Design, synthesis, and anticancer activity evaluation of irreversible allosteric inhibitors of the ubiquitin-conjugating enzyme Ube2g2

Article abstract of DOI:10.1039/C8MD00320C

The RING finger-dependent ubiquitin ligase (E3) gp78, known as the tumor autocrine motility factor receptor, contributes to tumor progression. The protein interacts with its cognate ubiquitin-conjugating enzyme (E2), Ube2g2, via its RING domain and a unique region called G2BR that strongly binds to E2. The binding of G2BR to Ube2g2 allosterically enhances the binding of RING to E2, and the binding of RING triggers the departure of G2BR from E2 also in an allosteric fashion. Targeting these allosteric events, we developed a family of inhibitors that irreversibly block E2-E3 interactions and thereby eliminate the tumorigenic effect of gp78. One among 19 compounds screened with the NCI 60 tumor cell lines exhibited outstanding anticancer activities. At 10 μM, it caused >50% growth inhibition to 40% of the cell lines; at 100 μM, it showed lethiferous activity against most cell lines.

Full text of DOI:10.1039/C8MD00320C

View Article Online
View Journal
MedChemComm
Accepted Manuscript
This article can be cited before page numbers have been issued, to do this please use: C. Wang, G. Shi
and X. Ji, Med. Chem. Commun., 2018, DOI: 10.1039/C8MD00320C.
This is an Accepted Manuscript, which has been through the
Volume 7 Number 1 January 2016 Pages 1–204
Royal Society of Chemistry peer review process and has been
accepted for publication.
MedChemComm
Accepted Manuscripts are published online shortly after
acceptance, before technical editing, formatting and proof reading.
Broadening the field of opportunity for medicinal chemists
www.rsc.org/medchemcomm
Using this free service, authors can make their results available
to the community, in citable form, before we publish the edited
article. We will replace this Accepted Manuscript with the edited
and formatted Advance Article as soon as it is available.
You can find more information about Accepted Manuscripts in the
author guidelines.
Please note that technical editing may introduce minor changes
to the text and/or graphics, which may alter content. The journal’s
Themed issue: Antibiotic Resistance
ISSN 2040-2503
standard Terms & Conditions and the ethical guidelines, outlined
in our author and reviewer resource centre, still apply. In no
event shall the Royal Society of Chemistry be held responsible
for any errors or omissions in this Accepted Manuscript or any
consequences arising from the use of any information it contains.
rsc.li/medchemcomm

Page 1 of 23
MedChemComm
View Article Online
DOI: 10.1039/C8MD00320C
Design, synthesis, and anticancer activity evaluation of irreversible allosteric
inhibitors of ubiquitin-conjugating enzyme Ube2g2
Chao Wang, Genbin Shi*, and Xinhua Ji*
Macromolecular Crystallography Laboratory, National Cancer Institute, 1050 Boyles
Street, Frederick, MD 20702, USA
*Corresponding Authors
E-mail: shigenbin@mail.nih.gov (GS); jix@mail.nih.gov (XJ).
ORCID
Xinhua Ji: 0000ꢀ0001ꢀ6942ꢀ1514
1

MedChemComm
Page 2 of 23
View Article Online
DOI: 10.1039/C8MD00320C
Abstract
The RING fingerꢀdependent ubiquitin ligase (E3) gp78, known as the tumor autocrine motility
factor receptor, contributes to tumor progression. The protein interacts with its cognate ubiquitinꢀ
conjugating enzyme (E2), Ube2g2, via its RING domain and a unique region called G2BR that
strongly binds to the E2. The binding of G2BR to Ube2g2 allosterically enhances the binding of
RING to the E2, and the binding of RING triggers the departure of G2BR from the E2 also in an
allosteric fashion. Targeting these allosteric events, we developed a family of inhibitors that
irreversibly block E2ꢀE3 interactions and thereby eliminate the tumorigenic effect of gp78. One
among 19 compounds screened with the NCI 60 tumor cell lines exhibited outstanding
anticancer activities. At 10 ꢀM, it caused > 50% growth inhibition to 40% cell lines; at 100 ꢀM,
it showed lethiferous activity against most cell lines.
Keywords
Ubiquitinꢀconjugating enzyme, E2, Ube2g2, allosteric inhibitor, anticancer
Abbreviations
Cdc34, cell division cycle 34; E2, ubiquitinꢀconjugating enzyme; E3, ubiquitin ligase; His6,
hexahistidine; PCR, polymerase chain reaction; PDB, Protein Data Bank
2

Page 3 of 23
MedChemComm
View Article Online
DOI: 10.1039/C8MD00320C
1. Introduction
Ubiquitination, the reaction of ubiquitin (Ub) conjugation to substrate, is catalyzed by Ubꢀ
activating E1, Ubꢀconjugating E2, and Ubꢀligating E3 enzymes. In an ATPꢀdependent manner,
an E1 activates a Ub and transfers the activated Ub to an E2; then, the E2 interacts with an E3 to
conjugate the Ub onto the substrate (Fig. 1). In the human genome, two E1, ∼40 E2, and >600 E3
enzymes have been identified.1 In cancer, the Ub conjugation pathway is frequently perturbed;
therefore, modulating the activities of E1, E2, and E3 is of intense interest for the development
of anticancer agents.2 However, ubiquitination depends on dynamic rearrangement of multiple
proteinꢀprotein interactions that are traditionally difficult to target with small molecules.3 So far,
several E1 or E3 inhibitors have entered clinical trials, but only one E2 inhibitor has been under
preclinical studies.4,5 More E2 inhibitors are needed because E2 plays a critical role deciding
between life and death of proteins.6 Here, we present a new family of inhibitors targeting
Ube2g2, the specific E2 of gp78, an E3 enzyme known as tumor autocrine motility factor
receptor.7 This E2ꢀE3 pair is critically important for endoplasmic reticulum (ER)ꢀassociated
degradation of multiple substrates,8 including Kangai1 (KAI1) that suppresses tumor
progression.9,10
Containing 643 amino acid residues, gp78 is a transmembrane protein. The transmembrane
domains of gp78 (residues 82ꢀ296) are followed by the RING domain (residues 313ꢀ393), a Cue
domain (residues 452ꢀ504), and a specific Ube2g2ꢀbinding region known as G2BR (residues
574ꢀ600).8 Threeꢀdimensional structure of fullꢀlength gp78 is not available. Unlike gp78,
Ube2g2 has a singleꢀdomain structure containing 165 amino acid residues. The crystal structure
of Ube2g2 was determined about a decade ago (Protein Data Bank (PDB) entry 2CYX).11
Recently, crystal structures of Ube2g2 in complex with G2BR (PDB entries 3FSH and
3

MedChemComm
Page 4 of 23
View Article Online
DOI: 10.1039/C8MD00320C
3H8K)12,13 and with both the RING and G2BR (PDB entry 4LAD)14 were determined.
Comparative structural and functional analyses revealed three allosteric regulatory events along
the functional cycle of Ube2g2 (Fig. 1).14 First, highꢀaffinity binding of G2BR to Ube2g2 (Kd =
21 nM) induces a conformational change at the RINGꢀbinding site of Ube2g2, which triggers the
exposure of a hidden Glu side chain that is necessary for enhanced binding of RING to Ube2g2
by forming a salt bridge with an Arg side chain from the RING (Figs. 1C and 1D). Second, the
binding of RING to Ube2g2 induces a second allosteric effect, which reduces the buried
Ube2g2:G2BR interface from 1950 to 1640 Å2, drops the number of intermolecular interactions
between Ube2g2 and G2BR from 35 to 23, including several hydrogen bonds along one side of
the G2BR helix, and lowers the affinity between G2BR and Ube2g2 (Kd = 132 nM), leading to
the departure of G2BR from Ube2g2 (Figs. 1D and 1E). Third, the departure of G2BR from
Ube2g2 reverses the G2BRꢀinduced conformational change at the Ube2g2:RING interface,
which breaks the GluUbe2g2ꢀArgRING salt bridge, promoting the departure of RING from Ube2g2
(Figs. 1E and 1F). The ligandꢀfree Ube2g2 is ready for the next functional cycle (Fig. 1A). These
findings provide an opportunity for structureꢀbased development of allosteric inhibitors targeting
Ube2g2 because the insertion of any small molecule into the allosteric pathway would inhibit
gp78ꢀUbe2g2 interactions and thereby prevent the tumorigenic effect of gp78.
The family of E2 enzymes is characterized by the presence of a highly conserved
ubiquitinꢀconjugating domain.6 Among the ∼40 active E2 enzymes identified in humans is the
cell division cycle 34 (Cdc34). Cdc34 is involved in G1ꢀS phase transition of eukaryotic cell
cycle.15 It catalyzes the ubiquitination of proteins in conjunction with the cullinꢀRING
superfamily of E3 enzymes. Identified from a smallꢀmolecule screening, the aforementioned E2
inhibitor is an allosteric inhibitor of Cdc34, known as CC0651 (Fig. 2A). It binds to Cdc34 in an
4

Page 5 of 23
MedChemComm
View Article Online
DOI: 10.1039/C8MD00320C
induced binding site that does not exist in apoꢀCdc34 (Fig. 2B).2 This allosteric inhibitorꢀbinding
site is located between the binding sites of G2BR and RING, which prompted us to develop
CC0651 derivatives that specifically recognize Ube2g2.
2. Results and discussion
2.1 Inhibitor design
A unique feature of the Ube2g2 sequence offers an opportunity for the design of covalent
inhibitors. CC0651 contains a methoxy moiety (Fig. 2A). It forms a hydrogen bond with the
backbone amide group of Tyr52 of Cdc34 (Fig. 2B). The counterpart of Tyr52 in Cdc34 is a
cysteine residue (Cys48) in Ube2g2, which is unique among human E2 sequences.2 To design
our first covalent inhibitor that specifically targets Ube2g2, we replaced the methoxy group in
CC0651 (Fig. 2A) with a vinyl group, resulting in compound CW19 (Fig. 2C). Like Cdc34, the
binding pocket of CW19 does not exist in apoꢀUbe2g2 structure. Based on the Cdc34 structure in
the Cdc34:CC0651 complex (PDB entry 3RZ3),2 we derived a Ube2g2 model using the Phyre2
web portal for protein modeling, prediction, and analysis.16 Superpositioning the Ube2g2 model
and the CW19 molecule onto the Cdc34 and CC0651 in the Cdc34:CC0651 complex,
respectively, a covalent bond is readily feasible between the thiol side chain of Cys48 in Ube2g2
and the ethyl group of CW19 (Fig. 2D). Comparison between the Ube2g2ꢀCW19 model and the
apoꢀUbe2g2 structure visualizes conformational changes induced by the binding of CW19.
2.2 Chemistry
We synthesized two types of irreversible Ube2g2 inhibitors, D (Scheme 1) and L (Scheme 2). As
shown, these two types of inhibitors differ only in the absolute configuration of one chiral center,
which is dictated by the starting material (compounds 1 and 21). A total of 20 compounds were
5

MedChemComm
Page 6 of 23
View Article Online
DOI: 10.1039/C8MD00320C
synthesized. Herein, we use type D inhibitors (CW1 to CW10) to describe the synthetic route.
The nonꢀpolar dichlorobiphenyl moiety of CC0651 was conserved in consideration of the inner
hydrophobic environment of the allosteric binding pocket (Fig. 2). In contrast, the remaining
structure of CC0651 contains multiple single bonds that significantly increase the conformational
flexibility of the inhibitors. To ensure the covalent bond formation between the electrophilic
moiety of the inhibitor and the thiol group of Cys48, the methoxy group of CC0651 was replaced
with not only a vinyl, but also an allyl group (Scheme 1). Finally, the discovery of multiple
modes of interaction between Cdc34 and the pentanoic acid moiety of the inhibitor (PDB entry
3RZ3)2 prompted us to explore the size and rigidity of this scaffold. For example, compounds 13
and 14 (CW1 and CW2) with a much smaller scaffold were synthesized from compound 4 by
Boc deprotection followed by PyAOPꢀmediated acylation of the resulting amine. Also from
compound 4, another intermediate compound 6 with a rigid carbonꢀcarbon double bond was
synthesized by Dess–Martin oxidation followed by a Horner–Wadsworth–Emmons reaction.
Starting from compound 6 and through another intermediate compound 7, compounds 8 and 9
(CW3 and CW4) were synthesized using the same conditions for the synthesis of compounds 13
and 14 (CW1 and CW2). The hydrolysis of compounds 8 and 9 further afforded their respective
acid analogs, compounds 10 and 11 (CW5 and CW6). To synthesize compounds 17 and 18
(CW7 and CW8), the Sharpless asymmetric dihydroxylation was employed to introduce the two
hydroxyl groups. Then, compounds 17 and 18 were hydrolyzed to give compounds 19 and 20
(CW9 and CW10, Scheme 1).
6

Page 7 of 23
MedChemComm
View Article Online
DOI: 10.1039/C8MD00320C
2.3 Formation of Ube2g2-inhibitor conjugates
We incubated each of the 20 compounds (CW1ꢀCW20) with Ube2g2 at three pH values. We did
not detect any proteinꢀinhibitor conjugates at pH 7.4, found more than three conjugates at pH
9.0, and identified 15 conjugates at pH 8.5 (Table 1). Ube2g2 has three cysteine residues: Cys48,
Cys75, and Cys89. The thiol groups of Cys48 and Cys89 are readily accessible from the solvent,
whereas that of Cys76 appears to be less accessible by the inhibitors. However, the identification
of three Ube2g2ꢀCW11 conjugate species, corresponding to Ube2g2 with 1, 2, or 3 modified
cysteine side chains (Table 1), demonstrates that all three cysteine side chains can be modified
by the irreversible allosteric inhibitors.
2.4 Anticancer activity
Against the NCI 60 tumor cell panel, we evaluated the cytotoxic activities of these irreversible
Ube2g2 inhibitors. We submitted 19 inhibitors (CW2ꢀCW20) for oneꢀdose (10 µM) screening.
The results are presented in Fig. 3 and the data are summarised in Table S1. Among the 19
compounds, CW3 exhibited the highest inhibitory activity against tumor cell growth. In addition,
it also showed lethiferous activity against several tumor cell lines (Table S1). Further, CW3 was
tested for dose response effect at five concentrations (0.01, 0.1, 1.0, 10, and 100 µM). As shown
in Fig. 4A, the dose dependence of CW3 is clear. At 10 ꢀM, it caused > 50% growth inhibition
to 40% cell lines; at 100 ꢀM, it showed lethiferous activity against most cell lines (Table S2).
The dose dependence for individual cell lines, grouped according to cancer types, is shown in
Fig. S1, showing that CW3 has the highest lethiferous activity against Melanoma cancer cells.
Recently, a preclinical model system suggests that gp78 is a tumor suppressor in human liver.17
The NCI 60 tumor cell panel does not contain liver cancer cells (Table S1). Whether CW3 would
7

MedChemComm
Page 8 of 23
View Article Online
DOI: 10.1039/C8MD00320C
be active against liver cancer and whether targeting the Ube2g2ꢀgp78 interaction would induce
side effects in liver remain to be elucidated. Likewise, further studies are needed to discern the
effects of CW3 on normal mammalian cell lines which are not screened by the NCI panel.
The interaction between CW3 and the enzyme could be implicated by molecular docking,
for which the Ube2g2 model, containing the allosteric binding site (Fig. 2D), was employed. As
expected, CW3 was positioned such that a covalent bond was formed between its vinyl group
and the thiol group of Cys48 (Fig. 4B). The dichlorobiphenyl moiety is positioned in the inner
hydrophobic pocket of the allosteric binding site. A total of three hydrogen bonds were observed
between CW3 and Ube2g2. As shown, the acetyl oxygen and amino nitrogen from the acetamido
group of CW3 formed hydrogen bonds with the amino group of Cys48 and the hydroxyphenyl
group of Tyr152, respectively. The third hydrogen bond is observed between the acetoxy oxygen
of CW3 and the indole group of Trp144 (Fig. 4B).
3. Conclusions
We designed and synthesized a family of irreversible allosteric inhibitors of Ube2g2. The NCI
60 tumor cell line screen demonstrated that one such inhibitor, CW3, has significant inhibitory
and lethiferous activities against most cell lines with a clear dose dependence. Ube2g2 is the
specific E2 enzyme required for gp78 (E3) to promote tumor progression by facilitating ERꢀ
associated degradation of KAI1. As an irreversible allosteric inhibitor of Ube2g2, CW3 is a lead
compound for the development of anticancer agents. Structureꢀbased development of next
generation inhibitors is undertaken in our laboratory for the improvement of potency and
specificity as well as the understanding of detailed molecular mechanisms.
8

Page 9 of 23
MedChemComm
View Article Online
DOI: 10.1039/C8MD00320C
4. Experimental section
4.1 Homologous modeling
We modeled the Ube2g2 conformation that contains the allosteric binding site at the Phyre2
server16 using the oneꢀtoꢀone threading expert mode with the Cdc34 structure in the
Cdc34:CC0651 complex (PDB entry 3RZ3)2 as the template. Structural illustrations were
prepared with PyMOL (Delano Scientific LLC).
4.2 Chemistry
All reagents and solvents were commercially available from SigmaꢀAldrich, except for (R)ꢀBocꢀ
2ꢀaminoꢀ3ꢀ(4ꢀiodophenyl)propionic acid (Bocꢀ4ꢀiodoꢀDꢀphenylalanine) and (S)ꢀBocꢀ2ꢀaminoꢀ3ꢀ
(4ꢀiodophenyl)propionic acid (Bocꢀ4ꢀiodoꢀLꢀphenylalanine), which were purchased from Chemꢀ
Impex International, and used without further purification.
The synthetic route for type D inhibitors (CW1 through CW10), starting from (R)ꢀ2ꢀ
((tertꢀbutoxycarbonyl)amino)ꢀ3ꢀ(4ꢀiodophenyl)propanoic acid (1), is shown in Scheme 1. The
synthetic route for type L inhibitors (CW11 through CW20), starting from (S)ꢀ2ꢀ((tertꢀ
butoxycarbonyl)amino)ꢀ3ꢀ(4ꢀiodophenyl)propanoic acid (21), is shown in Scheme 2. The
synthesis and characterization of compound 8 (CW3) is described below, whereas the synthetic
details of other compounds can be found in the Electronic Supplementary Information (ESI).
4.3 Synthesis of Compound 8 (CW3)
Ethyl (R,E)-4-acrylamido-5-(3',5'-dichloro-[1,1'-biphenyl]-4-yl)pent-2-enoate (8, CW3). Acrylic
acid (55 µL, 0.81 mmol) and PyAOP (0.42 g, 0.81 mmol) were added to 40 mL DMF and stirred
at room temperature for 30 min, followed by the addition of 0.42 mL (0.24 mmol) DIPEA. Then,
the mixture was stirred for 30 min before the addition of compound 7 (0.20 g, 0.55 mmol) and
9

MedChemComm
Page 10 of 23
View Article Online
DOI: 10.1039/C8MD00320C
being stirred for 2 h. The resulting solvent was removed with a rotary evaporator and the residue
was purified by HPLC to afford a white solid (0.12 g, 52% yield). NMR δ H (400 MHz; CDCl3),
1.28 (3H, t), 3.02 (2H, d), 4.16–4.21 (2H, m), 5.08 (1H, t), 5.55 (1H, d), 5.68 (1H, d), 5.87 (1H,
d), 6.03–6.10 (1H, m), 6.29 (1H, d), 6.92–6.97 (1H, m), 7.26 (2H, d), 7.33 (1H, s), 7.44 (2H, s),
7.48 (2H, d). 13C NMR (CDCl3) 164.99, 164.00, 145.24, 142.54, 136.19, 135.61, 134.26, 129.20,
128.95, 126.44, 126.25, 126.13, 124.44, 120.86, 59.64, 49.81, 38.92, 13.18. MS (ESI): m/z Calcd
for C22H22Cl2NO3 [M + H]+ 418.10, found 418.0.
4.4 Cloning, Expression, and Purification of Ube2g2
Expression vectors were constructed by Gateway recombinational cloning (Life Technologies,
Grand Island, NY, USA). pDEST17ꢀUbe2g2 was acquired from Addgene (Cambridge, MA,
USA). This vector has a few tags on it. The Ube2g2 gene was amplified by polymerase chain
reaction (PCR) from this vector with primers 5’ꢀ
GGGGACAACTTTGTACAAAAAAGTTGTGGAGAACCTGTACTTCCAGGGTGCGGGGA
CCGCGCTCAAGAGG and 5’ꢀ
GGGGACAACTTTGTATAATAAAGTTGCATTACAGTCCCAGAGACTTCTGGACGA. The
PCR product was recombined into donor vector pDONR221 to produce the entry vector, the
entry vector was recombined into the destination vector pDESTꢀ527 and pDEST HISꢀMBP
(Protein Expression Laboratory, Leidos Biomedical Research Inc., Frederick, MD, USA) to
produce the expression vectors, an expression vectors encoding a TEV proteaseꢀcleavable
hexahistidine (His6) tag preceding Ube2g2 and His6 maltoseꢀbinding protein preceding Ube2g2.
The protein was produced in Escherichia coli strain Rosetta 2(DE3) (EMD Millipore, Billerica,
MA, USA). Cells were grown to midꢀlog phase at 310 K in LB broth containing 100 mg/mL
10

Page 11 of 23
MedChemComm
View Article Online
DOI: 10.1039/C8MD00320C
ampicillin, 30 mg/ml chloramphenicol. Overproduction of the fusion protein was induced with
IPTG at a final concentration of 0.5 mM for 4 h at 303 K. The cells were pelleted by
centrifugation and stored at 193 K. For protein purification, all procedures were performed at
277–281 K. Fifteen g of E. coli cell paste were suspended in 150 ml lysis buffer (25 mM
phosphate buffer, pH 7.4, 500 mM NaCl). The cells were lysed with an APVꢀ2000 homogenizer
(Invensys APV Products, Albertslund, Denmark) at 69 MPa and centrifuged at 30,000 g for 30
min. The supernatant was filtered through a 0.2 mm polyethersulfone membrane and applied
onto an IMAC 30 mL column (GE Healthcare Life Sciences, Pittsburgh, PA, USA) equilibrated
with buffer A (10 mM phosphate, pH 7.4, 150 mM NaCl, 10 mM imidazole). The column was
washed to baseline with buffer A and eluted with a linear gradient of imidazole to 500 mM in
buffer A. Fractions containing recombinant protein were pooled, concentrated using an Amicon
YM10 membrane (EMDMillipore, Billerica, MA, USA), diluted to an imidazole concentration
of about 25 mM with 10 mM phosphate, pH 7.4, 150 mM NaCl buffer and digested overnight at
277 K with His6ꢀtagged TEV protease18,19. TEV protease digestion, which removed the His6
affinity tag and amino acids encoded by sequences that facilitate Gateway cloning, resulted in a
native protein product devoid of cloning artifacts. The digest was applied onto a 30 mL IMAC
column equilibrated in buffer A and recombinant protein emerged in the column effluent. The
effluent was concentrated using an Amicon YM10 membrane. Aliquots were flash frozen in
liquid nitrogen and stored at 193 K. The molecular weight of the product was confirmed by
electrospray ionization mass spectroscopy.
11

MedChemComm
Page 12 of 23
View Article Online
DOI: 10.1039/C8MD00320C
4.5 LC/MS Analysis of Inhibitor-Protein Conjugates
All compounds (CW1ꢀCW20) were dissolved in DMSO at 10 mM. The concentrated protein at
10 mg/mL was diluted 10 times in buffers at different pH values. Forty µL diluted protein
solutions were acquired in mass spectroscopy sample vials, and 5 µL compound solutions were
added to each vial and incubated overnight at room temperature. An Agilent 6100 single
quadrupole mass spectrometer was used to detect the proteinꢀinhibitor conjugation products.
4.6 NCI 60 Human Cancer Cell Line Screening
We submitted 19 compounds (CW2ꢀCW20) to National Cancer Institute (NCI) Developmental
Therapeutics Program (DTP) for human cancer cell line screening, for which the standard
methodology and protocols are described in the Electronic Supplementary Information (ESI). For
both oneꢀ and fiveꢀdose assays, growth relative to the noꢀdrug control, and relative to the number
of cells at time zero was reported, allowing the detection of both growth inhibition (values
between 0 and 100) and lethality (negative values). For example, a value of 100 means no
growth inhibition, a value of 40 means 60% growth inhibition, a value of 0 means no net growth,
a value of ꢀ40 means 40% lethality, and a value of ꢀ100 means all cells are dead.
4.7 Molecular Docking
The Ube2g2ꢀCW3 model was built using the Schrödinger Maestro interface (Schrödinger, LLC,
New York, NY, 2018). The CW3 structure was prepared in its preꢀreactive form with LigPrep.
The Ube2g2 preparation was performed with the Protein Preparation Wizard. Grid was
generated by the Receptor Grid Generation facility. The covalent docking pose was formed by
Covalent Docking using the Pose Prediction mode.
12

Page 13 of 23
MedChemComm
View Article Online
DOI: 10.1039/C8MD00320C
Conflicts of Interest
The authors declare no conflict of interest.
Acknowledgments
This research was supported by the Intramural Research Program of the NIH, National Cancer
Institute, Center for Cancer Research. Mass spectrometry experiments were conducted at the
Biophysics Resource in the Structural Biophysics Laboratory of the National Cancer Institute
(NCI). The NCI 60 tumor cell line screens were performed by the NCI’s Developmental
Therapeutics Program.
13

MedChemComm
Page 14 of 23
View Article Online
DOI: 10.1039/C8MD00320C
References
(1) W. Li, M. H. Bengtson, A. Ulbrich, A. Matsuda, V. A. Reddy, A. Orth, S. K. Chanda, S.
Batalov and C. A. Joazeiro, PLoS One, 2008, 3, e1487.
(2) D. F. Ceccarelli, X. Tang, B. Pelletier, S. Orlicky, W. Xie, V. Plantevin, D. Neculai, Y. C.
Chou, A. Ogunjimi, A. AlꢀHakim, X. Varelas, J. Koszela, G. A. Wasney, M. Vedadi, S.
DheꢀPaganon, S. Cox, S. Xu, A. LopezꢀGirona, F. Mercurio, J. Wrana, D. Durocher, S.
Meloche, D. R. Webb, M. Tyers and F. Sicheri, Cell, 2011, 145, 1075ꢀ1087.
(3) X. Huang and V. M. Dixit, Cell Res, 2016, 26, 484ꢀ498.
(4) M. R. Mattern, J. Wu and B. Nicholson, Biochim. Biophys. Acta, 2012, 1823, 2014ꢀ2021.
(5) S. Lub, K. Maes, E. Menu, E. De Bruyne, K. Vanderkerken and E. Van Valckenborgh,
Oncotarget, 2016, 7, 6521ꢀ6537.
(6) S. J. van Wijk and H. T. Timmers, FASEB J., 2010, 24, 981ꢀ993.
(7) I. R. Nabi, H. Watanabe, S. Silletti and A. Raz, EXS, 1991, 59, 163ꢀ177.
(8) B. Chen, J. Mariano, Y. C. Tsai, A. H. Chan, M. Cohen and A. M. Weissman, Proc. Natl.
Acad. Sci. USA, 2006, 103, 341ꢀ346.
(9) W. M. Liu and X. A. Zhang, Cancer Lett., 2006, 240, 183ꢀ194.
(10) Y. C. Tsai, A. Mendoza, J. M. Mariano, M. Zhou, Z. Kostova, B. Chen, T. Veenstra, S. M.
Hewitt, L. J. Helman, C. Khanna and A. M. Weissman, Nat. Med., 2007, 13, 1504ꢀ1509.
(11) R. Arai, S. Yoshikawa, K. Murayama, Y. Imai, R. Takahashi, M. Shirouzu and S.
Yokoyama, Acta Crystallogr. F, 2006, 62, 330ꢀ334.
(12) W. Li, D. Tu, L. Li, T. Wollert, R. Ghirlando, A. T. Brunger and Y. Ye, Proc. Natl. Acad.
Sci. USA, 2009, 106, 3722ꢀ3727.
14

Page 15 of 23
MedChemComm
View Article Online
DOI: 10.1039/C8MD00320C
(13) R. Das, J. Mariano, Y. C. Tsai, R. C. Kalathur, Z. Kostova, J. Li, S. G. Tarasov, R. L.
McFeeters, A. S. Altieri, X. Ji, R. A. Byrd and A. M. Weissman, Mol. Cell, 2009, 34,
674ꢀ685.
(14) R. Das, Y. H. Liang, J. Mariano, J. Li, T. Huang, A. King, S. G. Tarasov, A. M. Weissman,
X. Ji and R. A. Byrd, EMBO J., 2013, 32, 2504ꢀ2516.
(15) E. Schwob, T. Bohm, M. D. Mendenhall and K. Nasmyth, Cell, 1994, 79, 233ꢀ244.
(16) L. A. Kelley, S. Mezulis, C. M. Yates, M. N. Wass and M. J. Sternberg, Nat. Protoc., 2015,
10, 845ꢀ858.
(17) T. Zhang, D. H. Kho, Y. Wang, Y. Harazono, K. Nakajima, Y. Xie and A. Raz, PLoS One,
2015, 10, e0118448.
(18) R. B. Kapust, J. Tözsér, J. D. Fox, D. E. Anderson, S. Cherry, T. D. Copeland and D. S.
Waugh, Protein. Eng., 2001, 14, 993ꢀ1000.
(19) J. E. Tropea, S. Cherry and D. S. Waugh, Methods Mol. Biol., 2009, 498, 297ꢀ307.
15

MedChemComm
Page 16 of 23
View Article Online
DOI: 10.1039/C8MD00320C
Table 1 The Ube2g2ꢀInhibitor Conjugation Products at pH 8.5
Compound
Inhibitor
Name
CW1
Molecular
Weight (Da)
350
Molecular Weight of Detected
Ube2g2bꢀInhibitor Conjugate (Da)
Numbera
13
14
8
18840, 19190
None
CW2
364
CW3
418
18908
9
CW4
432
None
10
11
17
18
19
20
33
34
28
29
25
26
37
38
39
40
CW5
390
18880
CW6
404
None
CW7
452
18942
CW8
466
None
CW9
424
18914, 19338
None
CW10
CW11
CW12
CW13
CW14
CW15
CW16
CW17
CW18
CW19
CW20
438
350
18840, 19190, 19540
None
364
418
18908
432
None
390
18880, 19270
18894
404
452
18942
466
None
424
None
438
None
aAs shown in Schemes 1 and S1. bThe molecular weight of our Ube2g2 (from cloning, the first
amino acid residue is a glycine instead of methionine) is 18,491 Da.
16

Page 17 of 23
MedChemComm
View Article Online
DOI: 10.1039/C8MD00320C
Scheme 1 Chemical Synthesis of Type D Inhibitors (CW1 to CW10). Starting reagent, Bocꢀ4ꢀ
iodoꢀDꢀphenylalanine (1) (5.00 g, 12.78 mmol). (a) 3ꢀ5ꢀdichlorophenylboronic acid, Na2CO3,
Pd(PPh3)4, THF/H2O (2:1), 70 °C, 48 h, yield 90%; (b) CH3I, NaHCO3, DMF, rt, 12 h, yield
92%; (c) DIBAL, CH2Cl2, rt, 12 h, yield 70%; (d) HCl. EtOH, rt, 6 h, yield 96%; (e) acrylic acid
(13) or 3ꢀbutenoic acid (14), PyAOP, DIPEA, DMF, rt, 3 h, yield 62% (13, CW1) and 65% (14,
CW2), respectively; (f) DessꢀMartin periodinane, CH2Cl2, rt, 5 h, yield 97%; (g) triethyl
phosphonoacetate, NaH, DMF, 0 °C, 1 h or rt, 2h, yield 96%; (h) same as d, yield 98%; (i) same
as e, yield 52% (8, CW3) and 55% (9, CW4), respectively; (j) NaOH, MeOH/H2O (1:1), rt, 12
h, yield 77% (10, CW5) and 80% (11, CW6), respectively; (k) methanesulfonamide, K3Fe(CN)6,
OsO4, (DHQD)2PHAL, K2CO3, tꢀBuOH/H2O (1:1), rt, 12 h, yield 65%; (l) same as d, yield 95%;
(m) same as e, yield 67% (17, CW7) and 64% (18, CW8), respectively; (n) NaOH,
THF/MeOH/H2O (1:1:1) (19, CW9) or MeOH/H2O (1:1) (20, CW10), rt, 12 h, yield 70% (19)
and 76% (20), respectively.
17

MedChemComm
Page 18 of 23
View Article Online
DOI: 10.1039/C8MD00320C
Scheme 2 Chemical Synthesis of Type L Inhibitors (CW11 to CW20). Starting reagent, Bocꢀ4ꢀ
iodoꢀLꢀphenylalanine (21) (5.00 g, 12.78 mmol). (a) 3ꢀ5ꢀdichlorophenylboronic acid, Na2CO3,
Pd(PPh3)4, THF/H2O (2:1), 70 °C, 48 h, yield 98%; (b) CH3I, NaHCO3, DMF, rt, 12 h, yield
96%; (c) DIBAL, CH2Cl2, rt, 12 h, yield 78%; (d) HCl. EtOH, rt 6 h, yield 99%; (e) acrylic acid
(33) or 3ꢀbutenoic acid (34), PyAOP, DIPEA, DMF, rt, 3 h, yield 70% (33, CW11) and 75% (34,
CW12), respectively; (f) DessꢀMartin periodinane, CH2Cl2, rt 5 h, yield 90%; (g) triethyl
phosphonoacetate, NaH, DMF, 0 °C, 1 h or rt, 2h, yield 97%; (h) same as d, yield 99%; (i) same
as e, yield 59% (28, CW13) and 55% (29, CW14), respectively; (j) NaOH, MeOH/H2O (1:1), rt,
12 h, yield 74% (30, CW15) and 80% (31, CW16), respectively; (k) methanesulfonamide,
K3Fe(CN)6, OsO4, (DHQD)2PHAL, K2CO3, tꢀBuOH/H2O (1:1), rt, 12 h, yield 67%; (l) same as
d, yield 84%; (m) same as e, yield 59% (37, CW17) and 85% (38, CW18), respectively; (n)
NaOH, THF/MeOH/H2O (1:1:1) (39) or MeOH/H2O (1:1) (40), rt, 12 h, yield 68% (39, CW19)
and 64% (40, CW20), respectively.
18

Page 19 of 23
MedChemComm
View Article Online
DOI: 10.1039/C8MD00320C
Fig. 1 Allosteric regulation of a processive ubiquitination machine. Comparative analysis of
crystal structures of ligandꢀfree Ube2g2 (PDB entry 2CYX), Ube2g2 in complex with G2BR of
gp78 (PDB entry 3H8K), and Ube2g2 in complex with both G2BR and RING of gp78 (PDB
entry 4LAD) reveal allosteric regulation events along the functional cycle of Ube2g2.14
(A) Schematic representation of E2 enzyme Ube2g2 with G2BRꢀbinding, RINGꢀbinding, and
Ubꢀconjugating sites indicated. The minus sign indicates the hidden carboxyl group of the
Glu108 side chain. It forms a salt bridge with the Arg379 guanidinium group of the RING.
(B) In an ATPꢀdependent manner, a Ub molecule is activated by an E1 enzyme and conjugated
to Ube2g2. (C) The E3 enzyme gp78 binds to Ube2g2 with the G2BR and RING motifs. G2BR
is nonꢀstructured before binding to the E2 enzyme. The Arg379 guanidinium group of the RING
is indicated with a plus sign. (D) Upon binding to Ube2g2, G2BR becomes an αꢀhelix. In an
allosteric manner, the binding of G2BR triggers the exposure of the hidden carboxyl group of
Glu108. (E) Readily, the Glu108Ube2g2ꢀArg379gp78 salt bridge forms and the binding of RING
promotes the ligation of Ub to substrate and the release of G2BR from Ube2g2. (F) The
departure of G2BR destroys the salt bridge, promoting the release of RING from Ube2g2. The
ligandꢀfree Ube2g2 will be loaded with another Ub for the next ubiquitination cycle.
19

MedChemComm
Page 20 of 23
View Article Online
DOI: 10.1039/C8MD00320C
Fig. 2
Design of irreversible allosteric inhibitor CW19 targeting Ube2g2. (A) CC0651, the
allosteric inhibitor for Cdc34.2 (B) Superimposed Cdc34 structures in its ligandꢀfree (apoꢀCdc34,
PDB entry 2OB4) and CC0651ꢀbound (Cdc34:CC0651, PDB entry 3RZ3) forms. (C) CW19, the
irreversible allosteric inhibitor for Ube2g2 (this work). (D) The Ube2g2ꢀCW19 model, created at
the Phyre2 server16 using the Cdc34 structure in the Cdc34:CC0651 complex as template, is
superimposed with the apoꢀUbe2g2 structure (PDB entry 2CYX). In panels B and D, detailed
interactions between protein and inhibitor are highlighted with zoomꢀin boxes. In panel D, the
G2BRꢀbinding and RINGꢀbinding sites are indicated with molecular surfaces modelled based on
the G2BR and RING motifs in the Ube2g2:RINGꢀG2BR structure (PDB entry 4LAD).
20

Page 21 of 23
MedChemComm
View Article Online
DOI: 10.1039/C8MD00320C
Fig. 3 Mean growth percentages of tumor cell lines in the presence of CW2 through CW20
(oneꢀdose screening).
21

MedChemComm
Page 22 of 23
View Article Online
DOI: 10.1039/C8MD00320C
Fig. 4
Anticancer activity of CW3. (A) In vitro anticancer activity of CW3 tested with the
National Cancer Institute (NCI) 60 Tumor Cell Lines performed by the NCI Developmental
Therapeutics Program. (B) Covalent docking of CW3 into its binding site on Ube2g2 results in
the Ube2g2ꢀCW3 conjugate.
22

Page 23 of 23
MedChemComm
View Article Online
DOI: 10.1039/C8MD00320C
Table of contents information
Anticancer activity of CW3, an irreversible allosteric inhibitor of ubiquitinꢀconjugating enzyme Ube2g2,
and its interaction with the protein
23