Novel inhibitors of RANKL-induced osteoclastogenesis: Design, synthesis, and biological evaluation of 6-(2,4-difluorophenyl)-3-phenyl-2H-benzo[e][1,3]oxazine-2,4(3H)-diones

Article abstract of DOI:10.1016/j.bmc.2015.06.007

A series of novel 6-(2,4-difluorophenyl)-3-phenyl-2H-benzo[e][1,3]oxazine-2,4(3H)-dione derivatives were synthesized and evaluated for their inhibitory effects on osteoclast activities by using TRAP-staining assay. Among the tested compounds, 3d and 3h ex

Full text of DOI:10.1016/j.bmc.2015.06.007

Bioorganic & Medicinal Chemistry 23 (2015) 4522–4532
Contents lists available at ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc
Novel inhibitors of RANKL-induced osteoclastogenesis: Design,
synthesis, and biological evaluation of 6-(2,4-difluorophenyl)-3-
phenyl-2H-benzo[e][1,3]oxazine-2,4(3H)-diones
Chia-Chung Lee a,b,c, Fei-Lan Liu d, Chun-Liang Chen a, Tsung-Chih Chen a, Feng-Cheng Liu e,
Ahmed Atef Ahmed Ali b,f, Deh-Ming Chang b,d, , Hsu-Shan Huang a,b,c,
⇑
⇑
a Graduate Institute of Cancer Biology and Drug Discovery, College of Medical Science and Technology, Taipei Medical University, Taipei 110, Taiwan, ROC
b Graduate Institute of Life Sciences, National Defense Medical Center, Taipei 114, Taiwan, ROC
c School of Pharmacy, National Defense Medical Center, Taipei 114, Taiwan, ROC
d Rheumatology/Immunology/Allergy, Taipei Veterans General Hospital, Taipei 112, Taiwan, ROC
e Rheumatology/Immunology/Allergy, Tri-Service General Hospital, National Defense Medical Center, Taipei 114, Taiwan, ROC
f Taiwan International Graduate Program, Molecular and Cell Biology Program, Institute of Molecular Biology, Academia Sinica, Taipei 115, Taiwan, ROC
a r t i c l e i n f o
a b s t r a c t
Article history:
A series of novel 6-(2,4-difluorophenyl)-3-phenyl-2H-benzo[e][1,3]oxazine-2,4(3H)-dione derivatives
were synthesized and evaluated for their inhibitory effects on osteoclast activities by using TRAP-staining
assay. Among the tested compounds, 3d and 3h exhibited more potent osteoclast-inhibitory activities
than the lead compound NDMC503 (a ring-fused structure of NDMC101), as reported in our previous
study. Both 3d and 3h exhibited two-fold increase in activity compared to NDMC503. In addition, our
biological results indicated that 3d and 3h could suppress RANKL-induced osteoclastogenesis-related
marker genes, such as NFATc1, c-fos, TRAP, and cathepsin K. Notably, 3d could significantly attenuate
the bone-resorbing activity of osteoclasts in the pit formation assay. Thus, this study might provide a
new class of lead structures that warrant further development as potential anti-resorptive agents.
Ó 2015 Elsevier Ltd. All rights reserved.
Received 26 April 2015
Revised 2 June 2015
Accepted 3 June 2015
Available online 10 June 2015
Keywords:
NDMC101
Osteoclastogenesis
RANKL
TRAP-staining assay
Pit formation assay
1. Introduction
transcription factors NF-
j
B and nuclear factor of activated T cells
B and
c1 (NFATc1) pathways.16,17 Among these factors, both NF-
j
Bone remodeling is a dynamic process that is mediated by the
balance between bone formation and resorption, which are regu-
lated by osteoblasts and osteoclasts, respectively.1–3 When the bal-
anced bone remodeling is disturbed in favor of bone resorption, it
will lead to pathological diseases, such as osteoporosis4,5 and
rheumatoid arthritis (RA).6–8 Osteoclasts are multinucleated cells
(MNCs) originating from fusion of the monocyte/macrophage
hematopoietic lineage mononuclear progenitors.9–12 The receptor
NFATc1 play essential roles in controlling excessive osteoclast dif-
ferentiation and activation.18–20 Furthermore, it was found that
RANKL signaling is associated with the expression of osteoclast-as-
sociated genes such as NFATc1,18–20 c-fos,21,22 tartrate-resistant acid
phosphatase (TRAP),23,24 cathepsin K,25,26 matrix metalloprotease-9
(MMP-9),27,28 and dendritic cell-specific transmembrane protein
(DC-STAMP).29,30 Based on these mechanistic findings, we conclude
that osteoclast differentiation in RANKL–RANK signaling pathway
provides potential molecular targets for the development of anti-
resorptive agents.
In clinical trials, bisphosphonates are widely used as therapeu-
tic agents for bone loss by inhibiting excessive osteoclast formation
and activation.31–33 However, bisphosphonates may cause some
adverse gastrointestinal effects, osteonecrosis of jaw, and renal
toxicity.34–36 Hence, numerous natural products and synthetic
small molecules have been found to be potential inhibitors of
osteoclastogenesis, such as Paeonol,37 Genistein,38 Daidzein,39
Magnolol,40 NDMC101,41,42 NDMC503,42 and ABD345 (Fig. 1).43 In
our previous work, we developed a salicylanilide-derived synthetic
activator of nuclear factor
jB ligand (RANKL) is a member of the
tumor necrosis factor (TNF) family and is an essential factor for
osteoclast differentiation.13–15 Through the activation of RANKL–
RANK signaling transduction cascades, TNF receptor-associated
factor 6 (TRAF 6) is recruited to the intracellular domain of RANK
and triggers various downstream signaling, including the
⇑
Corresponding authors. Tel.: +886 2 275 7799; fax: +886 2 7735 1333 (D.-M.C.);
tel.: +886 2 2736 1661x7525; fax: +886 2 6638 7537 (H.-S.H.).
E-mail addresses: ming0503@ms3.hinet.net (D.-M. Chang), huanghs99@tmu.
edu.tw (H.-S. Huang).
http://dx.doi.org/10.1016/j.bmc.2015.06.007
0968-0896/Ó 2015 Elsevier Ltd. All rights reserved.

C.-C. Lee et al. / Bioorg. Med. Chem. 23 (2015) 4522–4532
4523
OH
OH
HO
OH
O
O
O
O
OH
OH
Paeonol
O
HO
HO
O
OH
Magnolol
Genistein
Daidzein
F
Cl
Cl
O
O
O
N
N
H
F
F
F
O
OH
OH
O
ABD345
NDMC101
NDMC503
Figure 1. Chemical structures of osteoclast inhibitors in literatures.
higher inhibitory effects on the RANKL-induced osteoclastogene-
sis.42 On the basis of our previous structure–activity relationships
(SARs) studies, the scaffold of 3-phenyl-2H-benzo[e][1,3]oxazine-
2,4(3H)-dione can be considered as an essential pharmacophore
for the development of osteoclast inhibitors. Recently, van’t Hof
developed a series of biphenyl-based derivatives including the
20,40-difluorobiphenyl pharmacophore, as inhibitors of the
RANKL-induced osteoclastogenesis which exhibited anti-resorp-
tive effects in vitro and in vivo.43–49 These observations along with
our previous promising results initiated quest for the development
of a new class of anti-resorptive agents.
Considering the importance of the ring-fused pharmacophore
and the 20,40-difluorobiphenyl group in the development of new
class of anti-resorptive agents, a series of 6-(2,4-difluorophenyl)-
3-phenyl-2H-benzo[e][1,3]oxazine-2,4(3H)-diones (3a–3l) were
designed and synthesized in the present work (Fig. 3). The inhibi-
tory effects of synthesized compounds (3a–3l) on RANKL-induced
osteoclast differentiation and formation were evaluated using the
TRAP-staining assay. On the basis of these screening results, we
constructed the SARs of all compounds according to the inhibition
of RANKL-induced osteoclastogenesis. Among our new synthesized
series, compounds 3d and 3h were the most potent derivatives
that effectively inhibited the RANKL-induced osteoclastogenesis.
To further investigate the inhibitory effects of compounds 3d and
3h on the activation of RANKL–RANK signaling transduction
cascades, we tested the effects of both compounds on the
RANKL-induced osteoclastogenesis through suppressing the osteo-
"Ring-fused pharmacophore" is a new
scaffold for osteoclast inhibition
O
R4
Scaffold-hopping
previous work
R3
R2
O
O
Isoflavones
N
R4
R1
R1
R3
R2
O
O
O
N
3-Phenyl-2H-benzo[e][1,3]oxazine-
2,4(3H)-diones
H
(NDMC503, R1=F, R3=Cl)
O
H
Intramolecular hydrogen bonding
Salicylanilides (NDMC101, R1=F, R3=Cl)
(Six-member pseudo-ring)
Figure 2. The essential pharmacophore for osteoclast inhibition.
small molecule (NDMC101) that not only inhibited the RANKL-in-
duced osteoclastogenesis by suppressing NFATc1 and NF-jB activ-
ity, but also significantly reduced the number of TRAP-staining
osteoclasts at sites of articular bone erosions in collagen-induced
arthritis (CIA) mice.41 On the basis of these findings, the lead struc-
ture of NDMC101 can be considered as an osteoclastogenesis inhi-
bitor that warrants further lead optimization. Therefore, we
developed a series of 3-phenyl-2H-benzo[e][1,3]oxazine-2,4(3H)-
dione derivatives by scaffold hopping strategy, as reported in our
previous study (Fig. 2).42 We also found that rigidifying the pseudo
six-membered ring of salicylanilide core may increase the anti-re-
sorptive activity.42 Compared to the lead structure NDMC101, we
found that the ring-fused pharmacophore of NDMC503 exhibited
clastogenesis-related marker genes, blocking the NF-jB nuclear
translocation, and decreasing the NFATc1 expression levels.
Detailed illustration of the biological experiments performed to
evaluate compounds 3d and 3h is presented as follows.
Ring-fused rigidification
(pharmacophore A)
"Ring-fused pharmacophore" is a new
scaffold for osteoclast inhibition
R4
Cl
F
R3
R2
O
O
O
N
N
2
,
4
-
F
d
F
R1
(
p
i
f
O
O
h
l
u
O
a
o
r
r
m
o
a
b
NDMC503
c
i
p
o
this work
h
e
p
e
h
(
3-Phenyl-2H-benzo[e][1,3]oxazine-
2,4(3H)-diones)
n
y
o
r
l
B)
2
,
4
6-(2,4-difluorophenyl)-3-phenyl-2H-benzo[e][1,3]
3a-3l
-
d
i
f
l
u
oxazine-2,4(3H)-diones
o
r
o
b
i
p
F
h
e
n
y
l
SARs study
2,4-Difluorobiphenyl pharmacophore is
essential for osteoclast inhibition
F
OH
O
ABD345
Figure 3. Rational deign, SARs study, and the essential pharmacophore for the development of 6-(2,4-difluorophenyl)-3-phenyl-2H-benzo[e][1,3]oxazine-2,4(3H)-diones
(3a–3l).

4524
C.-C. Lee et al. / Bioorg. Med. Chem. 23 (2015) 4522–4532
Table 1
R4
F
Effects of 6-(2,4-difluorophenyl)-3-phenyl-2H-benzo[e][1,3]oxazine-2,4(3H)-diones
on RANKL-induced osteoclastogenesis and cell viability in RAW264.7 cells
F
R3
R2
O
O
i, ii
OH
OH
N
H
Compound
Substituent
% inhibition of
MNCa
% cell
F
F
R1
viabilityb
OH
R1
R2
R3
R4
1
2a-2l
3a
3b
3c
3d
3e
3f
3g
3h
3i
F
F
H
F
CF3
H
H
H
H
H
H
H
H
H
F
H
H
CF3
H
Cl
F
F
H
H
H
CF3
H
H
CN
H
H
H
F
H
H
H
H
H
H
H
H
19.41 1.40
42.32 6.62
17.35 7.49
86.84 1.74
31.58 4.00
62.92 2.65
16.85 4.61
57.46 3.25
33.99 6.98
29.44 5.48
21.20 2.49
30.75 5.77
96.22 0.53
96.49 1.86
72.15 0.43
86.60 5.69
95.53 3.86
100.13 0.94
103.01 2.51
88.38 4.65
102.79 1.93
108.33 1.10
103.05 4.03
105.53 4.7
iii
R4
R1
F
R3
R2
O
CCH
CN
H
OCH3 OCH3
OCH3
N
F
3j
3k
3l
O
O
3a-3l
H
a
RAW 264.7 cells, the cells were cultured in the maintaining mediums and
RANKL (100 ng/mL) with or without the tested compound (5 M) for 4 days. TRAP-
Scheme
1. Synthetic
routes
of
6-(2,4-difluorophenyl)-3-phenyl-2H-
l
benzo[e][1,3]oxazine-2,4(3H)-diones (3a–3l). Reagents and conditions: (i) SOCl2,
anhydrous THF, reflux, 6 h; (ii) anilines, anhydrous THF, reflux, 12–14 h; (iii) methyl
chloroformate, anhydrous THF/pyridine, reflux, 2 h.
positive multinucleated cells (MNCs) were counted as osteoclasts (three or more
than three nuclei (N > 3). RANKL-induced osteoclast differentiation is shown as
relative activity (% of RANKL-treated with compounds/RANKL-treated without
compounds as vehicle). Inhibition (%) = 100% ꢀ MNCs (%) of compounds.
2. Chemical synthesis
b
Cell viability of tested compounds were determined relative to the control at
5 lM by MTT assay. All representative data were performed the means SD at least
three times independently (n > 3).
In the present work, it is noteworthy to mention that this
study is the first to use 20,40-difluoro-4-hydroxybiphenyl-3-car-
boxylic acid (diflunisal) as starting material for the synthesis
of a series of 6-(2,4-difluorophenyl)-3-phenyl-2H-benzo[e][1,3]ox-
azine-2,4(3H)-diones. Diflunisal is approved worldwide for the
treatment of inflammatory diseases.50,51 As part of an endeavor
to profile the potential therapeutics for the treatment of inflamma-
tion-related bone diseases, diflunisal is an attractive scaffold that
justifies further structure modification. Thus, diflunisal (1) was
used as our starting material that was transformed to the corre-
sponding acid chloride after treatment with thionyl chloride, and
then the acid chloride was reacted with the substituted anilines
to give the corresponding compounds (2a–2l). We further cyclized
compounds (2a–2l) to the corresponding cyclic compounds (3a–3l)
by using methyl chloroformate as cyclization reagent in the pres-
ence of pyridine and tetrahydrofuran (THF).52 The reaction mix-
tures were refluxed over 70 °C for 2 h and then stirred for
another 12 h at room temperature. The mixture solution was acid-
ified with 5% hydrochloric acid and was put in ice bath to obtain
compounds (3a–3l) in 11–61% yields (see Scheme 1). The
byproducts were separated and purified by employing their differ-
ent physicochemical properties using recrystallization and chro-
matography procedures. The purity of all synthetic compounds
was more than 95%. The structures of all synthesized compounds
are elucidated along with their spectroscopic characterizations in
the experimental section. In addition, the ring-fused structure of
3h was further confirmed by using the single-crystal X-ray crystal-
lography (the ORTEP plot of 3h is presented in Fig. 4).
3. Biological results and discussion
3.1. Effects of the synthesized compounds on the RANKL-
induced osteoclast differentiation
RAW264.7 cells (osteoclast precursor cells) are widely used as
an osteoclast differentiation model.41,53 The TRAP enzyme is highly
expressed in osteoclasts and the histochemical staining of TRAP-
positive MNCs is widely used to identify osteoclasts both in vivo
Figure 4. ORTEP diagram of 3h. Ellipsoids are drawn at 50% probability level; selected crystallographic data for 3h are given in Supplementary data.

C.-C. Lee et al. / Bioorg. Med. Chem. 23 (2015) 4522–4532
4525
Figure 5. Effects of compounds 3d and 3h on the RANKL-induced osteoclastogenesis from RAW264.7 cells by using TRAP-staining activity assay. (A) Control group was
cultured without test compounds in the absence of RANKL (100 ng/mL). Vehicle was cultured without the tested compounds and RAW264.7 cells were cultured with 3d and
3h at 5
l
M in the presence of RANKL. After 4 days, the mature osteoclasts were fixed and stained by TRAP. The TRAP-positive MNCs containing more than three nuclei (N > 3)
M in the
were visualized by light microscopy. (B) Vehicle was cultured without the tested compounds and RAW264.7 cells were cultured with 3d and 3h at 7.5, 5, and 2.5
l
presence of RANKL. RANKL-induced osteoclast differentiation is shown as relative activity (% of RANKL-treated with compounds/RANKL-treated without compounds as
vehicle). All data were performed the means SD at least three times independently; *P <0.05 and **P <0.01 compared with the RANKL-treated group.
and in vitro.54 The inhibitory activities of all synthesized com-
pounds (3a–3l) on the RANKL-induced TRAP-positive MNCs from
RAW264.7 cells were screened using the TRAP-staining assay.
Almost all of final compounds (3a–3l) did not affect the viability
of RAW264.7 cells (Table 1). These observations prove that their
inhibitory activities were not due to their cytotoxic effects. As illus-
trated in Table 1, most of our synthesized compounds decreased
the percentage of TRAP-positive MNCs at a concentration of
bearing mono-substitution at the aniline moiety, we found that
the substitution at R2 position showed relatively higher activities
than those at R1 or R3 position, especially for 3-ethynyl aniline.
Amongst compounds bearing difluoro groups at the aniline moiety
and their cyclic analogs, we observed that the 2,5-difluoro analogs
showed relatively higher activities than the 2,4-difluoro and
3,4-difluoro analogs. Based on these SARs observations, it is
confirmed that the 6-(2,4-difluorophenyl)-3-phenyl-2H-benzo[e]
[1,3]oxazine-2,4(3H)-dione derivatives can increase in the inhibi-
tory activity of RANKL-induced osteoclastogenesis, especially for
3d and 3h. Thus, we chose both compounds which were the most
potent among the synthesized series for further mechanistic inves-
tigation in the RANKL/RANK signaling pathway.
5
l
M. The highest percent inhibition values of MNCs were for com-
pounds 3d, 3f, and 3h at 5 M (86.84 1.74%, 62.92 2.65%, and
l
57.46 3.25%, respectively). Compared to compounds 3d, 3f, and
3h, NDMC503 (a ring-fused structure of NDMC101) exhibited
lower inhibitory effect (25.38 11.63%) on the TRAP-positive stain-
ing MNCs at a concentration of 5 l
M in our previous study.42 In
order to investigate whether these compounds inhibited the activ-
ity of osteoclasts, the inhibitory effects of compounds 3d, 3f, and
3h on RANKL-induced TRAP activity were determined.
Compounds 3d, 3f, and 3h were found to dose-dependently sup-
press RANKL-induced TRAP activity with IC50 values of 4.31, 4.29,
3.2. Effects of 3d and 3h on the expression levels of
osteoclastogenesis-related marker genes during the RANKL-
induced osteoclast formation
Osteoclast differentiation is associated with up-regulation of
osteoclastogenesis-related marker genes such as NFATc1, c-fos,
TRAP, cathepsin K, MMP-9, and DC-STAMP in response to the binding
of RANKL to RANK.55,56 In order to test whether compounds 3d and
3h would regulate the expression levels of osteoclastic genes dur-
ing the RANKL-induced osteoclastogenesis, we assessed the inhibi-
tory effects of 3d and 3h on the expression levels of NFATc1, c-fos,
TRAP, cathepsin K, MMP-9, and DC-STAMP genes by using the
reverse transcription polymerase chain reaction (RT-PCR) assay.
Our results showed that the expression levels of NFATc1, c-fos,
and 3.7 lM, respectively (as shown in Supplementary data).
Based on the results of TRAP-staining assay and TRAP activity,
we conclude that our new 6-(2,4-difluorophenyl)-3-phenyl-2H-
benzo[e][1,3]oxazine-2,4(3H)-diones 3d and 3h are potent inhibi-
tors of RANKL-induced osteoclastogenesis. Both compounds 3d
and 3h were able to reduce the number of TRAP-positive MNCs
at 5 lM as shown in Figure 5A and B.
On the basis of these screening results, the SARs of compounds
3a–3l are briefly summarized as follows. Amongst compounds

4526
C.-C. Lee et al. / Bioorg. Med. Chem. 23 (2015) 4522–4532
Figure 6. Effects of compounds 3d and 3h on the RANKL-induced osteoclastogenesis-related gene expression levels. (A) RAW264.7 cells were either pretreated or not with 3d
and 3h at 5 M for 1 h and then treated with RANKL (100 ng/mL) for 24 h. Total RNA was isolated with TRIzol, and 2 g of total RNA was used to transcribe cDNA. cDNA was
l
l
used as a template for PCR with mouse-specific primers. (B) Effects of compounds 3d and 3h on the RANKL-induced osteoclastogenic mRNA expression levels were
normalized as relative activity (% of control). All data were performed the means SD at least two times independently; *P <0.05 and **P <0.01 compared with the RANKL-
treated group.
TRAP, cathepsin K, MMP-9, and DC-STAMP were increased in
response to RANKL stimulation for 24 h (Fig. 6A). However, such
levels including NFATc1, c-fos, TRAP, and cathepsin K were signifi-
cantly suppressed after treatment with 3d and 3h at concentra-
genes through a mechanism dependent on RANKL–RANK interac-
tion.55,56 For example, NF-
jB and NFATc1 are essential transcrip-
tional factors for the osteoclast differentiation and formation.18,57
However, they are not activated within the same time frame.
tions of 2.5 and 5
l
M (Fig. 6B). These results revealed that
NF-
factor.57 In addition, it has been reported that NF-
upstream transcriptional factor which can modulate NFATc1
expression. In the inactive state, NF- is retained in the
cytoplasm. When activated, NF- B would translocate from the
j
B is an early-response factor and NFATc1 is a late-response
compounds 3d and 3h might decrease the RANKL-induced mRNA
expression levels in response to inhibiting RANK signaling
pathway.
j
B is an
j
B
j
3.3. Effects of 3d and 3h on the RANKL-induced NF-
j
B
cytoplasm into the nucleus. Initially, we examined the inhibitory
activation and NFATc1 expression levels in the nucleus during
osteoclast differentiation
effects of compounds 3d and 3h on the RANKL-stimulated nuclear
expression levels of NF-
jB in RAW264.7 cells by using NF-jB activ-
ity assay. This assay is used to analyze the NF-
j
B activity through
Some master transcriptional factors can be activated and are
responsible for promoting osteoclastogenesis-related marker
using enzyme-linked immunosorbent assay plates. Compared to
the nuclear expression levels in the untreated cells, the

C.-C. Lee et al. / Bioorg. Med. Chem. 23 (2015) 4522–4532
4527
accumulation of NF-
(Fig. 7A). However, such elevated levels of the nuclear NF-
reduced by treatment with the tested compounds, especially for
3d.
j
B was increased after treatment with RANKL
resorbing activity of mature osteoclasts through RANKL–RANK
interaction. In this assay, RAW264.7 cells are seeded on dentine
slices and then differentiated into mature osteoclasts in response
to RANKL stimulation. Resorbing pits were formed on the dentine
slices by mature osteoclasts. However, dose-dependent attenua-
tion of the resorbed areas could be observed after treatment with
various concentrations of 3d. Our results showed that 3d might
reduce osteoclast formation by ameliorating RANKL-induced
bone-resorbing activity of mature osteoclasts at concentrations of
jB were
To further confirm the above results, we tested the inhibitory
effects of 3d on the RANKL-induced NF-
levels in nuclear extracts using Western blotting assay. The data
are expressed as the ratios of the protein levels of NF- B and
NFATc1 normalized to the level of TATA-box binding protein
(TBP). As shown in Figure 7B, the expression levels of NF- B and
jB and NFATc1 expression
j
j
2.5, 5, and 7.5
lM (Fig. 8).
NFATc1 in nuclear extracts increased by RANKL treatment.
However, such elevated levels were reduced by treatment with
3d. These results showed that 3d might suppress the RANKL-in-
4. Conclusions
duced NF-jB activation and NFATc1 expressions in nucleus.
In a continuous interest in the synthesis of new class of anti-re-
sorptive agents, a series of 6-(2,4-difluorophenyl)-3-phenyl-2H-
benzo[e][1,3]oxazine-2,4(3H)-dione derivatives were developed
and evaluated for their inhibitory activities on the RANKL-induced
osteoclast formation. The general SARs were established by using
TRAP-staining assay. These SARs was outlined as follows: (a) com-
pounds bearing mono-substituted groups at R2 position had higher
activities than those at R1 or R3 positions at the aniline moiety,
especially for 3-ethynyl aniline; (b) compounds bearing di-substi-
tuted groups at the aniline moiety revealed that difluoro groups
showed relatively higher inhibitory activities, especially for the
2,5-difluoro analogs. Our biological results indicated that com-
pound 3d exhibited the most potent inhibitory activity towards
the RANKL-induced osteoclastogenesis. The proposed mechanism
of this activity is shown in Figure 9.
3.4. Effects of 3d on the RANKL-induced bone-resorbing activity
of osteoclasts
In order to investigate whether compound 3d would attenuate
the bone-resorbing activity of osteoclasts, the pit formation assay
was used for evaluating the effect of 3d on dentine slices. This
assay is based on the facts that bone resorption is a characteristic
feature of functional osteoclasts, and RANKL induces the bone-
The inhibitory activities of 3d might be affected by inhibiting
NF-j
B
transcriptional activation and suppressing NFATc1-
regulated osteoclastogenesis-related genes. Furthermore, the pit
formation assay showed that 3d could reduce the bone-resorbing
activity of mature osteoclasts. This study provides
a new
class of 6-(2,4-difluorophenyl)-3-phenyl-2H-benzo[e][1,3]ox-
azine-2,4(3H)-diones as potent anti-resorptive agents for the treat-
ment of bone disorders characterized by excessive osteoclastic
resorption.
5. Materials and methods
5.1. Chemistry
Unless otherwise stated, all materials used were commercially
available. Chemical reagents and solvents were purchased from
Aldrich and Merck without further purification. Reactions requir-
ing anhydrous conditions were performed in oven-dried glassware
and cooled under nitrogen atmosphere. Melting points were deter-
mined by a Büchi B-545 melting point apparatus and are uncor-
rected. Analytical thin layer chromatography was performed with
E. Merck silica gel 60 F254.
1H nuclear magnetic resonance (NMR)
and 13C NMR spectra were recorded on Varian Gemini 300
(300 MHz) and Agilent 400 MR DD2 (400 MHz). d value is pre-
sented in parts per million (ppm) relative to TMS as an internal
standard (0 ppm). Multiplicities were recorded as singlet (s), dou-
blet (d), triplet (t), quartet (q), and double of doublet (dd). Coupling
constants (J) are expressed in Hz. High resolution mass spectra
(HRMS) were measured by Finnigan MAT-95XL (high resolution
electron impact ionization, HREI) and Finnigan MAT-95S (high res-
olution electrospray ionization, HRESI). Spectral data are recorded
as m/z values. The purity of all synthetic compounds was analyzed
by reverse-phase high performance liquid chromatography (HPLC)
analysis to be >95%. HPLC spectra for all compounds were acquired
using a Hitachi L-2000 series system with UV detector (L-2400,
Hitachi). The retention time (tR) is expressed in min at UV detec-
tion of 208 nm. By using HPLC analysis, chromatography
Figure 7. (A) Effects of compounds 3d and 3h on the RANKL-induced NF-
expression levels in nucleus. RAW264.7 cells were pretreated with 3d and 3h at
jB
5 lM for 1 h prior to treatment with RANKL (100 ng/mL) for 24 h. The data
represent more than two cultures (n > 2); *P <0.05, **P <0.01, significantly different
from values after treatment with RANKL along. (B) Effect of 3d on RANKL-induced
nuclear expression levels of NF-
RANKL (100 ng/mL) and test compounds as control. Nuclear extracts (NE) were
analyzed by using Western blotting employing antibodies to NFATc1 and NF-
jB and NFATc1. RAW264.7 cells treated without
j
B
proteins. Equal amounts of proteins were loaded in each lane as demonstrated by
the level of TATA-box protein (TBP). All representative data were performed the
results at least two times independently.

4528
C.-C. Lee et al. / Bioorg. Med. Chem. 23 (2015) 4522–4532
Figure 8. Effect of compound 3d on the bone-resorbing activity of mature osteoclasts. RAW264.7 cells were cultured on bone slices with 3d at different concentrations (7.5, 5,
and 2.5 M) in the presence of RANKL (100 ng/mL). After 4 days, the dentine slices were recovered for staining with 0.1% toluidine blue to visualize the resorption pits; arrows
l
indicate pit area; RAW264.7 cells were cultured on bone slices with 3d at 7.5, 5, and 2.5 lM in the presence of RANKL. Percentages (%) of the resorbed area were determined
using ImageJ software and then normalized as relative activity (% of control). Data represent the means SD of more than 6 slices; *P <0.05 and **P <0.01 compared with the
RANKL-treated group.
Figure 9. Proposed mechanism for the inhibition of RANKL-induced osteoclastogenesis and bone resorption by compound 3d includes direct effects on NF-jB activation and
NFATc1-regulated osteoclastogenesis-related marker genes.

C.-C. Lee et al. / Bioorg. Med. Chem. 23 (2015) 4522–4532
4529
Table 2
Primers used for RT-PCR
Target gene
Forward primer sequence (50–30)
Reverse primer sequence (50–30)
Cathespin K
c-fos
DCSTAMP
GAPDH
TRAP
AGGCAGCTAAATGCAGAGGGTA
GGTTTCAACGCCGACTACGAG
CCGCTGTGGACTATCTGCTGTA
GTGAGGCCGGTGCTGAGTATGT
ACGGCTACTTGCGGTTTCACTA
AGGCCTCTACAGAGTCTTTG
CCCTGACCACCGATAGCACTCT
CAGGCGTTGTTCTTATTCCGAG
CTGACACGGTCTTCACCATTCC
TTCCCGTCAGCCTCTCTCAAT
ACAGTCTTCTGGGTGGCAGTGAT
GTGTGGGCATACTTCTTTCCTGT
CAGTCCAACAAGAAAGGACG
GGCTGCCTTCCGTCTCATAGTG
MMP-9
NFATc1
performed on a C18 reverse-phase column (XBridge Shield RP18
Column, 130 Å, 5
1.0 mL/min was used with a mobile phase gradient of 0–20% H2O
(td, J = 8.4, 2.5 Hz, 1H), 7.23 (td, J = 10.4, 2.7 Hz, 1H), 7.48–7.52 (m,
1H), 7.63–7.75 (m, 4H), 8.05 (dt, J = 8.4, 1.5 Hz, 1H), 8.10 (t,
J = 1.8 Hz, 1H); 13C NMR (75 MHz, DMSO-d6): d ppm 104.47,
104.74, 105.00, 112.26, 112.30, 112.47, 112.51, 114.34, 117.00,
117.23, 117.30, 121.26, 121.39, 122.63, 122.67, 122.76, 122.80,
125.50, 125.54, 127.25, 127.28, 131.62, 131.99, 132.03, 132.09,
134.89, 134.99, 137.17, 146.64, 152.12, 156.15, 157.85, 157.98,
158.67, 159.73, 160.33, 160.46, 160.87, 160.99, 163.34; HPLC pur-
ity: >95%; tR = 3.80 min; HRMS (EI) m/z: calcd [M]+, 403.0223
(C20H9ClF3NO+3), found, 403.0229.
l
m, 4.6 mm ꢁ 250 mm, Waters). A flow rate of
in MeOH.
5.2. X-ray crystallography
A single crystal of suitable size for X-ray diffractometry was
selected under a microscope and mounted on the tip of a glass
fiber, which was positioned on a copper pin. Crystallographic assay
was performed as described in the reported protocol.58,59 The X-ray
data for 3d was collected with a Bruker Kappa CCD diffractometer,
5.4.2. 3,6-Bis(2,4-difluorophenyl)-2H-benzo[e][1,3]oxazine-2,4
(3H)-dione (3b)
The pure compound was obtained as white powder (yield 61%).
Mp: 155–156 °C (EtOH); 1H NMR (300 MHz, DMSO-d6): d ppm
7.20–7.33 (m, 2H), 7.42 (td, J = 9.7, 1.5 Hz, 1H), 7.54 (td, J = 9.7,
2.1 Hz, 1H), 7.65–7.74 (m, 3H), 8.03–8.10 (m, 2H); 13C NMR
employing graphite-monochromated Mo-K
a radiation at 200 K
and the h–2h scan mode. The space group for 3d was determined
on the basis of systematic absences and intensity statistics, and
the structure of 3d was solved by direct methods using SIR92 or
SIR97 and refined with SHELXL-97. Selected crystallographic data
for 3d are given in Supplementary data.
(75 MHz, DMSO-d6):
d ppm 104.38, 104.62, 104.74, 104.93,
104.98, 105.09, 105.29, 112.25, 112.53, 114.41, 117.34, 118.73,
118.85, 112.70, 112.87, 127.34, 131.75, 132.02, 132.07, 132.15,
132.20, 132.26, 137.21, 152.24, 156.10, 156.28, 157.74, 159.45,
159.94, 160.85, 161.04, 164.30; HPLC purity: >95%; tR = 4.71 min;
HRMS (EI) m/z: calcd [M]+, 387.0519 (C20H9F4NO+3), found,
387.0518.
5.3. General procedure I: Preparation of compounds (2a–2l)
To a solution of diflunisal (0.9 g, 4 mmol) in anhydrous tetrahy-
drofuran (30 mL) was added dropwise thionyl chloride (1 mL,
14 mmol), and the mixture was refluxed under nitrogen atmo-
sphere for 6 h. After cooling to room temperature, the mixture
was steamed to give the intermediate by Dean–Stark apparatus.
The residue was carried onto the next step without further purifi-
cation and it was directly reacted with various anilines (4 mmol) in
anhydrous tetrahydrofuran (30 mL) for 12–14 h. After removal of
tetrahydrofuran, the reaction mixture was washed with ethyl acet-
ate/n-hexane and the crude product was extraction with ethyl
acetate (3 ꢁ 25 mL), washed with 10% NaHCO3 (15 mL), H2O
(3 ꢁ 25 mL), brine (10 mL), and then dried over anhydrous
MgSO4. The organic layer was collected and concentrated in vacuo.
The crude product was washed and purified by crystallization from
hot ethanol to obtain compounds (2a–2l). The physicochemical
characterizations of intermediates 2a–2l are reported in the
literature.60
5.4.3. 6-(2,4-Difluorophenyl)-3-(3,4-difluorophenyl)-2H-benzo[e]
[1,3]oxazine-2,4(3H)-dione (3c)
The pure compound was obtained as white powder (yield 25%).
Mp: 193–194 °C (EtOH); 1H NMR (300 MHz, DMSO-d6): d ppm
7.20–7.23 (m, 1H), 7.34–7.45 (m, 2H), 7.57–7.73 (m, 4H), 8.03–
8.04 (m, 1H), 8.08 (t, J = 1.8 Hz, 1H); 13C NMR (75 MHz, DMSO-
d6):
d ppm 104.48, 104.74, 105.00, 112.26, 112.29, 112.47,
112.51, 114.96, 117.10, 117.81, 117.99, 118.20, 118.39, 122.73,
122.76, 112.86, 122.89, 126.18, 126.21, 126.25, 126.28, 127.15,
127.18, 131.34, 131.59, 131.62, 131.67, 131.71, 131.94, 131.98,
132.04, 132.08, 136.74, 147.31, 147.92, 148.04, 148.33, 148.45,
150.37, 150.49, 150.79, 150.91, 152.05, 157.85, 157.98, 160.33,
160.42, 160.46, 160.84, 160.97, 163.31, 163.43; HPLC purity:
>95%; tR = 4.56 min; HRMS (EI) m/z: calcd [M]+, 387.0519
(C20H9F4NO+3), found, 387.0522.
5.4. General procedure II: Preparation of compounds (3a–3l)
A solution of methyl chloroformate (1.2 mL, 12 mmol) was
added to a solution of compounds (2a–2l) (4 mmol) in dry anhy-
drous tetrahydrofuran/pyridine (30 mL) at 0 °C for 0.5 h. The fol-
lowing mixture was refluxed for 2 h and then stirred at room
temperature upon completion. The reaction was adjusted to
pH = 6 by 5% HCl(aq). The mixture was cooled to obtain precipitated
product under ice bath for 2–3 h. And then, precipitated crystals
were filtered off and washed with diluted H2O/HCl(aq). The crude
product was purified by crystallization from hot ethanol to afford
compounds (3a–3l).
5.4.4. 6-(2,4-Difluorophenyl)-3-(2,5-difluorophenyl)-2H-benzo[e]
[1,3]oxazine-2,4(3H)-dione (3d)
The pure compound was obtained as white powder (yield 15%).
Mp: 144–145 °C (EtOH); 1H NMR (300 MHz, DMSO-d6): d ppm 7.23
(td, J = 8.4, 2.4 Hz, 1H), 7.37–7.58 (m, 4H), 7.65–7.73 (m, 2H), 8.03–
8.11 (m, 2H); 13C NMR (75 MHz, DMSO-d6): d ppm 104.38, 104.74,
105.09, 112.25, 112.30, 112.53, 112.59, 114.32, 114.36, 117.39,
117.45, 117.50, 117.58, 117.75, 117.85, 118.06, 118.16, 118.37,
118.48, 122.66, 122.71, 122.87, 123.02, 123.08, 123.22, 127.37,
127.41, 131.86, 132.02, 132.07, 132.15, 132.20, 137.32, 137.35,
146.64, 152.21, 152.64, 155.95, 156.21, 157.60, 157.76, 159.40,
159.75, 160.63, 160.79, 160.91, 161.07, 163.92, 164.09; HPLC pur-
ity: >95%; tR = 3.90 min; HRMS (EI) m/z: calcd [M]+, 387.0519
(C20H9F4NO+3), found, 387.0516.
5.4.1. 3-(4-Chloro-2-fluorophenyl)-6-(2,4-difluorophenyl)-2H-
benzo[e][1,3]oxazine-2,4(3H)-dione (3a)
The pure compound was obtained as white powder (yield 11%).
Mp: 176–177 °C (EtOH); 1H NMR (300 MHz, DMSO-d6): d ppm 7.23

4530
C.-C. Lee et al. / Bioorg. Med. Chem. 23 (2015) 4522–4532
5.4.5. 6-(2,4-Difluorophenyl)-3-(2-(trifluoromethyl)phenyl)-2H-
benzo[e][1,3]oxazine-2,4(3H)-dione (3e)
131.62, 131.67, 131.72, 133.97, 134.00, 139.13, 157.59, 157.74,
157.87, 160. 21, 160.33, 162.66, 162.78, 166.25; HPLC purity:
>95%; tR = 8.43 min; HRMS (EI) m/z: calcd [M]+, 376.0659
(C21H10F2N2O+3), found, 375.0622.
The pure compound was obtained as light orange powder (yield
31%). Mp: 200–201 °C (EtOH); 1H NMR (300 MHz, DMSO-d6): d
ppm 7.23 (td, J = 9.3, 2.4 Hz, 1H), 7.42 (td, J = 10.2, 2.4 Hz, 1H),
7.68–7.82 (m, 4H), 7.89–7.95 (m, 2H), 8.05–8.11 (m, 2H); 13C
NMR (75 MHz, DMSO-d6): d ppm 104.35, 104.70, 105.04, 112.21,
112.25, 112.53, 112.55, 114.31, 114.36, 117.38, 121.36, 122.64,
122.68, 122.80, 122.84, 124.90, 126.50, 126.92, 127.14, 127.30,
130.43, 131.55, 131.90, 132.06, 132.11, 132.19, 132.24, 132.70,
134.23, 137.35, 146.98, 152.15, 157.56, 157.63, 160.39, 161.04,
162.61, 162.74; HPLC purity: >95%; tR = 4.47 min; HRMS (EI) m/z:
calcd [M]+, 419.0581 (C21H10F5NO+3), found, 419.0586.
5.4.10. 4-(6-(2,4-Difluorophenyl)-2,4-dioxo-2H-benzo[e][1,3]-
oxazin-3(4H)-yl)benzonitrile (3j)
The pure compound was obtained as yellowish brown powder
(yield 22%). Mp: 203–204 °C (EtOH); 1H NMR (300 MHz, DMSO-
d6): d ppm 7.24 (td, J = 8.7, 0.9 Hz, 1H), 7.42 (td, J = 10.1, 2.7 Hz,
1H), 7.63–7.73 (m, 4H), 8.01–8.08 (m, 4H); 13C NMR (75 MHz,
DMSO-d6): d ppm 104.37, 104.72, 105.07, 111.91, 112.27, 112.51,
112.56, 115.05, 117.15, 118.32, 122.82, 122.95, 127.19, 130.14,
131.46, 131.96, 132.01, 132.08, 132.14, 133.35, 136.83, 139.47,
147.19, 152.24, 160.40, 163.97, 164.12; HPLC purity: >95%;
5.4.6. 6-(2,4-Difluorophenyl)-3-(3-(trifluoromethyl)phenyl)-2H-
benzo[e][1,3]oxazine-2,4(3H)-dione (3f)
tR = 3.48 min; HRMS (EI)
m/z:
calcd [M]+,
376.0659
The pure compound was obtained as white powder (yield 13%).
Mp: 165–166 °C (EtOH); 1H NMR (300 MHz, DMSO-d6): d ppm 7.24
(td, J = 7.5, 2.1 Hz, 1H), 7.42 (td, J = 10.1, 2.7 Hz, 1H), 7.64–7.73 (m,
2H), 7.78–7.80 (m, 2H), 7.85–7.88 (m, 1H), 7.91 (s, 1H), 8.03 (dt,
J = 9.3, 1.5 Hz, 1H), 8.08 (t, J = 1.8 Hz, 1H); 13C NMR (75 MHz,
DMSO-d6): d ppm 104.48, 104.74, 105.00, 112.26, 112.29, 112.47,
112.51, 115.03, 117.10, 119.73, 122.44, 122.74, 122.78, 122.88,
122.91, 125.15, 125.70, 125.74, 127.13, 127.16, 127.86, 129.38,
129.70, 130.02, 130.34, 130.48, 131.31, 131.93, 131.97, 132.03,
132.07, 133.10, 135.98, 136.72, 147.41, 152.12, 157.86, 157.98,
160.33, 160.46, 160.53, 160.84, 160.96, 163.30, 163.43; HPLC pur-
ity: >95%; tR = 3.79 min; HRMS (EI) m/z: calcd [M]+, 419.0581
(C21H10F5NO+3), found, 419.0590.
(C21H10F2N2O+3), found, 375.0655.
5.4.11. 6-(2,4-Difluorophenyl)-3-(3,4-dimethoxyphenyl)-2H-
benzo[e][1,3]oxazine-2,4(3H)-dione (3k)
The pure compound was obtained as white powder (yield 43%).
Mp: 198–199 °C (EtOH); 1H NMR (300 MHz, DMSO-d6): d ppm 3.72
(s, 3H), 3.81 (s, 3H), 6.96 (dd, J = 8.5, 2.1 Hz, 1H), 7.04–7.09 (m, 2H),
7.20–7.27 (m, 1H), 7.42 (td, J = 8.3, 2.7 Hz, 1H), 7.61 (d, J = 8.4 Hz,
1H), 7.65–7.73 (m, 1H), 7.98–8.02 (m, 1H), 8.07 (t, J = 1.5 Hz, 1H);
13C NMR (75 MHz, DMSO-d6):
d ppm 55.63, 55.68, 104.13,
104.48, 104.83, 111.95, 112.27, 112.32, 112.70, 114.97, 116.81,
120.78, 127.15, 127.78, 131.17, 131.74, 131.79, 13.87, 131.93,
136.37, 147.49, 149.10, 149.16, 152.07, 157.74, 160.48, 160.90,
161.15,164.26; HPLC purity: >95%; tR = 3.42 min; HRMS (EI) m/z:
calcd [M]+, 411.0918 (C22H15F2NO+5), found, 411.0917.
5.4.7. 6-(2,4-Difluorophenyl)-3-(4-(trifluoromethyl)phenyl)-2H-
benzo[e][1,3]oxazine-2,4(3H)-dione (3g)
The pure compound was obtained as white powder (yield 11%).
Mp: 209–210 °C (EtOH); 1H NMR (300 MHz, DMSO-d6): d ppm 7.24
(td, J = 9, 1.2 Hz, 1H), 7.42 (td, J = 10.2, 2.4 Hz, 1H), 7.63–7.73 (m,
4H), 7.93 (d, J = 8.4 Hz, 2H), 8.03 (dt, J = 8.7, 2.1 Hz, 1H), 8.08 (t,
J = 1.5 Hz, 1H); 13C NMR (75 MHz, DMSO-d6): d ppm 105.00,
105.35, 105.70, 112.85, 112.90, 113.13, 113.18, 115.74, 117.77,
122.86, 123.43, 123.48, 123.66, 126.48, 126.93, 126.97, 127.83,
127.87, 129.88, 130.30, 130.54, 132.06, 132.59, 132.65, 132.72,
132.78, 137.41, 139.60, 147.97, 152.91, 158.26, 158.36, 161.15,
161.68, 163.72, 164.64; HPLC purity: >95%; tR = 4.71 min; HRMS
(EI) m/z: calcd [M]+, 419.0581 (C21H10F5NO+3), found, 419.0584.
5.4.12. 6-(2,4-Difluorophenyl)-3-(3-methoxyphenyl)-2H-benzo-
[e][1,3]oxazine-2,4(3H)-dione (3l)
The pure compound was obtained as light orange powder (yield
12%). Mp: 160–161 °C (EtOH); 1H NMR (300 MHz, DMSO-d6): d
ppm 3.77 (s, 3H), 6.99–7.07 (m, 2H), 7.20–7.27 (m, 1H), 7.38–
7.45 (m, 2H), 7.23–7.60 (m, 2H), 7.98–8.03 (m, 1H), 8.07 (t,
J = 1.8 Hz, 1H); 13C NMR (75 MHz, DMSO-d6):
d ppm 55.18,
104.13, 104.48, 104.83, 112.03, 112.26, 112.31, 114.36, 114.44,
114.97, 116.84, 120.61, 122.70, 127.11, 129.59, 131.20, 131.79,
131.86, 131.92, 136.12, 136.41, 147.21, 152.10, 152.40, 159.79,
160.27, 162.73, 164.16; HPLC purity: >95%; tR = 3.92 min; HRMS
(EI) m/z: calcd [M]+, 381.0813 (C21H13F2NO+4), found, 381.0806.
5.4.8. 6-(2,4-Difluorophenyl)-3-(3-ethynylphenyl)-2H-benzo[e]
[1,3]oxazine-2,4(3H)-dione (3h)
The pure compound was obtained as light orange crystal (yield
14%). Mp: 195–196 °C (EtOH); 1H NMR (300 MHz, DMSO-d6): d
ppm 4.29 (s, 1H), 7.23 (td, J = 8.3, 2.7 Hz, 1H), 7.42 (td, J = 10.2,
2.4 Hz, 1H), 7.48–7.73 (m, 6H), 7.99–8.04 (m, 1H), 8.07 (t,
J = 1.8 Hz, 1H); 13C NMR (75 MHz, DMSO-d6): d ppm 81.64, 82.42,
104.38, 104.73, 105.08, 112.23, 112.28, 112.51, 112.56, 115.11,
117.12, 122.60, 122.87, 122.99, 123.05, 127.26, 129.49, 129.56,
129.67, 131.39, 131.92, 131.98, 132.09, 132.15, 132.20, 135.54,
136.72, 147.46, 152.25, 157.57, 157.73, 160.55, 160.87, 161.04;
HPLC purity: >95%; tR = 4.44 min; HRMS (EI) m/z: calcd [M]+,
375.0707 (C22H11F2NO+3), found, 375.0708.
5.5. Biological materials
RAW264.7 murine monocyte/macrophage cells was obtained
from American Type Culture Collection (ATCC, Rockville, MD,
USA); Receptor activator of nuclear factor kappa-B ligand
(RANKL, Peprotech, Inc., London, UK); Specific monoclonal primary
antibodies NF-jB (Clone code: E379, Epitomics, Inc., CA, USA);
NFATc1 (Clone code: 7A6, Santa Cruz Biotechnology, Santa Cruz
Inc., CA, USA); TATA box-binding protein (Clone code: 1TBP18,
Abcam Inc., Cambridge, MA, USA); NE-PER nuclear and cytoplasmic
extraction reagents (Thermo Fisher Scientific, USA); Unless other-
wise stated, all materials and assay kits were used from commer-
cially available. Chemical reagents were purchased from Sigma–
Aldrich without further purification.
5.4.9. 3-(6-(2,4-Difluorophenyl)-2,4-dioxo-2H-benzo[e][1,3]-
oxazin-3(4H)-yl)benzonitrile (3i)
The pure compound was obtained as brown powder (yield 49%).
Mp: 209–210 °C (EtOH); 1H NMR (300 MHz, DMSO-d6): d ppm
7.21–7.27 (m, 1H), 7.42 (td, J = 10.5, 2.4 Hz, 1H), 7.64–7.86 (m,
5H), 7.96–8.05 (m, 2H), 8.09 (t, J = 1.8 Hz, 1H); 13C NMR (75 MHz,
DMSO-d6): d ppm 104.24, 104.50, 104.76, 111.62, 111.91, 111.95,
112.12, 112.16, 117.50, 118.40, 118.66, 123.51, 123.97, 124.01,
124.11, 124.14, 125.23, 125.31, 127.61, 129.54, 130.22, 131.58,
5.5.1. Cell culture
RAW264.7 murine monocyte/macrophage cells were obtained
from American Type Culture Collection (ATCC, Rockville, MD,
USA). These cells were cultured with Dulbecco’s Modified Eagle
Medium (DMEM, Gibco BRL, NY, USA) and supplemented with

C.-C. Lee et al. / Bioorg. Med. Chem. 23 (2015) 4522–4532
4531
10% heat-inactivated fetal bovine serum (FBS) in 95% air, 5% CO2
X-100, 1 unit DNA polymerase (Protech), 200 lM dNTP and 10 lM
humid atmosphere at 37 °C.
primer. PCR products were separated on 1.5% agarose gels, and the
bands were visualized by ethidium bromide staining (EtBr). The
optical densities for each gene were normalized to the correspond-
ing values for glyceraldehyde-3-phosphate dehydrogenase
(GAPDH).
5.5.2. Cell viability assay41,53
RAW264.7 cells were seeded into a 96-well culture plate at a
density of 1 ꢁ 104 per well with 200
lL medium (DMEM) supple-
mented with 10% FBS and treated with a series of synthesized com-
pounds for 24 h. After 24 h, 96-well plate were washed three times
with phosphate-buffered saline (3 ꢁ PBS) and then treated with
5.5.6. Western blotting assay41,53
RAW264.7 cells were seeded into 6-cm dish at a density of
1 ꢁ 105 cells per well with DMEM medium containing 10% FBS
for 24 h. And then, the cells were pretreated with the test com-
medium containing 500 lg/mL of 3-(4,5-dimethylthiazol-2-yl)-
2,5-diphenyltetrazolium bromide (MTT) reagent for 1 h at 37 °C.
Cells were then washed with PBS and solubilized in 100 L of
l
pounds in a-MEM medium containing 10% FBS for 1 h prior to
DMSO. MTT reagent was designed to yield a formazan by metabolic
reduction of viable cells. Absorbance was measured at 540 nm by
using an ELISA reader.
treatment with RANKL (100 ng/mL) for 24 h. After 1 day, the cells
were washed three times with PBS. Nuclear extracts were collected
by NE-PER Nuclear and Cytoplasmic Extraction Kit (Cat. 78833,
Thermo Scientific, USA) according to the manufacturer’s instruc-
tions. Then, equivalent amounts of nuclear protein extracts
5.5.3. Tartrate-resistant acid phosphatase (TRAP) staining assay41
RAW264.7 cells were seeded into 96-well culture plate at a den-
sity of 1 ꢁ 103 per well and/or seeded into 48-well plate at a den-
sity of 2 ꢁ 104 cells per well with alpha-Minimum Essential
(18 lg) protein were loaded for 12% SDS–PAGE gels and trans-
ferred to immobilon polyvinyldifluoride members. Non-specific
binding was blocked by soaking members in the TBS buffer con-
taining 5% BSA for 1 h. The blots were probed with specific mono-
Medium (a-MEM, Gibco BRL, NY, USA) containing 10% FBS, 2 mM
clonal primary antibodies (mAb, 1:1000), such as NF-jB (Clone
L-glutamate, 100 ng/mL of recombinant soluble murine RANKL
code: E379, Epitomics, Inc., CA, USA), NFATc1 (Clone code: 7A6,
Santa Cruz Biotechnology, Santa Cruz, CA, USA), and TATA box-
binding protein (TBP, Clone code: 1TBP18, Abcam Inc.,
Cambridge, MA, USA) for 12 h at 4 °C. After further washing by
TBST, the blots were subsequently incubated with a secondary
antibody coupled to horseradish-peroxidase (a goat anti-rabbit
IgG, 1:10,000) for 1 h. The immunoreactive bands were visualized
by using the Immobilon Western Chemiluminescent HRP Substrate
kit (Millipore) and by exposing a clear Blue X-ray film (Thermo
Fisher Scientific, USA) to the membrane.
(Peprotech, London, UK) in the presence with or without tested
compounds. Cell cultures were incubated with 95% air, 5% CO2 at
37 °C for 4 days. Cell culture media (containing the test com-
pounds) were changed on day 2. After 4 days, cells were washed
with PBS and fixed with solution (acetone/citrate solution/37%
formaldehyde, 65:25:8) for 30 min. And then, cells were incubated
with light-protected incubator at 37 °C for 1 h by using the
Leukocyte Acid Phosphatase Assay kit (Cat.387A, Sigma). Cells
were washed three times with distilled water and TRAP-positive
multinucleated cells containing three or more than three nuclei
(N > 3) were counted under a light microscope and photographed.
5.5.7. NF-j
B activity assay60
RAW264.7 cells were seeded into 6-cm dish at a density of
1 ꢁ 105 cells per well with DMEM medium containing 10% FBS
for 24 h. And then, the cells were pretreated with the test com-
5.5.4. Tartrate-resistant acid phosphatase (TRAP) activity assay41,53
RAW264.7 cells were seeded into 48-well plate at a density of
2 ꢁ 104 cells per well with
a-MEM medium containing 10% FBS,
L-glutamate, 100 ng/mL of recombinant soluble murine
pounds in
a-MEM medium containing 10% FBS for 1 h prior to
2 mM
treatment with RANKL (100 ng/mL) for 24 h. After 1 day, the cells
were washed three times with PBS. Nuclear extracts were collected
by NE-PER Nuclear and Cytoplasmic Extraction Kit (Cat. 78833,
RANKL in the presence with or without tested compounds. For
the measurement of TRAP activity, the cells were washed with
phosphate-buffered saline (PBS) on 4 day, and then 100 lL of lysis
solution (0.1% Triton X-100 in 50 mM Tris–HCl, pH = 7.2) was
added to each well for 15 min under ice-bath. Subsequently, the
100 lL of substrate solution (2 mg/mL 4-nitrophenyl phosphate
in 0.09 M citrate buffer, Sigma Chemical Co.) was added to each
well and incubated for 15 min at 37 °C. The reaction was stopped
by adding 200 lL of 0.1 N NaOH(aq) and transferred 100 lL mix-
Thermo Scientific, USA). NF-
jB translocation was determined by
using a Cayman Chemical NF-
jB (p65) kit (Cat. 10007889), a sen-
sitive method for the detection of specific transcription factor DNA
binding activity in nuclear extracts. This assay is used to analyze
the NF-jB activity or transactivation potential, as NF-jB binds to
the response element pre-coated on specific ELISA plates, a
primary antibody followed by a tagged secondary antibody is then
tures into 96-well plates. Absorbance was measured at 405 nm
by using an ELISA reader. The intracellular protein level was mea-
sured at 562 nm by using a BCA protein assay kit (Pierce, USA).
added. Absorbance is read at 450 nm which correlates with NF-
activity.
jB
5.5.8. Resorbing activity of osteoclasts by bone resorption
assay41
5.5.5. Reverse transcription polymerase chain reaction (RT-PCR)
analysis41,53
RAW264.7 cells were seeded into 6-cm dish at a density of
1 ꢁ 105 cells per well with DMEM medium containing 10% FBS.
After 1 day, cells were starved for 24 h by replacing DMEM med-
RAW264.7 cells were seeded into dentine slices (24-well plates,
Corning) at a density of 1 ꢁ 104 cells per well with
a-MEM medium
(containing 10% FBS, 2 mM L-glutamate), 100 ng/mL of recombi-
nant soluble murine RANKL in the presence with or without the
test compounds. All cultured cells were replenished every 2 days
with fresh medium containing tested chemicals. After 4 days, the
wells were washed three times with PBS, left in 1 M ammonium
hydroxide to remove the attached cells and stained with 0.1% tolu-
idine blue (Sigma Chemical Co.). In optical field on a slice, the ratios
of the resorbed area to the total area were measured by using the
ImageJ software.
ium to a-MEM medium, 100 ng/mL of recombinant soluble murine
RANKL in the presence with or without the test compounds for
24 h. Total RNA was isolated from cultured cells with Trizol
reagent (Invitrogen). The RNA (2 lg) was reversibly transcribed
with SuperScript II reverse transcriptase (Invitrogen) and
oligo-(dT)15 primer. The cDNA was amplified using mouse-specific
primer (Table 2). The PCR was performed in 25
lL of 10 mM
Tris–HCl (pH = 8.8), 1.5 mM MgCl2, 50 mM KCl, 0.1% Triton

4532
C.-C. Lee et al. / Bioorg. Med. Chem. 23 (2015) 4522–4532
24. Hollberg, K.; Hultenby, K.; Hayman, A.; Cox, T.; Andersson, G. Exp. Cell Res.
Acknowledgments
2002, 279, 227.
25. Matsumoto, M.; Kogawa, M.; Wada, S.; Takayanagi, H.; Tsujimoto, M.;
Katayama, S.; Hisatake, K.; Nogi, Y. J. Biol. Chem. 2004, 279, 45969.
26. Saftig, P.; Hunziker, E.; Everts, V.; Jones, S.; Boyde, A.; Wehmeyer, O.; Suter, A.;
von Figura, K. Adv. Exp. Med. Biol. 2000, 477, 293.
27. Delaisse, J. M.; Andersen, T. L.; Engsig, M. T.; Henriksen, K.; Troen, T.; Blavier, L.
Microsc. Res. Tech. 2003, 61, 504.
28. Ishibashi, O.; Niwa, S.; Kadoyama, K.; Inui, T. Life Sci. 2006, 79, 1657.
29. Kukita, T.; Wada, N.; Kukita, A.; Kakimoto, T.; Sandra, F.; Toh, K.; Nagata, K.;
Iijima, T.; Horiuchi, M.; Matsusaki, H.; Hieshima, K.; Yoshie, O.; Nomiyama, H. J.
Exp. Med. 2004, 200, 941.
30. Yagi, M.; Miyamoto, T.; Sawatani, Y.; Iwamoto, K.; Hosogane, N.; Fujita, N.;
Morita, K.; Ninomiya, K.; Suzuki, T.; Miyamoto, K.; Oike, Y.; Takeya, M.;
Toyama, Y.; Suda, T. J. Exp. Med. 2005, 202, 345.
31. Arantes, H. P.; Silva, A. G.; Lazaretti-Castro, M. Arq. Bras. Endocrinol. Metabol.
2010, 54, 206.
32. Russell, R. G.; Watts, N. B.; Ebetino, F. H.; Rogers, M. J. Osteoporos. Int. 2008, 19,
733.
33. Sato, M.; Grese, T. A.; Dodge, J. A.; Bryant, H. U.; Turner, C. H. J. Med. Chem. 1999,
42, 1.
34. Conte, P.; Guarneri, V. Oncologist 2004, 9, 28.
The present study was supported by the National Science
Council Grant (NSC 101-2113-M-016-001), Ministry of Science
and Technology (MOST 102-2314-B-075-083-MY3), and Taipei
Medical University (TMU 102-AE1-B32). We also thank Ting-
Shen Kuo for kindly providing the information of crystallography.
Supplementary data
Supplementary data (inhibitory effects of compounds on
RANKL-induced osteoclastogenesis; spectroscopic characteriza-
tions (1H NMR, 13C NMR and HRMS spectra) of compounds; purity
of final compounds; crystallographic data) associated with this
article can be found, in the online version, at http://dx.doi.org/10.
1016/j.bmc.2015.06.007.
35. Strampel, W.; Emkey, R.; Civitelli, R. Drug Saf. 2007, 30, 755.
36. Watts, N. B. Clin. Geriatr. Med. 2003, 19, 395.
References and notes
37. Tsai, H. Y.; Lin, H. Y.; Fong, Y. C.; Wu, J. B.; Chen, Y. F.; Tsuzuki, M.; Tang, C. H.
Eur. J. Pharmacol. 2008, 588, 124.
38. Tang, C. H.; Chang, C. S.; Tan, T. W.; Liu, S. C.; Liu, J. F. Eur. J. Pharmacol. 2010,
648, 59.
1. Sims, N. A.; Gooi, J. H. Semin. Cell Dev. Biol. 2008, 19, 444.
2. Crockett, J. C.; Rogers, M. J.; Coxon, F. P.; Hocking, L. J.; Helfrich, M. H. J. Cell Sci.
2011, 124, 991.
39. Rassi, C. M.; Lieberherr, M.; Chaumaz, G.; Pointillart, A.; Cournot, G. J. Bone
Miner. Res. 2002, 17, 630.
40. Lu, S.-H.; Huang, R.-Y.; Chou, T.-C. Evid. Based Complement Alternat. Med. 2013,
2013, 12.
41. Cheng, C. P.; Huang, H. S.; Hsu, Y. C.; Sheu, M. J.; Chang, D. M. J. Clin. Immunol.
2012, 32, 762.
42. Chen, C. L.; Liu, F. L.; Lee, C. C.; Chen, T. C.; Ahmed Ali, A. A.; Sytwu, H. K.; Chang,
D. M.; Huang, H. S. J. Med. Chem. 2014, 57, 8072.
3. Martin, T. J.; Sims, N. A. Trends Mol. Med. 2005, 11, 76.
4. Kong, Y. Y.; Penninger, J. M. Exp. Gerontol. 2000, 35, 947.
5. Seeman, E. Lancet 2002, 359, 1841.
6. McInnes, I. B.; Schett, G. N. Eng. J. Med. 2011, 365, 2205.
7. Okamoto, K.; Takayanagi, H. Int. Immunopharmacol. 2011, 11, 543.
8. Takayanagi, H.; Iizuka, H.; Juji, T.; Nakagawa, T.; Yamamoto, A.; Miyazaki, T.;
Koshihara, Y.; Oda, H.; Nakamura, K.; Tanaka, S. Arthritis Rheum. 2000, 43, 259.
9. Boyle, W. J.; Simonet, W. S.; Lacey, D. L. Nature 2003, 423, 337.
10. Fujikawa, Y.; Quinn, J. M.; Sabokbar, A.; McGee, J. O.; Athanasou, N. A.
Endocrinology 1996, 137, 4058.
43. Coste, E.; Greig, I. R.; Mollat, P.; Rose, L.; Gray, M.; Ralston, S. H.; Van’t Hof, R. J.
Ann. Rheum. Dis. 2013.
44. Idris, A. I.; Coste, E.; Greig, I. R.; Ralston, S. H.; van’t Hof, R. J. Calcif. Tissue Int.
2010, 87, 525.
45. Greig, I. R.; Coste, E.; Ralston, S. H.; van’t Hof, R. J. Bioorg. Med. Chem. Lett. 2013,
23, 816.
46. Greig, I. R.; Idris, A. I.; Ralston, S. H.; van’t Hof, R. J. J. Med. Chem. 2006, 49, 7487.
47. Idris, A. I.; Greig, I. R.; Bassonga-Landao, E.; Ralston, S. H.; van’t Hof, R. J.
Endocrinology 2009, 150, 5.
11. Teitelbaum, S. L.; Ross, F. P. Nat. Rev. Genet. 2003, 4, 638.
12. Udagawa, N.; Takahashi, N.; Akatsu, T.; Tanaka, H.; Sasaki, T.; Nishihara, T.;
Koga, T.; Martin, T. J.; Suda, T. Proc. Natl. Acad. Sci. U.S.A. 1990, 87, 7260.
13. Suda, T.; Takahashi, N.; Udagawa, N.; Jimi, E.; Gillespie, M. T.; Martin, T. J.
Endocr. Rev. 1999, 20, 345.
14. Wong, B. R.; Josien, R.; Lee, S. Y.; Vologodskaia, M.; Steinman, R. M.; Choi, Y. J.
Biol. Chem. 1998, 273, 28355.
48. Idris, A. I.; Mrak, E.; Greig, I.; Guidobono, F.; Ralston, S. H.; van’t Hof, R. J.
Biochem. Biophys. Res. Commun. 2008, 371, 94.
49. Van’t Hof, R. J.; Idris, A. I.; Ridge, S. A.; Dunford, J.; Greig, I. R.; Ralston, S. H. J.
Bone Miner. Res. 2004, 19, 1651.
15. Yasuda, H.; Shima, N.; Nakagawa, N.; Yamaguchi, K.; Kinosaki, M.; Mochizuki,
S.; Tomoyasu, A.; Yano, K.; Goto, M.; Murakami, A.; Tsuda, E.; Morinaga, T.;
Higashio, K.; Udagawa, N.; Takahashi, N.; Suda, T. Proc. Natl. Acad. Sci. U.S.A.
1998, 95, 3597.
50. de Silva, M.; Hazleman, B. L.; Dippy, J. E. Rheumatol. Rehabil. 1980, 19, 126.
51. Tempero, K. F.; Cirillo, V. J.; Steelman, S. L. Br. J. Clin. Pharmacol. 1977, 4, 31S.
52. Skala, P.; Machacek, M.; Vejsova, M.; Kubicova, L.; Kunes, J.; Waisser, K. J.
Heterocycl. Chem. 2009, 46, 873.
16. Dougall, W. C.; Glaccum, M.; Charrier, K.; Rohrbach, K.; Brasel, K.; De Smedt, T.;
Daro, E.; Smith, J.; Tometsko, M. E.; Maliszewski, C. R.; Armstrong, A.; Shen, V.;
Bain, S.; Cosman, D.; Anderson, D.; Morrissey, P. J.; Peschon, J. J.; Schuh, J. Genes
Dev. 1999, 13, 2412.
53. Hsu, Y. C.; Cheng, C. P.; Chang, D. M. J. Rheumatol. 2011, 38, 1844.
54. Igarashi, Y.; Lee, M. Y.; Matsuzaki, S. J. Chromatogr., B Analyt. Technol. Biomed.
Life Sci. 2002, 781, 345.
55. Asagiri, M.; Takayanagi, H. Bone 2007, 40, 251.
56. Wada, T.; Nakashima, T.; Hiroshi, N.; Penninger, J. M. Trends Mol. Med. 2006, 12,
17.
57. Yamashita, T.; Yao, Z.; Li, F.; Zhang, Q.; Badell, I. R.; Schwarz, E. M.; Takeshita,
S.; Wagner, E. F.; Noda, M.; Matsuo, K.; Xing, L.; Boyce, B. F. J. Biol. Chem. 2007,
282, 18245.
58. Lee, W. Z.; Chiang, C. W.; Kulkarni, G. M.; Kuo, T. S. J. Chin. Chem. Soc. 2013, 60,
245.
17. Nakao, A.; Fukushima, H.; Kajiya, H.; Ozeki, S.; Okabe, K. Biochem. Biophys. Res.
Commun. 2007, 357, 945.
18. Asagiri, M.; Sato, K.; Usami, T.; Ochi, S.; Nishina, H.; Yoshida, H.; Morita, I.;
Wagner, E. F.; Mak, T. W.; Serfling, E.; Takayanagi, H. J. Exp. Med. 2005, 202,
1261.
19. Matsuo, K.; Galson, D. L.; Zhao, C.; Peng, L.; Laplace, C.; Wang, K. Z.; Bachler, M.
A.; Amano, H.; Aburatani, H.; Ishikawa, H.; Wagner, E. F. J. Biol. Chem. 2004, 279,
26475.
20. Zhou, B.; Cron, R. Q.; Wu, B.; Genin, A.; Wang, Z.; Liu, S.; Robson, P.; Baldwin, H.
S. J. Biol. Chem. 2002, 277, 10704.
21. Grigoriadis, A. E.; Wang, Z. Q.; Cecchini, M. G.; Hofstetter, W.; Felix, R.; Fleisch,
H. A.; Wagner, E. F. Science 1994, 266, 443.
22. Wang, Z. Q.; Ovitt, C.; Grigoriadis, A. E.; Mohle-Steinlein, U.; Ruther, U.;
Wagner, E. F. Nature 1992, 360, 741.
23. Hayman, A. R.; Jones, S. J.; Boyde, A.; Foster, D.; Colledge, W. H.; Carlton, M. B.;
Evans, M. J.; Cox, T. M. Development 1996, 122, 3151.
59. Lee, W. Z.; Wang, T. L.; Chang, H. C.; Chen, Y. T.; Kuo, T. S. Organometallics 2012,
31, 4106.
60. Lee, C. C.; Liu, F. L.; Chen, C. L.; Chen, T. C.; Chang, D. M.; Huang, H. S. Eur. J. Med.
Chem. 2015, 98, 115.