Small molecule mimetics of an interferon-α receptor interacting domain

Article abstract of DOI:10.1016/j.bmc.2013.12.049

Small molecules that mimic IFN-α epitopes that interact with the cell surface receptor, IFNAR, would be useful therapeutics One such 8-amino acid region in IFN-α2, designated IRRP-1, was used to derive 11 chemical compounds that belong to 5 distinct chemotypes, containing the molecular features represented by the key residues Leu30, Arg33, and Asp35 in IRRP-1 Three of these compounds exhibited potential mimicry to IRRP-1 and, in cell based assays, as predicted, effectively inhibited IFNAR activation by IFN-α Of these, compound 3 did not display cell toxicity and reduced IFN-α- inducible STAT1 phosphorylation and STAT-DNA binding Based on physicochemical properties' analyses, our data suggest that moieties with acidic pKa on the small molecule may be a necessary element for mimicking the carboxyl group of Asp35 in IRRP-1 Our data confirm the relevance of this strategy of molecular mimicry of ligand-receptor interaction domains of protein partners for small molecule drug discovery

Full text of DOI:10.1016/j.bmc.2013.12.049

Bioorganic & Medicinal Chemistry 22 (2014) 978–985
Contents lists available at ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc
Small molecule mimetics of an interferon-
domain
a receptor interacting
Angelica M. Bello a,b,d, Lianhu Wei a,b,d, Beata Majchrzak-Kita b, Noruê Salum a,f, Meena K. Purohit a,g
,
Eleanor N. Fish b,c, , Lakshmi P. Kotra a,b,d,e,
⇑
,
a Center for Molecular Design and Preformulations, University Health Network, Toronto, Ontario M5G 1L7, Canada
b Toronto General Research Institute, Toronto, Ontario M5G 2M1, Canada
c Department of Immunology, University of Toronto, Toronto, Canada
d Department of Pharmaceutical Sciences, Leslie Dan Faculty of Pharmacy, University of Toronto, Toronto, Ontario, Canada
e McLaughlin Center for Molecular Medicine, University of Toronto, Toronto, Ontario, Canada
f Federal University of Paraná, Curitiba, Paraná, Brazil
g Department of Pharmacy, Birla Institute of Technology & Science, Pilani 333 031, India
a r t i c l e i n f o
a b s t r a c t
Article history:
Small molecules that mimic IFN-
useful therapeutics. One such 8-amino acid region in IFN-a2, designated IRRP-1, was used to derive 11
chemical compounds that belong to 5 distinct chemotypes, containing the molecular features repre-
sented by the key residues Leu30, Arg33, and Asp35 in IRRP-1. Three of these compounds exhibited
potential mimicry to IRRP-1 and, in cell based assays, as predicted, effectively inhibited IFNAR activation
a
epitopes that interact with the cell surface receptor, IFNAR, would be
Received 17 October 2013
Revised 12 December 2013
Accepted 21 December 2013
Available online 2 January 2014
by IFN-a. Of these, compound 3 did not display cell toxicity and reduced IFN-a-inducible STAT1 phos-
Keywords:
Interferon
Peptidomimetics
IFN-a receptor
phorylation and STAT-DNA binding. Based on physicochemical properties’ analyses, our data suggest that
moieties with acidic pKa on the small molecule may be a necessary element for mimicking the carboxyl
group of Asp35 in IRRP-1. Our data confirm the relevance of this strategy of molecular mimicry of ligand–
receptor interaction domains of protein partners for small molecule drug discovery.
Ó 2014 Elsevier Ltd. All rights reserved.
1. Introduction
proteins that could be targeted effectively by small molecule drugs
in this way.
Many fundamental cellular processes are regulated by protein–
protein interactions (PPI) for normal physiological maintenance.1–3
PPI are important effectors in different disease processes, since
they either directly or indirectly influence pathogenesis.4–7 These
interactions which occur between two or more partner protein
molecules are therefore candidate targets for drug design.8,9 Small
molecule drugs that modulate PPI present as promising interven-
tion therapeutics. In this context, three types of small molecules
may be envisioned depending on the type of influence they elicit
with the partner proteins involved in the PPIs: (i) agonists, or small
molecules that would exert a positive response after binding to one
of the protein partners, to enable downstream signaling, (ii) antag-
onists that would block the response or the downstream signaling
after binding to one of the protein partners, or (iii) molecules that
would stabilize the PPI.10–12 Cytokines present themselves as
Cytokines are biological response modifier proteins that invoke
responses in target cells, mediated by activation of their cognate
cell surface receptors. Receptor activation, and therefore the down-
stream response, are determined by the specific three-dimensional
structure of the ligand interaction domains for each cytokine.
Interferons (IFNs) are a family of cytokines that exhibit antiviral,
growth inhibitory and immunomodulatory activities.13–15 Over
the past several years, investigations to delineate the essential hot-
spots on the surfaces of IFNs-
and activation of subsequent functional activities, have been
undertaken.16–19 IFN-
subtypes were systematically investigated
to decipher the specific regions on their surface responsible for
binding to the cognate receptor, IFNAR.20,21 Specifically, IFN-
2a
ab, associated with receptor binding
a
a
has three non-contiguous peptide regions on its primary structure
that are essential for binding to the two membrane spanning sub-
units of IFNAR.16,18 These groups of peptides, identified as IFN
receptor recognition peptides (IRRPs), are critical for the activity
of IFNs (Fig. 1).17,22
Currently, as a biological therapeutic, IFN is administered by
subcutaneous injection, due to the complexities associated with
administering protein molecules as therapeutics. Consequently,
⇑
Corresponding author. Address: 5-356, Toronto Medical Discoveries Tower/
MaRS Center, 101 College Street, Toronto, Ontario M5G 1L7, Canada. Tel.: +1 (416)
581 7601; fax: +1 (416) 581 7621.
E-mail address: lkotra@uhnres.utoronto.ca (L.P. Kotra).
Co-senior authors.
0968-0896/$ - see front matter Ó 2014 Elsevier Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.bmc.2013.12.049

A. M. Bello et al. / Bioorg. Med. Chem. 22 (2014) 978–985
979
IFNAR1
IRRP-2
IRRP-3
IRRP-1
A
IRRP-1
IFNAR2
IRRP-3
Lys133
Leu30
Arg33
Lys131
Leu128
Compound 3
Asp35
IFN-α2a
B
IRRP-3
IFNAR1
IRRP-1
IFNAR2
Figure 1. A model of the complex of IFN-a2a (in red) with its receptor, IFNAR.
IFNAR is a heterodimer represented by the two domains IFNAR1 (in blue) and
IFNAR2 (in orange). Residues in IRRP-1, IRRP-2 and IRRP-3 regions are shown in
capped stick models cyan, green and magenta, respectively, on IFN-a2a. Potential
strategy to design a complete mimic of IFN was to design individual IRRP regional
mimics and tether them to mimic the interaction surfaces with IFNAR, illustrated by
the stars in yellow with a tether.
Figure 2. (A) Three dimensional structure of IFN-a2a illustrating the key regions,
IRRP-1 and IRRP-3 (cyan and magenta regions, respectively). These regions are
illustrated by semi-transparent Connolly surfaces derived from the amino acid
residues in IRRP-1 and IRRP-3 segments. Ball-and-stick model of compound 3,
derived from IRRP-1 residues is presented as it overlaps with the three molecular
features used for in silico screening. Similarly, one of the mimics of IRRP-3 is also
shown which interferes with the IFN-IFNAR complex formation [25]. (B) A model of
the complex of IFN-IFNAR. Connolly surface spanning IRRP-3 region is shown in
the pharmaceutical and clinical challenges of these biologics lead
to high treatment costs.23,24 Thus, small non-protein molecule sub-
stitutes as mimics of IFNs would be an advantageous alternative,
both for reducing the costs associated with a biological drug, and
for increasing the ease of administration potentially via oral route.
As a first step towards designing a non-peptide mimetic of
magenta. Key residues from IRRP-1 region, Leu30, Arg33, and Asp35 on IFN-
the potential interacting residues on the IFNAR2 subdomain are shown by capped
stick model. IFN- 2a is illustrated in a cartoon model in red and IFNAR domains are
a2a and
a
shown in blue ribbon.
torsional rotation on the molecules. A set of 1079 hits matching all
three features were selected for further refinement in silico by
using additional criteria, such as the number of hetero atoms in
each molecule (>4 atoms), molecular weight (<700 daltons), and
the number of rotatable bonds (<10). The refined set of compounds
utilizing these parameters contained 153 unique molecules. Each
of these molecules was visually investigated, by overlapping
molecular features of each compound with the surface features
IFN-
screen to identify small molecule structural mimics of each of
the three IRRP regions on the surface of the IFN-
2a protein.25
Herein, we report the discovery of small molecules that mimic
IRRP-1 and potentially bind to IFNAR2. We reveal a systematic pro-
cess for screening a large set of molecules, and identify 11 com-
pounds as potential mimics of IRRP-1. From this set of 11
compounds, and based on bioassays and cellular toxicity studies,
we reveal unique small molecules that mimic surface residues on
a2a using in silico approaches, we undertook a systematic
a
of the IRRP-1 region of IFN-a2a for an optimal core structure. Addi-
tionally, synthetic feasibility and nonreactive structural features
were considered when determining the overall viability of the
small molecule for final selection. This selection process led to a
group of 11 compounds (1–11, Chart 1).
IFN-a2a, that disrupt IFN-IFNAR binding. These findings serve as
a foundation towards the larger goal of designing non-peptidic
molecules as agonists for IFNAR.
2. Experimental section
2.1. Computer modeling
2.2. Chemistry Compounds
1, 2, 4–11 were acquired from commercial sources and com-
pound 3 was synthesized. All anhydrous reactions were performed
under a nitrogen atmosphere. All solvents and reagents were ob-
tained from commercial sources; anhydrous solvents were pre-
pared following standard procedures. Reaction progress was
monitored on TLC plates (Silica gel-60 F254). Chromatographic puri-
fications were performed using silica gel (60 Å, 70–230 mesh).
Compounds were confirmed by LC/MS and 1H NMR spectroscopy.
NMR spectra were recorded on a Varian spectrometer (300 and
400 MHz for 1H, 75 and 100 for 13C). Chemical shifts were reported
in d ppm using tetramethylsilane (TMS) as a reference for the 1H
NMR spectra.
IRRP-1 in IFN-a2a is comprised of residues Ser28-Cys29-Leu30-
Lys31-Asp32-Arg33-His34-Asp35. Three structural features were
selected from these residues to conduct small molecule chemical
database searches, in order to identify small chemical compounds
matching the surface features of IRRP-1 (Fig. 2). These molecular
features are a hydrophobic character from the side chain of
Leu30, a cationic center defined by the side chain of Arg33, and
an anionic center defined by the carboxyl group of Asp35. The dis-
tance and volume tolerances for each feature were set in the range
0
of 0.5–1 ÅA. Chemical databases used in the in silico screening in-
clude those from the commercial vendors and public sources, cus-
tomized to work in our computational environment, and the
combined library contained a total of 4.1 million compounds. In
silico chemical database searches were performed using UNITY
module embedded in SYBYL molecular modeling package (Tripos
Inc./Certara Group).26 A UNITY Flex search was conducted allowing
2.2.1. Ethyl 4-(4,6-dioxo-5-(o-toluyl)-4,5,6,6a-tetrahydro-3aH-
pyrrolo[3,4-d]isoxazole-3-carbonyl)-5-methyl-1-(p-toluyl)-1H-
pyrazole-3-carboxylate (1)
1H NMR (CDCl3) d 7.89 (d, J = 8.0 Hz, 2H), 7.24–7.20 (m, 4H),
7.14–7.12 (m, 3H), 6.08 (d, J = 5.6 Hz, 2H), 5.02 (d, J = 5.6 Hz, 1H),

980
A. M. Bello et al. / Bioorg. Med. Chem. 22 (2014) 978–985
OC2H5
J = 6 Hz, 2H), 2.38 (d, J = 7.6 Hz, 2H), 2.27 (t, J = 7.6 Hz, 2H),
O
O
O
1.68–1.78 (m, 4H), 1.60–1.42 (m, 4H), 1.33–1.25 (m, 4H). Mass
OC2H5
N
N
ESI (C27H26N4O4S2) [MH+] calcd 535.1474, found. 535.3018.
N
O
S
N
O
N
H
CH3O
N
CH3
N
CH3
N
CH3
2.2.4. N-(4-Chlorophenyl)-3-(3-(furan-2-yl)-7-(furan-2-
ylmethylene)-2,3,4,5,6,7-hexahydro-1H-indazole-2-
carbonyl)benzenesulfonamide (5)
O
1
2
O
O
COOH
This compound is a mixture of E and Z isomers. 1H NMR (CDCl3)
d 8.39 (s, 1H), 8.09 (d, J = 7.6 Hz, 1H), 7.81 (d, J = 6.4 Hz, 1H),
7.59–7.41 (m, 3H), 7.15–6.99 (m, 5H), 6.52–6.37 (m, 4H), 5.23 (d,
J = 9 Hz, 1H), 3.48–3.39 (m, 1H), 2.48–2.36 (m, 1H), 2.32–2.23 (m,
1H), 2.09–2.01 (m, 1H), 1.73–1.63 (m, 2H). Mass ESI (C29H24ClN3O5-
S) [MH+] calcd 562.1203, found. 562.2392.
S
N
N
N
H
N
S
N
O
S
CH3
N
N
N
COOH
O
O
4
3
5
O
Cl
O
Cl
O
O
N
O
O
N
N
S
O
S
O
2.2.5. 5-(4-(Benzo[d][1,3]dioxol-5-yl-methyl)piperazine-1-
carbonyl)-2,4-dichloro-N-(3-chlorophenyl)
NH
H
N
O
HN
Cl
O
benzenesulfonamide (6)
1H NMR (CDCl3) d 8.07 (br s, 1H), 7.66 (d, J = 1.2 Hz, 1H), 7.51 (d,
J = 1.2 Hz, 1H), 7.22–7.01 (m, 5H), 6.89–6.86 (m, 1H), 6.03 (s, 2H),
4.18 (br s, 4H), 3.39 (s, 2H), 1.38–1.25 (m, 4H). Mass ESI (C22H22Cl3-
N3O5S) [MH+] calcd 582.0424, found 582.1658.
Cl
6
Cl
O
O
Cl
O
O
N
N
N
O
N
O
S
S
O
O
O
HN
O
HN
H3CO
2.2.6. 5-(4-(Benzo[d][1,3]dioxol-5-yl methyl)piperazine-1-
carbonyl)-2-chloro-N-(2-methoxyphenyl) benzene sulfonamide
(7)
7
8
CF3
Cl
O
1H NMR (CDCl3) d 7.95 (t, J = 1.2 Hz, 1H), 7.56 (br s, 1H), 7.53 (d,
1.2 Hz), 1H), 7.45 (dd, J = 8, 1.6 Hz,, 1H), 6.98 (dt, J = 8, 1.6 Hz, 1H),
6.85 (d, J = 1.2 Hz, 1H), 6.80 (dt, J = 7.6, 1.2 Hz, 1H), 6.78–6.71 (m,
3H), 5.96 (s, 2H), 3.72 (br s, 2H), 3.72 (s, 3H), 3.44 (s, 2H), 3.17
(br s, 2H), 2.49 (br s, 2H), 2.29 (br s, 2H). Mass ESI (C26H26ClN3O6S)
[MH+] calcd 544.1309, found 544.1410.
O
N
H
O
N
N
O
O
Cl
O
N
S
S
O
O
N
O
S
HN
O
Cl
10
CF3
9
Cl
Cl
O
O
N
H
N
2.2.7. 3-(4-(Benzo[d][1,3]dioxol-5-ylmethyl) piperazine-1-
carbonyl)-4-chloro-N-(3-(trifluoromethyl) phenyl)
benzenesulfonamide (8)
N
F
O
S
O
O
1H NMR (CDCl3) d 7.80 (d, J = 2 Hz, 1H), 7.58 (dd, J = 8.4, 2 Hz,
1H), 7.44 (d, J = 8.8 Hz, 1H), 7.39 (br s, 1H), 7.37–7.27 (m, 3H),
6.84 (br s, 1H), 6.76–6.71 (m, 2H), 5.95 (s, 2H), 3.81 (br s, 2H),
3.44 (s, 2H), 3.17–3.16 (m, 1H), 3.15–3.10 (m, 1H), 2.60–2.45 (m,
2H), 2.45–2.36 (m, 1H), 2.35–2.25 (m, 1H). Mass ESI (C26H23ClF3N3-
O5S) [MH+] calcd 582.1077, found 582.2308.
11
Chart 1. Structures of the small molecule mimics of IRRP-3 region on the surface of
IFN- 2a.
a
4.31 (q, J = 7.2 Hz, 2H), 2.43 (s, 3H), 2.43 (s, 3H), 2.39 (s, 3H), 1.30 (t,
J = 7.2 Hz, 3H). Mass ESI (C27H24N4O6) [MH+] calcd 501.1774,
found. 501.2875.
2.2.8. 3-((4-(4-Fluorophenyl)piperazin-1-yl)methyl)-N-(2-
methoxyphenyl)-2-thioxo-2,3-dihydrobenzo[d]oxazole-5-
sulfonamide (9)
2.2.2. N0-(2-Ethoxybenzylidene)-2-((4-oxo-3-o-toluyl-3,4-
dihydroquinazolin-2-yl)thio)aceto hydrazide (2)
1H NMR (CDCl3) d 7.73 (d, J = 7.2 Hz, 1H), 7.63 (s, 1H), 7.56 (d,
J = 7.2 Hz, 1H), 7.35 (d, J = 8.8 Hz, 1H), 7.02–6.96 (m, 3H), 6.90–
6.83 (m, 3H), 6.71 (d, J = 8.4 Hz, 1H), 4.99 (s, 2H), 3.61 (s, 3H),
3.05 (dd, J = 5.2 and 4.8 Hz, 4H), 2.82 (dd, J = 5.2 and 4.8 Hz, 4H).
Mass ESI (C25H25FN4O4S2) [MH+] calcd 529.1380, found 529.1453.
This compound is a mixture of E and Z isomers. 1H NMR (CDCl3)
d 8.45 (s, 1H), 8.76 (s, 1H), 8.29 (dd, J = 8 and 2 Hz, 1H), 8.22 (dd,
J = 8 and 2 Hz, 1H), 7.88 (dd, J = 8 and 2 Hz, 1H), 7.84 (dd, J = 8
and 2 Hz, 1H), 7.76 (dd, J = 8, 2 Hz, 1H), 7.72 (dd, J = 8, 2 Hz, 1H),
7.59–7.33 (m, 12H), 7.26 (t, J = 6.4 Hz, 2H), 6.98–6.86 (m, 4H),
4.12 (q, J = 7.2 Hz, 2H), 4.05 (q, J = 7.2 Hz, 2H), 3.37 (dd, J = 2,
1.6 Hz, 4H), 2.18 (s, 6H), 1.46 (t, J = 7.2 Hz, 3H), 1.37 (t,
J = 7.2 Hz). Mass ESI (C26H24N4O3S) [MH+] calcd 473.1647, found.
473.1793.
2.2.9. N-(4-(4-(Benzo[d][1,3]dioxol-5-yl-methyl)piperazine-1-
carbonyl)phenyl)-2,5-dichlorothiophene-3-sulfonamide (10)
1H NMR (CDCl3) d 7.35 (d, J = 8.8 Hz, 2H), 7.15 (d, J = 8.8 Hz, 2H),
7.07 (s, 1H), 6.84 (d, J = 1.2 Hz, 1H), 6.75 (d, J = 7.6 Hz, 1H), 6.720
(dd, J = 7.6, 1.2 Hz), 5.95 (s, 2H), 3.83–3.64 (br s, 2H), 3.49–3.33
(br s, 4H), 2.56–2.37 (br s, 2H), 2.361–2.274 (br s, 2H). Mass ESI
(C23H21Cl2N3O5S2) [MH+] calc. 554.0378, found 554.0330.
2.2.3. 6-(5-((2-(3,4-Dihydroquinolin-1-(2H)-yl)-4-oxo-4H-
pyrido[1,2-a]pyrimidin-3-yl)methylene)-4-oxo-2-
thioxothiazolidin-3-yl)hexanoic acid (4)
This compound is a mixture of E and Z isomers. 1H NMR (CDCl3)
d 8.89 (ddd, J = 7.2, 1.6, 0.8 Hz, 1H), 8.21 (ddd, J = 7.2, 1.6, 0.8 Hz,
1H), 7.82 (s, 1H), 7.73–7.68 (m, 1H), 7.67 (s, 1H), 7.60 (m, 1H),
7.42–7.31 (m, 1H), 7.70–7.34 (m, 1H), 7.21–7.08 (m, 8H), 7.00
(dt, J = 7.2, 1.2 Hz, 1H), 6.88 (dt, J = 7.2, 1.2 Hz, 1H), 4.13 (t,
J = 8 Hz, 1H), 3.930–3.80 (m, 5H), 3.13 (t, J = 6 Hz, 2H), 2.96 (t,
2.2.10. 5-(4-(Benzo[d][1,3]dioxol-5-ylmethyl)piperazine-1-
carbonyl)-2,4-dichloro-N-(2-fluorophenyl) benzene
sulfonamide (11)
1H NMR (CDCl3) d 7.87 (s, 1H), 7.64 (s, 1H), 7.44 (dt, J = 2 and
8 Hz, 1H), 7.12–6.97 (m, 3H), 6.85 (s, 1H), 6.79–6.74 (m, 2H),
5.97 (s, 2H), 4.13–3.99 (m, 2H), 3.83–3.74 (m, 2H), 2.60–2.49 (m,

A. M. Bello et al. / Bioorg. Med. Chem. 22 (2014) 978–985
981
2H), 2.33–2.26 (m, 2H). Mass ESI (C25H22Cl2FN3O5S) [MH+] calcd
566.0720, found 566.0671.
with dichloromethane (50 mL). The organic phase was washed
with brine (2 ꢀ 10 mL) and dried (Na2SO4). The organic phase
was concentrated and the crude was purified by column chroma-
tography (0–35% EtOAc:Hexanes) to obtain ethyl (2-formylphen-
oxy)acetate (72% yield). 1H NMR (CDCl3) d 10.57 (s, 1H), 7.87
(d, J = 8 Hz, 1H), 7.53 (t, J = 8 Hz, 1H), 7.09 (t, J = 8 Hz, 1H), 6.87
(d, J = 8 Hz, 1H), 4.76 (s, 2H), 4.27 (q, J = 7 Hz, 2 H), 1.30 (t,
J = 7 Hz, 3H). Mass ESI (C11H12O4) [MNa+] calcd 231.0627, found
231.0636.
Then, ethyl (2-formylphenoxy)acetate (0.3 g, 1.4 mmol) in abso-
lute ethanol (10 mL) was added dropwise to a solution of com-
pound 16 (0.5 g, 1.4 mmol) in absolute ethanol (20 mL). One drop
of sulfuric acid was added to the reaction mixture and the reaction
was refluxed for 4 h. Upon cooling the reaction to 0 °C, a precipitate
was formed. The solids were collected by filtration, washed with
cold ethanol (10 mL) followed by hexanes (10 mL) and dried under
vacuum to yield compound 17 as a white solid (72% yield). Product
was isolated as a mixture of E and Z isomers. 1H NMR (CDCl3) d
11.04 (s), 8.99 (s), 8.49 (s), 8.31 (s), 8.29 (d, J = 8 Hz), 8.21 (d,
J = 8 Hz), 8.09 (d, J = 8 Hz), 7.93 (d, J = 8 Hz), 7.85–7.77 (m), 7.65
(t, J = 8 Hz), 7.53–7.45 (m, 1H), 7.37–7.21 (m), 7.03–6.96 (m),
6.80 (d, J = 8 Hz), 6.74 (d, J = 8 Hz), 4.69 (s), 4.57 (s), 4.48 (s),
4.30–4.21 (m), 3.86 (s), 2.46, (s), 2.44 (s), 1.32–1.24 (m). Mass ESI
(C28H27N4O5S) [MNa+] calcd 531.1696, found 531.1697.
2.2.11. p-Toluyl isothiocyanate (13)
Carbon disulfide (7.8 g, 102.8 mmol) and triethylamine (1.6 g,
15.4 mmol) were dissolved in ethanol (15 mL). Then p-toluidine
12 (1.1 g, 10.3 mmol) in ethanol (2 mL) was added dropwise at
room temperature with continuous stirring. After 6 h stirring, the
reaction mixture was cooled to 0 °C, and ethyl chloroformate
(1.0 g, 9.3 mmol) was added dropwise. The reaction mixture was
stirred for an additional 30 min at 0 °C, and slowly warmed to
25 °C until the bubbles subsided. The reaction mixture was concen-
trated, dissolved in water (15 mL) and was extracted with diethyl
ether (3 ꢀ 15 mL). The organic phase was dried (anhydrous MgSO4)
and was concentrated to obtain the crude product 13 as a pale yel-
low oil (was used without further purification).
2.2.12. 3-(p-Toluyl)-2-thioxo-2,3-dihydroquinazolin-4(1H)-one
(14)
Compound 13 (2.1 g, 13.8 mmol) and 2-aminobenzoic acid
methyl ester were dissolved in 50% DMSO (8 mL) and placed in a
20 mL microwave vessel. The microwave vessel was sealed and
was subjected to microwave irradiation at 120 °C for 25 min. After
cooling to room temperature, the crude reaction mixture was
poured onto ice-water (100 mL) with vigorous stirring. The
resulting solids were filtered, washed with cold water
(3 ꢀ 15 mL), hexanes (3 ꢀ 15 mL) and dried under vacuum to
obtain the product 14 as white powder (81% yield). 1H NMR
(DMSO-d6) d 13.00 (s, 1H), 7.93 (d, J = 8.5 Hz, 1H), 7.76 (t,
J = 7.5 Hz, 1H), 7.42 (d, J = 8.5 Hz, 1H), 7.32 (t, J = 7.5 Hz, 1H), 7.25
(d, J = 8 Hz, 2H), 7.12 (d, J = 8 Hz, 2H), 2.52 (s, 1H), 2.35 (s, 3H).
2.2.16. (2-(2-((3-p-Toluyl-4-oxo-3,4-dihydroquinazolin-2-
yl)sulfanyl)-acetyl hydrazinylidene)methyl phenoxy) acetic acid
(3)
Compound 17 (0.21 g, 0.39 mmol) was dissolved in tetrahydro-
furan (8 mL) and 2 N LiOH solution (1.5 mL) was added dropwise at
room temperature. The reaction mixture was stirred for 18 h, sol-
vent was removed under vacuum and the crude product was puri-
fied by flash column chromatography using a reverse phase C18
column using water as the mobile phase. Fractions with the prod-
uct were concentrated and lyophilized to yield compound 3 as a
white powder (33% yield). Product was isolated as a mixture of E
and Z isomers. 1H NMR (CD3OD) d 8.71 (s), 8.54 (s), 8.15 (s), 8.13
(s), 7.96 (d, H = 8 Hz), 7.87 (d, J = 8 Hz), 7.82–7.74 (m), 7.68 (d,
J = 8 Hz), 7.57 (d, J = 8 Hz), 7.47–7.29 (m), 6.99–6.87 (m), 4.51 (s),
4.49 (s), 3.99 (s), 2.47 (s), 2.46 (s). Mass ESI (C26H23N4O5S) [MH+]
calcd 503.1383, found 503.1368.
2.2.13. Ethyl-2-(3-(p-toluyl)-4-oxo-3,4-dihydroquinazolin-2-
yl)sulfanyl acetate (15)
To a solution of compound 14 (1.1 g, 3.9 mmol) in DMF
(20 mL), ethyl bromoacetate (0.52 mL, 4.7 mmol) and potassium
carbonate (1.9 g, 14.1 mmol) were added. The reaction was con-
tinued at 100 °C for 3 h and the mixture was triturated with cold
water to yield a precipitate. The precipitate purified by flash col-
umn chromatography (gradient 0–50%, EtOAc in Hexanes) to
yield compound 15 as a white powder (94% yield). 1H NMR
(CDCl3) d 8.23 (d, J = 7.5 Hz, 1H), 7.72 (t, J = 7.5 Hz, 1H), 7.55
(d, J = 7.5 Hz, 1H), 7.40 (t, J = 7.5 Hz, 1H), 7.36 (d, J = 8 Hz, 2H),
7.24 (d, J = 8 Hz, 2H), 4.23 (q, J = 7 Hz, 2H), 3.89 (s, 2H), 2.46
(s, 3H), 1.30 (t, J = 7 Hz, 3H).
2.3. Physicochemical properties
Sirius-T3 instrument (Software Version 1.1.0.10, Sirius Analyti-
cal LTD, UK) was used to determine the pKa and Log D properties
for compounds 1–11. Assays were performed in triplicate at
2.2.14. 2-(3-(p-Toluyl)-4-oxo-3,4-dihydroquinazolin-2-
yl)sulfanyl acetohydrazide (16)
25 °C using 5 lL of 10 mM solution of each sample per assay. The
Compound 15 (1.2 g, 4.3 mmol) was dissolved in ethanol
(15 mL) and hydrazine hydrate (4.3 g, 86.5 mmol) was added.
The reaction mixture was cooled to 0 °C, and the stirring was con-
tinued overnight at 0 °C. The precipitate from the reaction was
collected by filtration and was washed with aqueous ethanol to
yield compound 16 as a white solid (yield 82%). The product
was used immediately for the next step without further
characterization.
dissociation constant (pKa) was determined by the Fast UV pKa
experiment in the presence of neutral buffer to stabilize the pH
electrode across the pH range of 2–12 during the titration of the
analyte. The distribution coefficient, Log D was determined using
the pH-metric method in which the compound was titrated for
pKa in the presence of water and octanol solvent mixture, and
compared to the measured aqueous pKa value.
2.4. Western immunoblots
2.2.15. Ethyl (2-(2-((3-p-toluyl-4-oxo-3,4-dihydroquinazolin-2-
yl) sulfanyl)-acetyl hydrazinylidene) methylphenoxy)acetate
(17)
Salicylaldehyde (7.21 g, 58.25 mmol) was dissolved in anhyd
acetone (50 mL) and bromoethyl acetate (10 g, 59 mmol) dis-
solved in acetone (10 mL) was added dropwise followed by potas-
sium carbonate (12.30 g, (88.43 mmol). The reaction mixture was
stirred at room temperature for 5 h. The crude was concentrated
under vacuum, dissolved in water (50 mL) and was extracted
Daudi cells were either left untreated, or treated with the indi-
cated dose of IFN alfacon-1 alone or in combination with the indi-
cated doses of test compounds, for 15 min. Cells were lysed in a
phosphorylation lysis buffer supplemented with protease and
phosphatase inhibitors. Equal protein aliquots were resolved by
SDS–PAGE, and transferred to membranes for immunoblotting
with an antibody against tyrosine phosphorylated STAT1, as
described.27

982
A. M. Bello et al. / Bioorg. Med. Chem. 22 (2014) 978–985
2.5. Electrophoretic mobility shift assays (EMSA)
delineated with features of hydrophobic, cationic, cationic and
hydrophobic characteristics, respectively, with the distance and
volume tolerances of 1 Å. The hit molecule was refined and a small
set of compounds were synthesized, but none demonstrated any
potential to interfere with IFN binding to IFNAR.25 In these mole-
cules, two of the appendages on the pyrimidine core structure
were carrying one hydrophobic and one cationic group, while the
third appendage to the pyrimidine ring carried two key features
of hydrophobic and cationic characteristics, mimicking Leu30 and
Arg33, respectively. As shown in Figure 1, the interaction surfaces
between IFN and IFNAR cover a large surface area, and the binding
surface on IFNAR subdomains is shallow. Thus, docking protocols
identify molecules to bind to IFNAR1 or IFNAR2 would not be a
productive strategy. To efficiently identify small molecules mim-
icking the protein ligand IFN, we continue to seek to employ small
molecules search protocols, and good success continues to be re-
corded with this tool for the identification of features in chemical
structures.25,33,34 The objective for this specific project is to gener-
ate molecular features mimicking the properties of surface resi-
dues and its’ receptor using chemical structure databases,
followed by selecting potentially useful chemical structures, com-
plete characterizations of the chemical compounds, including re-
synthesis if necessary to validate the structure, and finally confirm
their biological activity unequivocally to ascertain the design
principles.
Daudi cells were either left untreated, treated with 100 pg IFN
alfacon-1, or IFN alfacon-1 plus the indicated doses of the different
test compounds, for 15 min. Nuclear extracts were prepared and
32
reacted with P-GAS (50 AGCTTCATTTCCCGTAAATCCCT), the pro-
tein-DNA complexes resolved by native PAGE, then analyzed by
EMSA, as previously described.28
2.6. In vitro cell viability assay
Daudi cells (1 ꢀ 106) were either left untreated or treated with
the indicated doses of the specified compounds for 24 h, then
washed twice in PBS, resuspended in PBS with 2% FCS and 105 cells
stained with 2 lL of propidium iodide (BD Pharmingen, 50 lg/mL)
for 15 min. Propidium iodide stained dead cells were analyzed by
FACS.
3. Results and discussion
In the past two decades, extraordinary steps have been taken to
advance the generation of small molecule inhibitors that target PPI.
A variety of tools and strategies have been applied to address the
challenges of mimicking PPI.29–31 However, the identification of
agonists in the context of PPI, has been infrequent. Our objective
Close scrutiny of our model of the IFN-IFNAR complex suggests
a triad of residues in IRRP-1, Leu30, Arg33, Asp35 for further con-
sideration for PPI mimicry.32 Specifically, in light of our earlier pub-
lished findings and extending our analysis, we propose that Leu30
and Arg33 should be retained as critical residues for PPI with
IFNAR2, but that Lys31 and His 34 are less important, and that fea-
ture(s) of Asp35 are of greater consequence for molecular mimicry
(Fig. 2B). This led to the definition of a three-distinct-features set:
hydrophobic, cationic and anionic, mimicking Leu30, Arg33 and
Asp35, respectively. Using this refined features set, a database of
4.1 million compounds and several steps of refinement (see Exper-
imental Section) led to the identification of 11 compounds, 1–11
(Chart 1 and Fig. 3). These compounds generally can be classified
into five distinct chemical core structures, with 1, 2–3, 4, 5 and
6–11 grouped into each of the five cores. Compound 3 was synthe-
sized as per Scheme 1, whereas compounds 1–2 and 4–11 were ac-
quired from commercial sources, and their structures and purity
were analytically confirmed in our laboratory. Compound 3 was
synthesized in seven steps from p-methyl aniline 13. Compound
13 was treated with ethyl bromoacetate followed by hydrazine hy-
drate to produce the acyl hydrazine 5 that was condensed with the
benzyl aldehyde 7 to give the target compound 3. Physicochemical
properties for compounds 1–11 were determined for consideration
in the context of the corresponding biological activities’ profiles.
These compounds were evaluated for their potential to interfere
with IFN activation of IFNAR, an expected outcome if these mole-
cules are mimicking a portion of the surface features (IRRP-1) on
IFN that specifically interacts with the extracellular binding site
of the cell surface receptor. Specifically, for productive IFNAR acti-
vation, each of IRRP-1, IRRP-2 and IRRP-3 must contact the respec-
tive binding sites on IFNAR1 and IFNAR2 to enable receptor
dimerization and subsequent intracellular activation. Any interfer-
ence with IFN-IFNAR1 or IFN-IFNAR2 interactions will preclude
complete receptor activation.
is to mimic PPI between IFN-a and its cognate receptor by rational
means, IFNAR to promote receptor activation.
Our previous studies identified three IFNAR receptor recogni-
tion sites (IRRP-1, IRRP-2 and IRRP-3) on the surface of IFN-a2a,
that directly interact with the two receptor subunits, IFNAR1 and
IFNAR2.20,22 IRRP-1 and IRRP-3 together constitute a single, contig-
uous surface epitope, located on one face of IFN-a2a, potentially
interacting with IFNAR2.32 IRRP-2, on the other hand, has a much
larger surface in comparison to the other IRRPs and is located on
the opposite face of IFN-
faces of the IRRPs cover about 27% of the total water accessible sur-
face of IFN- 2. IRRP-1 and IRRP-3 are adjacent on the surface of
IFN- and occupy about 17% of total surface, whereas IRRP-2, on
a2a, binding to IFNAR1 (Fig. 1). The sur-
a
a
the opposite face of IFN, occupies about 10% of the total surface.
At the outset, our strategy was to mimic each of these 3 IRRPs sep-
arately as small molecules, then tether the molecules mimicking
IRRP-1 or IRRP-3 with those mimicking IRRP-2, thus capturing
two regions of IFN that would potentially interact with IFNAR1
and IFNAR2 (Fig. 1). To achieve this we first needed to identify
the residues in the IRRPs of IFN-
tial for interaction with IFNAR, and define the pharmacophore
features, based on an understanding of the complex of IFN- 2a-
a2a which have the greatest poten-
a
IFNAR, then use in silico screening techniques to identify ligands
from chemical databases that contain these pharmacophore
features.
In previous studies we used this approach to identify ligands
mimicking the IRRP-3 region on the surface of IFN-a
2a.25 Six amino
acid residues on the surface of IRRP-3 were targeted for defined
molecular features for in silico screening. An in-house customized
small molecule library containing approximately 300,000 com-
pounds was screened in silico for potential matches. One of the hits
(NCI-619009) was chosen from this in silico screening and four
analogs were synthesized. Among these compounds, two inhibited
the activation of IFNAR by IFN in a dose-dependent fashion, as
would be anticipated for compounds mimicking one of the
IFN-IFNAR complex interactive sites (Fig. 2A).25
However, using the same approach to mimic the IRRP-1 region
proved unsuccessful. Four surface residues on the IRRP-1 region,
Leu30, Lys31, Arg33 and His34, were considered to define the fea-
tures for in silico screening. Leu30, Lys31, Arg33 and His34 were
A series of experiments were conducted with compounds 1–11
to evaluate their potential to interfere with IFNAR activation by
IFN. Binding of IFN to IFNAR activates the JAK-STAT pathway. Spe-
cifically, following IFN binding to IFNAR, the receptor-associated
JAK1 and Tyk2 kinases phosphorylate tyrosine residues in the
intracellular domains of IFNAR1 and IFNAR2 that serve as recruit-
ments sites for STAT1, STAT2 and STAT3. Once recruited to the

A. M. Bello et al. / Bioorg. Med. Chem. 22 (2014) 978–985
983
(Fig. 4A and B). Compounds 3, 4 and 10 inhibited the phopshoryla-
tion of STAT1, but other compounds did not exhibit such activity.
Based on this initial screen, compounds 3, 4 and 10 were re-exam-
ined for their ability to block IFN-inducible STAT1 phosphorylation,
using nuclear extracts for analysis. The data in Figure 4, panel C,
confirm the findings of our initial screen. Compound 3 was identi-
fied as the most potent inhibitor of IFN alfacon-1 activation of
IFNAR, in the context of IFN-inducible STAT1 phosphorylation.
Accordingly, we conducted dose–response experiments with com-
pound 3 in the context of blocking IFN-inducible STAT1 phosphor-
ylation (Fig. 4D).
In subsequent experiments, we evaluated compounds 3, 4 and
10, based on their potency, for their ability to interfere with IFN
inducible STAT-DNA binding. As described above, IFN activation
of IFNAR leads to STAT phosphorylation, a pre-requisite for STAT
complex formation, and subsequent translocation to the nucleus
and DNA binding. To confirm the effects of the IRRP-1 compound
mimetics on IFN inducible STAT1 phosphorylation, we examined
IFN-inducible DNA binding of STAT complexes, in an electropho-
retic mobility shift assay (EMSA). Daudi cells were treated with
IFN alfacon-1 in the presence or absence of compounds 3, 4 or 10
and nuclear extracts were analyzed by EMSA for binding to an
Figure 3. Overlap of the structures of compounds 1–11 onto the features from
Leu30, Arg33 and Asp35 in IRRP-1 on the surface of IFN- 2a. Compounds are shown
2a in a cartoon model ( -helix: red,
a
IFN-c
-activated site (GAS/SIE) using a 32P-GAS element (Fig. 5).
in ball-and-stick representation, and IFN-
a
a
loops and turns: yellow).
Compounds 3, 4 and 10 exhibited inhibition of the activation of IF-
NAR by IFN as seen from the reduced amounts of SIE binding. Nota-
bly, compounds
3 and 10 were more potent inhibitors of
receptor, the STATs in turn are phosphorylated by the JAKs and re-
leased from the receptor. They then form homo- and hetero-di-
meric STAT complexes that translocate to the nucleus to bind to
IFN-inducible STAT-DNA binding than compound 4. These three
compounds were further evaluated for cell toxicity in a 24 h assay
(Supplementary Materials, Fig. S-1). Notably, compound 4 exhib-
interferon-stimulated response element (ISRE) and IFN-c-activated
ited toxicity across the 0–200 lM dose range, in contrast to com-
site (GAS, also referred to as sis-inducible elements or SIE) ele-
ments in the promoters of IFN-inducible genes, thereby activating
gene transcription. We chose to evaluate two events that are a di-
rect consequence on IFN-IFNAR interactions: (1) the IFN-inducible
phosphorylation of STAT1, and (2) the formation of STAT com-
plexes (sis-inducing factor or SIF) complexes that bind to the
GAS element. Both are immediate events associated with IFNAR
activation by IFN binding, and the choice of GAS element binding
will specify STAT1:STAT1 complex-DNA binding, confirming any
results obtained with STAT1 phosphorylation. Since, STAT1 is in-
volved in several IFN-inducible STAT complexes (STAT1:STAT1;
ISGF3; STAT1:STAT3), STAT1 was bioassayed to study the effects
of the inhibitors. For these bioassays we selected IFN alfacon-1 to
include in all experiments, since this novel synthetic IFN is the
pounds 3 and 10. Our data indicate that compound 3, mimicking
the features of IRRP-1 residues, inhibits the activation of IFNAR
by IFN-a confirming our design principles.
Compounds 6–11, all with pKa values greater than 5.1 units
(weak or strong bases) and corresponding LogD values in the range
of ꢁ0.3 to 2.4, did not exhibit any activity in our assays, with the
exception of 10, but the data are confounded by the high toxicity
of this compound that would affect the bioassay readouts. Com-
pounds 3 and 4, on the other hand, exhibited anticipated biological
activities, and they bear a carboxyl moiety with pKa values in the
range of 4 units. Distribution coefficient (LogDpH=7.4) for 4 is 8.9
units indicating this compound as a very nonpolar molecule. Com-
pound 3, on the other hand carries a carboxyl group, mimicking the
Asp35 side chain, as well as a moderate solubility with LogDpH=7.4
of 4.7 units (Table 1), making this the most relevant molecule
mimicking the protein surface residues and the lead in biological
activity evaluations.
most potent IFN-
a and exhibits the highest binding affinity for
IFNAR.35 Any inhibition of IFN alfacon-1-mediated receptor activa-
tion by a small compound would therefore indicate an optimal hit.
Accordingly, Daudi cells were treated with IFN alfacon-1 in the
presence or absence of compounds 1–11 and whole cell lysates
were analyzed for IFN-inducible phosphorylation of STAT1
Among the selected compounds, 3 met the criteria for all three
features chosen from IRRP-1: the hydrophobic side chain of Leu30
O
O
O
NH2
NCS
O
1) CS2, NEt3, EtOH, rt
BrCH2COOEt,
NH2
NH2NH2H2O
EtOH, 80oC
N
N
O
DMSO/H2O
120oC, 25 min
microwave
N
S
2) ClCOOEt, EtOH,
0oC-rt
K2CO3, DMF,
80oC, 5h
N
H
S
O
15
12
13
14
O
O
O
O
N
O
O
O
N
O
N
O
COOH
LiOH
N
O
H
N
H
H
N
N
O
EtOH
reflux
N
S
N
S
NH2
N
S
N
THF/H2O, rt
O
3
O
O
16
17
Scheme 1. Synthesis of compound 3.

984
A. M. Bello et al. / Bioorg. Med. Chem. 22 (2014) 978–985
Figure 5. Compounds 3, 4 and 10 inhibit IFN-inducible STAT-DNA binding. Daudi
cells were either left untreated or treated with 100 pg IFN in the presence or
absence of test compounds (200 lM). Nuclear extracts were prepared and analyzed
by EMSA for GAS binding, using a 32P-labeled GAS element. Data are representative
of duplicate independent experiments.
Table 1
Physicochemical properties (pKa and LogD(pH 7.4)) for compounds 1–11
=
Compound
pKa SD
Log D SD
1
2
9.7 0.4
2.7 0.2
12.5 0.3
3.0 0.1
3.3 0.3
11.5 0.0
5.8 0.1
2.9 0.1
9.8 0.1
6.0 0.1
6.9 0.1
6.0 0.3
8.1 0.0
6.8 0.2
6.9 0.3
5.1 0.0
9.1 0.0
5.8 0.1
6.8 0.1
6.1 0.1
6.9 0.5
ꢁ0.1 0.0
5.8 0.0
3
4.7 0.0
4
5
8. 9 0.0
ꢁ0.8 0.0
6
2.4 0.0
Figure 4. IRRP-1 mimetic compounds inhibit IFN-inducible STAT1 phosphorylation.
(A) Daudi cells were either left untreated, treated with either 10 pg IFN alone, or
10 pg IFN plus 200 lM of compounds 1–11 for 15 min. Whole cell lysates (A and B)
and nuclear (C) extracts were prepared and analyzed by Western immunoblots for
STAT1 tyrosine phosphorylation. The bar graphs are a quantitation of the band
intensities observed, relative to the loading control, tubulin. (D) Dose–response
study of whole cell extracts from Daudi cells left untreated or treated with 10 pg
IFN plus compound 3 (lM) at the indicated doses, then analyzed by Western
immunoblot for STAT1 phosphorylation.
7
ꢁ0.3 0.0
ꢁ0.1 0.0
0.2 0.0
8
9
10
11
2.9 0.0
0.01 0.00
is mimicked by the toluyl moiety at N3 of pyrimidine, the guanid-
inium moiety of Arg33 by the diaza moiety, and the carboxyl group
of Asp35 of IFN-a2 by the methyl carboxylate. Based on our studies
encapsulate the hotspot regions on the entire surface of IFN-a2a,
i.e. mimicking IRRP-1, -2 and -3, in one non-peptidic molecule,
paving the way for a potential IFN mimetic as an agonist for IFNAR.
thus far using the IRRP-1 segment of IFN, we infer that Asp35 is an
important residue for the mimicry of PPI, in addition to Arg33 and
Leu30, associated with productive engagement and activation of
IFNAR. Interestingly, compound 2 devoid of only one carboxyl
group in comparison to compound 3 did not show any inhibition
of IFN binding to IFNAR. This carboxyl moiety mimics the surface
Acknowledgments
Authors acknowledge the financial support from the Canadian
Institutes of Health Research to ENF and LPK (Grant#
MOP-102527). L.P.K. acknowledges the generous support of Can-
ada Foundation for Innovation (Leaders Opportunity Fund and
Hospital Research Fund). E.N.F. is a Tier 1 Canada Research Chair.
N.S. is a recipient of fellowship from Science Without Borders,
Government of Brazil. Authors thank Dr. Liyakat Fatima for her
excellent help with the synthesis and characterizations.
residue, Asp35 in the IRRP1 portion of IFN-a2a suggesting this
moiety to be an important moiety for interactions with the recep-
tor. In a recent study involving the generation of anti-IFN antibod-
ies, it was identified that Asp35 on IFN-a along with another three
residues including Leu30, but not Arg33, are critical for the forma-
tion of antigen–antibody complexes.36 This further argues for the
critical role of surface residues such as Asp35 for mimicry in pro-
tein–protein interactions while designing small molecule mimics.
With a potential mimic of IRRP-1 in the form of compound 3,
and our earlier identification of an IRRP-3 mimic, we now have
Supplementary data
two small molecules mimicking the contiguous surface on IFN-
that interacts with IFNAR2 (Fig. 2A). Studies are underway to
a2a
Supplementary data (cell viability data for compounds 3, 4, 10,
and purity data for compounds 1-11) associated with this article

A. M. Bello et al. / Bioorg. Med. Chem. 22 (2014) 978–985
985
19. Kontsek, P. Acta Virol. 1994, 38, 345–360.
20. Fish, E. N.; Banerjee, K.; Stebbing, N. J. Interferon Res. 1989, 9, 97–114.
21. Cajean-Feroldi, C.; Nosal, F.; Nardeux, P. C.; Gallet, X.; Guymarho, J.; Baychelier,
F.; Sempe, P.; Tovey, M. G.; Escary, J. L.; Eid, P. Biochemistry 2004, 43, 12498–
12512.
can be found, in the online version, at http://dx.doi.org/10.1016/
j.bmc.2013.12.049.
References and notes
22. Fish, E. N. FEBS Lett. 1995, 365, 87–91.
23. Gombotz, W. R.; Pettit, D. K. Bioconj. Chem. 1995, 6, 332–351.
24. Shaji, J.; Patole, V. Ind. J. Pharm. Sci. 2008, 70, 269–277.
25. Bello, A. M.; Bende, T.; Wei, L.; Wang, X.; Majchrzak-Kita, B.; Fish, E. N.; Kotra, L.
P. J. Med. Chem. 2008, 51, 2734–2743.
26. SYBYL 7.3, Tripos International, 1699 South Hanley Rd., St. Louis, Missouri-
63144, USA.
27. Jia, D.; Rahbar, R.; Chan, R. W.; Lee, S. M.; Chan, M. C.; Wang, B. X.;
Baker, D. P.; Sun, B.; Peiris, J. S.; Nicholls, J. M.; Fish, E. N. PLoS ONE 2010,
5, e13927.
28. Ghislain, J. J.; Fish, E. N. J. Biol. Chem. 1996, 271, 12408–12413.
29. Higueruelo, A. P.; Jubb, H.; Blundell, T. L. Curr. Opin. Pharmacol. 2013, 13, 791–
796. http://dx.doi.org/10.1016/j.coph.2013.05.009.
30. Valkov, E.; Sharpe, T.; Marsh, M.; Greive, S.; Hyvonen, M. Top. Curr. Chem. 2012,
317, 45–79.
31. Labbé, C. M.; Laconde, G.; Kuenemann, M. A.; Villoutreix, B. O.; Sperandio, O.
Drug Discov. Today 2013, 18, 958–968. http://dx.doi.org/10.1016/
j.drudis.2013.05.003.
1. Stelzl, U.; Worm, U.; Lalowski, M.; Haenig, C.; Brembeck, F. H.; Goehler, H.;
Stroedicke, M.; Zenkner, M.; Schoenherr, A.; Koeppen, S., et al Cell 2005, 122,
957–968.
2. Tucker, C. L. Prog. Brain Res. 2012, 196, 95–117.
3. Jones, S.; Thornton, J. M. Proc. Natl. Acad. Sci. U.S.A. 1996, 93, 13–20.
4. Oti, M.; Snel, B.; Huynen, M. A.; Brunner, H. G. J. Med. Genet. 2006, 43, 691–698.
5. Al-Khoury, R.; Coulombe, B. Expert Opin. Ther. Targets 2009, 13, 13–17.
6. Ryan, D. P.; Matthews, M. M. Opin. Struct. Biol. 2005, 15, 441–446.
7. Kuzmanov, U.; Emili, A. Genome Med. 2013, 5, 37. http://dx.doi.org/10.1186/
gm441.
8. Ivanov, A. S.; Gnedenko, O. V.; Molnar, A. A.; Mezentsev, Y. V.; Lisitsa, A. V.;
Archakov, A. I. J. Bioinform. Comput. Biol. 2007, 5, 579–592.
9. Bienstock, R. J. Curr. Pharm. Des. 2012, 18, 1240–1254.
10. Tan, C.; Wei, L.; Ottensmeyer, F. P.; Goldfine, I.; Maddux, B. A.; Yip, C. C.; Batey,
R. A.; Kotra, L. P. Bioorg. Med. Chem. Lett. 2004, 14, 1407–1410.
11. Shanmugam, M. K.; Nguyen, A. H.; Kumar, A. P.; Tan, B. K.; Sethi, G. Cancer Lett.
2012, 320, 158–170.
32. Kumaran, J.; Wei, L.; Kotra, L. P.; Fish, E. N. FASEB J. 2007, 21, 3288–3296.
33. Tervo, A. J.; Kyrylenko, S.; Niskanen, P.; Salminen, A.; Leppänen, J.; Nyrönen, T.
J.; Järvinen, T.; Poso, A. J. Med. Chem. 2004, 47, 6292–6298.
34. Hert, J.; Willett, P.; Wilton, D. J.; Acklin, P.; Azzaoui, K.; Jacoby, E.;
Schuffenhauer, A. J. Chem. Inf. Comput. Sci. 2004, 44, 1177–1185.
35. Blatt, L. M.; Davis, J. M.; Klein, S. B.; Taylor, M. W. J. Interferon Cytokine Res.
1996, 16, 489–499.
36. Ouyang, S.; Gong, B.; Li, J. Z.; Zhao, L. X.; Wu, W.; Zhang, F. S.; Sun, L.; Wang, S.
J.; Panm, M.; Li, C.; Liang, W.; Shaw, N.; Zheng, J.; Zhao, G. P.; Wang, Y.; Liu, Z. J.;
Liang, M. J. Mol. Med. (Berl) 2012, 90, 837–846.
12. Blain, J. C.; Mok, Y. F.; Kubanek, J.; Allingham, J. S. Chem. Biol. 2010, 17, 802–
807.
13. Samuel, C. E. J. Biol. Chem. 2007, 282, 20045–20046.
14. Rizza, P.; Moretti, F.; Belardelli, F. Autoimmunity 2010, 43, 204–209.
15. Maher, S. G.; Romero-Weaver, A. L.; Scarzello, A. J.; Gamero, A. M. Curr. Med.
Chem. 2007, 14, 1279–1289.
16. Piehler, J.; Schreiber, G. J. Mol. Biol. 1999, 289, 57–67.
17. Laila, C.; Roisman, L. C.; Piehler, J.; Trosset, J. Y.; Scheraga, H. A.; Schreiber, G.
Proc. Natl. Acad. Sci. U.S.A. 2001, 98, 13231–13236.
18. Cutrone, E. C.; Langer, J. A. J. Biol. Chem. 2001, 276, 17140–17148.