1.6 Hz, 1H), 7.79 (d, J = 8.0 Hz, 1H), 7.75−7.70
(m, 1H), 7.64 (dd, J = 9.1, 2.0 Hz, 1H), 7.42 (t, J = 5.5 Hz, 1H), 4.63
(d, J = 5.3 Hz, 2H); 13C NMR (100 MHz, d6-DMSO) δ 156.5, 155.2,
153.5, 143.9, 143.0, 142.3, 141.8, 124.2, 123.8, 123.5, 119.3, 105.7,
42.5; HPLC (method 2) 99%, tR 4.15 min; MS (ESI) m/z 286 [M +
H]+.
1
obtained as a white solid (34 mg, 41%): H NMR (400 MHz, d6-
DMSO) δ 9.40 (s, 1H), 8.54 (d, J = 2.0 Hz, 1H), 8.52 (d, J = 9.1 Hz,
1H), 7.81 (d, J = 8.1 Hz, 2H), 7.62 (dd, J = 9.1, 2.0 Hz, 1H), 7.51 (d, J
= 8.1 Hz, 2H), 7.05 (t, J = 6.0 Hz, 1H), 4.43 (d, J = 6.0 Hz, 2H);
HPLC (method 1) 97%, tR 4.86 min; MS (ESI) m/z 310 [M + H]+.
1-(Benzo[d][1,2,3]thiadiazol-6-yl)-3-(4-(trifluoromethyl)-
benzyl)urea (14r). The procedure used for preparation of compound
4 was followed for synthesis of compound 14r. The title compound
14r was obtained as a white solid (52 mg, 47%): 1H NMR (400 MHz,
d6-DMSO) δ 9.38 (s, 1H), 8.55 (d, J = 1.9 Hz, 1H), 8.52 (d, J = 9.0
Hz, 1H), 7.70 (d, J = 8.1 Hz, 2H), 7.62 (dd, J = 9.1, 2.0 Hz, 1H), 7.54
(d, J = 8.0 Hz, 2H), 7.04 (t, J = 6.0 Hz, 1H), 4.44 (d, J = 6.0 Hz, 2H);
13C NMR (100 MHz, d6-DMSO) δ 155.0, 153.4, 145.1 (q, J = 1.3 Hz),
1-(Benzo[d][1,2,3]thiadiazol-6-yl)-3-(pyridin-3-ylmethyl)urea
(14k). The procedure used for preparation of compound 4 was
followed for synthesis of compound 14k. The title compound 14k was
1
obtained as a white solid (45 mg, 41%): H NMR (400 MHz, d6-
DMSO) δ 9.72 (s, 1H), 8.84 (d, J = 1.4 Hz, 1H), 8.78 (d, J = 4.8 Hz,
1H), 8.55 (d, J = 1.9 Hz, 1H), 8.52 (d, J = 9.1 Hz, 1H), 8.41 (d, J = 8.1
Hz, 1H), 7.95 (dd, J = 8.0, 5.6 Hz, 1H), 7.63 (dd, J = 9.1, 2.0 Hz, 1H),
7.42 (t, J = 5.9 Hz, 1H), 4.52 (d, J = 5.8 Hz, 2H); 13C NMR (100
MHz, d6-DMSO) δ 155.2, 153.4, 143.0, 142.3, 142.0, 141.9, 141.8,
139.6, 126.3, 123.5, 119.3, 105.6, 40.3; HPLC (method 2) 99%, tR 3.67
min; MS (ESI) m/z 286 [M + H]+.
142.3, 142.0, 127.7, 127.5 (q, J = 31.6 Hz), 125.2 (q, J = 3.8 Hz),124.4
(q, J = 271.9 Hz), 123.5, 119.3, 105.6, 42.5; HPLC (method 1) 98%, tR
4.92 min; MS (ESI) m/z 353 [M + H]+.
1-(Benzo[d][1,2,3]thiadiazol-6-yl)-3-(4-fluorobenzyl)urea
(14s). The procedure used for preparation of compound 4 was
followed for synthesis of compound 14s. The title compound 14s was
1-(Benzo[d][1,2,3]thiadiazol-6-yl)-3-(pyridin-4-ylmethyl)urea
(14l). The procedure used for preparation of compound 4 was
followed for synthesis of compound 14l. The title compound 14l was
1
obtained as a white solid (41 mg, 48%): H NMR (400 MHz, d6-
DMSO) δ 9.29 (s, 1H), 8.54 (d, J = 1.8 Hz, 1H), 8.51 (d, J = 9.1 Hz,
1H), 7.61 (dd, J = 9.1, 2.0 Hz, 1H), 7.43−7.31 (m, 2H), 7.23−7.10
(m, 2H), 6.93 (t, J = 6.0 Hz, 1H), 4.32 (d, J = 5.9 Hz, 2H); 13C NMR
(100 MHz, d6-DMSO) δ 161.15 (d, J = 242.1 Hz), 154.85, 153.33,
142.28, 142.01, 136.22 (d, J = 3.0 Hz), 129.15 (d, J = 8.2 Hz, two
carbons), 123.46, 119.23, 115.01 (d, J = 21.2 Hz, two carbons). 105.44,
42.12; HPLC (method 1) 99%, tR 4.20 min; MS (ESI) m/z 303 [M +
H]+.
1-(Benzo[d][1,2,3]thiadiazol-6-yl)-3-(2-(trifluoromethyl)-
benzyl)urea (14t). The procedure used for preparation of compound
4 was followed for synthesis of compound 14t. The title compound
14t was obtained as a white solid (32 mg, 41%): 1H NMR (400 MHz,
d6-DMSO) δ 9.43 (s, 1H), 8.55 (d, J = 1.9 Hz, 1H), 8.52 (d, J = 9.1
Hz, 1H), 7.73 (d, J = 7.7 Hz, 1H), 7.68 (t, J = 7.6 Hz, 1H), 7.65−7.58
(m, 2H), 7.48 (t, J = 7.5 Hz, 1H), 6.99 (t, J = 6.0 Hz, 1H), 4.54 (d, J =
5.8 Hz, 2H); HPLC (method 1) 99%, tR 4.76 min; MS (ESI) m/z 353
[M + H]+.
1
obtained as a white solid (51 mg, 44%): H NMR (400 MHz, d6-
DMSO) δ 9.87 (s, 1H), 8.83 (d, J = 6.6 Hz, 2H), 8.58−8.49 (m, 2H),
7.91 (d, J = 6.5 Hz, 2H), 7.65 (dd, J = 9.1, 2.0 Hz, 1H), 7.56 (t, J = 5.9
Hz, 1H), 4.61 (d, J = 5.8 Hz, 2H); 13C NMR (100 MHz, d6-DMSO) δ
160.0, 155.2, 153.4, 142.5 (two carbons), 142.3, 141.9, 124.4 (two
carbons), 123.5, 119.3, 105.7, 42.6; HPLC (method 2) 97%, tR 3.19
min; MS (ESI) m/z 286 [M + H]+.
1-(Benzo[d][1,2,3]thiadiazol-6-yl)-3-(4-(dimethylamino)-
benzyl)urea (14m). The procedure used for preparation of
compound 4 was followed for synthesis of compound 14m. The
1
title compound 14m was obtained as a white solid (31 mg, 36%): H
NMR (400 MHz, d6-DMSO) δ 9.39 (s, 1H), 8.54 (d, J = 1.9 Hz, 1H),
8.51 (d, J = 9.1 Hz, 1H), 7.61 (dd, J = 9.1, 2.0 Hz, 1H), 7.33 (d, J = 8.6
Hz, 2H), 7.16 (d, J = 8.1 Hz, 2H), 7.02 (t, J = 5.1 Hz, 1H), 4.29 (d, J =
5.1 Hz, 2H), 3.02 (s, 6H); HPLC (method 2) 97%, tR 4.74 min; MS
(ESI) m/z 328 [M + H]+.
1-(Benzo[d][1,2,3]thiadiazol-6-yl)-3-(4-methoxybenzyl)urea
(14n). The procedure used for preparation of compound 4 was
followed for synthesis of compound 14n. The title compound 14n was
1-(Benzo[d][1,2,3]thiadiazol-6-yl)-3-(2-oxo-2-phenylethyl)-
urea (14u). The procedure used for preparation of compound 4 was
followed for synthesis of compound 14u. The title compound 14u was
1
1
obtained as a white solid (61 mg, 53%): H NMR (400 MHz, d6-
obtained as a white solid (42 mg, 45%): H NMR (400 MHz, d4-
DMSO) δ 9.22 (s, 1H), 8.54 (d, J = 1.8 Hz, 1H), 8.51 (d, J = 9.1 Hz,
1H), 7.60 (dd, J = 9.1, 2.0 Hz, 1H), 7.30−7.21 (m, 2H), 6.93−6.86
(m, 2H), 6.83 (t, J = 5.8 Hz, 1H), 4.26 (d, J = 5.8 Hz, 2H), 3.73 (s,
3H); 13C NMR (100 MHz, d6-DMSO) δ 158.2, 154.8, 153.3, 142.3,
142.1, 131.8, 128.6 (two carbons), 123.5, 119.2, 113.7 (two carbons),
105.3, 55.1, 42.3; HPLC (method 1) 99%, tR 3.77 min; MS (ESI) m/z
315 [M + H]+.
MeOH) δ 8.51 (d, J = 1.9 Hz, 1H), 8.46 (d, J = 9.1 Hz, 1H), 8.05 (dt, J
= 8.5, 1.7 Hz, 2H), 7.68 − 7.63 (m, 1H), 7.55 (ddd, J = 9.2, 5.1, 1.9
Hz, 3H), 4.80 (s, 2H); 13C NMR (100 MHz, d4-MeOH) δ 196.7,
157.5, 155.4, 144.1, 143.0, 136.3, 134.9, 130.0 (two carbons), 129.0
(two carbons), 124.6, 120.7, 107.0, 47.9; HPLC (method 1) 97%, tR
3.68 min; MS (ESI) m/z 313 [M + H]+; HRMS calcd. for
C15H12N4O2S + H: 313.0759; found: 313.0747 [M + H]+.
1-(Benzo[d][1,2,3]thiadiazol-6-yl)-3-(4-nitrobenzyl)urea
(14o). The procedure used for preparation of compound 4 was
followed for synthesis of compound 14o. The title compound 14o was
obtained as a white solid (26 mg, 35%): H NMR (400 MHz, d6-
DMSO) δ 9.43 (s, 1H), 8.54 (d, J = 1.9 Hz, 1H), 8.52 (d, J = 9.1 Hz,
1H), 8.26−8.16 (m, 2H), 7.63 (dd, J = 9.1, 2.1 Hz, 1H), 7.61−7.54
1-(Benzo[d][1,2,3]thiadiazol-6-yl)-3-(3-(4-fluorophenyl)-
propyl)urea (14v). The procedure used for preparation of compound
4 was followed for synthesis of compound 14v. The title compound
14v was obtained as a white solid (42 mg, 45%): 1H NMR (400 MHz,
d6-DMSO) δ 9.15 (s, 1H), 8.52 (d, J = 1.9 Hz, 1H), 8.50 (d, J = 9.1
Hz, 1H), 7.60 (dd, J = 9.1, 2.0 Hz, 1H), 7.29−7.22 (m, 2H), 7.14−
1
J
dx.doi.org/10.1021/jm3018332 | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
7.05 (m, 2H), 6.49 (t, J = 5.6 Hz, 1H), 3.18−3.09 (m, 2H), 2.65−2.57
(m, 2H), 1.80−1.69 (m, 2H); 13C NMR (100 MHz, d6-DMSO) δ
160.6 (d, J = 241.0 Hz), 154.8, 153.2, 142.3, 142.2, 137.7 (d, J = 3.1
Hz), 130.0 (d, J = 7.9 Hz, two carbons), 123.4, 119.2, 114.9 (d, J =
20.9 Hz, two carbons), 105.2, 38.6, 31.6, 31.4; HPLC (method 1)
99%, tR 5.02 min; MS (ESI) m/z 331 [M + H]+.
NMR (400 MHz, d4-MeOH) δ 8.51−8.47 (m, 1H), 8.45−8.39 (m,
1H), 7.54 (dd, J = 9.1, 2.0 Hz, 1H), 7.52−7.41 (m, 5H), 4.53 (dd, J =
7.9, 5.5 Hz, 1H), 3.79 (dd, J = 14.5, 8.0 Hz, 1H), 3.67 (dd, J = 14.5, 5.5
Hz, 1H); 13C NMR (100 MHz, d4-MeOH) δ 157.8, 155.4, 143.9,
142.8, 136.3, 130.5, 130.4 (two carbons), 128.3 (two carbons), 124.5,
120.8, 107.1, 56.8, 44.7; HPLC (method 2) 99%, tR 3.49 min; MS
(ESI) m/z 314 [M + H]+.
1-(Benzo[d][1,2,3]thiadiazol-6-yl)-3-(2-(piperidin-4-yl)ethyl)-
urea (15a). The procedure used for preparation of compound 4 was
followed for synthesis of Boc-protected compound 15a, which was
purified by flash column chromatography on silica gel (0−10%
MeOH/DCM gradient). To a solution of Boc-protected compound
15a (70 mg, 0.172 mmol) in DCM (5 mL) was added TFA (0.5 mL).
After being stirred overnight, the resulting mixture was purified by
preparative HPLC (10−100% methanol/0.1% TFA in H2O) to afford
the title compound 15a as a mono-TFA salt (39 mg, 37% in two
1-(Benzo[d][1,2,3]thiadiazol-6-yl)-3-(2-hydroxy-2-
phenylethyl)urea (17). The procedure used for preparation of
compound 4 was followed for synthesis of compound 17. The title
1
compound 17 was obtained as a white solid (52 mg, 50%): H NMR
(400 MHz, d4-MeOH) δ 8.44−8.41 (m, 1H), 8.41−8.36 (m, 1H), 7.45
(dd, J = 9.0, 2.0 Hz, 1H), 7.43−7.39 (m, 2H), 7.37−7.31 (m, 2H),
7.29−7.23 (m, 1H), 4.80 (dd, J = 7.9, 4.5 Hz, 1H), 3.56 (dd, J = 13.7,
4.5 Hz, 1H), 3.36 (dd, J = 13.7, 7.9 Hz, 1H); 13C NMR (100 MHz, d4-
MeOH) δ 157.5, 155.2, 144.0, 143.9, 143.0, 129.4 (two carbons),
128.6, 127.1 (two carbons), 124.4, 120.6, 106.8, 73.9, 48.3; HPLC
(method 1) 99%, tR 3.27 min; MS (ESI) m/z 315 [M + H]+.
1-(Benzo[d][1,2,3]thiadiazol-6-yl)-3-(2,2-difluoro-2-
phenylethyl)urea (18). The procedure used for preparation of
compound 4 was followed for synthesis of compound 18. The title
1
steps): H NMR (400 MHz, d4-MeOH) δ 8.45 (d, J = 2.0 Hz, 1H),
8.43 (d, J = 9.2 Hz, 1H), 7.53 (dd, J = 9.1, 2.0 Hz, 1H), 3.42−3.34 (m,
2H), 3.33−3.27 (m, 2H), 2.97 (td, J = 12.8, 2.6 Hz, 2H), 2.06−1.97
(m, 2H), 1.79−1.66 (m, 1H), 1.56 (q, J = 6.9 Hz, 2H), 1.48−1.34 (m,
2H); 13C NMR (100 MHz, d4-MeOH) δ 157.6, 155.3, 144.1, 143.2,
124.5, 120.7, 106.8, 45.3 (two carbons), 37.9, 37.4, 32.5, 29.9 (two
carbons); HPLC (method 2) 99%, tR 3.13 min; MS (ESI) m/z 306 [M
+ H]+.
1
compound 18 was obtained as a white solid (42 mg, 38%): H NMR
(400 MHz, d6-DMSO) δ 9.26 (s, 1H), 8.55−8.48 (m, 2H), 7.63−7.55
(m, 3H), 7.53−7.47 (m, 3H), 6.81 (t, J = 6.3 Hz, 1H), 3.95 (td, J =
15.0, 6.3 Hz, 2H); HPLC (method 1) 98%, tR 4.15 min; MS (ESI) m/
z 335 [M + H]+.
1-(2-(cis-4-Aminocyclohexyl)ethyl)-3-(benzo[d][1,2,3]-
thiadiazol-6-yl)urea (15b). The procedure used for preparation of
compound 15a was followed for synthesis of compound 15b. The title
compound 15b was obtained as a mono-TFA salt (42 mg, 41% in two
1-(Benzo[d][1,2,3]thiadiazol-6-yl)-3-(2-(4-fluorophenyl)-2-
hydroxyethyl)urea (19). To a stirred solution of 4-fluorobenzalde-
hyde (1.24 g, 10.0 mmol) and nitromethane (2.14 mL, 40.0 mmol) in
ethanol (40 mL) was added 4.2 mL of 10% aq NaOH at 0 °C. The
resulting mixture was stirred for 2 h at 0 °C and quenched with acetic
acid (0.61 mL, 10.5 mmol). After addition of 30 mL of saturated aq
NaHCO3 and extraction with ethyl acetate (100 mL × 3), the
combined organic phase was dried with sodium sulfate, filtered, and
concentrated to afford the desired crude product 1-(4-fluorophenyl)-2-
nitroethanol. A stirred suspension of the intermediate and palladium
carbon in methanol (100 mL) was treated with hydrogen at 1 atm
overnight at rt. The product 2-amino-1-(4-fluorophenyl)ethanol was
obtained after filtration and concentration. The procedure used for
preparation of compound 4 was followed for synthesis of compound
19 from 2-amino-1-(4-fluorophenyl)ethanol. The title compound 19
was obtained as a white solid (47 mg, 49%): 1H NMR (400 MHz, d4-
MeOH) δ 8.46 (dd, J = 2.0, 0.5 Hz, 1H), 8.43 (dd, J = 9.0, 0.5 Hz,
1H), 7.49 (dd, J = 9.0, 2.0 Hz, 1H), 7.46−7.40 (m, 2H), 7.12−7.03
(m, 2H), 4.80 (dd, J = 7.7, 4.5 Hz, 1H), 3.53 (dd, J = 13.7, 4.5 Hz,
1H), 3.35 (dd, J = 13.8, 7.8 Hz, 1H); HPLC (method 1) 98%, tR 3.59
min; MS (ESI) m/z 333 [M + H]+.
1
steps): H NMR (400 MHz, d4-MeOH) δ 8.45 (d, J = 1.9 Hz, 1H),
8.43 (d, J = 9.1 Hz, 1H), 7.53 (dd, J = 9.1, 2.0 Hz, 1H), 3.29−3.23 (m,
3H), 1.87−1.63 (m, 7H), 1.63−1.42 (m, 4H); 13C NMR (100 MHz,
d4-MeOH) δ 157.6, 155.3, 144.1, 143.2, 124.5, 120.7, 106.8, 50.1, 38.7,
34.8, 32.6, 27.9 (two carbons), 27.8(two carbons); HPLC (method 2)
98%, tR 3.56 min; MS (ESI) m/z 320 [M + H]+.
1-(2-(trans-4-Aminocyclohexyl)ethyl)-3-(benzo[d][1,2,3]-
thiadiazol-6-yl)urea (15c). The procedure used for preparation of
compound 15a was followed for synthesis of compound 15c. The title
compound 15c was obtained as a mono-TFA salt (49 mg, 47% in two
1
steps): H NMR (400 MHz, d4-MeOH) δ 8.45 (d, J = 1.9 Hz, 1H),
8.43 (d, J = 9.1 Hz, 1H), 7.52 (dd, J = 9.1, 2.0 Hz, 1H), 3.28 (t, J = 7.1
Hz, 2H), 3.09−2.98 (m, 1H), 2.10−2.00 (m, 2H), 1.98−1.90 (m, 2H),
1.53−1.33 (m, 5H), 1.17−1.03 (m, 2H); 13C NMR (100 MHz, d4-
MeOH) δ 157.6, 155.3, 144.1, 143.2, 124.5, 120.7, 106.7, 51.6, 38.5,
37.8, 35.1, 31.8 (two carbons), 31.7 (two carbons); HPLC (method 2)
98%, tR 3.43 min; MS (ESI) m/z 320 [M + H]+.
1-(3-(trans-4-Aminocyclohexyl)propyl)-3-(benzo[d][1,2,3]-
thiadiazol-6-yl)urea (15d). The procedure used for preparation of
compound 15a was followed for synthesis of compound 15d. The title
compound 15d was obtained as a mono-TFA salt (29 mg, 35% in two
1-(Benzo[d][1,2,3]thiadiazol-6-yl)-3-(2-(2-fluorophenyl)-2-
hydroxyethyl)urea (20). The procedure used for preparation of
compound 19 was followed for synthesis of compound 20. The title
1
steps): H NMR (400 MHz, d4-MeOH) δ 8.48−8.41 (m, 2H), 7.52
(dd, J = 9.1, 2.0 Hz, 1H), 3.22 (t, J = 7.1 Hz, 2H), 3.02 (tt, J = 11.9, 3.9
Hz, 1H), 2.08−1.97 (m, 2H), 1.97−1.86 (m, 2H), 1.62−1.53 (m, 2H),
1.44−1.25 (m, 5H), 1.13−1.00 (m, 2H); 13C NMR (100 MHz, d4-
MeOH) δ 157.6, 155.3, 144.1, 143.2, 124.5, 120.7, 106.8, 51.7, 40.9,
37.3, 34.7, 32.0 (two carbons), 31.8 (two carbons), 28.5; HPLC
(method 2) 98%, tR 3.76 min; MS (ESI) m/z 334 [M + H]+.
1-(Benzo[d][1,2,3]thiadiazol-6-yl)-3-(3-(piperidin-4-yl)-
propyl)urea (15e). The procedure used for preparation of compound
15a was followed for synthesis of compound 15e. The title compound
1
compound 20 was obtained as a white solid (57 mg, 54%): H NMR
(400 MHz, d4-MeOH) δ 8.45−8.37 (m, 2H), 7.58 (td, J = 7.5, 1.6 Hz,
1H), 7.46 (dd, J = 9.0, 2.0 Hz, 1H), 7.29 (tdd, J = 7.3, 5.3, 1.8 Hz, 1H),
7.19 (td, J = 7.5, 0.8 Hz, 1H), 7.06 (ddd, J = 10.5, 8.2, 0.9 Hz, 1H),
5.13 (dd, J = 7.3, 4.5 Hz, 1H), 3.60 (dd, J = 13.7, 4.5 Hz, 1H), 3.44
(dd, J = 13.7, 7.4 Hz, 1H); 13C NMR (100 MHz, d4-MeOH) δ 159.9
(d, J = 244.4 Hz), 156.14, 153.88, 142.65, 141.60, 129.4 (d, J = 13.7
Hz), 128.9 (d, J = 8.3 Hz), 127.5 (d, J = 4.4 Hz), 124.0 (d, J = 3.5 Hz),
123.1, 119.2, 114.7 (d, J = 22.0 Hz), 105.4, 66.4, 45.6; HPLC (method
1) 100%, tR 3.26 min; MS (ESI) m/z 333 [M + H]+.
1
15e was obtained as a mono-TFA salt (49 mg, 45% in two steps): H
NMR (400 MHz, d4-MeOH) δ 8.43 (d, J = 2.0 Hz, 1H), 8.40 (d, J =
9.1 Hz, 1H), 7.52 (dd, J = 9.1, 2.0 Hz, 1H), 3.41−3.32 (m, 2H), 3.22
(t, J = 7.0 Hz, 2H), 2.95 (td, J = 12.8, 2.5 Hz, 2H), 1.97−1.89 (m, 2H),
1.66−1.53 (m, 3H), 1.43−1.29 (m, 4H); 13C NMR (100 MHz, d4-
MeOH) δ 157.6, 155.2, 144.0, 143.2, 124.4, 120.7, 106.7, 45.3 (two
carbons), 40.7, 34.5, 34.1, 30.0 (two carbons), 27.9; HPLC (method
2) 99%, tR 3.32 min; MS (ESI) m/z 320 [M + H]+.
1-(Benzo[d][1,2,3]thiadiazol-6-yl)-3-(2-cyclohexyl-2-
hydroxyethyl)urea (21). The procedure used for preparation of
compound 19 was followed for synthesis of compound 21. The title
1
compound 21 was obtained as a white solid (57 mg, 48%): H NMR
(400 MHz, d4-MeOH) δ 8.46 (dd, J = 2.0, 0.5 Hz, 1H), 8.42 (dd, J =
9.1, 0.5 Hz, 1H), 7.49 (dd, J = 9.1, 2.0 Hz, 1H), 3.51 (dd, J = 13.6, 3.4
Hz, 1H), 3.41 (ddd, J = 8.2, 6.4, 3.4 Hz, 1H), 3.09 (dd, J = 13.6, 8.2
Hz, 1H), 1.97−1.87 (m, 1H), 1.84−1.63 (m, 4H), 1.47−1.35 (m, 1H),
1.35−0.99 (m, 5H); 13C NMR (100 MHz, d4-MeOH) δ 157.7, 155.3,
144.1, 143.1, 124.5, 120.6, 106.7, 76.0, 44.5, 43.2, 30.3, 29.4, 27.6, 27.4,
1-(2-Amino-2-phenylethyl)-3-(benzo[d][1,2,3]thiadiazol-6-
yl)urea (16). The procedure used for preparation of compound 15a
was followed for synthesis of compound 16. The title compound 16
1
was obtained as a mono-TFA salt (48 mg, 42% in two steps): H
K
dx.doi.org/10.1021/jm3018332 | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
27.2; HPLC (method 1) 100%, tR 4.51 min; MS (ESI) m/z 321 [M +
H]+.
www.millipore.com). Reaction mixtures in 20 mM Tris−HCl, pH 8.0,
5 mM DTT, 2 mM MgCl2, and 0.01% Triton X-100 were incubated at
room temperature for 1 h, 100 μL 10% TCA was added, and the
resulting reaction mixture was mixed and transferred to a filter plate.
The plates were centrifuged at 2000 rpm for 2 min followed by two
additional 10% TCA washes and one ethanol wash (180 μL) followed
by centrifugation. The plates were dried, 100 μL of MicroO was added,
and the plates were centrifuged. A 70 μL volume of MicroO was
added, and the cpm values were measured using a Topcount plate
reader.
Cocrystallization Protocols and Structure Refinement.
PRMT3 was incubated at 1.1 mg/mL overnight with compound
14u at a 1:30 molar ratio (PRMT3:compound 14u). Following
incubation, protein was concentrated to 3 mg/mL and crystallized
using the sitting drop diffusion method at 20 °C by mixing 1 μL of the
protein solution with 1 μL of the reservoir solution containing 25%
PEG 3350, 0.2 M LiSO4, and 0.1 M Hepes, pH 7.5. Prior to freezing,
the crystals were soaked for 10 min in the same buffer with 10%
glycerol.
1-(Benzo[d][1,2,3]thiadiazol-6-yl)-3-(2-cyclohexyl-2-
oxoethyl)urea (22). To a solution of compound 21 (46 mg, 0.143
mmol) in 2.2 mL of DCM/DMSO (2:1) were added triethylamine
(0.10 mL, 0.72 mmol) and Py·SO3 (92 mg, 0.574 mmol) at rt. The
resulting mixture was stirred for 1 h at rt, quenched with 1.0 mL of
water, concentrated, and purified by preparative HPLC (50−100%
methanol/0.1% TFA in H2O) to afford the title compound 23 as a
white solid (35 mg, 78%): 1H NMR (400 MHz, d6-DMSO) δ 9.50 (s,
1H), 8.54−8.49 (m, 2H), 7.59 (dd, J = 9.2, 2.0 Hz, 1H), 6.60 (t, J = 5.2
Hz, 1H), 4.12 (d, J = 5.2 Hz, 2H), 2.49−2.42 (m, 1H), 1.86−1.55 (m,
5H), 1.33−1.09 (m, 5H); HPLC (method 1) 98%, tR 4.38 min; MS
(ESI) m/z 319 [M + H]+.
1-(Benzo[d][1,2,3]thiadiazol-6-yl)-3-(2-(4-fluorophenyl)-2-
oxoethyl)urea (23). The procedure used for preparation of
compound 22 was followed for synthesis of compound 23. The title
1
compound 23 was obtained as a white solid (36 mg, 76%): H NMR
(400 MHz, d6-DMSO) δ 9.60 (s, 1H), 8.56−8.51 (m, 2H), 8.17−8.06
(m, 2H), 7.63 (dd, J = 9.1, 2.0 Hz, 1H), 7.44−7.34 (m, 2H), 6.78 (t, J
= 5.2 Hz, 1H), 4.72 (d, J = 5.2 Hz, 2H); 13C NMR (100 MHz, d6-
DMSO) δ 194.5, 165.2 (d, J = 252.2 Hz), 154.8, 153.4, 142.3, 141.9,
131.6 (d, J = 2.9 Hz), 130.9 (d, J = 9.6 Hz, two carbons), 123.6, 119.1,
115.9 (d, J = 21.9 Hz, two carbons), 105.4, 46.8; HPLC (method 1)
98%, tR 3.82 min; MS (ESI) m/z 331 [M + H]+.
1-(Benzo[d][1,2,3]thiadiazol-6-yl)-3-(2-oxo-2-(piperidin-1-
yl)ethyl)urea (24). The procedure used for preparation of compound
4 was followed for synthesis of compound 24. The title compound 24
was obtained as a white solid (57 mg, 51%): 1H NMR (400 MHz, d6-
DMSO) δ 9.60 (s, 1H), 8.57−8.46 (m, 2H), 7.60 (dd, J = 9.2, 2.0 Hz,
1H), 6.60 (t, J = 4.5 Hz, 1H), 4.01 (d, J = 4.5 Hz, 2H), 3.53−3.45 (m,
2H), 3.38−3.31 (m, 2H), 1.63−1.48 (m, 4H), 1.48−1.39 (m, 2H). 13C
NMR (100 MHz, d6-DMSO) δ 166.6, 154.6, 153.3, 142.3, 142.0,
123.6, 119.0, 105.2, 44.8, 42.3, 41.2, 25.8, 25.2, 23.9. HPLC (method
1) 98%, tR 3.26 min; MS (ESI) m/z 320 [M + H]+; HRMS calcd. for
C14H17N5O2S + H: 320.1181; found: 320.1181 [M+H]+.
Methyltransferase Activity Assays. Methyltransferase activity
assays were performed by monitoring the incorporation of tritium-
labeled methyl group to biotinylated peptide substrates using
scintillation proximity assay (SPA) for PRMT3, SETD7, G9a, GLP,
SETDB1, SETD8, SUV420H1, SUV420H2, SUV39H2, PRC2 trimeric
complex (EZH2:EED:SUZ12), MLL1 tetrameric complex
(MLL:WDR5:RbBP5:ASH2L), PRMT5−MEP50 complex, and
SMYD2. Assay components for all assays are summarized in Table
S1 (Supporting Information). The reaction buffer for SMYD2 and
SMYD3 was 50 mM Tris, pH 9.0, 5 mM DTT, and 0.01% TritonX-
100, that for G9a, GLP, and SUV39H2 was 25 mM potassium
phosphate, pH 8.0, 1 mM EDTA, 2 mM MgCl2, and 0.01% Triton X-
100, and that for the other HMTs was 20 mM Tris, pH 8.0, 5 mM
DTT, and 0.01% TritonX-100. To stop the enzymatic reactions, 10 μL
of 7.5 M guanidine hydrochloride was added, followed by 180 μL of
buffer, and the resulting reaction mixture was mixed and transferred to
a 96-well FlashPlate (catalog no. SMP103, Perkin-Elmer, www.
perkinelmer.com). After mixing, the reaction mixtures were incubated,
and the counts per minute (cpm) were measured using a Topcount
plate reader (Perkin-Elmer). The cpm values in the absence of
compound for each data set were defined as 100% activity. In the
absence of the enzyme, the cpm values in each data set were defined as
background (0%). IC50 values were determined using compound
concentrations ranging from 100 nM to 100 μM. The IC50 values were
determined using SigmaPlot software.
Data Collection and Processing. The native data set was collected
on APS beamline 19-ID at 100 K. Program HKL2000 was used for
data processing and scaling.60
Structure Determination and Refinement. The structure of
PRMT3 in complex with compound 14u was determined by molecular
replacement using MOLREP.61 PDB entry 2FYT was used as a search
template. The graphic program Coot62 was used for manual model
refinement and visualization. Refmac563 was used to refine the model.
MolProbity64 was used to validate the refined structure; 98.0% of the
residues are the favored regions of the Ramachandran plot, and none
of them are in the disallowed regions. The structure has been
deposited in the RCSB with PDB code 4HSG.
Modeling. Monte Carlo energy minimization simulations were run
in triplicate with ICM version 3.7-2c (Molsoft, San Diego) using the
“ssearch” command. Briefly, the conformational space accessible to
K392 was sampled in the internal coordinate space, with global
conformational sampling steps followed by local energy minimization
and calculation of the complete energy potential, including surface and
advanced electrostatics terms.65 Compound 14u and residues
surrounding K392 were kept static.
ASSOCIATED CONTENT
* Supporting Information
Methyltransferase assay components and conditions, data
■
S
collection and refinement statistics of the compound 14u−
1
PRMT3 cocrystal structure, and H and 13C NMR spectra of
compounds 14u and 24. This material is available free of charge
via the Internet at http://pubs.acs.org.
AUTHOR INFORMATION
Corresponding Author
■
*Phone: (919) 843-8459 (J.J.); (416) 946-0897 (M.V.). Fax:
(919) 843-8465 (J.J.). E-mail: jianjin@unc.edu (J.J.); m.
vedadi@utoronto.ca (M.V.).
Present Address
§Department of Pharmacology, Soochow University College of
Pharmaceutical Sciences, Suzhou, China 215325.
Notes
The authors declare no competing financial interest.
For DNMT1, the assay was performed as described above using
hemimethylated dsDNA as a substrate. The dsDNA substrate was
prepared by annealing two complementary strands (biotinylated
forward strand, B-GAGCCCGTAAGCCCGTTCAGGTCG; reverse
strand, CGACCTGAACGGGCTTACGGGCTC) synthesized by
Eurofins MWG Operon. The reaction buffer was 20 mM Tris−HCl,
pH 8.0, 5 mM DTT, and 0.01% Triton X-100.
ACKNOWLEDGMENTS
■
We thank the University Cancer Research Fund (UCRF) and
the Carolina Partnership from the University of North Carolina
at Chapel Hill for financial support. The Structural Genomics
Consortium is a registered charity (number 1097737) that
receives funds from Canadian Institutes of Health Research, Eli
Lilly Canada, Genome Canada, GlaxoSmithKline, the Ontario
Methyltransferase activity assays for DOT1L and SMYD3 were
performed using filter plates (catalog no. MSFBN6B10, Millipore,
L
dx.doi.org/10.1021/jm3018332 | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
(17) Smith, J. J.; Rucknagel, K. P.; Schierhorn, A.; Tang, J.; Nemeth,
A.; Linder, M.; Herschman, H. R.; Wahle, E. Unusual sites of arginine
methylation in poly(A)-binding protein II and in vitro methylation by
protein arginine methyltransferases PRMT1 and PRMT3. J. Biol.
Chem. 1999, 274, 13229−13234.
Ministry of Economic Development and Innovation, the
Novartis Research Foundation, Pfizer, AbbVie, Takeda, and
the Wellcome Trust. C.H.A. holds a Canada Research Chair in
Structural Genomics.
(18) Fronz, K.; Otto, S.; Kolbel, K.; Kuhn, U.; Friedrich, H.;
Schierhorn, A.; Beck-Sickinger, A. G.; Ostareck-Lederer, A.; Wahle, E.
Promiscuous modification of the nuclear poly(A)-binding protein by
multiple protein-arginine methyltransferases does not affect the
aggregation behavior. J. Biol. Chem. 2008, 283, 20408−20420.
(19) Tavanez, J. P.; Bengoechea, R.; Berciano, M. T.; Lafarga, M.;
Carmo-Fonseca, M.; Enguita, F. J. Hsp70 chaperones and type I
PRMTs are sequestered at intranuclear inclusions caused by
polyalanine expansions in PABPN1. PloS One 2009, 4, e6418.
(20) Allali-Hassani, A.; Wasney, G. A.; Siarheyeva, A.; Hajian, T.;
Arrowsmith, C. H.; Vedadi, M. Fluorescence-based methods for
screening writers and readers of histone methyl marks. J. Biomol.
Screening 2012, 17, 71−84.
ABBREVIATIONS USED
■
PRMTs, protein arginine methyltransferases; PRMT3, protein
arginine methyltransferase 3; rpS2, 40S ribosomal protein S2;
SAR, structure−activity relationship; HMTs, histone methyl-
transferases; PMTs, protein methyltransferases; PKMTs,
protein lysine methyltransferases; GAR, glycine- and arginine-
rich; PGM, proline-, glycine-, methionine-, and arginine-rich;
PABPN1, nuclear poly(A)-binding protein; MOA, mechanism
of action; LHS, left-hand side; RHS, right-hand side; SAM, S-
adenosylmethionine; DNMT1, DNA methyltransferase 1
(21) Lai, Y.; Song, M.; Hakala, K.; Weintraub, S. T.; Shiio, Y.
Proteomic dissection of the von Hippel-Lindau (VHL) interactome. J.
Proteome Res. 2011, 10, 5175−5182.
REFERENCES
■
(1) Arrowsmith, C. H.; Bountra, C.; Fish, P. V.; Lee, K.; Schapira, M.
Epigenetic protein families: a new frontier for drug discovery. Nat. Rev.
Drug Discovery 2012, 11, 384−400.
(2) Copeland, R. A.; Solomon, M. E.; Richon, V. M. Protein
methyltransferases as a target class for drug discovery. Nat. Rev. Drug
Discovery 2009, 8, 724−732.
(3) Bedford, M. T.; Richard, S. Arginine methylation an emerging
regulator of protein function. Mol. Cell 2005, 18, 263−272.
(4) Di Lorenzo, A.; Bedford, M. T. Histone arginine methylation.
FEBS Lett. 2011, 585, 2024−2031.
(5) Yost, J. M.; Korboukh, I.; Liu, F.; Gao, C.; Jin, J. Targets in
epigenetics: inhibiting the methyl writers of the histone code. Curr.
Chem. Genomics 2011, 5, 72−84.
(6) Zurita-Lopez, C. I.; Sandberg, T.; Kelly, R.; Clarke, S. G. Human
protein arginine methyltransferase 7 (PRMT7) is a type III enzyme
forming omega-NG-monomethylated arginine residues. J. Biol. Chem.
2012, 287, 7859−7870.
(7) Jansson, M.; Durant, S. T.; Cho, E. C.; Sheahan, S.; Edelmann,
M.; Kessler, B.; La Thangue, N. B. Arginine methylation regulates the
p53 response. Nat. Cell Biol. 2008, 10, 1431−1439.
(8) Bedford, M. T. Arginine methylation at a glance. J. Cell Sci. 2007,
120, 4243−4246.
(9) Pahlich, S.; Bschir, K.; Chiavi, C.; Belyanskaya, L.; Gehring, H.
Different methylation characteristics of protein arginine methyltrans-
ferase 1 and 3 toward the Ewing sarcoma protein and a peptide.
Proteins: Struct., Funct., Bioinf. 2005, 61, 164−175.
(10) Cheng, D. H.; Cote, J.; Shaaban, S.; Bedford, M. T. The arginine
methyltransferase CARM1 regulates the coupling of transcription and
mRNA processing. Mol. Cell 2007, 25, 71−83.
(11) Bedford, M. T.; Reed, R.; Leder, P. WW domain-mediated
interactions reveal a spliceosome-associated protein that binds a third
class of proline-rich motif: the proline glycine and methionine-rich
motif. Proc. Natl. Acad. Sci. U.S.A. 1998, 95, 10602−10607.
(12) Branscombe, T. L.; Frankel, A.; Lee, J. H.; Cook, J. R.; Yang, Z.;
Pestka, S.; Clarke, S. PRMT5 (Janus kinase-binding protein 1)
catalyzes the formation of symmetric dimethylarginine residues in
proteins. J. Biol. Chem. 2001, 276, 32971−32976.
(13) Tang, J.; Gary, J. D.; Clarke, S.; Herschman, H. R. PRMT 3, a
type I protein arginine N-methyltransferase that differs from PRMT1
in its oligomerization, subcellular localization, substrate specificity, and
regulation. J. Biol. Chem. 1998, 273, 16935−16945.
(22) Singh, V.; Miranda, T. B.; Jiang, W.; Frankel, A.; Roemer, M. E.;
Robb, V. A.; Gutmann, D. H.; Herschman, H. R.; Clarke, S.;
Newsham, I. F. DAL-1/4.1B tumor suppressor interacts with protein
arginine N-methyltransferase 3 (PRMT3) and inhibits its ability to
methylate substrates in vitro and in vivo. Oncogene 2004, 23, 7761−
7771.
(23) Chen, X.; Niroomand, F.; Liu, Z.; Zankl, A.; Katus, H. A.; Jahn,
L.; Tiefenbacher, C. P. Expression of nitric oxide related enzymes in
coronary heart disease. Basic Res. Cardiol. 2006, 101, 346−353.
(24) Miyata, S.; Mori, Y.; Tohyama, M. PRMT3 is essential for
dendritic spine maturation in rat hippocampal neurons. Brain Res.
2010, 1352, 11−20.
(25) Bissinger, E.-M.; Heinke, R.; Sippl, W.; Jung, M. Targeting
epigenetic modifiers: inhibitors of histone methyltransferases.
MedChemComm 2010, 1, 114−124.
(26) He, Y.; Korboukh, I.; Jin, J.; Huang, J. Targeting protein lysine
methylation and demethylation in cancers. Acta Biochim. Biophys. Sin.
2012, 44, 70−79.
(27) Muller, S.; Brown, P. J. Epigenetic chemical probes. Clin.
Pharmacol. Ther. 2012, 92, 689−693.
(28) Blancafort, P.; Jin, J.; Frye, S. V. Writing and re-writing the
epigenetic code of cancer cells: from engineered proteins to small
molecules. Mol. Pharmacol. 2013, 83, 563−576.
(29) Cheng, D. H.; Yadav, N.; King, R. W.; Swanson, M. S.;
Weinstein, E. J.; Bedford, M. T. Small molecule regulators of protein
arginine methyltransferases. J. Biol. Chem. 2004, 279, 23892−23899.
(30) Bonham, K.; Hemmers, S.; Lim, Y. H.; Hill, D. M.; Finn, M. G.;
Mowen, K. A. Effects of a novel arginine methyltransferase inhibitor on
T-helper cell cytokine production. FEBS J. 2010, 277, 2096−2108.
(31) Trapp, J.; Meier, R.; Hongwiset, D.; Kassack, M. U.; Sippl, W.;
Jung, M. Structure-activity studies on suramin analogues as inhibitors
of NAD(+)-dependent histone deacetylases (sirtuins). ChemMedChem
2007, 2, 1419−1431.
(32) Ragno, R.; Simeoni, S.; Castellano, S.; Vicidomini, C.; Mai, A.;
Caroli, A.; Tramontano, A.; Bonaccini, C.; Trojer, P.; Bauer, I.; Brosch,
G.; Sbardella, G. Small molecule inhibitors of histone arginine
methyltransferases: homology modeling, molecular docking, binding
mode analysis, and biological evaluations. J. Med. Chem. 2007, 50,
1241−1253.
(33) Mai, A.; Cheng, D.; Bedford, M. T.; Valente, S.; Nebbioso, A.;
Perrone, A.; Brosch, G.; Sbardella, G.; De Bellis, F.; Miceli, M.; Altucci,
L. Epigenetic multiple ligands: mixed histone/protein methyltransfer-
ase, acetyltransferase, and class III deacetylase (sirtuin) inhibitors. J.
Med. Chem. 2008, 51, 2279−2290.
(34) Purandare, A. V.; Chen, Z.; Huynh, T.; Pang, S.; Geng, J.;
Vaccaro, W.; Poss, M. A.; Oconnell, J.; Nowak, K.; Jayaraman, L.
Pyrazole inhibitors of coactivator associated arginine methyltransferase
1 (CARM1). Bioorg. Med. Chem. Lett. 2008, 18, 4438−4441.
(14) Bachand, F.; Silver, P. A. PRMT3 is a ribosomal protein
methyltransferase that affects the cellular levels of ribosomal subunits.
EMBO J. 2004, 23, 2641−2650.
(15) Swiercz, R.; Person, M. D.; Bedford, M. T. Ribosomal protein
S2 is a substrate for mammalian PRMT3 (protein arginine
methyltransferase 3). Biochem. J. 2005, 386, 85−91.
(16) Swiercz, R.; Cheng, D.; Kim, D.; Bedford, M. T. Ribosomal
protein rpS2 is hypomethylated in PRMT3-deficient mice. J. Biol.
Chem. 2007, 282, 16917−16923.
M
dx.doi.org/10.1021/jm3018332 | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
(35) Huynh, T.; Chen, Z.; Pang, S.; Geng, J.; Bandiera, T.; Bindi, S.;
Vianello, P.; Roletto, F.; Thieffine, S.; Galvani, A.; Vaccaro, W.; Poss,
M. A.; Trainor, G. L.; Lorenzi, M. V.; Gottardis, M.; Jayaraman, L.;
Purandare, A. V. Optimization of pyrazole inhibitors of coactivator
associated arginine methyltransferase 1 (CARM1). Bioorg. Med. Chem.
Lett. 2009, 19, 2924−2927.
(36) Allan, M.; Manku, S.; Therrien, E.; Nguyen, N.; Styhler, S.;
Robert, M.-F.; Goulet, A.-C.; Petschner, A. J.; Rahil, G.; MacLeod, A.
R.; Deziel, R.; Besterman, J. M.; Nguyen, H.; Wahhab, A. N-Benzyl-1-
heteroaryl-3-(trifluoromethyl)-1H-pyrazole-5-carboxamides as inhibi-
tors of co-activator associated arginine methyltransferase 1 (CARM1).
Bioorg. Med. Chem. Lett. 2009, 19, 1218−1223.
(37) Spannhoff, A.; Heinke, R.; Bauer, I.; Trojer, P.; Metzger, E.;
Gust, R.; Schule, R.; Brosch, G.; Sippl, W.; Jung, M. Target-based
approach to inhibitors of histone arginine methyltransferases. J. Med.
Chem. 2007, 50, 2319−2325.
(38) Heinke, R.; Spannhoff, A.; Meier, R.; Trojer, P.; Bauer, I.; Jung,
M.; Sippl, W. Virtual screening and biological characterization of novel
histone arginine methyltransferase PRMT1 inhibitors. ChemMedChem
2009, 4, 69−77.
(39) Spannhoff, A.; Machmur, R.; Heinke, R.; Trojer, P.; Bauer, I.;
Brosch, G.; Schule, R.; Hanefeld, W.; Sippl, W.; Jung, M. A novel
arginine methyltransferase inhibitor with cellular activity. Bioorg. Med.
Chem. Lett. 2007, 17, 4150−4153.
(40) Feng, Y.; Li, M. Y.; Wang, B. H.; Zheng, Y. G. Discovery and
mechanistic study of a class of protein arginine methylation inhibitors.
J. Med. Chem. 2010, 53, 6028−6039.
(41) Selvi, B. R.; Batta, K.; Kishore, A. H.; Mantelingu, K.; Varier, R.
A.; Balasubramanyam, K.; Pradhan, S. K.; Dasgupta, D.; Sriram, S.;
Agrawal, S.; Kundu, T. K. Identification of a novel inhibitor of
coactivator-associated arginine methyltransferase 1 (CARM1)-medi-
ated methylation of histone H3 Arg-17. J. Biol. Chem. 2010, 285,
7143−7152.
(42) Wang, J.; Chen, L.; Sinha, S. H.; Liang, Z.; Chai, H.; Muniyan,
S.; Chou, Y. W.; Yang, C.; Yan, L.; Feng, Y.; Kathy, Li, K.; Lin, M. F.;
Jiang, H.; George Zheng, Y.; Luo, C. Pharmacophore-based virtual
screening and biological evaluation of small molecule inhibitors for
protein arginine methylation. J. Med. Chem. 2012, 55, 7978−7987.
(43) Kubicek, S.; O’Sullivan, R. J.; August, E. M.; Hickey, E. R.;
Zhang, Q.; Teodoro, M. L.; Rea, S.; Mechtler, K.; Kowalski, J. A.;
Homon, C. A.; Kelly, T. A.; Jenuwein, T. Reversal of H3K9me2 by a
small-molecule inhibitor for the G9a histone methyltransferase. Mol.
Cell 2007, 25, 473−481.
(44) Liu, F.; Chen, X.; Allali-Hassani, A.; Quinn, A. M.; Wigle, T. J.;
Wasney, G. A.; Dong, A.; Senisterra, G.; Chau, I.; Siarheyeva, A.;
Norris, J. L.; Kireev, D. B.; Jadhav, A.; Herold, J. M.; Janzen, W. P.;
Arrowsmith, C. H.; Frye, S. V.; Brown, P. J.; Simeonov, A.; Vedadi, M.;
Jin, J. Protein lysine methyltransferase G9a inhibitors: design,
synthesis, and structure activity relationships of 2,4-diamino-7-
aminoalkoxy-quinazolines. J. Med. Chem. 2010, 53, 5844−5857.
(45) Chang, Y.; Ganesh, T.; Horton, J. R.; Spannhoff, A.; Liu, J.; Sun,
A.; Zhang, X.; Bedford, M. T.; Shinkai, Y.; Snyder, J. P.; Cheng, X.
Adding a lysine mimic in the design of potent inhibitors of histone
lysine methyltransferases. J. Mol. Biol. 2010, 400, 1−7.
(46) Liu, F.; Chen, X.; Allali-Hassani, A.; Quinn, A. M.; Wasney, G.
A.; Dong, A.; Barsyte, D.; Kozieradzki, I.; Senisterra, G.; Chau, I.;
Siarheyeva, A.; Kireev, D. B.; Jadhav, A.; Herold, J. M.; Frye, S. V.;
Arrowsmith, C. H.; Brown, P. J.; Simeonov, A.; Vedadi, M.; Jin, J.
Discovery of a 2,4-diamino-7-aminoalkoxyquinazoline as a potent and
selective inhibitor of histone lysine methyltransferase G9a. J. Med.
Chem. 2009, 52, 7950−7953.
(47) Liu, F.; Barsyte-Lovejoy, D.; Allali-Hassani, A.; He, Y.; Herold, J.
M.; Chen, X.; Yates, C. M.; Frye, S. V.; Brown, P. J.; Huang, J.; Vedadi,
M.; Arrowsmith, C. H.; Jin, J. Optimization of cellular activity of G9a
inhibitors 7-aminoalkoxy-quinazolines. J. Med. Chem. 2011, 54, 6139−
6150.
(48) Vedadi, M.; Barsyte-Lovejoy, D.; Liu, F.; Rival-Gervier, S.; Allali-
Hassani, A.; Labrie, V.; Wigle, T. J.; DiMaggio, P. A.; Wasney, G. A.;
Siarheyeva, A.; Dong, A.; Tempel, W.; Wang, S.-C.; Chen, X.; Chau, I.;
Mangano, T.; Huang, X.-P.; Simpson, C. D.; Pattenden, S. G.; Norris,
J. L.; Kireev, D. B.; Tripathy, A.; Edwards, A.; Roth, B. L.; Janzen, W.
P.; Garcia, B. A.; Petronis, A.; Ellis, J.; Brown, P. J.; Frye, S. V.;
Arrowsmith, C. H.; Jin, J. A chemical probe selectively inhibits G9a
and GLP methyltransferase activity in cells. Nat. Chem. Biol. 2011, 7,
566−574.
(49) Daigle, S. R.; Olhava, E. J.; Therkelsen, C. A.; Majer, C. R.;
Sneeringer, C. J.; Song, J.; Johnston, L. D.; Scott, M. P.; Smith, J. J.;
Xiao, Y.; Jin, L.; Kuntz, K. W.; Chesworth, R.; Moyer, M. P.; Bernt, K.
M.; Tseng, J. C.; Kung, A. L.; Armstrong, S. A.; Copeland, R. A.;
Richon, V. M.; Pollock, R. M. Selective killing of mixed lineage
leukemia cells by a potent small-molecule DOT1L inhibitor. Cancer
Cell 2011, 20, 53−65.
(50) Ferguson, A. D.; Larsen, N. A.; Howard, T.; Pollard, H.; Green,
I.; Grande, C.; Cheung, T.; Garcia-Arenas, R.; Cowen, S.; Wu, J.;
Godin, R.; Chen, H.; Keen, N. Structural basis of substrate methylation
and inhibition of SMYD2. Structure 2011, 19, 1262−1273.
(51) Yao, Y.; Chen, P.; Diao, J.; Cheng, G.; Deng, L.; Anglin, J. L.;
Prasad, B. V. V; Song, Y. Selective inhibitors of histone
methyltransferase DOT1L: design, synthesis and crystallographic
studies. J. Am. Chem. Soc. 2011, 133, 16746−16749.
(52) Yuan, Y.; Wang, Q.; Paulk, J.; Kubicek, S.; Kemp, M. M.; Adams,
D. J.; Shamji, A. F.; Wagner, B. K.; Schreiber, S. L. A small-molecule
probe of the histone methyltransferase G9a induces cellular senescence
in pancreatic adenocarcinoma. ACS Chem. Biol. 2012, 7, 1152−1157.
(53) McCabe, M. T.; Ott, H. M.; Ganji, G.; Korenchuk, S.;
Thompson, C.; Van Aller, G. S.; Liu, Y.; Graves, A. P.; Iii, A. D.; Diaz,
E.; Lafrance, L. V.; Mellinger, M.; Duquenne, C.; Tian, X.; Kruger, R.
G.; McHugh, C. F.; Brandt, M.; Miller, W. H.; Dhanak, D.; Verma, S.
K.; Tummino, P. J.; Creasy, C. L. EZH2 inhibition as a therapeutic
strategy for lymphoma with EZH2-activating mutations. Nature 2012,
492, 108−112.
(54) Knutson, S. K.; Wigle, T. J.; Warholic, N. M.; Sneeringer, C. J.;
Allain, C. J.; Klaus, C. R.; Sacks, J. D.; Raimondi, A.; Majer, C. R.;
Song, J.; Scott, M. P.; Jin, L.; Smith, J. J.; Olhava, E. J.; Chesworth, R.;
Moyer, M. P.; Richon, V. M.; Copeland, R. A.; Keilhack, H.; Pollock,
R. M.; Kuntz, K. W. A selective inhibitor of EZH2 blocks H3K27
methylation and kills mutant lymphoma cells. Nat. Chem. Biol. 2012, 8,
890−896.
(55) Verma, S. K.; Tian, X.; LaFrance, L. V.; Duquenne, C.; Suarez,
D. P.; Newlander, K. A.; Romeril, S. P.; Burgess, J. L.; Grant, S. W.;
Brackley, J. A.; Graves, A. P.; Scherzer, D. A.; Shu, A.; Thompson, C.;
Ott, H. M.; Aller, G. S. V.; Machutta, C. A.; Diaz, E.; Jiang, Y.;
Johnson, N. W.; Knight, S. D.; Kruger, R. G.; McCabe, M. T.; Dhanak,
D.; Tummino, P. J.; Creasy, C. L.; Miller, W. H. Identification of
potent, selective, cell-active inhibitors of the histone lysine
methyltransferase EZH2. ACS Med. Chem. Lett. 2012, 3, 1091−1096.
́
(56) Zheng, W.; Ibanez, G.; Wu, H.; Blum, G.; Zeng, H.; Dong, A.;
̃
Li, F.; Hajian, T.; Allali-Hassani, A.; Amaya, M. F.; Siarheyeva, A.; Yu,
W.; Brown, P. J.; Schapira, M.; Vedadi, M.; Min, J.; Luo, M. Sinefungin
derivatives as inhibitors and structure probes of protein lysine
methyltransferase SETD2. J. Am. Chem. Soc. 2012, 134, 18004−18014.
(57) Siarheyeva, A.; Senisterra, G.; Allali-Hassani, A.; Dong, A.;
Dobrovetsky, E.; Wasney, G. A.; Chau, I.; Marcellus, R.; Hajian, T.;
Liu, F.; Korboukh, I.; Smil, D.; Bolshan, Y.; Min, J.; Wu, H.; Zeng, H.;
Loppnau, P.; Poda, G.; Griffin, C.; Aman, A.; Brown, Peter J.; Jin, J.;
Al-awar, R.; Arrowsmith, C. H.; Schapira, M.; Vedadi, M. An allosteric
inhibitor of protein arginine methyltransferase 3. Structure 2012, 20,
1425−1435.
(58) Ward, E.; Poesche, W.; Higgins, D.; Heard, D. 458. 1, 2, 3-
Benzothiadiazole. Part I. Nitro-, amino-, and hydroxy-derivatives. J.
Chem. Soc. 1962, 2374−2379.
(59) Rostami, A.; Colin, A.; Li, X. Y.; Chudzinski, M. G.; Lough, A. J.;
Taylor, M. S. N,N′-Diarylsquaramides: general, high-yielding synthesis
and applications in colorimetric anion sensing. J. Org. Chem. 2010, 75,
3983−3992.
(60) Minor, W.; Cymborowski, M.; Otwinowski, Z.; Chruszcz, M.
HKL-3000: the integration of data reduction and structure solution
N
dx.doi.org/10.1021/jm3018332 | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
from diffraction images to an initial model in minutes. Acta Crystallogr.,
D: Biol. Crystallogr. 2006, 62, 859−866.
(61) Vagin, A.; Teplyakov, A. MOLREP: an automated program for
molecular replacement. J. Appl. Crystallogr. 1997, 30, 1022−1025.
(62) Emsley, P.; Cowtan, K. Coot: model-building tools for
molecular graphics. Acta Crystallogr., D: Biol. Crystallogr. 2004, 60,
2126−2132.
(63) Murshudov, G. N.; Vagin, A. A.; Dodson, E. J. Refinement of
macromolecular structures by the maximum-likelihood method. Acta
Crystallogr., D: Biol. Crystallogr. 1997, 53, 240−255.
(64) Chen, V. B.; Arendall, W. B., III; Headd, J. J.; Keedy, D. A.;
Immormino, R. M.; Kapral, G. J.; Murray, L. W.; Richardson, J. S.;
Richardson, D. C. MolProbity: all-atom structure validation for
macromolecular crystallography. Acta Crystallogr., D: Biol. Crystallogr.
2010, 66, 12−21.
(65) Abagyan, R.; Totrov, M. Biased probability Monte Carlo
conformational searches and electrostatic calculations for peptides and
proteins. J. Mol. Biol. 1994, 235, 983−1002.
O
dx.doi.org/10.1021/jm3018332 | J. Med. Chem. XXXX, XXX, XXX−XXX