Design and structure activity relationship of tumor-homing histone deacetylase inhibitors conjugated to folic and pteroic acids

Article abstract of DOI:10.1016/j.ejmech.2015.04.014

Histone deacetylase (HDAC) inhibition has recently emerged as a novel therapeutic approach for the treatment of various pathological conditions including cancer. Currently, two HDAC inhibitors (HDACi) - Vorinostat and Romidepsin - have been approved for t

Full text of DOI:10.1016/j.ejmech.2015.04.014

European Journal of Medicinal Chemistry 96 (2015) 340e359
Contents lists available at ScienceDirect
European Journal of Medicinal Chemistry
journal homepage: http://www.elsevier.com/locate/ejmech
Original article
Design and structure activity relationship of tumor-homing histone
deacetylase inhibitors conjugated to folic and pteroic acids
,
,
, e, **
Quaovi H. Sodji a, James R. Kornacki d e, John F. McDonald b c, Milan Mrksich d
,
, c, *
Adegboyega K. Oyelere a
a School of Chemistry and Biochemistry, Georgia Institute of Technology, Atlanta, GA 30332-0400, USA
b School of Biology, Georgia Institute of Technology, Atlanta, GA 30332-0400, USA
c Parker H. Petit Institute for Bioengineering and Bioscience, Georgia Institute of Technology, Atlanta, GA 30332-0400, USA
d Department of Chemistry, Northwestern University, 2145 Sheridan Road, Evanston, IL 60208-3113, USA
e Department of Biomedical Engineering, Northwestern University, 2145 Sheridan Road, Evanston, IL 60208-3113, USA
a r t i c l e i n f o
a b s t r a c t
Article history:
Histone deacetylase (HDAC) inhibition has recently emerged as a novel therapeutic approach for the
treatment of various pathological conditions including cancer. Currently, two HDAC inhibitors (HDACi) e
Vorinostat and Romidepsin e have been approved for the treatment of cutaneous T-cell lymphoma.
However, HDACi remain ineffective against solid tumors and are associated with adverse events
including cardiotoxicity. Targeted delivery may enhance the therapeutic indices of HDACi and enable
them to be efficacious against solid tumors. We showed herein that morphing of folic and pteroic acids
into the surface recognition group of HDACi results in hydroxamate and benzamide HDACi which derived
tumor homing by targeting folate receptor (FR), a receptor commonly overexpressed in solid tumors. We
observed a correlation between the potency of HDAC1 inhibition and cytotoxicity as only the potent
pteroate hydroxamates, 11d and 11e, displayed antiproliferative activity against two representative FR-
expression cancer cells. Our observation further supports the previous results which suggest that for a
drug to be successfully targeted using the FR, it must be extremely potent against its primary target as
the FR has a low delivery efficiency.
Received 21 August 2014
Received in revised form
3 April 2015
Accepted 4 April 2015
Available online 8 April 2015
Keywords:
Targeted delivery
Histone deacetylase
Folate
Pteroic acid
Hydroxamic acid
Tubastatin A
Published by Elsevier Masson SAS.
1. Introduction
HDAC6 and 10 are members of class IIb, and HDAC11 represents the
sole member of class IV. HDACs catalyze the removal of acetyl group
Recent advances in cancer biology have led to the identification
of novel targets for therapy [1,2]. Such targets include histone
deacetylases (HDACs) which are components of the cellular
epigenetic machinery [3e5]. There are 11 zinc dependent HDAC
isoforms grouped into 3 classes (Classes I, II and IV) and 7 NADþ
dependent which form class III. Class I includes nuclear HDAC1, 2, 3
and 8. Isoforms 4, 5, 7 and 9 constitute the class IIa, which shuttle
between the nucleus and the cytoplasm. The purely cytoplasmic
from lysine residues of histone and non-histone proteins. Histone
hypoacetylation causes chromatin condensation which concomi-
tantly impedes the access of transcription factors to promoter
segments within the condensed chromatin [3]. HDACs substrates
are not limited to histone proteins. Other non-histone proteins
whose activities are directly regulated by HDACs include HSP90,
tubulin, androgen receptors, and p53 [6,7]. Moreover, the activity of
the HDACs is opposed by histone acetyltransferases (HATs) which
add acetyl group to lysine residues [3].
Due to their involvement in gene expression regulation, HDACs
are recruited into various complexes by many cancers to purposely
silence key pro-apoptotic genes. Consequently, specific HDAC iso-
forms are overexpressed in various cancer-types [8,9]. Inhibition of
HDAC activity by broad spectrum inhibitors is now recognized as a
novel treatment for certain cancers. Clinical trials have resulted in
the FDA approvals of Vorinostat (SAHA) and Romidepsin (FK228)
for the treatment of cutaneous T-cell lymphoma (CTCL) in 2006 and
Abbreviations: FR, Folate receptor; HDAC, Histone deacetylase; HDACi, Histone
deacetylase inhibitor; ZBG, zinc binding group; SAR, structure activity relationship.
* Corresponding author. School of Chemistry and Biochemistry, Georgia Institute
of Technology, Atlanta, GA 30332-0400, USA.
** Corresponding author. Department of Chemistry, Northwestern University,
2145 Sheridan Road, Evanston, IL 60208-3113, USA.
E-mail addresses: milan.mrksich@northwestern.edu (M. Mrksich), aoyelere@
gatech.edu (A.K. Oyelere).
http://dx.doi.org/10.1016/j.ejmech.2015.04.014
0223-5234/Published by Elsevier Masson SAS.

Q.H. Sodji et al. / European Journal of Medicinal Chemistry 96 (2015) 340e359
341
2009 respectively [10,11]. Like other anticancer drugs, HDACi have
been associated with side effects including neutropenia, throm-
bocytopenia and potentially fatal cardiac arrhythmias [12]. In light
of these shortcomings, HDACi therapy could benefit from a targeted
therapeutic approach as it is the case for some currently available
drugs [13]. Furthermore, this approach may address other de-
ficiencies of HDACi, primarily their lack of efficacy towards solid
tumors attributable to low therapeutic concentration within the
malignant cells [14,15].
To meet their high metabolic demands, cancer cells overexpress
various ligands receptors including those of vitamins [16,17]. Such
receptors include the folate receptor (FR) whose expression is
limited to certain epithelial cells including the choroid plexus, lung,
thyroid, kidneys, and various malignancies [18e20]. This selective
overexpression in cancer cells has made the FR an ideal candidate
for targeted cancer therapy. FR mediated endocytic uptake of folate
conjugates into malignant cells have been exploited for the delivery
of diagnostic and therapeutic agents while minimizing delivery to
Fig. 1. HDACi pharmacophoric model and structures of selected HDACi A), folic acid (Bi), pteroic acid (Bii), folate g-hydroxamic acid (Ci) and pteroate hydroxamic acid (Cii).

342
Q.H. Sodji et al. / European Journal of Medicinal Chemistry 96 (2015) 340e359
healthy cells [21e24]. Folate delivery to healthy cells is instead
mediated by the ubiquitously expressed reduced folate carrier
(RFC), which does not uptake folate conjugates [25,26]. Herein, we
describe the design, synthesis and characterization of tumor-
homing HDACi which derive their tumor selective accumulation
from targeting the FR. We find that both folate and pteroate-based
hydroxamates are potent inhibitors of HDAC1 and 6, but only the
pteroic conjugated HDACi display anticancer activities against the
folate receptor positive (FRþ) tumors KB and HeLa. Moreover,
HDAC1 inhibition is sufficient to induce apoptosis in KB cells
whereas selective HDAC6 inhibition has no impact on KB cells
survival.
and pteroate-HDACi hybrids (Figs. 3, 5 and 7).
2.2. Synthesis and HDAC inhibition activity of folate
and pteroate hydroxamic acids
g-hydroxamic
Due to the structural similarity of the pteroate group with
typical HDACi surface recognition groups, we envisioned that the
substitution of the carboxylic acid group of folic and pteroic acids
with a zinc binding group (ZBG), essential for HDAC inhibition,
would imbue tumor-homing functionality. Hence, the g-carboxyl of
folate and the carboxylate moiety of pteroic acid were converted to
hydroxamic acid, the most commonly used ZBG for HDAC inhibi-
tion, to furnish compounds 6 and 7 respectively (Fig. 1C).
2. Results and discussion
The reaction route for the synthesis of the folate
6 and pteroate hydroxamate 7 is shown in Scheme 1.
acid -tert-butyl ester was subjected to diazo-transfer resulting
quantitatively in the -azido -glutamic acid -tert-butyl ester 1
[30]. The -azido glutamic acid 1 was coupled with O-tritylhy-
droxylamine in the presence of isobutylchloroformate (IBCF) and
N-methyl-morpholine (NMM) resulting in compound 2 [31]. The
azide moiety was then reduced to an amine with Zn and NH4Cl
yielding compound 3 [32]. The coupling of 3 with pteroyl azide 4
(see supporting info, Scheme S1 for the synthesis of 4) in the
presence of tetramethylguanidine (TMG) [33] resulted in the
penultimate intermediate 5. Exposure of this intermediate to tri-
fluoroacetic acid (TFA) in the presence of triisopropylsilane (TIPS)
g
-hydroxamate
L-Glutamic
2.1. Design of folate receptor ligand-HDACi conjugates
a
a
L
a
Folic acid, which is comprised of pteroic acid and a glutamate
residue (Fig. 1), has been commonly used to target the FR. Recent
reports have however suggested that pteroic acid is also capable of
mediating selective delivery of ligands to tumors overexpressing FR
despite having minimal affinity for the FR [27e29]. Our main
objective in this study is to investigate the prospect of folic and
pteroic acids as mediators of selective delivery of HDACi to FR
overexpressing cancer cells. To this end, we have designed a set of
folate- and pteroate-HDACi conjugates in which the folate or
pteroate moiety is integrated into the surface recognition group of a
prototypical HDACi [3]. This design approach furnished minimally
perturbed folate and pteroate analogs (Fig. 1C) and morphed folate-
a
yielded the desired folate g-hydroxamate 6 (Scheme 1A) [34].
To obtain the pteroic hydroxamate 7, N10-(Trifluoroacetyl)
pyrofolic acid (III, see Supporting info, Scheme S1), an intermediate
Scheme 1. Syntheses of folate
g-hydroxamate 6 (A) and pteroate hydroxamate 7 (B). a) TfN3, K2CO3, CuSO4.5H2O, DCM, H2O, MeOH, rt; b) IBCF, NMM, NH2-O-trityl; c) NH4Cl, Zn,
EtOH/H2O (3:1), reflux; d) Pteroyl azide (4), TMG, DMSO, rt; e) TFA, TIPS; f) 50% aqueous NH2OH, DMSO, rt.

Q.H. Sodji et al. / European Journal of Medicinal Chemistry 96 (2015) 340e359
343
Table 1
the ZBG (Fig. 3).
Inhibition profile of folate g-hydroxamic and pteroate hydroxamic acids (IC50 in nM)
The synthesis of the pteroate hydroxamates 11aeg is depicted in
Scheme 2. Reduction of the previously described trityl azido
hydroxamates 8aeg with PPh3 furnished the corresponding amines
9aeg which were subsequently reacted with pteroyl azide 4 to
yield the O-trityl protected hydroxamates 10aeg [37,38]. The trityl
protecting group was removed with TFA in presence of TIPS to give
the requisite hydroxamates 11aeg (Scheme 2) [34].
against selected HDAC isoforms.
HDAC1
HDAC6
HDAC8
Folate
g-hydroxamate (6)
aNI
2390 470
NI
NI
Pteroate hydroxamate (7)
17.6 2.2
581 198
a
No significant inhibition (inhibition below 20% at 10 mM).
To evaluate the impact of the linker on their potency and iso-
form selectivity, we profiled the HDAC inhibition activity of
hydroxamates 11aeg against HDACs 1, 6 and 8 (Table 2). Relative to
the “linker-less” compound 7, the 3-methylene linker compound
11a is a significantly weaker HDACi. Despite the loss of potency,
however, 11a is selective for HDAC6. Subsequent increases in the
methylene linker length, up to 8-methylene groups largely resulted
in improved HDAC1 and HDAC6 inhibition activities. We observed
that a further increase in linker length is ultimately detrimental
(Table 2, compare 11f and 11g). Among these pteroate hydrox-
amates, 11e is the best HDAC1 inhibitor while 11f is the best for
HDAC6. Interestingly, we did not notice any glaring correlation
between changes in the linker length and the HDAC8 inhibition
activity of these pteroate hydroxamates.
To understand the basis of HDAC1 and HDAC6 inhibition by the
pteroate-based hydroxamates, we docked 11a, 11c and 11e against
the homology model of HDAC1, whereas against the homology
model of HDAC6, we docked 11a, 11c and 11f. Zn2þ chelation seems
to be the major determinant of HDAC inhibition against both iso-
forms. In HDAC1, the 3-carbon methylene linker of 11a is not long
enough to achieve optimal Zn2þ chelation (Fig. 4Ai). An increase to
5 carbon-methylene linker as in 11c results in the close proximity of
the ZBG to Zn2þ to achieve chelation. In addition to zinc chelation,
11e is further stabilized by a T-shape interaction between its pterin
ring and aromatic ring of TYR204 (Fig. 4Aii). Against HDAC6, all
three compounds display optimal Zn2þ chelation (Fig. 4Bi), how-
ever, 11a does not seem to be stabilized by any secondary in-
teractions. On the other hand, the pterin moiety of 11c and 11f is
in the synthesis of pteroyl azide 4 [33], was reacted with a 50%
aqueous hydroxylamine in DMSO (Scheme 1B).
We then investigated the HDAC inhibition potential of the folate
g
-hydroxamate 6 and pteroate hydroxamate 7 against HDAC1, 6,
and 8 using the SAMDI mass spectrometry HDAC activity assay as
previously described [35,36]. We observed that the folate
g-
hydroxamate 6 was inactive against all three isoforms while the
pteroate hydroxamate 7 inhibited these three HDACs. Compound 7
is particularly effective against HDAC6, with an IC50 of 17.6 nM, and
a selectivity enhancement of 130-fold relative to HDAC1 and 32-
fold relative to HDAC8 (Table 1).
To obtain structural basis for the lack of HDAC inhibition by the
folate g-hydroxamate 6, it was docked against homology models of
HDAC1 and 6 built from human HDAC2 (PDB code: 3MAX) and
HDAC8 (PDB code: 3F0R) respectively using Autodock 4.2 as previ-
ously described [35,36]. Against both isoforms, the folate
g-
hydroxamate 6 adopts poses with the hydroxamate moiety pointing
toward the active site Zn2þ ion, however it does so by positioning the
a
-carboxylate moiety in locations that are entropically unfavorable.
With HDAC6, the -carboxylate is inserted deep into the hydro-
a
phobic pocket where aromatic amino acids are located (Fig. 2i). The
ensuing interactions may be unfavorable, potentially precluding the
chelation of the hydroxamate moiety of 6 with the active site Zn2þ
ion. Against HDAC1, compound 6 adopts different docked poses. Due
to the narrowness of the channel leading to HDAC1 active site, the a-
carboxylate is excluded from the channel and instead positioned in
close proximity (<3 Å)tothe carboxylateof ASP99near the channel's
entrance (Fig. 2ii). Electrostatic repulsion may then prevent the
insertion of the ZBG into the active site.
involved in a
p-stacking interaction with the aromatic ring of
PHE680. The geometry of the
p-stacking may explain the increased
potency of 11f compared to 11c as the pterin ring in 11f is ideally
positioned for stacking with the phenyl ring of PHE680 (Fig. 4Bii).
2.3. SAR on pteroate-based hydroxamate HDACi
Unlike the folate
g-hydroxamate 6, pteroate hydroxamate 7 was
2.4. Folate-based hydroxamate HDACi
active against HDAC1, 6, and 8. To optimize its activity, we main-
tained the pteroate moiety as the surface recognition group
but varied the length of the methylene linker separating it from
Encouraged by the observed linker length dependence of the
anti-HDAC activity of the pteroate hydroxamates, we revisited our
Fig. 2. Molecular docking studies explaining the lack HDAC inhibition by folate
active site residues preclude optimum chelation to the active site Zn2þ ion; i) In HDAC6: The
is unable to enter the hydrophobic channel but is placed in close proximity to the carboxylate of ASP99.
g
-hydroxamate 6. The unfavorable interactions between the
a
-carboxylate of 6 and the enzymes
a
-carboxylate is inserted in the hydrophobic pocket; ii) HDAC1: The
a
-carboxylate of 6

344
Q.H. Sodji et al. / European Journal of Medicinal Chemistry 96 (2015) 340e359
Table 2
HDAC inhibition of Pteoric based hydroxamates (IC50 in nM) against selected HDAC
isoforms.
Fig. 3. Structure of Pteroate-based hydroxamates 11aeg.
n
HDAC1
HDAC6
HDAC8
25 18%
39 6%
41 17%
1060 320
9380 1720
7590 2120
40 10%
11a
11b
11c
11d
11e
11f
(1)
(2)
(3)
(4)
(5)
(6)
(7)
e
22.1 1.7%
6150 1320
79.6 12.6
23.4 4.2
16.1 2.8
524 36
1460 310
212 15
43.6 8.4
12.2 0.2
55.4 2.2
10.2 1.0
476 48
144 23
study on the folate series and performed similar structural alter-
ations to the -carboxylate group of the folate template (Fig. 5).
g
Additional impetus for studying folate-derived compounds may be
the significantly enhanced affinity of folic acid, compared to their
pteroic acid congeners, for the FR. The synthesis of the folate-
11g
SAHA
53
38
7%
2
derived hydroxamates 15aed is depicted in Scheme 3. The
a-
232 19
azido -glutamic acid -tert-butyl ester 1 was coupled to the trityl
L
a
% inhibition at 10 mM are given if the IC50 was above 10 mM.
amino hydroxamates 9a, 9d, 9e, 9f in the presence of IBCF and
NMM to give the azido trityl protected hydroxamate compounds
12aed [31,39]. Subsequent azide reduction with NH4Cl and Zn
followed by coupling to the pteroyl azide 4 gave the protected folate
based hydroxamate HDACi 14aed [32,33]. Removal of the trityl and
t-Butyl protecting groups was accomplished in TFA with TIPS
furnishing the desired folate based hydroxamate compounds
15aed [34].
Analogous to the pteroate series, compounds 15aed displayed
linker length-dependent anti-HDAC activity with a clear preference
for HDAC6 (Table 3). Against the three HDAC isoforms investigated,
15b is the most potent among this series of HDACi. Relative to
pteroate hydroxamates 11aeg, compounds 15aed are generally
less potent. However, selected members of this series e 15c and
15d e are more active against HDAC8 relative to their pteroate
hydroxamate congeners 11e and 11f.
To understand the basis of the HDAC6 selectivity by the folate
based hydroxamates, 15c was docked against the homology models
of HDAC1 and 6 built respectively from human HDAC2 (PDB code:
3MAX) and HDAC8 (PDB code: 3F0R) using Autodock 4.2 as previ-
ously described [35,36]. Against HDAC6, the hydroxamate ZBG of
15c chelates to the zinc (Fig. 6Ai) and is stabilized by hydrogen
bonds with the side chain of ASP567 and the C]O backbone of
HDACi therapy based in part on the observation that the class I
selective inhibitor MS275 and the HDAC6 selective inhibitor ACY-
1215 are well tolerated in clinical trials [3,40]. We incorporated
benzamide, which is a known HDAC1-selective ZBG, into the design
of the folate based compounds (Fig. 7).
Precursor of the biaryl benzamide ZBG 16 was synthesized as
previously reported [41]. The biaryl benzamide ZBG 17 was ob-
tained following the reduction of the nitro group in presence of Zn
in dioxane/H2O (4:1) (Scheme 4) [42]. In presence of EDCI and
HOBT, the ZBG 17 was coupled to various azido carboxylic acids
(18aed) to give compounds 19aed [31,37]. Following the reduction
of the azide 19aed with zinc and NH4Cl, the resulting compounds
20aed were coupled to
a-azido glutamic acid 1 to give in-
termediates 21aed. Zinc-mediated reduction of 21aed gave 22aed
which were coupled with pteroyl azide 4 to give the penultimate
intermediates 23aed. Final removal of protecting groups with TFA
containing TIPS affords the desired folate based biaryl benzamide
HDACi 24aed (Scheme 4) [34].
In contrast to their hydroxamate congeners, the biaryl benza-
mides 24aed are devoid of HDAC6 and 8 inhibition. However, they
show chain length-dependent HDAC1 inhibition from the mini-
mally potent 3-methylene linker 24a to the highly potent 7-
methylene spacer 24c (Table 4). This HDAC1 selectivity is ex-
pected as the biaryl benzamide ZBG is selective for HDAC1 [41].
PHE566. Further stabilizing interactions may be attributed to the p-
stacking interaction between the pterin ring and the phenyl ring of
PHE680 (Fig. 6Aii). With HDAC1, zinc chelation is not optimal due to
the following interactions obliging the hydroxamate ZBG to adopt
the observed binding mode (Fig. 6Bi): hydrogen bonds with the
side chains of GLU146, ASN95, ASP99, amide backbone of PHE205,
as well as a T-shape interaction between the pterin ring and
PHE205 (Fig. 6Bii).
2.6. Anticancer activity of pteroate and folate-derived HDACi
Most HDACi are inherently incapable of targeting tumor cells,
and they therefore have off-target toxic effects [3]. Tumor cell-
selective uptake of HDACi could potentially ameliorate many of
their shortcomings. To evaluate the influence of the FR on the
cytotoxic activity of the folate- and pteroate-derived HDACi
2.5. Isoform selective folate based biaryl benzamide HDACi
Isoform selectivity of HDACi is believed to enhance the safety of
Scheme 2. Synthesis of Pteroate-based hydroxamates 11aeg. a) i)PPh3, THF, rt ii) H2O; b) Pteroyl azide 4, TMG, DMSO, rt; c) TFA, TIPS.

Q.H. Sodji et al. / European Journal of Medicinal Chemistry 96 (2015) 340e359
345
Fig. 4. Molecular docking poses explaining the inhibitory profile of selected pteroate-based hydroxamates against HDAC1 and HDAC6; A) HDAC1: i) Both 11c (purple) and 11e (gray)
chelate the active site Zn2þ but 11a (green) does not due to a short linker; ii) In addition to Zn2þ chelation, 11e (gray) is further stabilized by a T-shape interaction between its pterin
and the aromatic ring of TYR204. B) HDAC6: i) All three inhibitors, 11a (green), 11c (purple) and 11f (orange) chelate the Zn2þ; ii) Both 11c and 11f are further stabilized by a
p-
stacking between their respective pterin ring and PHE680, furthermore the pterin ring of 11f is ideally positioned for stacking with the aromatic ring of PHE680 unlike in 11c. (For
interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
identified above, we investigated the effects of their exposure on
the viability of two FR (þ) transformed cell lines, KB (oral carci-
noma) and HeLa (cervical carcinoma) cells [43]. We observed that
none of the folate-based hydroxamates and biaryl benzamides
were active against either cell lines. Among the pteroate hydrox-
amates, only the 6- and 7-methylene linker 11d and 11e, respec-
tively, were active with micromolar IC50s (Table 5). KB cells were
more responsive to these compounds as reflected by the lower IC50
compared to those in HeLa cells. This observed difference in
sensitivity is in agreement with previous observations since HeLa
cells have a lower FR density than the KB cells [44].
To confirm the FR as the route of entry of the pteroate-based
hydroxamates into the KB cells, we measured the cell viability in
Fig. 5. Structure of folate based hydroxamates 15aeg.

346
Q.H. Sodji et al. / European Journal of Medicinal Chemistry 96 (2015) 340e359
Scheme 3. Synthesis of folate based hydroxamates. a) IBCF, NMM; b) Zn, NH4Cl, EtOH/H2O (3:1), reflux; c) Pteroyl azide 4, TMG, DMSO, rt; d) TFA, TIPS.
the presence and absence of folic acid as previously described [45].
The addition of folic acid (250 M) reduced the cytotoxicity of 11e
(Fig. 8). Furthermore, we observed that both 11d and 11e are
inactive against the FR (ꢀ) lung cancer cell line A549. These results
suggest a reliance on the FR for the cellular uptake of the pteroate
hydroxamate compounds [46].
pteroate hydroxamate 7 and active lead-compounds 11d and 11e
are capable of productive interaction with FR and this may lead to
their FR-dependent cell uptake [49].
m
We used immunoblotting to investigate the cell response to
compounds 7, 11d, and 11e. First, we monitored tubulin acetylation
as a marker of HDAC6 activity in KB cells and included the pan-
inhibitor SAHA as a control [50]. As expected, SAHA and the lead-
compounds 11d and 11e induced an increase in acetylated
tubulin levels at IC50 doses and above, thereby confirming HDAC6
as a target (Fig. 10). Interestingly, a similar increase in tubulin
acetylation was observed upon cell exposure to pteroate hydrox-
2.7. Validation of intracellular targets
Inhibition of HDAC1 or 6 have been associated with the anti-
proliferative activities of HDACi [41,47,48]. The most potent HDAC6
selective inhibitor in the series disclosed herein is the pteroate
hydroxamate 7 (Table 1). However, compound 7 is not cytotoxic to
amate 7 (100 mM) (Fig. 10). This finding suggests that the selective
HDAC6 inhibitor 7 is indeed targeting intracellular HDAC6. Because
compound 7 is non-cytotoxic, it appears that HDAC6 inhibition is
not entirely detrimental to the viability of KB cells.
To further exclude the contribution of HDAC6 inhibition to the
mechanism of cytotoxicity, we investigated the effects of the
HDAC6-selective inhibitor Tubastatin A [51] and HDAC1-selective
inhibitor biaryl benzamide SHI-1:2 [41] on KB cell survival. We
observed that the HDAC1 selective SHI-1:2 potently inhibits cell
the KB and HeLa cells up to 100 mM. The lack of cytotoxic activity of
7 may suggest that HDAC6 inhibition does not lead to KB cell death.
Alternatively, it may be that 7 is unable to penetrate KB cell.
However, when docked against the FR crystal structure (PDB code:
4LRH), 7 binds to the FR, and its pterin moiety is involved in sta-
bilizing interactions similar to the interactions between the active
lead-compounds 11d and 11e and the FR. Furthermore, the in-
teractions between the pterin ring of compounds 7, 11d, 11e and the
FR are analogous to those previously reported between folic acid
and FR (Fig. 9). This structural information suggests that the
proliferation with an IC50 of 5.27 0.84
mM. Tubastatin A was also
cytototoxic but less potent with an IC50 of 14.81 2.74
mM. Thus, it
would be easy to conclude that HDAC6 activity is essential to
viability. However, the high concentration of Tubastatin A required
for cell death approximate its in vitro IC50 for HDAC1 (16.4 2.6 mM)
Table 3
[51]. Therefore, the observed cytotoxicity of Tubastatin A to the KB
cells may largely be derived from HDAC1 inhibition. To verify the
plausibility of this scenario, we used KB cells to determine the effect
of Tubastatin A, together with pteroate hydroxamates 7, 11d, 11e,
and SAHA, on the acetylation status histone H4, an intracellular
marker of HDAC1 inhibition [50]. As expected, SAHA, 11d, and 11e
displayed dose dependent increases in histone H4 acetylation
HDAC inhibition of folate based hydroxamates (IC50 in nM) against selected HDAC
isoforms.
(Fig. 11). At 14 mM, Tubastatin A also showed a significant increase
in H4 acetylation. This observation further supports the involve-
ment of intracellular HDAC1 inhibition as the major contributor to
the cytotoxic activity of Tubastatin A against KB cells. Interestingly,
n
HDAC1
HDAC6
HDAC8
40 5%
2390 640
2370 430
1560 340
232 19
15a
15b
15c
(1)
(4)
(5)
(6)
e
NI
8050 330
132 23
193 41
179 19
144 23
pteroate hydroxamate 7 at 100 mM has little effect on H4 acetylation
1770 100
1800 180
2760 550
relative to the control (Fig. 11, compare lanes 1 and 8), supporting
its selectivity for HDAC6 and further explaining why it is non-
cytotoxic at this concentration.
15d
SAHA
38
2
Finally, the correlation between HDAC1 inhibition and KB cell
viability may explain the lack of anticancer activity of the folate
% inhibition at 10
NI: No significant inhibition (below 20% Inhibition at 10
m
M are given if the IC50 was above 10
m
m
M.
M concentration).

Q.H. Sodji et al. / European Journal of Medicinal Chemistry 96 (2015) 340e359
347
Fig. 6. Molecular basis for isoform selectivity of 15c. A) Molecular docking of 15c with HDAC6 homology model built from HDAC8 (PDB code: 3F0R); i) Zinc chelation by 15c; ii) Polar
interactions between 15c and HDAC6 homology model and -stacking of phenyl of PHE680 with 15c; B) Molecular docking of 15c with HDAC1 homology model built from HDAC2
p
(PDB code: 3MAX); i) Orientation of the hydroxamate ZBG at the active site; ii) Stabilizing interactions between 15c and HDAC1 homology model include H-bonds and T-shape
interaction of PHE205 with pterin ring of 15c.
based hydroxamate compounds, since they are poor HDAC1 in-
hibitors (Table 3). However, the inactivity of the HDAC1-selective
folate-based biaryl benzamides 24aed (Table 4) against KB cells
may be contrary to this correlation. In an attempt to resolve this
apparent contradiction, we speculated that the biaryl benzamide
ZBG may be perturbing FR binding. However, molecular docking
studies of 24b and 24c revealed that the binding interactions with
the FR were similar to folic acid (Fig. 12), suggesting that the ZBG
may not be perturbing the stabilizing interactions between these
compounds and the FR. Recent studies have shown that a proton-
coupled folate transporter (PCFT) is responsible for the export of
folates from endosomes following endocytosis [52]. The folate-
based biaryl benzamides may not be efficiently transported by
the PCFT leading to their retention in the endosomes upon endo-
cytosis. Although the folate receptor has been successfully targeted
for the delivery of therapeutic agents, observations made by Philip
Low's group revealed that only 15e25% of the bound FR release
their substrates following endocytosis, the rest of the bound re-
ceptors are returned to the cell surface [22]. Thus, targeting by FR
binding may require relatively potent leads to compensate for the
fractions that remain bound [21]. This may explain why the rela-
tively more potent compounds 11d and 11e (Table 2) are cytotoxic,
while the less potent 24aed are not.
3. Conclusion
Despite success against hematological malignancies, HDACi
have not been effective against solid tumors. Targeting HDACi
directly to tumors, however, may enhance their therapeutic utility.
Prior attempts have exploited the folate receptor, which is over-
expressed in some tumors, as a Trojan horse for delivery by
conjugating HDACi to folate [45,53]. While these compounds
indicate HDACi inhibition, there is little indication of FR involve-
ment for cellular uptake [53]. A direct conjugate of folic acid to
common thiolate HDACi unfortunately abolishes HDAC inhibition
activity [45]. We show that morphing of folic and pteroic acids into
the surface recognition group of certain hydroxamate and benza-
mide HDACi yields isoform selective HDACi that target the FR. We
observed that the benzamide HDACi are HDAC1 selective while the
pteroate-based hydroxamates are potent inhibitors of HDAC1 and
6. Furthermore, we established a correlation between the potency
of HDAC1 inhibition and cytotoxicity, as only the pteroate
hydroxamates 11d and 11e harboring low nanomolar HDAC1 in-
hibition activity displayed antiproliferative activity against KB and
HeLa cells. While the folate receptor is a promising conduit for
targeted therapy, its low delivery efficiency may constitute an
Fig. 7. Structure of folate based biaryl benzamide HDACi.

348
Q.H. Sodji et al. / European Journal of Medicinal Chemistry 96 (2015) 340e359
Scheme 4. Synthesis of folate based biaryl benzamide HDACi. a) Zn, Dioxane/H2O (4:1), 70 ꢁC; b) EDCI, HOBT, DMF, 70 ꢁC; c) Zn, NH4Cl, EtOH/H2O (3:1), reflux; d) 1, EDCI, HOBT,
DMF, rt; e) Pteroyl azide 4, TMG, DMSO; f) TFA, TIPS.
obstacle. Our observations support the notion that targeting by way
of the folate receptor requires that drugs are very potent against
their primary targets.
from Invitrogen (Life Technologies, Grand Island, NY, USA), rabbit
anti-actin, rabbit anti-tubulin , rabbit anti-histone H4 antibodies
a
and Tubastatin A were purchased from SigmaeAldrich (St. Louis,
MO, USA). Secondary antibodies, goat anti-rabbit conjugated to
IRDye680 and goat anti-mouse conjugated to IRDye800 were pur-
chased from LI-COR Biosciences (Lincoln, NE, USA). The CellTiter 96
AQueous One Solution Cell Proliferation assay (MTS) kit was pur-
chased from Promega (Madison, WI, USA).
4. Experimental section
4.1. Materials and methods
Folic acid and other reagents used were purchased from Sig-
maeAldrich (St. Louis, MO, USA) and Alfa Aesar (WardHill, MA,
USA). Analtech silica gel plates (60 F254) were used for analytical
Table 4
HDAC inhibition of folate based biaryl benzamides (IC50 in nM) against selected
HDAC isoforms.
TLC, and Analtech preparative TLC plates (UV 254, 2000 mm) were
used for purification. UV light was used to examine the spots. Silica
gel (200e400 Mesh) was used in column chromatography. NMR
spectra were recorded on a Varian-Gemini 400 magnetic resonance
spectrometer. 1H NMR spectra were recorded in parts per million
(ppm) relative to the peak of CDCl3, (7.24 ppm), CD3OD (3.31 ppm),
or DMSO-d6 (2.49 ppm). 13C spectra were recorded relative to the
central peak of the CDCl3 triplet (77.0 ppm), CD3OD (49.0 ppm), or
the DMSO-d6 septet (39.7 ppm), and were recorded with complete
heterodecoupling. Multiplicities are described using the abbrevia-
tion s, singlet; d, doublet, t, triplet; q, quartet; m, multiplet; and
app, apparent. High-resolution mass spectra were recorded at the
Georgia Institute of Technology mass spectrometry facility in
Atlanta. KB and A549 cells were obtained from ATCC (Manassas, VA,
USA), HeLa cell line was kindly donated by Dr. Christoph Farhni and
grown on folate free RPMI medium supplemented with 10% fetal
bovine serum (Global Cell Solutions, Charlottesville, VA, USA) and
1% pen/Strep (Cellgro, Manassas, VA) at 37 ꢁC in an incubator with
n
HDAC1
HDAC6
HDAC8
24a (C4)
24b (C7)
24c (C8)
24d (C9)
SAHA
(1)
(4)
(5)
(6)
e
2940 330
435 35
287 53
309 74
22.8 0.3%
NI
NI
NI
23 6%
NI
z10,000
NI
38
2
144 23
232 19
% inhibition at 10
m
M are given if the IC50 was above 10
m
M.
5% CO2. Mouse anti-acetylated
a-Tubulin antibody was obtained
NI: No significant Inhibition (below 20% Inhibition at 10 mM concentration).

Q.H. Sodji et al. / European Journal of Medicinal Chemistry 96 (2015) 340e359
349
Table 5
Folate receptor-dependent anti-proliferative activity of folate- and pteroate-derived hydroxamates (IC50 in
mM).
R
n
KB
HeLa
A549
11a
11b
11c
11d
11e
11f
11g
15a
15b
15c
15d
1
2
3
4
5
6
7
1
4
5
6
NI
NI
NI
NI
NI
NT
NT
NT
NI
25 2%y
53.7 2.4
30.3 2.1
33 3%y
47 3%y
NT
NI
NI
NT
34 3%y
56.6 1.1
35 3%y
36 8%y
NT
NI
NI
NT
NI
NT
NT
NT
NT
NT
NT
SAHA
e
1.8 0.3
3.7 0.2
NT
NI: No inhibition (below 20% inhibition at 100
m
M); y: % inhibition at 100
m
M; NT: Not tested.
4.2. Histone deacetylase inhibition assay
the ratio of the former over the sum of both. Yields were plotted
with respect to inhibitor concentration and fitted to obtain IC50
values for each isoformeinhibitor pair.
The HDAC activity in presence of various compounds was
assessed by SAMDI mass spectrometry as described [54]. To obtain
IC50 values, we incubated isoform-optimized substrates (50
Isoform-optimized substrates were prepared by traditional
FMOC solid phase peptide synthesis (reagents supplied by Anaspec)
and purified by semi preparative HPLC on a reverse phase C18
column (Waters). The peptide of sequence GRKacFGC was prepared
for HDAC1 and HDAC8 experiments, while the peptide of sequence
GRKacYGC was prepared for HDAC6 experiments. Isoform prefer-
ence for the indicated substrates was determined by earlier studies
on peptide arrays [54].
HDAC1 and HDAC6 were purchased from BPS Biosciences. The
catalytic domain of HDAC8 was expressed as previously reported
[54]. Briefly, an amplicon was prepared by PCR with the following
primers: forward 50-30 TATTCTCGAGGACCACATGCTTCA and reverse
50-30 ATAAGCTAGCATGGAGGAGCCGGA. A pET21a construct bearing
the genetic insert between NheI and Xho1 restriction sites was
transformed into Escherichia coli BL21(DE3) (Lucigen) and
expressed by standard protocols. Following purification by affinity
chromatography, the His-tagged enzyme-containing fractions were
purified by FPLC (AKTA) on a superdex size exclusion column (GE),
spin concentrated, and stored at ꢀ80 ꢁC in HDAC buffer with 10%
glycerol.
mM,
detailed below) with enzyme (250 nM, detailed below) and in-
hibitor (at concentrations ranging from 10 nM to 1.0 mM), in HDAC
buffer (25.0 mM TriseHCl pH 8.0,140 mM NaCl, 3.0 mM KCl,1.0 mM
MgCl2, 0.1 mg/mL BSA) in 96-well microtiter plates (60 min, 37 ꢁC).
Solution-phase deacetylation reactions were quenched with tri-
chostatin A (TSA) and transferred to SAMDI plates to immobilize
the substrate components. SAMDI plates were composed of an
array of self-assembled monolayers (SAMs) presenting maleimide
in standard 384-well format for high-throughput handling capa-
bility. Following immobilization, plates were washed to remove
buffer constituents, enzyme, inhibitor, and any unbound substrate
and analyzed by MALDI mass spectrometry using automated pro-
tocols [55]. Deacetylation yields in each triplicate sample were
determined from the integrated peak intensities of the molecular
ions for the substrate and the deacetylated product ion by taking
4.3. Molecular docking analysis
The docking studies were performed as previously reported
with Autodock Vina through PyRx [56,57]. Following the 3D energy
minimization of the ligand by ChemBioDraw 3D, the docking was
run in a 25 Å cubic space surrounding the active site, the binding
pocket.
4.4. Cell viability assay
KB and HeLa cells were maintained in folate free-RPMI supple-
mented with 10% FBS and 1% pen/strep while A549 cells were
maintained in DMEM supplemented with 10% FBS and 1% pen/
strep. All cells were incubated on a 96-wells plate in folate free-
RPMI for 24 h prior to a 72 h drug treatment. Cell viability was
measured using the MTS assay according to manufacturer protocol.
The DMSO concentration in the cell media during the cell viability
experiment was maintained at 0.1%.
Fig. 8. Folic acid (FA) competition assay. Viability of KB cells treated with 25
in the absence and presence of FA. *p < 0.01 (Student's t-test).
mM of 11e

350
Q.H. Sodji et al. / European Journal of Medicinal Chemistry 96 (2015) 340e359
Fig. 9. Molecular docking of the FR (PDB code: 4LRH) against folic acid (green), Pteroate hydroxamate 7 (purple), 11d (pink) and 11e (blue). A) The pterin ring of pteroate
hydroxamate 7, 11d and 11e have a similar binding mode to the ligand binding pocket as folic acid. B) Stabilizing interactions between the FR and the pterin ring of Pteroate
hydroxamate 7, 11d and 11e are analogous to those reported for the interaction between the FR and folic acid [49]. (For interpretation of the references to color in this figure legend,
the reader is referred to the web version of this article.)
4.5. Western blot analysis for tubulin and histone H4 acetylation
for 2 h. The gel was transfer onto a nitrocellulose membrane and
probed for acetylated tubulin, tubulin, acetylated histone H4, his-
tone H4 and actin.
KB cells were plated for 24 h and treated with various concen-
trations of compounds for 4 h (tubulin acetylation) or 24 h (histone
H4 acetylation). Cells were washed with PBS buffer and resus-
pended in CelLytic™M buffer containing a cocktail of protease in-
hibitor (SigmaeAldrich, St. Louis, MO, USA). Following the protein
quantification using a Bradford protein assay, equal amount of
protein was loaded onto an SDS-page gel (Bio-Rad, Hercules, CA,
USA) and resolved by electrophoresis at a constant voltage of 100 V
4.6. Statistical analysis
The values reported as mean standard deviation from at least
2 independent triplicate experiments. A student's t-test was per-
formed in Excel, and results with p value less than 5% were
considered statistically different.
4.7. Synthesis of compounds
4.7.1. Trifluoromethanesulfonyl azide (TfN3)
The title compound was synthesized according to previous
protocol [58]. Briefly, NaN3 (1.36 g, 20.86 mmol) was dissolved in
DCM (7.5 mL) and H2O (4.5 mL) and cooled in an ice bath. Upon
addition of triflyl anhydride (0.71 mL, 4.17 mmol) dropwise, the
reaction was stirred at room temperature for 2 h. The DCM layer
was removed using a separatory funnel and the aqueous layer was
extracted with DCM (2 ꢂ 4 mL). The organic layers were combined
and washed with Na2CO3 and dried with Na2SO4. The crude product
Fig. 10. Western blot analysis of tubulin acetylation in KB cells. 1) Control; 2) SAHA
(2
mM); 3) SAHA (20
mM); 4) 11d (50
mM); 5) 11d (100 mM); 6) 11e (30 mM); 7) 11e
(100
m
M); 8) 7 (100
mM).

Q.H. Sodji et al. / European Journal of Medicinal Chemistry 96 (2015) 340e359
351
Fig. 11. Western blot analysis of Histone H4 acetylation in KB cell. 1) Control; 2) SAHA (2
7 (100 M); 9) Tubastatin A (14 M).
mM); 3) SAHA (20
mM); 4) 11d (50
mM); 5) 11d (100
mM); 6) 11e (30
mM); 7) 11e (100
mM); 8)
m
m
was used without further purification.
and dried with Na2SO4. Following the evaporation of the organic
layer, the crude product was dissolved in EtOAc and addition of
Hexanes resulted in the precipitation of the product 2 as a white
4.7.2. (S)-4-Azido-5-(tert-butoxy)-5-oxopentanoic acid (1)
solid (0.69 g, 66% yield). 1H NMR (400 MHz, CDCl3)
d
7.61e7.28 (m,
15H), 3.66e3.49 (m, 1H), 2.06e1.91 (m, 1H), 1.80e1.66 (m, 2H),
1.62e1.55 (m, 1H), 1.46 (s, 9H). 13C NMR (101 MHz, cdcl3)
175.8,
L-Glutamic acid a-tert-butyl ester (0.5 g, 2.09 mmol), K2CO3
(0.43 g, 3.13 mmol), and CuSO4.5H2O (0.0050 g, 0.021 mmol) were
dissolved in MeOH (18 mL) and H2O (9 mL). The previously syn-
thesized TfN3 in DCM was added and the mixture was stirred
overnight at room temperature. The organic solvents were evapo-
rated off and the aqueous layer was acidified to pH 2 with a 2 M HCl
solution and extracted with DCM (4 ꢂ 20 mL). The DCM extracts
were combined, washed with brine and dried with Na2SO4. Evap-
oration of the DCM resulted in 1 (0.52 g, quantitative yield). 1H NMR
d
169.2, 141.8, 141.0, 129.1, 128.2, 93.6, 82.8, 61.6, 28.0, 27.4, 25.3.
4.7.4. (S)-Tert-butyl 2-amino-5-oxo-5-((trityloxy)amino)
pentanoate (3): representative procedure for azide reduction to
amine using Zn and NH4Cl
To a solution of 2 (0.25 g, 0.51 mmol) in EtOH (3 mL) and H2O
(1 mL), NH4Cl (0.066 g, 1.23 mmol) and zinc powder (0.047 g) were
added and the resulting mixture was stirred under reflux for 2 h.
After completion of the reaction, the mixture was filtered through a
cilite pad. Following the removal of the solvent, the crude product
was purified by preparative TLC with DCM:MeOH (20:1) yielding 3
(400 MHz, CDCl3)
d
3.85 (dd, J ¼ 8.7, 5.2 Hz, 1H), 2.47 (t, J ¼ 6.8 Hz,
2H), 2.17e2.04 (m,1H), 2.01e1.88 (m,1H),1.47 (d, J ¼ 1.5 Hz, 9H). 13
C
NMR (101 MHz, CDCl3)
d 178.6, 169.0, 83.4, 61.4, 29.9, 27.9, 26.1.
4.7.3. (S)-Tert-butyl 2-azido-5-oxo-5-((trityloxy)amino)pentanoate
(2): representative procedure for amide bond formation through a
mixed anhydride intermediate
(0.15 g, 61% yield). 1H NMR (400 MHz, CDCl3)
3.12e3.01 (m, 1H), 2.17e1.98 (m, 1H), 1.96e1.83 (m, 1H), 1.81e1.56
(m, 2H), 1.41 (s, 9H). 13C NMR (101 MHz, CDCl3)
177.8, 171.1, 142.2,
d 7.55e7.18 (m, 15H),
d
A THF solution of 1 (0.49 g, 2.15 mmol) and N-methylmorpho-
line (0.22 g, 2.15 mmol) was cooled to ꢀ15 ꢁC and stirred for 5 min.
Isobutylchloroformate (0.29 g, 2.15 mmol) was added and the
mixture stirred at ꢀ15 ꢁC for 10 min. O-Tritylhydroxylamine (1.19 g,
4.30 mmol) and N-methylmorpholine (0.44 g, 4.30 mmol) were
added and the reaction was stirred at ꢀ15 ꢁC for 15 min and at room
temperature for 2 h. Upon reaction completion, DCM (100 mL) was
added and the mixture was washed with approx. 50 mL of H2O,
50 mL of NaHCO3 (1ꢂ), 50 mL of 1 M HCl (1ꢂ), 50 mL of brine (1ꢂ)
141.0, 129.0, 127.8, 82.3, 81.4, 56.0, 29.3, 28.0, 24.9.
4.7.5. Tert-butyl2-(4-(((2-amino-4-oxo-3,4-dihydropteridin-6-yl)
methyl)amino)benzamido)-5-oxo-5-((trityloxy)amino)pentanoate
(5): representative procedure for amide bond formation from acyl
azide and amine
Pteroyl azide (0.13 g, 0.40 mmol) and 3 (0.14 g, 0.30 mmol) were
dissolved in DMSO. Upon addition of tetramethylguanidine (0.07 g,
Fig. 12. Molecular docking of the FR (PDB code: 4LRH) with folic acid (pink), 24b (gold) and 24c (green) showing similar binding mode between their pterin moiety and FR binding
pocket. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

352
Q.H. Sodji et al. / European Journal of Medicinal Chemistry 96 (2015) 340e359
0.61 mmol), the reaction was stirred overnight at room tempera-
ture. Dropwise addition of acetonitrile resulted in a yellow pre-
cipitate which was collected by centrifugation and washed by Et2O.
The crude product was purified by preparative TLC with Et2O:N-
H4OH:Isopropanol:EtOH (2:1:1:1) to yield a yellow powder 5
93.2, 38.9, 31.5, 30.2, 26.3.
4.7.7.3. 6-Amino-N-(trityloxy)hexanamide
(9c). Compound 8c
(0.5 g, 1.21 mmol) was reacted with PPh3 (0.76 g, 1.9 mmol) in THF
as described for the synthesis of 9a to give 9c (0.34 g, 72% yield). 1H
(0.048 g, 21%). 1H NMR (400 MHz, DMSO-d6)
d
8.62 (s, 1H), 7.59 (d,
NMR (500 MHz, CDCl3)
1.95e1.82 (m, 1H), 1.69e1.53 (m, 1H), 1.49e0.96 (m, 6H). 13C NMR
(126 MHz, CDCl3) 177.0,141.9,140.9,128.9,128.0,127.8,127.5, 93.2,
d
7.64e7.21 (m, 15H), 2.61 (t, J ¼ 6.2 Hz, 2H),
J ¼ 8.4 Hz, 2H), 7.29 (s, 15H), 6.60 (d, J ¼ 7.5 Hz, 2H), 4.47 (s, 2H),
4.20e3.87 (m, 1H), 1.98e1.77 (m, 2H), 1.74e1.49 (m, 2H), 1.34 (s,
d
9H). 13C NMR (101 MHz, DMSO-d6)
d
171.8, 166.8, 154.3, 151.2, 149.0,
50.1, 41.5, 32.7, 31, 26.1, 24.6, 23.
142.8, 129.4, 128.4, 128.0, 121.7, 111.6, 92.3, 80.7, 56.3, 53.2, 46.3,
28.1.
4.7.7.4. 7-Amino-N-(trityloxy)heptanamide (9d). Compound 8d
(1.5 g, 3.5 mmol) was reacted with PPh3 (2.2 g, 8.4 mmol) in THF as
described for the synthesis of 9a to give 9d (1.25 g, 89% yield). 1H
4.7.6. 2-(4-(((2-Amino-4-oxo-3,4-dihydropteridin-6-yl)methyl)
amino)benzamido)-5-(hydroxyamino)-5-oxopentanoic acid (6):
representative procedure for protecting groups removal
NMR (400 MHz, DMSO-d6)
d
7.30 (s, 15H), 2.43 (t, J ¼ 6.8 Hz, 2H),
1.75 (t, J ¼ 7.0 Hz, 2H), 1.27e1.02 (m, 6H), 0.98e0.87 (m, 2H). 13
C
Compound 5 (0.046 g, 0.061 mmol) was dissolved in neat TFA
(2 mL) containing TIPS (0.5 mL) and stirred at room temperature for
2 h. The slurry residue obtained upon the TFA evaporation was
added to acetonitrile dropwise resulting in a precipitate which was
collected by centrifugation. The precipitate was washed with Et2O
(4 ꢂ 40 mL) and dried yielding a yellow powder 6 (0.028 g, quan-
NMR (101 MHz, DMSO-d6) d 170.7, 142.9, 129.4, 127.9, 127.8, 92.1,
41.9, 33.3, 32.4, 28.7, 26.5, 25.3.
4.7.7.5. 8-Amino-N-(trityloxy)octanamide
(9e). Compound
8e
(1.5 g, 3.39 mmol) was reacted with PPh3 (2.13 g, 8.13 mmol) in THF
as described for the synthesis of 9a to give 9e (1.16 g, 82% yield). 1H
titative yield). 1H NMR (400 MHz, DMSO-d6)
d
8.67 (s, 1H), 7.60 (d,
NMR (400 MHz, DMSO-d6)
2H), 1.75 (t, J ¼ 7.2 Hz, 2H), 1.32e1.21 (m, 2H), 1.20e1.01 (m, 6H),
0.99e0.88 (m, 2H). 13C NMR (101 MHz, DMSO-d6)
170.6, 143.0,
129.4, 128, 127.8, 92.1, 55.4, 42.0, 33.6, 29.1, 28.8, 26.7, 25.2.
d
7.38e7.15 (m, 15H), 2.46 (t, J ¼ 5.3 Hz,
J ¼ 8.6 Hz, 2H), 6.61 (d, J ¼ 8.5 Hz, 2H), 4.51 (s, 2H), 4.27e4.17 (m,
1H), 2.12e1.96 (m, 3H), 1.95e1.83 (m, 1H). 13C NMR (126 MHz,
d
DMSO-d6) d 174.2, 174.0, 168.9, 166.7, 151.1, 148.9, 129.3, 128.2, 121.6,
111.5, 52.4, 30.7, 29.3. HRMS (ESI) calcd for C19H21N8O6 [MþH]þ
457.1579 found 457.1567.
4.7.7.6. 9-Amino-N-(trityloxy)nonanamide
(9f). Compound
8f
(0.98 g, 2.15 mmol) was reacted with PPh3 (1.35 g, 5.15 mmol) in
4.7.7. 4-(((2-Amino-4-oxo-3,4-dihydropteridin-6-yl)methyl)
amino)-N-hydroxybenzamide (7)
THF as described for the synthesis of 9a to give 9f (0.8 g, 86% yield).
1H NMR (400 MHz, CDCl3)
d
7.56e7.21 (m, 15H), 2.65 (t, J ¼ 7.0 Hz,
2H), 1.65e1.50 (m, 2H), 1.48e1.36 (m, 2H), 1.31e0.98 (m, 10H). 13
NMR (101 MHz, CDCl3) 177.4, 141.1, 129.0, 128.1, 128.1, 105.0, 93.3,
53.4, 42.0, 33.5, 29.2, 29.0, 26.8, 23.5.
An intermediate in the synthesis of pteroyl azide, N10-(tri-
fluoroacetyl)pyrofolic acid (0.25 g), was dissolved in DMSO (6 mL)
followed by the addition of a 50% aqueous hydroxylamine solution
(0.15 mL). After stirring at room temperature for 5 h, the reaction
was added dropwise to acetonitrile. The yellow precipitate thus
obtained was collected by centrifugation and washed with Et2O
(4 ꢂ 40 mL), MeOH (2 ꢂ 30 mL) and dried. Multiple rounds of
DMSO dissolution and precipitation were conducted to obtain the
desired purity of 7, a dark yellow precipitate (0.050 g, 32% yield). 1H
C
d
4.7.7.7. 10-Amino-N-(trityloxy)decanamide (9g). Compound 8g
(1.5 g, 3.19 mmol) was reacted with PPh3 (2.0 g, 7.65 mmol) in THF
as described for the synthesis of 9a to give 9g (1.22 g, 86% yield). 1H
NMR (400 MHz, CDCl3)
2.01e1.70 (m, 2H), 1.57e1.47 (m, 2H), 1.33e0.93 (m, 12H). 13C NMR
(101 MHz, CDCl3) 177.4, 141.1, 129.0, 128.8, 128.1, 127.8, 105.0, 93.3,
d
7.63e7.13 (m, 15H), 2.71 (t, J ¼ 6.8 Hz, 2H),
NMR (400 MHz, DMSO-d6)
d
8.62 (s, 1H), 7.49 (d, J ¼ 8.7 Hz, 2H),
d
6.59 (d, J ¼ 8.8 Hz, 2H), 4.44 (d, J ¼ 6.2 Hz, 2H). 13C NMR (126 MHz,
41.2, 31.2, 30.9, 29.2, 29.1, 26.7, 23.4.
DMSO-d6) d 167.7, 165.1, 154.1, 152.2, 150.9, 148.9, 131.4, 128.6, 128.2,
120.3, 118.4, 111.6, 46.2. HRMS (ESI) calcd for C14H14N7O3 [MþH]þ
4.7.7.8. 4-(((2-Amino-4-oxo-3,4-dihydropteridin-6-yl)methyl)
328.1153 found 328.1160.
amino)-N-(4-oxo-4-((trityloxy)amino)butyl)benzamide
(10a).
Compound 9a (0.2 g, 0.55 mmol) was coupled to pteroyl azide
(0.24 g, 0.72 mmol) in the presence of TMG (0.13 g, 1.11 mmol) in
DMSO as described for the synthesis of 5 to yield 10a (0.11 g, 31%
4.7.7.1. 4-Amino-N-(trityloxy)butanamide (9a): representative pro-
cedure of azide reduction with PPh3. Trityl protected hydroxamate
azide 8a (1.5 g, 3.88 mmol) and PPh3 (2.44 g, 9.32 mmol) were
dissolved in anhydrous THF (6 mL) and stirred at room temperature
under inert atmosphere overnight. H2O was then added and the
reaction allowed to proceed at room temperature for 2 h. DCM was
added to the reaction and washed with H2O (3 ꢂ 50 mL), brine
(50 mL) and dried with Na2SO4. The crude product was purified by
column chromatography eluted with DCM:MeOH:NH4OH
(10:1:0.1) to yield 9a (0.91 g, 65% yield). 1H NMR (400 MHz, DMSO-
yield). 1H NMR (400 MHz, DMSO-d6)
d 8.62 (s, 1H), 7.54 (d,
J ¼ 8.5 Hz, 2H), 7.29 (s, 15H), 6.59 (d, J ¼ 8.6 Hz, 2H), 4.45 (d,
J ¼ 5.8 Hz, 2H), 2.98 (dd, J ¼ 12.5, 7.1 Hz, 2H), 1.77 (t, J ¼ 7.5 Hz, 2H),
1.39 (t, J ¼ 8.1 Hz, 2H). 13C NMR (101 MHz, DMSO-d6)
d 166.6, 161.8,
154.4, 150.9, 149.0, 142.8, 129.3, 129.1, 128.0, 127.9, 111.7, 92.2, 65.4,
56.5, 46.3, 18.9, 15.6.
4.7.7.9. 4-(((2-Amino-4-oxo-3,4-dihydropteridin-6-yl)methyl)
d6)
d
7.29 (dd, J ¼ 13.7, 4.6 Hz, 15H), 2.29 (t, J ¼ 6.4 Hz, 2H), 1.81 (t,
amino)-N-(4-(hydroxyamino)-4-oxobutyl)benzamide
(10b).
J ¼ 7.0 Hz, 2H),1.36e1.22 (m, 2H). 13C NMR (101 MHz, CDCl3)
d
174.7,
Compound 9b (0.2 g, 0.53 mmol) was coupled to pteroyl azide
(0.23 g, 0.69 mmol) in the presence of TMG (0.12 g, 1.07 mmol) in
DMSO as described for the synthesis of 5 to yield 10b (0.12 g, 33%
146.0, 144.9, 133.0, 132.0, 131.6, 131.5, 96.9, 44.2, 34.0, 31.4.
4.7.7.2. 5-Amino-N-(trityloxy)pentanamide (9b). Compound 8b
(1.5 g, 3.75 mmol) was reacted with PPh3 (2.36 g, 8.99 mmol) in THF
as described for the synthesis of 9a to give 9b (0.8 g, 57% yield). 1H
NMR (400 MHz, DMSO-d6)
J ¼ 7.0 Hz, 2H), 1.74 (t, J ¼ 7.3 Hz, 2H), 1.26e1.15 (m, 2H), 1.09e1.00
(m, 2H). 13C NMR (101 MHz, CDCl3)
141.8,140.8,129.0,128.2,127.8,
yield). 1H NMR (400 MHz, DMSO-d6)
d 8.62 (s, 1H), 7.57 (d,
J ¼ 8.0 Hz, 2H), 7.29 (s, 14H), 6.60 (d, J ¼ 8.0 Hz, 2H), 4.45 (d,
J ¼ 5.9 Hz, 2H), 3.09e2.93 (m, 2H), 1.90e1.69 (m, 2H), 1.30e1.02 (m,
d
7.28 (dd, J ¼ 10.3, 3.6 Hz, 15H), 2.35 (t,
4H). 13C NMR (101 MHz, DMSO-d6)
d 166.4, 154.3, 150.9, 149.0,
142.9, 129.4, 129.0, 128.4, 127.9, 127.8, 122.6, 111.6, 92.1, 46.4, 29.1,
22.8.
d

Q.H. Sodji et al. / European Journal of Medicinal Chemistry 96 (2015) 340e359
353
4.7.7.10. 4-(((2-Amino-4-oxo-3,4-dihydropteridin-6-yl)methyl)
amino)-N-(6-oxo-6-((trityloxy)amino)hexyl)benzamide (10c).
The desired product 11a (0.05 g, 81% yield) was obtained as
described for the synthesis of 6. 1H NMR (500 MHz, DMSO-d6)
Compound 9c (0.2 g, 0.52 mmol) was coupled to pteroyl azide
(0.26 g, 0.77 mmol) in the presence of TMG (0.12 g, 1.03 mmol) in
DMSO as described for the synthesis of 5 to yield 10c (0.10 g, 29%
d
8.65 (s, 1H), 7.61 (d, J ¼ 8.0 Hz, 2H), 6.63 (d, J ¼ 8.0 Hz, 2H), 4.48 (d,
J ¼ 5.3 Hz, 2H), 3.24e3.13 (m, 2H), 1.98 (t, J ¼ 7.2 Hz, 2H), 1.81e1.59
(m, 2H). 13C NMR (126 MHz, DMSO-d6)
174.42, 169.2, 166.4, 161.1,
d
yield). 1H NMR (400 MHz, DMSO-d6)
d
8.62 (s, 1H), 7.57 (d,
156.9, 154.0, 150.8, 149.0, 128.9, 128.2, 122.3, 111.5, 46.2, 33.0, 30.3,
25.8, 25.6. HRMS (ESI) calcd for C18H21N8O4 [MþH]þ 413.1680
found 413.1692.
J ¼ 8.3 Hz, 2H), 7.30 (s, 14H), 6.59 (d, J ¼ 8.1 Hz, 2H), 4.45 (d,
J ¼ 5.7 Hz, 2H), 3.07 (dd, J ¼ 11.6, 6.0 Hz, 2H), 1.74 (t, J ¼ 11.6 Hz, 2H),
1.38e1.11 (m, 4H),1.04e0.88 (m, 2H). 13C NMR (101 MHz, DMSO-d6)
d
166.4, 154.3, 150.9, 149.0, 142.9, 129.4, 129.0, 127.9, 122.6, 111.6,
4.7.7.16. 4-(((2-Amino-4-oxo-3,4-dihydropteridin-6-yl)methyl)
105.0, 92.2, 46.4, 32.4, 29.5, 26.4, 25.0.
amino)-N-(5-(hydroxyamino)-5-oxopentyl)benzamide
(11b).
Compound 10b (0.054 g, 0.081 mmol) was dissolved in neat TFA
(2 mL) and TIPS (0.5 mL) and stirred at room temperature for 2 h.
The desired product 11b (0.025 g, 72% yield) was obtained as
described for the synthesis of 6. 1H NMR (400 MHz, DMSO-d6)
4.7.7.11. 4-(((2-Amino-4-oxo-3,4-dihydropteridin-6-yl)methyl)
amino)-N-(7-oxo-7-((trityloxy)amino)heptyl)benzamide
(10d).
Compound 9d (0.2 g, 0.5 mmol) was coupled to pteroyl azide
(0.22 g, 0.65 mmol) in the presence of TMG (0.11 g, 0.99 mmol) in
DMSO as described for the synthesis of 5 to yield 10d (0.14 g, 41%
d
8.61 (s, 1H), 7.57 (d, J ¼ 7.4 Hz, 2H), 6.59 (d, J ¼ 7.4 Hz, 2H), 4.43 (s,
2H), 3.20e3.04 (m, 2H), 1.92 (t, J ¼ 6.3 Hz, 2H), 1.56e1.30 (m, 4H).
13C NMR (126 MHz, DMSO-d6)
169.3, 166.3, 154.0, 150.7, 148.9,
yield). 1H NMR (400 MHz, DMSO-d6)
d
8.61 (s, 1H), 7.56 (d,
d
J ¼ 8.1 Hz, 2H), 7.29 (s, 16H), 6.58 (d, J ¼ 8.8 Hz, 2H), 4.44 (d,
J ¼ 5.2 Hz, 2H), 3.13e3.03 (m, 2H), 1.80e1.68 (m, 2H), 1.41e1.28 (m,
2H), 1.20e1.04 (m, 4H), 1.00e0.87 (m, 2H). 13C NMR (101 MHz,
128.9, 128.2, 122.4, 111.5, 46.2, 32.3, 29.3, 23.0. HRMS (ESI) calcd for
C
19H23N8O4 [MþH]þ 427.1837 found 427.1845.
DMSO-d6)
d
172.7, 166.4, 154.3, 150.9, 149.9, 149.0, 129.4, 129.0,
4.7.7.17. 4-(((2-Amino-4-oxo-3,4-dihydropteridin-6-yl)methyl)
amino)-N-(6-(hydroxyamino)-6-oxohexyl)benzamide (11c).
127.9, 127.8, 122.6, 111.6, 92.1, 55.4, 29.6, 26.6.
Compound 10c (0.081 g, 0.12 mmol) was dissolved in neat TFA
(2 mL) and TIPS (0.5 mL) and stirred at room temperature for 2 h.
The desired product 11c (0.048 g, 92% yield) was obtained as
described for the synthesis of 6. 1H NMR (400 MHz, DMSO-d6)
4.7.7.12. 4-(((2-Amino-4-oxo-3,4-dihydropteridin-6-yl)methyl)
amino)-N-(8-oxo-8-((trityloxy)amino)octyl)benzamide
(10e).
Compound 9e (0.2 g, 0.48 mmol) was coupled to pteroyl azide
(0.21 g, 0.62 mmol) in the presence of TMG (0.11 g, 0.96 mmol) in
DMSO as described for the synthesis of 5 to yield 10e (0.15 g, 45%
d
8.62 (s, 1H), 7.57 (d, J ¼ 7.0 Hz, 2H), 6.59 (d, J ¼ 7.2 Hz, 2H), 4.44 (s,
2H), 3.15e3.05 (m, 2H), 1.90 (t, J ¼ 7.2 Hz, 2H), 1.54e1.33 (m, 4H),
1.33e1.12 (m, 2H). 13C NMR (126 MHz, DMSO-d6)
169.4, 166.2,
yield). 1H NMR (400 MHz, DMSO-d6)
d
8.61 (s, 1H), 7.57 (d,
d
J ¼ 8.5 Hz, 2H), 7.29 (s, 15H), 6.59 (d, J ¼ 8.5 Hz, 2H), 4.44 (d,
J ¼ 5.9 Hz, 2H), 3.13 (d, J ¼ 6.0 Hz, 2H), 1.73 (t, J ¼ 7.5 Hz, 2H),
1.44e1.32 (m, 2H), 1.24e1.08 (m, 6H), 0.97e0.87 (m, 2H). 13C NMR
161.2, 154.0, 150.7, 148.9, 128.9, 128.2, 122.5, 111.5, 46.2, 32.5, 29.4,
26.4, 25.2. HRMS (ESI) calcd for C20H25N8O4 [MþH]þ 441.1993
found 441.1977.
(101 MHz, DMSO-d6) d 166.4, 154.3, 150.9, 149.0, 142.9, 129.4, 129.0,
127.9, 122.6, 111.6, 92.1, 65.4, 46.4, 29.8, 28.9, 26.8, 25.2, 15.6.
4.7.7.18. 4-(((2-Amino-4-oxo-3,4-dihydropteridin-6-yl)methyl)
amino)-N-(7-(hydroxyamino)-7-oxoheptyl)benzamide
(11d).
4.7.7.13. 4-(((2-Amino-4-oxo-3,4-dihydropteridin-6-yl)methyl)
Compound 10d (0.12 g, 0.17 mmol) was dissolved in neat TFA (2 mL)
and TIPS (0.5 mL) and stirred at room temperature for 2 h. The
desired product 11d (0.066 g, 85% yield) was obtained as described
amino)-N-(9-oxo-9-((trityloxy)amino)nonyl)benzamide
(10f).
Compound 9f (0.2 g, 0.46 mmol) was coupled to pteroyl azide
(0.20 g, 0.60 mmol) in the presence of TMG (0.11 g, 0.93 mmol) in
DMSO as described for the synthesis of 5 to yield 10f (0.088 g, 26%
for the synthesis of 6. 1H NMR (500 MHz, DMSO-d6)
d 8.65 (s, 1H),
7.60 (d, J ¼ 8.5 Hz, 2H), 6.62 (d, J ¼ 8.6 Hz, 2H), 4.48 (d, J ¼ 5.8 Hz,
2H), 3.17 (dd, J ¼ 12.7, 6.4 Hz, 2H), 1.93 (t, J ¼ 7.3 Hz, 2H), 1.53e1.40
(m, 4H), 1.26 (d, J ¼ 2.8 Hz, 4H). 13C NMR (126 MHz, DMSO-d6)
yield). 1H NMR (400 MHz, DMSO-d6)
d 8.62 (s, 1H), 7.58 (d,
J ¼ 8.6 Hz, 2H), 7.30 (s, 15H), 6.60 (d, J ¼ 8.7 Hz, 2H), 4.45 (d,
J ¼ 5.8 Hz, 2H), 3.19e3.10 (m, 2H), 1.74 (t, J ¼ 7.8 Hz, 2H), 1.42 (t,
J ¼ 8.5 Hz, 2H), 1.22e1.00 (m, 8H), 0.99e0.88 (m, 2H). 13C NMR
d
169.4, 166.3, 154.0, 150.7, 149.0, 128.9, 128.2, 122.5, 111.5, 46.2,
32.5, 29.5, 28.7, 26.5, 25.4. HRMS (ESI) calcd for C21H27N8O4
(101 MHz, DMSO-d6)
d
166.4, 154.3, 150.9, 149.0, 142.9, 129.4, 129.0,
[MþH]þ 455.2150 found 455.2137.
128.4, 127.9, 127.8, 122.6, 111.6, 106.0, 96.3, 46.4, 29.8, 29.1, 26.9.
4.7.7.19. 4-(((2-Amino-4-oxo-3,4-dihydropteridin-6-yl)methyl)
4.7.7.14. 4-(((2-Amino-4-oxo-3,4-dihydropteridin-6-yl)methyl)
amino)-N-(8-(hydroxyamino)-8-oxooctyl)benzamide
(11e).
amino)-N-(10-oxo-10-((trityloxy)amino)decyl)benzamide
(10g).
Compound 10e (0.13 g, 0.18 mmol) was dissolved in neat TFA (2 mL)
and TIPS (0.5 mL) and stirred at room temperature for 2 h. The
desired product 11e (0.082 g, 97% yield) was obtained as described
Compound 9g (0.2 g, 0.45 mmol) was coupled to pteroyl azide
(0.2 g, 0.59 mmol) in the presence of TMG (0.10 g, 0.89 mmol) in
DMSO as described for the synthesis of 5 to yield 10g (0.15 g, 45%
for the synthesis of 6. 1H NMR (500 MHz, DMSO-d6)
d 8.65 (s, 1H),
yield). 1H NMR (400 MHz, DMSO-d6)
d
8.62 (s, 1H), 7.57 (d,
7.60 (d, J ¼ 8.0 Hz, 2H), 6.62 (d, J ¼ 8.0 Hz, 2H), 4.48 (d, J ¼ 4.4 Hz,
J ¼ 8.8 Hz, 2H), 7.30 (s, 15H), 6.59 (d, J ¼ 8.8 Hz, 2H), 4.44 (d,
J ¼ 5.9 Hz, 2H), 3.14 (dd, J ¼ 12.8, 6.4 Hz, 2H), 1.74 (t, J ¼ 7.9 Hz, 2H),
1.48e1.35 (m, 2H), 1.26e1.04 (m, 10H), 0.98e0.87 (m, 2H). 13C NMR
(101 MHz, DMSO-d6) d 166.4, 154.3, 150.9, 149.0, 142.9, 129.4, 129.0,
127.9, 127.8, 122.7, 122.0, 111.6, 85.9, 46.4, 29.8, 29.3, 29.2, 29.1, 28.8,
28.7, 27.0.
2H), 3.21e3.12 (m, 2H), 1.92 (t, J ¼ 14.3 Hz, 2H), 1.55e1.39 (m, 4H),
1.33e1.16 (m, 6H). 13C NMR (126 MHz, DMSO-d6)
d 169.4, 166.3,
154.0, 150.7, 149.0, 128.9, 128.2, 122.5, 112.8, 111.5, 55.2, 46.2, 32.5,
29.6, 28.8, 28.8, 26.7, 25.4. HRMS (ESI) calcd for C22H29N8O4
[MþH]þ 469.2306 found 469.2290.
4.7.7.20. 4-(((2-Amino-4-oxo-3,4-dihydropteridin-6-yl)methyl)
4.7.7.15. 4-(((2-Amino-4-oxo-3,4-dihydropteridin-6-yl)methyl)
amino)-N-(9-(hydroxyamino)-9-oxononyl)benzamide
(11f).
amino)-N-(4-(hydroxyamino)-4-oxobutyl)benzamide
Compound 10a (0.099 g, 0.15 mmol) was dissolved in neat TFA
(2 mL) and TIPS (0.5 mL) and stirred at room temperature for 2 h.
(11a).
Compound 10f (0.053 g, 0.073 mmol) was dissolved in neat TFA
(2 mL) and TIPS (0.5 mL) and stirred at room temperature for 2 h.
The desired product 11f (0.024 g, 70% yield) was obtained as

354
Q.H. Sodji et al. / European Journal of Medicinal Chemistry 96 (2015) 340e359
described for the synthesis of 6. 1H NMR (400 MHz, DMSO-d6)
4.7.7.25. (S)-Tert-butyl
amino)nonyl)amino)pentanoate (12d). The
a-tert-butyl ester 1 (0.2 g, 0.87 mmol) was coupled to 9f (0.38 g,
0.87 mmol) in the presence of IBCF (0.12 g, 0.87 mmol) and NMM
(0.27 g, 2.62 mmol) as described for the synthesis of 2. Purification
of the crude product was done by prep TLC in EtOAc:Hexanes (1:1)
resulting in 12d (0.34 g, 60% yield). 1H NMR (500 MHz, CDCl3)
2-azido-5-oxo-5-((9-oxo-9-((trityloxy)
d
8.71 (s, 1H), 7.57 (d, J ¼ 6.4 Hz, 2H), 6.60 (d, J ¼ 8.0 Hz, 2H), 4.53 (s,
a
-azido -glutamic acid
L
2H), 3.14 (t, J ¼ 11.7 Hz, 2H), 1.89 (t, J ¼ 8.4 Hz, 2H), 1.52e1.34 (m,
4H), 1.29e1.06 (m, 10H). HRMS (ESI) calcd for C23H31N8O4 [MþH]þ
483.2463 found 483.2452.
4.7.7.21. 4-(((2-Amino-4-oxo-3,4-dihydropteridin-6-yl)methyl)
d
7.59e7.27 (m, 15H), 3.89 (ddd, J ¼ 42.9, 8.9, 4.8 Hz, 1H), 3.31e3.12
amino)-N-(10-(hydroxyamino)-10-oxodecyl)benzamide
(11g).
(m, 2H), 2.29 (t, J ¼ 7.1 Hz, 2H), 2.25e2.16 (m, 1H), 1.99 (dq, J ¼ 14.3,
7.0 Hz, 1H), 1.93e1.79 (m, 1H), 1.60 (t, J ¼ 20.4 Hz, 1H), 1.52 (s, 9H),
1.50e1.43 (m, 2H), 1.33e0.99 (m, 10H). 13C NMR (126 MHz, CDCl3)
Compound 10g (0.13 g, 0.17 mmol) was dissolved in neat TFA (2 mL)
and TIPS (0.5 mL) and stirred at room temperature for 2 h. The
desired product 11g (0.075 g, 89% yield) was obtained as described
d
171.0, 169.1, 140.9, 128.9, 128.0, 82.9, 61.6, 39.4, 32.0, 29.4, 28.7,
for the synthesis of 6. 1H NMR (400 MHz, DMSO-d6)
d 8.66 (s, 1H),
27.9, 26.9, 26.5.
7.56 (d, J ¼ 8.5 Hz, 2H), 6.58 (d, J ¼ 7.8 Hz, 2H), 4.48 (s, 2H),
3.21e3.05 (m, 2H), 1.89 (t, J ¼ 6.5 Hz, 2H), 1.54e1.37 (m, 4H), 1.21
(dd, J ¼ 14.9, 5.8 Hz, 10H). 13C NMR (126 MHz, DMSO-d6)
d
175.5,
4.7.7.26. (S)-Tert-butyl
2-amino-5-oxo-5-((4-oxo-4-((trityloxy)
167.2, 160.1, 152.8, 130.3, 128.8, 114.0, 66.5, 39.8, 33.8, 29.2, 28.9,
28.8, 28.7, 28.6, 26.5, 25.2, 24.6. HRMS (ESI) calcd for C26H25N8O3
[MþH]þ 497.2044 found 497.2060.
amino)butyl)amino)pentanoate (13a). To a solution of 12a (0.22 g,
0.39 mmol) in EtOH (6 mL) and H2O (2 mL), NH4Cl (0.094 g,
1.76 mmol) and zinc powder (0.12 g) were added and the resulting
mixture was stirred under reflux for 2 h. After completion of the
reaction, the mixture was filtered through a cilite pad. Following
the removal of the solvent, the crude product was purified by
preparative TLC with DCM:MeOH:NH4OH (10:1:0.1) yielding 13a
4.7.7.22. (S)-Tert-butyl
amino)butyl)amino)pentanoate (12a): representative protocol for
amide synthesis with EDCI. The -azido -glutamic acid -tert-butyl
2-azido-5-oxo-5-((4-oxo-4-((trityloxy)
a
L
a
(0.097 g, 46% yield). 1H NMR (400 MHz, CDCl3)
d 7.51e7.19 (m, 15H),
ester 1 (0.27 g, 1.17 mmol), EDCI (0.22 g, 1.17 mmol) and HOBT
(0.16 g, 1.17 mmol) were dissolved in DMF and stirred at room
temperature for 30 min. The O-trityl protected hydroxamate 9a
(0.3 g, 0.83 mmol) was added and the mixture allowed to stir
overnight at room temperature. DCM was added to the reaction and
then washed with H2O (3 ꢂ 50 mL), NaHCO3 (1 ꢂ 50 mL), brine
(1 ꢂ 50 mL) and dried with Na2SO4. The crude product was purified
by preparative TLC using EtOAc:Hexanes (1:1) to yield 12a (0.23 g,
3.24 (s,1H), 3.09e2.84 (m, 2H), 2.21 (t, J ¼ 7.4 Hz, 2H), 2.06e1.93 (m,
1H), 1.90e1.82 (m, 1H), 1.76e1.66 (m, 1H), 1.64e1.54 (m, 2H), 1.43 (s,
9H), 1.40e1.36 (m, 1H). 13C NMR (101 MHz, CDCl3)
d 176.9, 142.1,
140.9, 129.1, 128.1, 127.8, 127.6, 93.5, 81.2, 54.4, 39.2, 32.8, 30.4, 29.0,
28.0, 22.8.
4.7.7.27. (S)-Tert-butyl
2-amino-5-oxo-5-((7-oxo-7-((trityloxy)
45% yield). 1H NMR (400 MHz, CDCl3)
d
7.54e7.20 (m, 15H),
amino)heptyl)amino)pentanoate (13b). Compound 12b (0.28 g,
0.45 mmol) was reduced in the presence of NH4Cl (0.058 g,
1.08 mmol) and zinc powder (0.042 g) as described for 13a. Prep
TLC with DCM:MeOH:NH4OH (10:1:0.1) yielded 13b (0.25 g, 93%
3.87e3.70 (m,1H), 3.12e2.99 (m,1H), 2.96e2.85 (m,1H), 2.28e2.05
(m, 3H), 2.00e1.81 (m, 2H), 1.70e1.54 (m, 2H), 1.53e1.35 (m, 10H).
13C NMR (101 MHz, CDCl3)
d
169.2, 141.9, 140.9, 129.0, 128.2, 127.8,
93.6, 83.0, 61.8, 39.3, 32.1, 29.2, 28.0, 27.0, 22.5.
yield). 1H NMR (400 MHz, CDCl3)
d 7.52e7.10 (m, 15H), 3.59e3.40
(m, 1H), 3.21e3.01 (m, 2H), 2.43e2.24 (m, 2H), 2.21e2.06 (m, 1H),
1.96e1.77 (m, 2H),1.62e1.52 (m,1H),1.44 (s, 9H),1.40e1.34 (m, 3H),
d 177.3, 172.2, 142.0,
141.1, 129.0, 128.1, 127.9, 127.8, 127.7, 93.3, 82.2, 54.0, 39.4, 32.6, 31.1,
29.1, 28.6, 28.0, 26.5, 24.9, 23.2.
4.7.7.23. (S)-Tert-butyl
amino)heptyl)amino)pentanoate (12b). The a-azido L-glutamic acid
2-azido-5-oxo-5-((7-oxo-7-((trityloxy)
1.23e1.05 (m, 5H). 13C NMR (101 MHz, cdcl3)
a
-tert-butyl ester 1 (0.2 g, 0.87 mmol) was coupled to 9d (0.35 g,
0.87 mmol) in the presence of IBCF (0.12 g, 0.87 mmol) and NMM
(0.27 g, 2.62 mmol) as described for the synthesis of 2. Purification
of the crude product was done by prep TLC in EtOAc:Hexanes (1:1)
resulting in 12b (0.33 g, 61% yield). 1H NMR (400 MHz, CDCl3)
4.7.7.28. (S)-Tert-butyl
2-amino-5-oxo-5-((8-oxo-8-((trityloxy)
amino)octyl)amino)pentanoate (13c). Compound 12c (0.25 g,
0.39 mmol) was reduced in the presence of NH4Cl (0.05 g,
0.94 mmol) and zinc powder (0.036 g) as described for 13a. Prep
TLC with DCM:MeOH:NH4OH (10:1:0.1) yielded 13c (0.20 g, 85%
d
7.53e7.12 (m, 15H), 3.78 (dd, J ¼ 9.0, 4.8 Hz, 1H), 3.20e3.04 (m,
2H), 2.28e2.19 (m, 2H), 2.19e2.08 (m, 1H), 1.93 (dt, J ¼ 13.8, 10.5 Hz,
1H), 1.85e1.76 (m, 1H), 1.62e1.51 (m, 1H), 1.46 (s, 9H), 1.42e1.29 (m,
3H), 1.28e0.92 (m, 5H). 13C NMR (101 MHz, CDCl3)
d
177.3, 171.4,
yield). 1H NMR (400 MHz, CDCl3)
d 7.58e7.11 (m, 15H), 3.37e3.24
169.2, 141.9, 141.1, 129.0, 128.1, 127.8, 93.4, 83.0, 61.8, 39.4, 32.1, 31.1,
29.2, 28.6, 28.0, 27.1, 26.5, 23.2.
(m, 1H), 3.16 (dd, J ¼ 12.7, 6.4 Hz, 2H), 2.28 (t, J ¼ 7.4 Hz, 2H),
2.11e2.01 (m, 1H), 1.87e1.69 (m, 2H), 1.61e1.51 (m, 1H), 1.48e1.34
(m, 10H), 1.33e0.94 (m, 8H). 13C NMR (101 MHz, CDCl3)
d 177.3,
174.7, 172.3, 141.9, 141.1, 129.0, 128.1, 127.9, 93.3, 81.4, 54.3, 39.4,
33.0, 31.1, 30.3, 29.7, 29.4, 28.8, 28.0, 26.6, 23.2.
4.7.7.24. (S)-Tert-butyl
amino)octyl)amino)pentanoate (12c). The
-tert-butyl ester 1 (0.19 g, 0.83 mmol) was coupled to 9e (0.45 g,
2-azido-5-oxo-5-((8-oxo-8-((trityloxy)
a
-azido -glutamic acid
L
a
1.08 mmol) in the presence of IBCF (0.11 g, 0.83 mmol) and NMM
(0.25 g, 2.49 mmol) as described for the synthesis of 2. Purification
of the crude product was done by prep TLC in EtOAc:Hexanes (1:1)
4.7.7.29. (S)-Tert-butyl
2-amino-5-oxo-5-((9-oxo-9-((trityloxy)
amino)nonyl)amino)pentanoate (13d). Compound 12d (0.29 g,
0.45 mmol) was reduced in the presence of NH4Cl (0.057 g,
1.07 mmol) and zinc powder (0.041 g) as described for 13a. Prep
TLC with DCM:MeOH:NH4OH (10:1:0.1) yielded 13c (0.26 g, 92%
resulting in 12c (0.28 g, 54% yield). 1H NMR (500 MHz, CDCl3)
d 7.43
(d, J ¼ 65.5 Hz,15H), 3.85 (dd, J ¼ 8.9, 4.9 Hz,1H), 3.28e3.16 (m, 2H),
2.30 (t, J ¼ 7.2 Hz, 2H), 2.21 (dt, J ¼ 13.5, 7.0 Hz, 1H), 1.99 (dq,
J ¼ 14.2, 7.0 Hz, 1H), 1.92e1.82 (m, 1H), 1.66e1.56 (m, 1H), 1.52 (s,
9H), 1.49e1.42 (m, 2H), 1.31e0.99 (m, 8H). 13C NMR (126 MHz,
yield). 1H NMR (400 MHz, CDCl3)
d 7.51e7.15 (m, 15H), 3.51e3.40
(m, 1H), 3.23e3.10 (m, 2H), 2.39e2.26 (m, 2H), 2.20e2.06 (m, 1H),
1.98e1.77 (m, 2H), 1.64e1.36 (m, 12H), 1.33e0.85 (m, 10H). 13C NMR
CDCl3)
d
171.1, 169.1, 128.9, 128.0, 82.9, 61.6, 39.4, 32.0, 29.2, 28.6,
(101 MHz, CDCl3)
d 177.4, 172.3, 141.9, 141.1, 129.0, 128.1, 127.9, 93.3,
27.8, 26.9, 26.3.
82.0, 54.1, 39.5, 32.7, 31.2, 29.7, 29.4, 29.0, 28.8, 28.0, 26.7, 25.0, 23.3.

Q.H. Sodji et al. / European Journal of Medicinal Chemistry 96 (2015) 340e359
355
4.7.7.30. (S)-Tert-butyl 2-(4-(((2-amino-4-oxo-3,4-dihydropteridin-
6-yl)methyl)amino)benzamido)-5-oxo-5-((4-oxo-4-((trityloxy)
amino)butyl)amino)pentanoate (14a). Compound 13a (0.078 g,
0.14 mmol) was coupled to pteroyl azide (0.13 g, 0.29 mmol) in
presence of TMG (0.05 g, 0.43 mmol) in DMSO as described for 5 to
4.7.7.35. (S)-2-(4-(((2-Amino-4-oxo-3,4-dihydropteridin-6-yl)
methyl)amino)benzamido)-5-((7-(hydroxyamino)-7-oxoheptyl)
amino)-5-oxopentanoic acid (15b). Compound 14b (0.061 g,
0.069 mmol) was dissolved in neat TFA (2 mL) and TIPS (0.5 mL)
and the resulting mixture was stirred at room temperature for 2 h.
The desired product 15b (0.043 g, quantitative yield) was obtained
as described for the synthesis of 6. 1H NMR (500 MHz, DMSO-d6)
yield 14a (0.035 g, 29% yield). 1H NMR (500 MHz, DMSO-d6)
d 8.66
(s, 1H), 7.64 (d, J ¼ 8.3 Hz, 2H), 7.32 (s, 16H), 6.64 (d, J ¼ 8.4 Hz, 2H),
4.49 (d, J ¼ 5.8 Hz, 2H), 4.24e4.15 (m, 1H), 2.85e2.75 (m, 2H),
2.17e2.11 (m, 2H), 2.04e1.95 (m, 1H), 1.92e1.82 (m, 1H), 1.79e1.72
(m, 2H), 1.40 (s, 9H), 1.34e1.27 (m, 2H). HRMS (ESI) calcd for
d
8.67 (s, 1H), 7.66 (d, J ¼ 8.3 Hz, 2H), 6.65 (d, J ¼ 8.2 Hz, 2H), 4.51 (s,
2H), 4.35e4.20 (m, 1H), 3.00 (dd, J ¼ 12.1, 6.1 Hz, 2H), 2.22e2.14 (m,
2H), 2.11e2.01 (m, 1H), 1.97e1.85 (m, 3H), 1.52e1.41 (m, 2H),
1.39e1.30 (m, 2H),1.28e1.16 (m, 4H). 13C NMR (126 MHz, DMSO-d6)
C
46H50N9O7 [MþH]þ 840.3828 found 840.3828.
d
174.1, 171.6, 166.6,153.9,151.0, 148.8, 129.3,128.3,121.7, 111.5, 52.5,
4.7.7.31. (S)-Tert-butyl 2-(4-(((2-amino-4-oxo-3,4-dihydropteridin-
6-yl)methyl)amino)benzamido)-5-oxo-5-((7-oxo-7-((trityloxy)
amino)heptyl)amino)pentanoate (14b). Compound 13b (0.22 g,
0.38 mmol) was coupled to pteroyl azide (0.16 g, 0.49 mmol) in
presence of TMG (0.086 g, 0.75 mmol) in DMSO as described for 5 to
46.2, 38.8, 32.5, 32.3, 29.3, 28.6, 26.9, 26.4, 25.3. HRMS (ESI) calcd
for C26H34N9O7 [MþH]þ 584.2576 found 584.2568.
4.7.7.36. (S)-2-(4-(((2-Amino-4-oxo-3,4-dihydropteridin-6-yl)
methyl)amino)benzamido)-5-((8-(hydroxyamino)-8-oxooctyl)
amino)-5-oxopentanoic acid (15c). Compound 14c (0.07 g,
0.078 mmol) was dissolved in neat TFA (2 mL) and TIPS (0.5 mL)
and the resulting mixture was stirred at room temperature for 2 h.
The desired product 15c (0.058 g, quantitative yield) was obtained
as described for the synthesis of 6. 1H NMR (500 MHz, DMSO-d6)
yield 14b (0.08 g, 24% yield). 1H NMR (400 MHz, DMSO-d6)
d 8.62 (s,
1H), 7.62 (d, J ¼ 8.7 Hz, 2H), 7.30 (s, 19H), 6.61 (d, J ¼ 8.9 Hz, 2H),
4.46 (d, J ¼ 5.9 Hz, 2H), 4.24e4.13 (m, 1H), 2.97e2.88 (m, 2H),
2.18e2.10 (m, 2H), 2.02e1.93 (m, 1H), 1.92e1.82 (m, 1H), 1.74 (t,
J ¼ 7.7 Hz, 2H), 1.44e1.34 (m, 11H), 1.28e1.18 (m, 4H), 0.95e0.88 (m,
2H). HRMS (ESI) calcd for C49H56N9O7 [MþH]þ 882.4297 found
882.4295.
d
8.69 (s, 1H), 7.66 (d, J ¼ 8.8 Hz, 2H), 6.65 (d, J ¼ 8.8 Hz, 2H), 4.52 (s,
2H), 4.35e4.20 (m, 1H), 3.09e2.89 (m, 2H), 2.22e2.14 (m, 2H),
2.09e2.00 (m, 1H), 1.98e1.85 (m, 3H), 1.51e1.42 (m, 2H), 1.39e1.30
4.7.7.32. (S)-Tert-butyl 2-(4-(((2-amino-4-oxo-3,4-dihydropteridin-
6-yl)methyl)amino)benzamido)-5-oxo-5-((8-oxo-8-((trityloxy)
amino)octyl)amino)pentanoate (14c). Compound 13c (0.20 g,
0.34 mmol) was coupled to pteroyl azide (0.23 g, 0.50 mmol) in
presence of TMG (0.097 g, 0.84 mmol) in DMSO as described for 5 to
(m, 2H), 1.27e1.16 (m, 6H). 13C NMR (126 MHz, DMSO-d6)
d 174.1,
171.6, 169.4, 166.5, 160.8, 153.6, 151.0, 149.8, 148.7, 129.2, 128.2,
121.7, 111.5, 52.6, 46.1, 38.8, 32.5, 32.3, 29.3, 28.8, 28.7, 26.9, 26.6,
25.4. HRMS (ESI) calcd for C27H36N9O7 [MþH]þ 598.2732 found
598.2717.
yield 14c (0.070 g, 23% yield). 1H NMR (400 MHz, DMSO-d6)
d 8.62
(s, 1H), 7.62 (d, J ¼ 8.7 Hz, 2H), 7.30 (s, 15H), 6.61 (d, J ¼ 8.7 Hz, 2H),
4.46 (d, J ¼ 5.8 Hz, 2H), 4.22e4.14 (m, 1H), 3.01e2.91 (m, 2H), 2.15
(dd, J ¼ 13.8, 6.8 Hz, 2H), 2.02e1.93 (m, 1H), 1.92e1.81 (m, 1H), 1.74
(t, J ¼ 7.0 Hz, 2H), 1.36 (s, 9H), 1.32e1.24 (m, 2H), 1.17e1.04 (m, 6H),
0.94e0.81 (m, 2H). HRMS (ESI) calcd for C50H58N9O7 [MþH]þ
896.4454 found 896.4447.
4.7.7.37. (S)-2-(4-(((2-Amino-4-oxo-3,4-dihydropteridin-6-yl)
methyl)amino)benzamido)-5-((9-(hydroxyamino)-9-oxononyl)
amino)-5-oxopentanoic acid (15d). Compound 14d (0.065 g,
0.071 mmol) was dissolved in neat TFA (2 mL) and TIPS (2 mL) and
the resulting mixture was stirred at room temperature for 2 h. The
desired product 15d (0.037 g, 84% yield) was obtained as described
for the synthesis of 6. 1H NMR (500 MHz, DMSO-d6)
d 8.67 (s, 1H),
4.7.7.33. (S)-Tert-butyl 2-(4-(((2-amino-4-oxo-3,4-dihydropteridin-
6-yl)methyl)amino)benzamido)-5-oxo-5-((9-oxo-9-((trityloxy)
amino)nonyl)amino)pentanoate (14d). Compound 13d (0.25 g,
0.41 mmol) was coupled to pteroyl azide (0.21 g, 0.62 mmol) in
presence of TMG (0.095 g, 0.82 mmol) in DMSO as described for 5 to
7.66 (d, J ¼ 8.7 Hz, 2H), 6.65 (d, J ¼ 8.7 Hz, 2H), 4.51 (s, 2H),
4.34e4.20 (m,1H), 3.00 (dd, J ¼ 12.8, 6.7 Hz, 2H), 2.22e2.13 (m, 2H),
2.09e2.03 (m, 1H), 1.98e1.85 (m, 3H), 1.54e1.41 (m, 2H), 1.41e1.30
(m, 2H), 1.26e1.16 (m, 8H). 13C NMR (126 MHz, DMSO-d6)
d 174.1,
171.6, 169.4,166.5,161.1,155.6,153.9,151.0, 148.8,129.2,128.2,121.6,
111.5, 52.6, 46.2, 38.8, 32.5, 32.3, 29.4, 29.0, 28.9, 28.8, 26.9, 26.7,
25.4. HRMS (ESI) calcd for C28H38N9O7 [MþH]þ 612.2889 found
612.2881.
yield 14d (0.065 g, 17% yield). 1H NMR (400 MHz, DMSO-d6)
d 8.62
(s, 1H), 7.62 (d, J ¼ 8.4 Hz, 2H), 7.30 (s, 12H), 6.61 (d, J ¼ 8.5 Hz, 2H),
4.46 (d, J ¼ 5.1 Hz, 2H), 4.26e4.11 (m, 1H), 3.00e2.94 (m, 2H),
2.21e2.09 (m, 2H), 2.06e1.93 (m, 1H), 1.91e1.79 (m, 1H), 1.74 (t,
J ¼ 8.6 Hz, 2H), 1.37 (s, 8H), 1.33e1.26 (m, 2H), 1.17e1.03 (m, 8H),
0.97e0.84 (m, 2H). HRMS (ESI) calcd for C51H60N9O7 [MþH]þ
910.4610 found 910.4603.
4.7.7.38. Tert-butyl
(2-amino-4-(thiophen-2-yl)phenyl)carbamate
(17). Zinc powder (4.75 g) was added to a solution of 16 (6.65 g,
20.74 mmol) in dioxane (180 mL) and H2O (45 mL) and stirred
overnight at 70 ꢁC. Upon completion, EtOAc was added and the
4.7.7.34. (S)-2-(4-(((2-Amino-4-oxo-3,4-dihydropteridin-6-yl)
methyl)amino)benzamido)-5-((4-(hydroxyamino)-4-oxobutyl)
amino)-5-oxopentanoic acid (15a). Compound 14a (0.035 g,
0.042 mmol) was dissolved in neat TFA (2 mL) and TIPS (0.5 mL)
and the resulting mixture was stirred at room temperature for 2 h.
The desired product 15a (0.022 g, 96% yield) was obtained as
described for the synthesis of 6. 1H NMR (500 MHz, DMSO-d6)
mixture was washed with H2O (3
ꢂ
100 mL) and brine
(1 ꢂ 100 mL). The crude product was purified by column chroma-
tography, eluting with EtOAc:Hexanes (2:1), to obtain 17 (3.95 g,
54% yield). 1H NMR (400 MHz, CDCl3)
d
7.34e7.20 (m, 3H),
7.10e6.98 (m, 3H), 1.52 (s, 9H). 13C NMR (101 MHz, CDCl3)
153.7,
144.1, 139.9, 132.2, 127.9, 124.8, 124.4, 122.8, 117.5, 115.0, 80.7, 28.3.
d
d
8.67 (s, 1H), 7.67 (d, J ¼ 8.7 Hz, 2H), 6.65 (d, J ¼ 8.7 Hz, 2H), 4.51 (s,
4.7.7.39. Tert-butyl
(2-(4-azidobutanamido)-4-(thiophen-2-yl)
2H), 4.29 (t, J ¼ 10.8 Hz,1H), 3.01 (dt, J ¼ 13.2, 6.8 Hz, 2H), 2.22e2.13
phenyl)carbamate (19a). The azido carboxylic acid 18a (0.31 g,
2.41 mmol), EDCI (0.46 g, 2.41 mmol) and HOBT (0.33 g, 2.41 mmol)
were dissolved in DMF and the mixture was stirred at room tem-
perature for 30 min. Following the addition of 17 (0.5 g, 1.72 mmol),
the reaction was allowed to stir at 70 ꢁC for 6 h. Once the reaction
was completed, DCM was added and the mixture was washed with
(m, 2H), 2.11e2.02 (m, 1H), 1.98e1.85 (m, 3H), 1.64e1.52 (m, 2H).
13C NMR (126 MHz, DMSO-d6)
d 174.1, 171.7, 169.1, 166.6, 161.0,
153.8, 151.0, 149.4, 148.8, 129.3, 128.2, 121.6, 111.5, 52.4, 46.2, 38.4,
32.3, 30.2, 26.9, 25.6. HRMS (ESI) calcd for C23H28N9O7 [MþH]þ
542.2106 found 542.2097.

356
Q.H. Sodji et al. / European Journal of Medicinal Chemistry 96 (2015) 340e359
H2O (3 ꢂ 50 mL), NaHCO3 (1 ꢂ 50 mL), brine (1 ꢂ 50 mL) and dried
with Na2SO4. Solvent was evaporated off to give 19a (0.64 g, 92%
yield) which was used without further purification. 1H NMR
(400 MHz, CDCl3)
d
7.58 (s, 1H), 7.41 (d, J ¼ 8.4 Hz, 1H), 7.30 (d,
J ¼ 8.4 Hz, 1H), 7.17 (t, J ¼ 3.8 Hz, 2H), 7.02e6.89 (m, 1H), 2.70e2.48
(m, 2H), 2.27 (t, J ¼ 7.2 Hz, 2H), 1.67e1.53 (m, 2H), 1.45 (s, 9H), 1.36
(d, J ¼ 5.6 Hz, 2H), 1.29e1.15 (m, 4H). 13C NMR (101 MHz, CDCl3)
(400 MHz, CDCl3)
d 7.42e7.31 (m, 2H), 7.28e7.19 (m, 2H), 7.04 (dd,
J ¼ 5.1, 3.6 Hz, 1H), 6.98 (s, 1H), 3.34 (t, J ¼ 6.6 Hz, 2H), 2.42 (t,
d 172.9, 154.1, 143.3, 131.1, 130.5, 130.0, 128.0, 124.7, 124.5, 123.4,
J ¼ 7.2 Hz, 2H), 1.95 (p, J ¼ 6.9 Hz, 2H), 1.51 (s, 9H). 13C NMR
123.1, 122.5, 80.6, 41.7, 36.8, 32.7, 28.8, 28.3, 26.4, 25.5.
(101 MHz, CDCl3) d 171.3, 154.1, 143.1, 131.5, 130.1, 129.8, 128.1,124.9,
124.6, 123.7, 123.3, 122.6, 81.1, 50.7, 33.7, 28.3, 24.7.
4.7.7.45. Tert-butyl
(2-(8-aminooctanamido)-4-(thiophen-2-yl)
phenyl)carbamate (20c). Compound 19c (0.40 g, 0.87 mmol) was
reduced with NH4Cl (0.12 g, 2.19 mmol) and zinc (0.14 g) as
described for 20a resulting in 20c (0.32 g, 86% yield). 1H NMR
4.7.7.40. Tert-butyl
(2-(7-azidoheptanamido)-4-(thiophen-2-yl)
phenyl)carbamate (19b). The azido carboxylic acid 18b (0.41 g,
2.4 mmol) was coupled to 17 (0.5 g, 1.72 mmol) in the presence of
EDCI (0.46 g, 2.41 mmol) and HOBT (0.33 g, 2.41 mmol) as described
for 19a to give 19b (0.74 g, 98% yield) which was used without
(400 MHz, CDCl3)
d
7.55 (s, 1H), 7.38 (d, J ¼ 7.6 Hz, 1H), 7.26 (d,
J ¼ 3.4 Hz, 1H), 7.19e7.04 (m, 2H), 6.94 (s, 1H), 2.64e2.47 (m, 2H),
2.32e2.15 (m, 2H), 1.67e1.49 (m, 2H), 1.42 (s, 9H), 1.27e0.93 (m,
further purification. 1H NMR (400 MHz, CDCl3)
d
7.40 (d, J ¼ 8.4 Hz,
8H). 13C NMR (101 MHz, CDCl3)
d 173.0, 154.1, 143.2, 131.1, 130.5,
1H), 7.33 (dd, J ¼ 8.4, 1.9 Hz, 1H), 7.21 (ddd, J ¼ 12.5, 8.3, 4.9 Hz, 3H),
7.07e6.95 (m, 1H), 3.22 (t, J ¼ 6.9 Hz, 2H), 2.31 (t, J ¼ 7.5 Hz, 2H),
1.74e1.61 (m, 2H), 1.60e1.51 (m, 2H), 1.49 (s, 9H), 1.34 (t, J ¼ 9.5 Hz,
130.0, 128.0, 124.6, 123.4, 123.0, 122.4, 80.5, 41.7, 36.9, 32.7, 28.9,
28.3, 26.5, 25.5.
4H). 13C NMR (101 MHz, CDCl3)
d 172.6, 154.1, 143.2, 131.3, 130.3,
129.9, 128.0, 124.7, 124.6, 123.5, 123.2, 122.5, 80.8, 51.3, 36.9, 28.7,
28.3, 26.4, 25.4.
4.7.7.46. Tert-butyl
(2-(9-aminononanamido)-4-(thiophen-2-yl)
phenyl)carbamate (20d). Compound 19d (0.45 g, 0.95 mmol) was
reduced with NH4Cl (0.13 g, 2.39 mmol) and zinc (0.16 g) as
described for 20a resulting in 20d (0.34 g, 79% yield). 1H NMR
4.7.7.41. Tert-butyl
(2-(8-azidooctanamido)-4-(thiophen-2-yl)
phenyl)carbamate (19c). The azido carboxylic acid 18c (0.45 g,
2.4 mmol) was coupled to 17 (0.5 g, 1.72 mmol) in the presence of
EDCI (0.46 g, 2.41 mmol) and HOBT (0.33 g, 2.41 mmol) as described
for 19a to give 19c (0.56 g, 72% yield) which was used without
(400 MHz, CDCl3)
d
7.60 (s, 1H), 7.38 (d, J ¼ 8.4 Hz, 1H), 7.30 (d,
J ¼ 8.2 Hz, 1H), 7.19 (d, J ¼ 5.7 Hz, 2H), 7.04e6.91 (m, 1H), 2.63 (t,
J ¼ 8.7 Hz, 2H), 2.30 (t, J ¼ 7.2 Hz, 2H),1.73e1.56 (m, 2H),1.46 (s, 9H),
1.41 (s, 2H), 1.24 (s, 8H). 13C NMR (101 MHz, CDCl3)
d 172.9, 154.2,
further purification. 1H NMR (500 MHz, CDCl3)
d
7.45e7.34 (m, 2H),
143.3, 131.2, 130.4, 130.1, 128.0, 124.7, 124.6, 123.4, 123.1, 122.5, 80.6,
41.7, 37.0, 32.5, 29.1, 29.1, 29.0, 28.3, 26.7, 25.6.
7.30e7.23 (m, 2H), 7.06 (dd, J ¼ 8.9, 5.0 Hz, 2H), 3.27 (t, J ¼ 6.9 Hz,
2H), 2.36 (t, J ¼ 7.5 Hz, 2H), 1.76e1.66 (m, 2H), 1.65e1.56 (m, 2H),
1.53 (s, 9H), 1.42e1.31 (m, 6H). 13C NMR (126 MHz, CDCl3)
d 172.4,
4.7.7.47. (S)-Tert-butyl
amino)-5-(thiophen-2-yl)phenyl)amino)-4-oxobutyl)amino)-5-
oxopentanoate (21a). The -azido -glutamic acid -tert-butyl ester
2-azido-5-((4-((2-((tert-butoxycarbonyl)
154.0, 143.1, 131.4, 129.9, 127.9, 124.6, 124.5, 123.4, 123.1, 122.4, 80.8,
51.3, 36.9, 28.9, 28.7, 28.6, 28.1, 26.4, 25.3.
a
L
a
1 (0.13 g, 0.56 mmol), EDCI (0.11 g, 0.56 mmol) and HOBT (0.076 g,
0.56 mmol) were dissolved in DMF and stirred at room temperature
for 30 min. Compound 20a (0.15 g, 0.34 mmol) was added and the
mixture allowed to stir overnight at room temperature. DCM was
added to the reaction and then washed with H2O (3 ꢂ 50 mL),
NaHCO3 (1 ꢂ 50 mL), brine (1 ꢂ 50 mL) and dried with Na2SO4.
Solvent was evaporated off and the crude product was purified by
preparative TLC using DCM:MeOH:NH4OH (8.5:1.5:0.3) to yield 21a
4.7.7.42. Tert-butyl
(2-(9-azidononanamido)-4-(thiophen-2-yl)
phenyl)carbamate (19d). The azido carboxylic acid 18d (0.48 g,
2.41 mmol) was coupled to 17 (0.5 g, 1.72 mmol) in the presence of
EDCI (0.46 g, 2.41 mmol) and HOBT (0.33 g, 2.41 mmol) as described
for 19a. The crude product was purified by column chromatography
using DCM:Acetone (30:1) as eluent to obtain 19d (0.56 g, 70%
yield). 1H NMR (400 MHz, CDCl3)
d
7.29 (dt, J ¼ 8.4, 5.1 Hz, 2H), 7.16
(ddd, J ¼ 5.5, 4.4, 1.1 Hz, 2H), 7.02e6.91 (m, 2H), 3.18 (t, J ¼ 6.9 Hz,
2H), 2.27 (t, J ¼ 7.5 Hz, 2H), 1.67e1.57 (m, 2H), 1.55e1.48 (m, 2H),
(0.23 g, 98% yield). 1H NMR (400 MHz, CDCl3)
d 7.59e7.49 (m, 2H),
7.36 (dd, J ¼ 8.4, 1.7 Hz, 1H), 7.20 (t, J ¼ 3.7 Hz, 2H), 7.00 (dd, J ¼ 4.8,
3.8 Hz, 1H), 3.78 (dd, J ¼ 8.7, 4.8 Hz, 1H), 3.29e3.20 (m, 2H), 2.36 (t,
J ¼ 11.1 Hz, 2H), 2.25 (t, J ¼ 7.1 Hz, 2H), 2.18e2.04 (m, 1H), 2.00e1.89
(m, 1H), 1.86e1.75 (m, 2H), 1.47 (s, 9H), 1.45 (s, 9H). 13C NMR
1.43 (s, 8H), 1.33e1.18 (m, 8H). 13C NMR (101 MHz, CDCl3)
d 172.6,
154.1, 143.2, 131.5, 130.1, 128.0, 124.8, 124.7, 123.6, 123.2, 122.6, 80.9,
51.4, 37.1, 29.2, 29.1, 29.0, 28.8, 28.3, 26.7, 25.6.
(101 MHz, CDCl3)
128.0,124.7,124.4,123.6,123.1,122.3, 83.1, 80.7, 61.8, 38.7, 34.2, 32.1,
28.3, 28.0, 27.0, 25.9.
d 172.4, 169.2, 153.9, 143.2, 131.0, 130.5, 129.5,
4.7.7.43. Tert-butyl
(2-(4-aminobutanamido)-4-(thiophen-2-yl)
phenyl)carbamate (20a). To a solution of 19a (0.53 g, 1.37 mmol) in
EtOH (9 mL), EtOAc (3 mL) and H2O (3 mL), NH4Cl (0.18 g,
3.42 mmol) and zinc powder (0.23 g) were added and the resulting
mixture was stirred under reflux for 2 h. After completion of the
reaction, the mixture was filtered through a cilite pad. The crude
product was purified by preparative TLC with DCM:MeOH:NH4OH
(8.5:1.5:0.3) yielding 20a (0.40 g, 78% yield). 1H NMR (400 MHz,
4.7.7.48. (S)-Tert-butyl
2-azido-5-((7-((2-((tert-butoxycarbonyl)
amino)-5-(thiophen-2-yl)phenyl)amino)-7-oxoheptyl)amino)-5-
oxopentanoate (21b). Compound 1 (0.12 g, 0.50 mmol) was coupled
to 20b (0.15 g, 0.36 mmol) with EDCI (0.096 g, 0.50 mmol) and
HOBT (0.068 g, 0.50 mmol) as described for 21a to give 21b (0.22 g,
CDCl3)
(s, 1H), 2.80e2.53 (m, 2H), 2.42e2.29 (m, 2H), 1.86e1.69 (m, 2H),
1.52e1.38 (m, 9H). 13C NMR (101 MHz, CDCl3)
172.8, 153.9, 143.3,
d
7.66e7.45 (m, 2H), 7.31 (d, J ¼ 8.1 Hz, 1H), 7.15 (s, 2H), 6.97
98% yield). 1H NMR (400 MHz, CDCl3)
d 7.57e7.44 (m, 2H), 7.33 (d,
d
J ¼ 8.4 Hz, 1H), 7.18 (d, J ¼ 4.5 Hz, 2H), 7.03e6.90 (m, 1H), 3.76 (dd,
J ¼ 8.9, 4.8 Hz, 1H), 3.10 (dd, J ¼ 12.9, 6.6 Hz, 2H), 2.30 (t, J ¼ 7.2 Hz,
2H), 2.22 (t, J ¼ 7.2 Hz, 2H), 2.17e2.05 (m, 1H), 1.96e1.83 (m, 1H),
1.64e1.54 (m, 2H), 1.45 (s, 9H), 1.44 (s, 9H), 1.41e1.32 (m, 2H),
131.2, 130.6, 129.1, 128.0, 124.6, 124.0, 123.7, 123.0, 122.6, 80.6, 40.8,
34.4, 28.3, 27.3.
4.7.7.44. Tert-butyl
(2-(7-aminoheptanamido)-4-(thiophen-2-yl)
1.30e1.18 (m, 4H). 13C NMR (101 MHz, CDCl3)
d 172.9, 171.6, 169.2,
phenyl)carbamate (20b). Compound 19b (0.55 g, 1.24 mmol) was
reduced with NH4Cl (0.16 g, 2.98 mmol) and zinc (0.21 g) as
described for 20a resulting in 20b (0.38 g, 74% yield). 1H NMR
154.0, 143.2, 131.1, 130.5, 129.8, 128.0, 124.7, 124.5, 123.4, 123.1,
122.5, 83.0, 80.7, 61.8, 39.3, 36.7, 32.1, 29.2, 28.5, 28.3, 27.9, 27.1,
26.3, 25.4.

Q.H. Sodji et al. / European Journal of Medicinal Chemistry 96 (2015) 340e359
357
4.7.7.49. (S)-Tert-butyl
2-azido-5-((8-((2-((tert-butoxycarbonyl)
3.20e3.07 (m, 2H), 2.99e2.75 (m, 2H), 2.35 (t, J ¼ 7.1 Hz, 2H), 2.25
(t, J ¼ 14.4 Hz, 2H), 2.04 (dd, J ¼ 20.4, 9.4 Hz, 1H), 1.84e1.72 (m, 1H),
amino)-5-(thiophen-2-yl)phenyl)amino)-8-oxooctyl)amino)-5-
oxopentanoate (21c). Compound 1 (0.11 g, 0.49 mmol) was coupled
to 20c (0.15 g, 0.35 mmol) with EDCI (0.093 g, 0.49 mmol) and
HOBT (0.066 g, 0.49 mmol) as described for 21a to give 21c (0.23 g,
1.70e1.61 (m, 2H), 1.47 (s, 9H), 1.40 (s, 9H), 1.34e1.18 (m, 6H). 13
C
NMR (101 MHz, CDCl3) d 172.9,154.1,143.3,131.2,130.4,130.1, 128.0,
125.0, 123.5, 123.1, 122.6, 82.0, 80.7, 77.4, 77.1, 76.8, 50.4, 39.4, 36.9,
32.7, 29.2, 28.7, 28.4, 28.3, 28.0, 26.4, 25.4.
quantitative yield). 1H NMR (400 MHz, CDCl3)
d 7.53e7.41 (m, 2H),
7.39e7.30 (m, 1H), 7.18 (t, J ¼ 3.8 Hz, 2H), 6.99 (dd, J ¼ 4.9, 3.8 Hz,
1H), 3.76 (dd, J ¼ 9.0, 4.8 Hz, 1H), 3.13 (dd, J ¼ 13.4, 6.7 Hz, 2H), 2.32
(t, J ¼ 7.3 Hz, 2H), 2.21 (t, J ¼ 7.2 Hz, 2H), 2.15e2.03 (m, 1H), 1.89
(ddd, J ¼ 15.6, 13.9, 6.9 Hz, 1H), 1.71e1.57 (m, 2H), 1.46 (s, 9H), 1.44
(s, 9H), 1.42e1.37 (m, 2H), 1.31e1.22 (m, 6H). 13C NMR (101 MHz,
4.7.7.54. (S)-Tert-butyl
2-amino-5-((9-((2-((tert-butoxycarbonyl)
amino)-5-(thiophen-2-yl)phenyl)amino)-9-oxononyl)amino)-5-
oxopentanoate (22d). Compound 21d (0.20 g, 0.30 mmol) was
reduced in the presence of NH4Cl (0.073 g, 1.36 mmol) and zinc
powder (0.089 g) as described for 22a yielding 22d (0.17 g, 88%
CDCl3)
d 172.8, 171.5, 169.2, 154.0, 143.3, 131.1, 130.4, 129.9, 128.0,
124.7, 124.5, 123.4, 123.1, 122.5, 83.0, 80.7, 61.8, 39.4, 36.9, 32.1, 29.3,
28.8, 28.6, 28.3, 28.0, 27.1, 26.5, 25.4.
yield). 1H NMR (400 MHz, CDCl3)
d
7.58 (s, 1H), 7.44 (t, J ¼ 11.0 Hz,
1H), 7.32 (dd, J ¼ 8.4, 1.6 Hz, 1H), 7.22e7.13 (m, 2H), 7.04e6.92 (m,
1H), 3.18e3.03 (m, 2H), 2.34 (t, J ¼ 7.3 Hz, 2H), 2.31e2.20 (m, 2H),
2.10e1.94 (m, 1H), 1.87e1.70 (m, 1H), 1.71e1.60 (m, 2H), 1.46 (s, 9H),
4.7.7.50. (S)-Tert-butyl
2-azido-5-((9-((2-((tert-butoxycarbonyl)
amino)-5-(thiophen-2-yl)phenyl)amino)-9-oxononyl)amino)-5-
oxopentanoate (21d). Compound 1 (0.087 g, 0.38 mmol) was
coupled to 20d (0.15 g, 0.27 mmol) with EDCI (0.072 g, 0.38 mmol)
and HOBT (0.051 g, 0.38 mmol) as described for 21a to give 21d
1.41 (m, 10H), 1.36e1.15 (m, 9H). 13C NMR (101 MHz, CDCl3)
d 173.0,
154.1,143.3,131.1,130.5,130.0,128.0,124.7,124.5, 123.4,123.1,122.5,
81.9, 80.6, 39.4, 36.9, 32.7, 29.3, 28.8, 28.7, 28.3, 28.0, 26.5, 25.5.
(0.20 g, quantitative yield). 1H NMR (400 MHz, CDCl3)
d
7.43 (dd,
4.7.7.55. (S)-Tert-butyl 2-(4-(((2-amino-4-oxo-3,4-dihydropteridin-
6-yl)methyl)amino)benzamido)-5-((4-((2-((tert-butoxycarbonyl)
amino)-5-(thiophen-2-yl)phenyl)amino)-4-oxobutyl)amino)-5-
oxopentanoate (23a). Compound 22a (0.12 g, 0.21 mmol) was
coupled to pteroyl azide (0.19 g, 0.41 mmol) in the presence of TMG
(0.071 g, 0.62 mmol) in DMSO as described for the synthesis of 5 to
J ¼ 15.0, 9.4 Hz, 2H), 7.34 (dd, J ¼ 8.4, 2.0 Hz, 1H), 7.20 (dd, J ¼ 4.1,
2.9 Hz, 2H), 7.00 (dd, J ¼ 4.9, 3.7 Hz, 1H), 3.77 (dd, J ¼ 9.0, 4.8 Hz,
1H), 3.16 (dd, J ¼ 13.6, 6.5 Hz, 2H), 2.34 (t, J ¼ 7.4 Hz, 2H), 2.22 (t,
J ¼ 7.1 Hz, 2H), 2.17e2.07 (m, 1H), 1.97e1.85 (m, 1H), 1.71e1.61 (m,
2H), 1.47 (s, 9H), 1.45 (s, 9H), 1.43e1.39 (m, 2H), 1.30e1.18 (m, 8H).
13C NMR (101 MHz, CDCl3)
d
172.8, 171.4, 169.2, 154.0, 143.3, 131.2,
yield 23a (0.045 g, 26% yield). 1H NMR (500 MHz, DMSO-d6)
d 8.66
130.4, 130.0, 128.0, 124.7, 124.5, 123.5, 123.1, 122.5, 83.1, 80.7, 61.8,
39.5, 37.0, 32.1, 29.4, 28.9, 28.8, 28.3, 28.0, 27.1, 26.6, 25.5.
(s, 1H), 7.75 (d, J ¼ 1.9 Hz, 1H), 7.67 (d, J ¼ 8.8 Hz, 2H), 7.62 (d,
J ¼ 8.5 Hz, 1H), 7.52 (dd, J ¼ 5.1, 1.0 Hz, 1H), 7.48e7.38 (m, 2H), 7.12
(dd, J ¼ 5.0, 3.6 Hz, 1H), 6.66 (dd, J ¼ 14.6, 8.9 Hz, 2H), 4.49 (d,
J ¼ 6.0 Hz, 2H), 4.24 (dd, J ¼ 12.3, 9.4 Hz, 1H), 3.15e3.08 (m, 2H),
2.38 (t, J ¼ 7.3 Hz, 2H), 2.21 (dt, J ¼ 14.2, 7.1 Hz, 2H), 2.09e1.99 (m,
1H), 1.97e1.87 (m, 1H), 1.74 (dd, J ¼ 16.3, 9.0 Hz, 2H), 1.46 (s, 9H),
1.40 (s, 9H). HRMS (ESI) calcd for C42H51N10O8S [MþH]þ 855.3607
found 855.3607.
4.7.7.51. (S)-Tert-butyl
2-amino-5-((4-((2-((tert-butoxycarbonyl)
amino)-5-(thiophen-2-yl)phenyl)amino)-4-oxobutyl)amino)-5-
oxopentanoate (22a). To a solution of 21a (0.21 g, 0.37 mmol) in
EtOH (9 mL) and H2O (3 mL) was added NH4Cl (0.049 g, 0.91 mmol)
and zinc powder (0.06 g) and the resulting mixture was stirred
under reflux for 3 h. After completion of the reaction, the mixture
was filtered through a cilite pad. The crude product was purified by
preparative TLC with DCM:MeOH (10:1) yielding 22a (0.13 g, 63%
4.7.7.56. (S)-Tert-butyl 2-(4-(((2-amino-4-oxo-3,4-dihydropteridin-
6-yl)methyl)amino)benzamido)-5-((7-((2-((tert-butoxycarbonyl)
amino)-5-(thiophen-2-yl)phenyl)amino)-7-oxoheptyl)amino)-5-
oxopentanoate (23b). Compound 22b (0.12 g, 0.20 mmol) was
coupled to pteroyl azide (0.18 g, 0.41 mmol) in the presence of TMG
(0.07 g, 0.61 mmol) in DMSO as described for the synthesis of 5 to
yield). 1H NMR (400 MHz, CDCl3)
d
7.72 (s, 1H), 7.55 (d, J ¼ 8.3 Hz,
1H), 7.38 (d, J ¼ 8.4 Hz, 1H), 7.23 (dd, J ¼ 8.9, 8.1 Hz, 2H), 7.06e6.98
(m, 1H), 3.36e3.20 (m, 3H), 2.39 (t, J ¼ 6.2 Hz, 2H), 2.32e2.24 (m,
2H), 2.14e2.06 (m,1H),1.93e1.83 (m, 2H),1.79e1.70 (m,1H),1.49 (s,
9H), 1.43 (s, 9H). 13C NMR (101 MHz, CDCl3)
d
172.3, 154.0, 143.4,
yield 23b (0.038 g, 21% yield). 1H NMR (500 MHz, DMSO-d6)
d 8.66
131.1, 130.4, 129.8, 128.0, 124.7, 123.6, 123.1, 122.4, 81.5, 80.6, 38.6,
34.3, 33.0, 28.3, 28.0, 26.1.
(s, 1H), 7.73 (d, J ¼ 1.9 Hz, 1H), 7.66 (d, J ¼ 8.8 Hz, 2H), 7.61 (d,
J ¼ 8.4 Hz, 1H), 7.52 (dd, J ¼ 5.1, 1.1 Hz, 1H), 7.47e7.40 (m, 2H), 7.13
(dd, J ¼ 4.5, 3.0 Hz, 1H), 6.65 (d, J ¼ 8.8 Hz, 2H), 4.49 (d, J ¼ 5.9 Hz,
2H), 4.24e4.16 (m, 1H), 3.03 (dd, J ¼ 12.9, 6.7 Hz, 2H), 2.40e2.35 (m,
2H), 2.24e2.12 (m, 2H), 2.06e1.97 (m, 1H), 1.94e1.85 (m, 1H),
1.65e1.54 (m, 2H), 1.47 (s, 10H), 1.42e1.36 (m, 12H), 1.35e1.27 (m,
4H). HRMS (ESI) calcd for C45H57N10O8S [MþH]þ 897.4076 found
897.4072.
4.7.7.52. (S)-Tert-butyl
2-amino-5-((7-((2-((tert-butoxycarbonyl)
amino)-5-(thiophen-2-yl)phenyl)amino)-7-oxoheptyl)amino)-5-
oxopentanoate (22b). Compound 21b (0.22 g, 0.34 mmol) was
reduced in the presence of NH4Cl (0.046 g, 0.86 mmol) and zinc
powder (0.056 g) as described for 22a yielding 22b (0.14 g, 68%
yield). 1H NMR (400 MHz, CDCl3)
7.29e7.18 (m, 2H), 7.10e6.94 (m, 1H), 3.29e3.07 (m, 2H), 2.37 (t,
J ¼ 5.5 Hz, 2H), 2.32e2.19 (m, 2H), 2.15e1.99 (m, 1H), 1.85e1.63 (m,
4H), 1.61e1.39 (m, 20H), 1.39e1.27 (m, 4H). 13C NMR (101 MHz,
d
7.42 (dd, J ¼ 31.0, 8.4 Hz, 3H),
4.7.7.57. (S)-Tert-butyl2-(4-(((2-amino-4-oxo-3,4-dihydropteridin-
6-yl)methyl)amino)benzamido)-5-((8-((2-((tert-butoxycarbonyl)
amino)-5-(thiophen-2-yl)phenyl)amino)-8-oxooctyl)amino)-5-
oxopentanoate (23c). Compound 22c (0.17 g, 0.28 mmol) was
coupled to pteroyl azide (0.25 g, 0.56 mmol) in the presence of TMG
(0.097 g, 0.84 mmol) in DMSO as described for the synthesis of 5 to
CDCl3)
d 172.5, 143.3, 131.5, 130.2, 128.0, 124.8, 123.6, 123.2, 122.6,
81.4, 80.8, 39.2, 36.8, 33.1, 29.3, 28.3, 28.0, 26.2, 25.3.
4.7.7.53. (S)-Tert-butyl
2-amino-5-((8-((2-((tert-butoxycarbonyl)
yield 23c (0.070 g, 28% yield). 1H NMR (400 MHz, DMSO-d6)
d 8.58
amino)-5-(thiophen-2-yl)phenyl)amino)-8-oxooctyl)amino)-5-
oxopentanoate (22c). Compound 21c (0.23 g, 0.36 mmol) was
reduced in the presence of NH4Cl (0.086 g, 1.61 mmol) and zinc
powder (0.11 g) as described for 22a yielding 22c (0.20 g, 90% yield).
(s, 1H), 7.71 (s, 1H), 7.62 (d, J ¼ 8.6 Hz, 2H), 7.58 (d, J ¼ 8.7 Hz, 1H),
7.49 (d, J ¼ 4.5 Hz,1H), 7.44e7.37 (m, 2H), 7.12e7.08 (m,1H), 6.61 (d,
J ¼ 8.5 Hz, 2H), 4.44 (d, J ¼ 6.0 Hz, 2H), 4.23e4.12 (m,1H), 3.03e2.94
(m, 2H), 2.34 (t, J ¼ 7.5 Hz, 2H), 2.20e2.11 (m, 2H), 2.02e1.94 (m,
1H), 1.91e1.82 (m, 1H), 1.62e1.54 (m, 2H), 1.42 (s, 9H), 1.37 (s, 9H),
1.32e1.20 (m, 8H). HRMS (ESI) calcd for C46H59N10O8S [MþH]þ
1H NMR (400 MHz, CDCl3)
d
7.59 (s, 1H), 7.45 (d, J ¼ 8.4 Hz, 1H), 7.34
(d, J ¼ 8.3 Hz, 1H), 7.20 (d, J ¼ 4.3 Hz, 2H), 7.06e6.93 (m, 1H),

358
Q.H. Sodji et al. / European Journal of Medicinal Chemistry 96 (2015) 340e359
911.4233 found 911.4217.
1.44e1.25 (m, 8H). 13C NMR (126 MHz, DMSO-d6)
d 174.1, 171.8,
171.6, 171.1, 171.0, 166.5, 161.0, 153.8, 151.0, 149.3, 148.8, 144.5, 129.2,
128.5,128.2,124.5,123.7,123.6,123.4,122.6,121.7,121.5,121.4,117.0,
111.5, 52.6, 46.2, 36.1, 32.3, 30.9, 29.4, 29.3, 29.0, 28.8, 26.9, 26.6,
25.4. HRMS (ESI) calcd for C37H43N10O6 S [MþH]þ 755.3082 found
755.3075.
4.7.7.58. (S)-Tert-butyl 2-(4-(((2-amino-4-oxo-3,4-dihydropteridin-
6-yl)methyl)amino)benzamido)-5-((9-((2-((tert-butoxycarbonyl)
amino)-5-(thiophen-2-yl)phenyl)amino)-9-oxononyl)amino)-5-
oxopentanoate (23d). Compound 22d (0.17 g, 0.27 mmol) was
coupled to pteroyl azide (0.24 g, 0.53 mmol) in the presence of TMG
(0.091 g, 0.80 mmol) in DMSO as described for the synthesis of 5 to
4.7.7.62. (S)-2-(4-(((2-Amino-4-oxo-3,4-dihydropteridin-6-yl)
methyl)amino)benzamido)-5-((9-((2-amino-5-(thiophen-2-yl)
yield 23d (0.11 g, 46% yield). 1H NMR (400 MHz, DMSO-d6)
d 8.63 (s,
1H), 7.69 (d, J ¼ 2.1 Hz, 1H), 7.63 (d, J ¼ 8.8 Hz, 2H), 7.57 (d,
J ¼ 8.5 Hz, 1H), 7.49 (d, J ¼ 5.1 Hz, 1H), 7.45e7.36 (m, 2H), 7.10 (dd,
J ¼ 5.0, 3.7 Hz, 1H), 6.62 (d, J ¼ 8.8 Hz, 2H), 4.46 (d, J ¼ 6.0 Hz, 2H),
4.23e4.12 (m, 1H), 3.02e2.94 (m, 2H), 2.34 (t, J ¼ 7.5 Hz, 2H), 2.15
(dd, J ¼ 12.6, 6.6 Hz, 2H), 2.01e1.93 (m, 1H), 1.91e1.83 (m, 1H),
1.64e1.54 (m, 2H), 1.44 (s, 9H), 1.41e1.38 (m, 2H), 1.37 (s, 9H),
1.32e1.21 (m, 8H). HRMS (ESI) calcd for C47H61N10O8S [MþH]þ
925.4389 found 925.4386.
phenyl)amino)-9-oxononyl)amino)-5-oxopentanoic
acid
(24d).
Compound 23d (0.034 g, 0.037 mmol) was dissolved in neat TFA
(2 mL) and TIPS (0.5 mL) and stirred at room temperature for 2 h.
The desired product 24d (0.022 g, 79% yield) was obtained as
described for the synthesis of 6. 1H NMR (500 MHz, DMSO-d6)
d
8.67 (s, 1H), 7.66 (d, J ¼ 8.4 Hz, 2H), 7.51 (s, 1H), 7.37 (d, J ¼ 5.0 Hz,
1H), 7.28e7.21 (m, 2H), 7.08e7.02 (m, 1H), 6.80 (d, J ¼ 8.3 Hz, 1H),
6.65 (d, J ¼ 8.4 Hz, 2H), 4.51 (s, 2H), 4.35e4.25 (m, 1H), 3.05e2.97
(m, 2H), 2.34 (t, J ¼ 7.3 Hz, 2H), 2.19 (t, J ¼ 11.0 Hz, 2H), 2.11e2.00
(m, 1H), 1.97e1.86 (m, 1H), 1.67e1.54 (m, 2H), 1.40e1.22 (m, 10H).
4.7.7.59. (S)-2-(4-(((2-Amino-4-oxo-3,4-dihydropteridin-6-yl)
methyl)amino)benzamido)-5-((4-((2-amino-5-(thiophen-2-yl)
13C NMR (126 MHz, DMSO-d6)
d 174.1, 171.8, 171.6, 166.5, 161.0,
phenyl)amino)-4-oxobutyl)amino)-5-oxopentanoic
acid
(24a).
153.8, 151.0, 148.8, 144.4, 129.2, 128.5, 128.2, 123.7, 123.4, 122.6,
121.7, 121.5, 111.5, 52.6, 46.2, 36.1, 32.3, 29.4, 29.1, 29.0, 26.9, 26.7,
25.5. HRMS (ESI) calcd for C38H45N10O6 S [MþH]þ 769.3239 found
769.3236.
Compound 23a (0.032 g, 0.037 mmol) was dissolved in neat TFA
(2 mL) and TIPS (0.5 mL) and stirred at room temperature for 2 h.
The desired product 24a (0.03 g, quantitative yield) was obtained as
described for the synthesis of 6. 1H NMR (500 MHz, DMSO-d6)
d
8.66 (s, 1H), 7.67 (d, J ¼ 8.5 Hz, 2H), 7.50 (s, 1H), 7.36 (d, J ¼ 4.8 Hz,
Acknowledgments
1H), 7.27e7.18 (m, 2H), 7.07e7.03 (m, 1H), 6.77 (d, J ¼ 8.3 Hz, 1H),
6.65 (d, J ¼ 8.5 Hz, 2H), 4.50 (s, 2H), 4.32 (t, J ¼ 10.6 Hz, 1H), 3.11 (dt,
J ¼ 12.8, 6.7 Hz, 2H), 2.33 (t, J ¼ 7.4 Hz, 2H), 2.22 (t, J ¼ 7.3 Hz, 2H),
2.14e2.06 (m, 1H), 1.99e1.88 (m, 1H), 1.78e1.65 (m, 2H). 13C NMR
We are grateful to Professor Olaf Wiest for providing us with the
HDAC1 homology model. We thank Professor Philip S. Low for
helpful discussion. This work was financially supported by NIH
Grant R01CA131217 (A.K.O.) and R01GM084188 (MM) Q.H.S. is a
recipient of a GAANN predoctoral fellowship from the Georgia Tech
Center for Drug Design, Development, and Delivery and a disser-
tation fellowship from the Southern Regional Education Board
(SREB).
(126 MHz, DMSO-d6)
d 174.1, 171.8, 171.4, 166.7, 153.9, 151.0, 148.8,
144.5,129.3,128.5,124.1,123.6,123.5,122.9,121.6,121.3,116.6,111.5,
65.2, 52.4, 46.2, 38.3, 33.4, 32.3, 31.0, 26.9, 25.6, 15.5. HRMS (ESI)
calcd for C33H35N10O6 S [MþH]þ 699.2456 found 699.2450.
4.7.7.60. (S)-2-(4-(((2-Amino-4-oxo-3,4-dihydropteridin-6-yl)
methyl)amino)benzamido)-5-((7-((2-amino-5-(thiophen-2-yl)
phenyl)amino)-7-oxoheptyl)amino)-5-oxopentanoic
Appendix A. Supplementary data
acid
(24b).
Compound 23b (0.039 g, 0.043 mmol) was dissolved in neat TFA
(2 mL) and TIPS (0.5 mL) and stirred at room temperature for 2 h.
The desired product 24b (0.027 g, 84% yield) was obtained as
described for the synthesis of 6. 1H NMR (500 MHz, DMSO-d6)
Supplementary data related to this article can be found at http://
dx.doi.org/10.1016/j.ejmech.2015.04.014.
References
d
8.67 (s, 1H), 7.67 (d, J ¼ 8.6 Hz, 2H), 7.51 (d, J ¼ 1.8 Hz, 1H), 7.36 (d,
J ¼ 4.9 Hz, 1H), 7.26e7.20 (m, 2H), 7.07e7.03 (m, 1H), 6.79 (d,
J ¼ 8.2 Hz, 1H), 6.65 (d, J ¼ 8.6 Hz, 2H), 4.50 (s, 2H), 4.28 (t,
J ¼ 10.9 Hz, 1H), 3.08e2.99 (m, 2H), 2.34 (t, J ¼ 7.4 Hz, 2H), 2.19 (t,
J ¼ 8.4 Hz, 2H), 2.08e2.02 (m, 1H), 1.97e1.88 (m, 1H), 1.65e1.53 (m,
2H), 1.43e1.34 (m, 2H), 1.35e1.25 (m, 4H). 13C NMR (126 MHz,
[1] R.L. Strausberg, A.J.G. Simpson, L.J. Old, G.J. Riggins, Oncogenomics and the
development of new cancer therapies, Nature 429 (2004) 469e474.
[2] W.W. Ma, A.A. Adjei, Novel agents on the horizon for cancer therapy, CA-
Cancer J. Clin. 59 (2009) 111e137.
[3] B.E. Gryder, Q.H. Sodji, A.K. Oyelere, Targeted cancer therapy: giving histone
deacetylase inhibitors all they need to succeed, Future Med. Chem. 4 (2012)
505e524.
[4] L.M. Butler, X. Zhou, W.-S. Xu, H.I. Scher, R.A. Rifkind, P.A. Marks, V.M. Richon,
The histone deacetylase inhibitor SAHA arrests cancer cell growth, up-
regulates thioredoxin-binding protein-2, and down-regulates thioredoxin,
Proc. Natl. Acad. Sci. 99 (2002) 11700e11705.
[5] S. Minucci, P.G. Pelicci, Histone deacetylase inhibitors and the promise of
epigenetic (and more) treatments for cancer, Nat. Rev. Cancer 6 (2006) 38e51.
[6] M. Dokmanovic, C. Clarke, P.A. Marks, Histone deacetylase inhibitors: over-
view and perspectives, Mol. Cancer Res. 5 (2007) 981e989.
[7] O. Witt, H.E. Deubzer, T. Milde, I. Oehme, HDAC family: what are the cancer
relevant targets? Cancer Lett. 277 (2009) 8e21.
[8] N. Ueki, S. Lee, N.S. Sampson, M.J. Hayman, Selective cancer targeting with
prodrugs activated by histone deacetylases and a tumour-associated protease,
Nat. Commun. 4 (2013) 2735.
[9] W. Weichert, HDAC expression and clinical prognosis in human malignancies,
Cancer Lett. 280 (2009) 168e176.
[10] P. Porcu, H.K. Wong, We should have a dream: unlocking the workings of the
genome in cutaneous T-cell lymphomas, Clin. Lymphoma Myeloma Leuk. 9
(2009) 409e411.
[11] B.S. Mann, J.R. Johnson, M.H. Cohen, R. Justice, R. Pazdur, FDA approval
summary: vorinostat for treatment of advanced primary cutaneous T-cell
lymphoma, Oncologist 12 (2007) 1247e1252.
DMSO-d6)
d 174.1,171.6,166.6,151.0,148.8,144.5,129.3,128.5,128.2,
123.6, 122.7, 121.6, 121.4, 111.5, 65.2, 52.6, 46.2, 38.8, 36.1, 32.3, 29.3,
28.7, 26.9, 26.5, 25.4, 15.5. HRMS (ESI) calcd for C36H41N10O6
S
[MþH]þ 741.2926 found 741.2922.
4.7.7.61. (S)-2-(4-(((2-Amino-4-oxo-3,4-dihydropteridin-6-yl)
methyl)amino)benzamido)-5-((8-((2-amino-5-(thiophen-2-yl)
phenyl)amino)-8-oxooctyl)amino)-5-oxopentanoic
acid
(24c).
Compound 23c (0.032 g, 0.035 mmol) was dissolved in neat TFA
(2 mL) and TIPS (0.5 mL) and stirred at room temperature for 2 h.
The desired product 24c (0.025 g, 93% yield) was obtained as
described for the synthesis of 6. 1H NMR (500 MHz, DMSO-d6)
d
8.67 (s, 1H), 7.66 (d, J ¼ 8.8 Hz, 2H), 7.51 (d, J ¼ 1.9 Hz, 1H), 7.37 (d,
J ¼ 4.6 Hz, 1H), 7.27e7.21 (m, 2H), 7.07e7.03 (m, 2H), 6.79 (t,
J ¼ 7.3 Hz, 1H), 6.65 (d, J ¼ 8.8 Hz, 2H), 4.51 (s, 2H), 4.32e4.23 (m,
1H), 3.08e2.99 (m, 2H), 2.34 (dd, J ¼ 9.4, 5.4 Hz, 2H), 2.22e2.15 (m,
2H), 2.08e2.01 (m, 1H), 1.98e1.87 (m, 1H), 1.65e1.57 (m, 2H),

Q.H. Sodji et al. / European Journal of Medicinal Chemistry 96 (2015) 340e359
359
[12] S. Subramanian, S.E. Bates, J.J. Wright, I. Espinoza-Delgado, R.L. Piekarz, Clin-
2080e2083.
€
ical Toxicities of Histone Deacetylase Inhibitors, Pharmaceuticals (Basel) 3,
2010, pp. 2751e2767.
[39] S. Schafer, L. Saunders, E. Eliseeva, A. Velena, M. Jung, A. Schwienhorst,
A. Strasser, A. Dickmanns, R. Ficner, S. Schlimme, W. Sippl, E. Verdin, M. Jung,
Phenylalanine-containing hydroxamic acids as selective inhibitors of class IIb
histone deacetylases (HDACs), Bioorg. Med. Chem. 16 (2008) 2011e2033.
[40] L. Santo, T. Hideshima, A.L. Kung, J.-C. Tseng, D. Tamang, M. Yang, M. Jarpe,
J.H. van Duzer, R. Mazitschek, W.C. Ogier, D. Cirstea, S. Rodig, H. Eda,
T. Scullen, M. Canavese, J. Bradner, K.C. Anderson, S.S. Jones, N. Raje, Pre-
clinical activity, pharmacodynamic, and pharmacokinetic properties of a se-
lective HDAC6 inhibitor, ACY-1215, in combination with bortezomib in
multiple myeloma, Blood 119 (2012) 2579e2589.
[13] J.S. de Bono, A. Ashworth, Translating cancer research into targeted thera-
peutics, Nature 467 (2010) 543e549.
[14] T.Z. Qiu, L. Zhou, W. Zhu, T.S. Wang, J. Wang, Y.Q. Shu, P. Liu, Effects of
treatment with histone deacetylase inhibitors in solid tumors: a review based
on 30 clinical trials, Future Oncol. 9 (2013) 255e269.
[15] A. Grassadonia, P. Cioffi, F. Simiele, L. Iezzi, M. Zilli, C. Natoli, Role of
hydroxamate-based histone deacetylase inhibitors (Hb-HDACIs) in the treat-
ment of solid malignancies, Cancers 5 (2013) 919e942.
[16] J.A. Bauer, B.H. Morrison, R.W. Grane, B.S. Jacobs, S. Dabney, A.M. Gamero,
K.A. Carnevale, D.J. Smith, J. Drazba, B. Seetharam, D.J. Lindner, Effects of
[41] J.L. Methot, P.K. Chakravarty, M. Chenard, J. Close, J.C. Cruz, W.K. Dahlberg,
J. Fleming, C.L. Hamblett, J.E. Hamill, P. Harrington, A. Harsch, R. Heidebrecht,
B. Hughes, J. Jung, C.M. Kenific, A.M. Kral, P.T. Meinke, R.E. Middleton,
N. Ozerova, D.L. Sloman, M.G. Stanton, A.A. Szewczak, S. Tyagarajan,
D.J. Witter, J. Paul Secrist, T.A. Miller, Exploration of the internal cavity of
histone deacetylase (HDAC) with selective HDAC1/HDAC2 inhibitors (SHI-1:
2), Bioorg. Med. Chem. Lett. 18 (2008) 973e978.
[42] P. Kumar, K. Lokanatha Rai, Reduction of aromatic nitro compounds to amines
using zinc and aqueous chelating ethers: mild and efficient method for zinc
activation, Chem. Papers 66 (2012) 772e778.
[43] C.M. Paulos, J.A. Reddy, C.P. Leamon, M.J. Turk, P.S. Low, Ligand binding and
kinetics of folate receptor recycling in vivo: impact on receptor-mediated
drug delivery, Mol. Pharmacol. 66 (2004) 1406e1414.
[44] H. Chen, R. Ahn, J. Van den Bossche, D.H. Thompson, T.V. O'Halloran, Folate-
mediated intracellular drug delivery increases the anticancer efficacy of
nanoparticulate formulation of arsenic trioxide, Mol. Cancer Ther. 8 (2009)
1955e1963.
interferon
b on transcobalamin II- receptor expression and antitumor activity
of Nitrosylcobalamin, J. Natl. Cancer Instit. 94 (2002) 1010e1019.
[17] G. Russell-Jones, K. McTavish, J. McEwan, J. Rice, D. Nowotnik, Vitamin-
mediated targeting as a potential mechanism to increase drug uptake by tu-
mours, J. Inorg. Biochem. 98 (2004) 1625e1633.
ꢀ
[18] L.T. Mantovani, S. Miotti, S. Menard, S. Canevari, F. Raspagliesi, C. Bottini,
F. Bottero, M.I. Colnaghi, Folate binding protein distribution in normal tissues
and biological fluids from ovarian carcinoma patients as detected by the
monoclonal antibodies MOv18 and MOv19, Eur. J. Cancer 30 (1994) 363e369.
[19] N. Parker, M.J. Turk, E. Westrick, J.D. Lewis, P.S. Low, C.P. Leamon, Folate re-
ceptor expression in carcinomas and normal tissues determined by a quan-
titative radioligand binding assay, Anal. Biochem. 338 (2005) 284e293.
[20] S.D. Weitman, R.H. Lark, L.R. Coney, D.W. Fort, V. Frasca, V.R. Zurawski,
B.A. Kamen, Distribution of the folate receptor GP38 in Normal and malignant
cell lines and tissues, Cancer Res. 52 (1992) 3396e3401.
[21] W. Xia, P.S. Low, Folate-targeted therapies for cancer, J. Med. Chem. 53 (2010)
6811e6824.
[22] Y. Lu, P.S. Low, Folate-mediated delivery of macromolecular anticancer ther-
apeutic agents, Adv. Drug Deliv. Rev. 64 (Suppl.) (2012) 342e352.
[23] P.S. Low, S.A. Kularatne, Folate-targeted therapeutic and imaging agents for
cancer, Curr. Opin. Chem. Biol. 13 (2009) 256e262.
[24] I.R. Vlahov, C.P. Leamon, Engineering folateedrug conjugates to target cancer:
from chemistry to clinic, Bioconjugate Chem. 23 (2012) 1357e1369.
[25] P.S. Low, W.A. Henne, D.D. Doorneweerd, Discovery and development of folic-
acid-based receptor targeting for imaging and therapy of cancer and inflam-
matory diseases, Acc. Chem. Res. 41 (2007) 120e129.
[45] T. Suzuki, S. Hisakawa, Y. Itoh, N. Suzuki, K. Takahashi, M. Kawahata,
K. Yamaguchi, H. Nakagawa, N. Miyata, Design, synthesis, and biological ac-
tivity of folate receptor-targeted prodrugs of thiolate histone deacetylase
inhibitors, Bioorg. Med. Chem. Lett. 17 (2007) 4208e4212.
[46] G. Simmons, A.J. Rennekamp, N. Chai, L.H. Vandenberghe, J.L. Riley, P. Bates,
Folate receptor alpha and caveolae are not required for Ebola virus
glycoprotein-mediated viral infection, J. Virol. 77 (2003) 13433e13438.
[47] J.A. Bergman, K. Woan, P. Perez-Villarroel, A. Villagra, E.M. Sotomayor,
A.P. Kozikowski, Selective histone deacetylase 6 inhibitors bearing substituted
urea linkers inhibit melanoma cell growth, J. Med. Chem. 55 (2012)
9891e9899.
[26] L. Matherly, Z. Hou, Y. Deng, Human reduced folate carrier: translation of basic
biology to cancer etiology and therapy, Cancer Metastasis Rev. 26 (2007)
111e128.
[27] C.P. Leamon, R.B. DePrince, R.W. Hendren, Folate-mediated drug delivery:
effect of alternative conjugation chemistry, J. Drug Target 7 (1999) 157e169.
[28] C.-Y. Ke, C.J. Mathias, M.A. Green, Targeting the tumor-associated folate re-
ceptor with an 111InꢀDTPA conjugate of pteroic acid, J. Am. Chem. Soc. 127
(2005) 7421e7426.
[29] A.K. Barton, A. Capdevila, Receptor-mediated folate accumulation is regulated
by the cellular folate content, Proc. Natl. Acad. Sci. 83 (1986) 5983e5987.
[30] J.C. Lundquist, Pelletier, Improved solid-phase peptide synthesis method
utilizing a-azide- protected amino acids, Org. Lett. 3 (2001) 781e783.
[31] S.-Y. Han, Y.-A. Kim, Recent development of peptide coupling reagents in
organic synthesis, Tetrahedron 60 (2004) 2447e2467.
[32] W. Lin, X. Zhang, Z. He, Y. Jin, L. Gong, A. Mi, Reduction of azides to amines or
amides with zinc and ammonium chloride as reducing agent, Synth. Commun.
32 (2002) 3279e3284.
[33] J. Luo, M.D. Smith, D.A. Lantrip, S. Wang, P.L. Fuchs, Efficient syntheses of
pyrofolic acid and pteroyl azide, reagents for the production of carboxyl-
differentiated derivatives of folic acid, J. Am. Chem. Soc. 119 (1997)
10004e10013.
[34] A. Mehta, R. Jaouhari, T.J. Benson, K.T. Douglas, Improved efficiency and
selectivity in peptide synthesis: use of triethylsilane as a carbocation scav-
enger in deprotection of t-butyl esters and t-butoxycarbonyl-protected sites,
Tetrahedron Lett. 33 (1992) 5441e5444.
[35] V. Patil, Q.H. Sodji, J.R. Kornacki, M. Mrksich, A.K. Oyelere, 3-Hydroxypyridin-
2-thione as novel zinc binding group for selective histone deacetylase inhi-
bition, J. Med. Chem. 56 (2013) 3492e3506.
[48] S. Senese, K. Zaragoza, S. Minardi, I. Muradore, S. Ronzoni, A. Passafaro,
L. Bernard, G.F. Draetta, M. Alcalay, C. Seiser, S. Chiocca, Role for histone
deacetylase 1 in human tumor cell proliferation, Mol. Cell. Biol. 27 (2007)
4784e4795.
[49] C. Chen, J. Ke, X.E. Zhou, W. Yi, J.S. Brunzelle, J. Li, E.-L. Yong, H.E. Xu,
K. Melcher, Structural basis for molecular recognition of folic acid by folate
receptors, Nature 500 (2013) 486e489.
[50] M. Bantscheff, C. Hopf, M.M. Savitski, A. Dittmann, P. Grandi, A.-M. Michon,
J. Schlegl, Y. Abraham, I. Becher, G. Bergamini, M. Boesche, M. Delling,
B. Dumpelfeld, D. Eberhard, C. Huthmacher, T. Mathieson, D. Poeckel,
V. Reader, K. Strunk, G. Sweetman, U. Kruse, G. Neubauer, N.G. Ramsden,
G. Drewes, Chemoproteomics profiling of HDAC inhibitors reveals selective
targeting of HDAC complexes, Nat. Biotech. 29 (2011) 255e265.
[51] K.V. Butler, J. Kalin, C. Brochier, G. Vistoli, B. Langley, A.P. Kozikowski, Rational
design and simple chemistry yield a Superior, neuroprotective HDAC6 in-
hibitor, Tubastatin A, J. Am. Chem. Soc. 132 (2010) 10842e10846.
[52] R. Zhao, S.H. Min, Y. Wang, E. Campanella, P.S. Low, I.D. Goldman, A role for
the proton-coupled folate transporter (PCFT-SLC46A1) in folate receptor-
mediated endocytosis, J. Biol. Chem. 284 (2009) 4267e4274.
[53] M.P. Carrasco, E.A. Enyedy, N.I. Krupenko, S.A. Krupenko, E. Nuti, T. Tuccinardi,
S. Santamaria, A. Rossello, A. Martinelli, M. Amelia Santos, Novel folate-
hydroxamate based antimetabolites: synthesis and biological evaluation,
Med. Chem. 7 (2011) 265e274.
€
[54] Z.A. Gurard-Levin, K.A. Kilian, J. Kim, K. Bahr, M. Mrksich, Peptide arrays
identify isoform- selective substrates for profiling endogenous lysine deace-
tylase activity, ACS Chem. Biol. 5 (2010) 863e873.
[55] Z.A. Gurard-Levin, M.D. Scholle, A.H. Eisenberg, M. Mrksich, High-throughput
screening of small molecule libraries using SAMDI mass spectrometry, ACS
Comb. Sci. 13 (2011) 347e350.
[36] Q.H. Sodji, V. Patil, J.R. Kornacki, M. Mrksich, A.K. Oyelere, Synthesis and
structureeactivity relationship of 3-hydroxypyridine-2-thione-based histone
deacetylase inhibitors, J. Med. Chem. 56 (2013) 9969e9981.
[56] O. Trott, A.J. Olson, AutoDock Vina: Improving the speed and accuracy of
docking with
a new scoring function, efficient optimization, and multi-
[37] B.E. Gryder, M.J. Akbashev, M.K. Rood, E.D. Raftery, W.M. Meyers, P. Dillard,
S. Khan, A.K. Oyelere, Selectively targeting prostate cancer with antiandrogen
threading, J. Comput. Chem. 31 (2010) 455e461.
[57] B.E. Gryder, M.K. Rood, K.A. Johnson, V. Patil, E.D. Raftery, L.-P.D. Yao, M. Rice,
B. Azizi, D.F. Doyle, A.K. Oyelere, Histone deacetylase inhibitors equipped with
estrogen receptor modulation activity, J. Med. Chem. 56 (2013) 5782e5796.
[58] A.K. Oyelere, P.C. Chen, L.P. Yao, N. Boguslavsky, Heterogeneous diazo-transfer
Reaction: a facile unmasking of azide groups on amine-functionalized insol-
uble supports for solid-phase synthesis, J. Org. Chem. 71 (2006) 9791e9796.
equipped histone deacetylase inhibitors, ACS Chem. Biol.
8 (2013)
2550e2560.
[38] K.J. Wallace, R. Hanes, E. Anslyn, J. Morey, K.V. Kilway, J. Siegel, Preparation of
1,3,5-tris(aminomethyl)-2,4,6-triethylbenzene from two versatile 1,3,5-
tri(halosubstituted) 2,4,6-triethylbenzene derivatives, Synthesis 2005 (2005)