Dual recognition of double-stranded DNA by 2'-aminoethoxy-modified oligonucleotides

Article abstract of DOI:10.1002/(SICI)1521-3773(19980518)37:9<1288::AID-ANIE1288>3.0.CO;2-U

Simultaneous interaction of the 2'-aminoethoxy-modified oligonucleotides with the phosphodiester backbone (shown on the right, A) and with the bases through Hoogsteen base contacts (B) is seen at each base-pair step of the duplex DNA target. The electrost

Full text of DOI:10.1002/(SICI)1521-3773(19980518)37:9<1288::AID-ANIE1288>3.0.CO;2-U

COMMUNICATIONS
Dual Recognition of Double-Stranded DNA by
2'-Aminoethoxy-Modified Oligonucleotides**
Bernard Cuenoud,* Florence Casset, Dieter Hüsken,
François Natt, Romain M. Wolf, Karl-Heinz Altmann,
Pierre Martin, and Heinz E. Moser
Molecular recognition of duplex DNA by proteins plays a
central role in biology. Although there are no clear and simple
rules or codes to describe sequence-specific recognition,
hydrogen bonds with the nucleic bases as well as with the
phosphodiester backbone are of critical importance.[1] Efforts
to mimic such recognition with smaller synthetic biopolymers
have been described.[2] However, in all these cases, specific
contacts with the DNA duplex are only provided by hydrogen
bonds with the bases, and potential interactions with the DNA
backbone are left unexploited. Here we report that 2'-
aminoethoxy-modified oligonucleotides can interact simulta-
neously with the bases and the phosphodiester backbone at
each base-pair step of the DNA target, which provides for a
dramatic increase in the binding affinity as well as in the
association rate constant.
The sequence-specific recognition of duplex DNA by
pyrimidine oligonucleotides involves the formation of triple-
helical structures, which are stabilized by Hoogsteen hydro-
gen bonds between the bases on the DNA target and the
pyrimidine third strand.[3] Examination of a molecular model
of a triple helix with a RNA third strand indicates that the 2'-
hydroxyl groups of the RNA and the phosphate groups of the
DNA second strand are in close proximity.[4] Thus, it appeared
conceivable that the attachment of a short amino alkyl group
at the 2' position of the ribose of the third strand would allow
the protonated amino group to form a specific intermolecular
contact with a proximal phosphate group of the DNA duplex.
Such charge ± charge interactions should strongly enhance the
affinity of the modified oligonucleotide for double-strand
DNA.
To test this hypothesis, we first examined the properties of a
2'-aminoethoxy-modified oligonucleotide with regard to tri-
plex formation. The synthesis of the 2'-aminoethyl-modified
monomeric tymidine and C5-methylcytidine building blocks
is summarized in Scheme 1. Alkylation of protected ribothy-
midine 1[5] with methyl bromoacetate followed by reduction
of the ester group and tosylation gave the tosylate 2.
Hydrogenolytic removal of the BOM group and subsequent
replacement of the tosyloxy group by an azide substituent
yielded the azidoethyl derivative 3, which was further trans-
formed into the desired protected 2'-aminoethoxy-thymidine
Scheme 1. Synthesis of protected 2'-aminoethoxy phosphoramidites thy-
midine (5) and C5-methylcytidine (8): a) BrCH2CO2Me (5 equiv), NaH
(2.2 equiv), DMF, 1.5 h, 58C, 98%; b) LiBH4 (4 equiv), MeOH/THF (2/
8), 1.5 h, 58C, 84%; c) TsCl (1.5 equiv), NEt3 (1.6 equiv), DMAP (10 wt%),
CH2Cl2, 8 h, 228C, 89%; d) H2, Pd/C (20 wt%), HCl (0.02 equiv), THF/
MeOH (1/1), 7 h, 228C, 88%; e) NaN3 (3 equiv), DMF, 3 h, 658C, 92%;
f) SnCl2 (3.5 equiv), MeOH, 1 d, 228C, 70%; g) (CF3CO)2O (1.2 equiv),
pyridine, 2 h, 228C, 57%; h) TBAF (2.1 equiv), THF, 15 min, 228C, 100%;
i) DMTrCl (1.2 equiv), pyridine, 16 h, 228C, 85%; j) (iPr2N)2-
POCH2CH2CN (2.2 equiv), diisopropylammonium tetrazolide (2.4 equiv),
CH2Cl2, 1 h, 228C, 85%; k) triazole (22.5 equiv), POCl3 (2.5 equiv), NEt3
(23 equiv), CH3CN/CH2Cl2 (1/1), 3 h, 228C; l) concd NH3 (aq)/dioxane (1/
1), 1 h, 228C, 84% over two steps; m) N-methyl-2,2-dimethoxypyrrolidine
(1.8 equiv), pyridine, 3 h, 228C, 95%; n) H2, Pd/C (10 wt%), MeOH/THF
(1/1), 3 h, 228C; o) CF3COOEt (10 equiv), NEt3 (7 equiv), MeOH, 1 h,
228C, 96% over two steps; p) TBAF (1.0 equiv), THF, 1 h, 228C, 100%;
q) DMTrCl (1.2 equiv), pyridine, 1 h, 228C, 85%; r) (iPr)2N2-
POCH2CH2CN (2.2 equiv), diisopropylammonium tetrazolide (2.4 equiv),
CH2Cl2, 2 h, 408C, 87%. TIPS ˆ 1,1,3,3-tetraisopropyldisiloxane, BOM ˆ
benzyloxymethyl, N(NMPA) ˆ N-methylpyrrolidinamidine, DMF ˆ N,N-
dimethylformamide, THF ˆ tetrahydrofuran, DMAP ˆ 4-dimethylamino-
pyridine, TBAF ˆ tetra-n-butylammonium fuoride, DMTrˆ 4,4'-dimeth-
oxytriphenylmethyl, Ts ˆ toluene-4-sulfonyl.
and C5-methylcytidine phosphoramidites 5 and 8 by standard
procedures. A pentadecameric oligonucleotide containing
five 2'-aminoethoxy-modified thymidines was synthesized,
and its affinity for a double-stranded DNA target measured
by UV-melting experiments (Figure 1A). A large increase in
melting temperature Tm of 17.58C was observed compared to
the unmodified DNA oligonucleotide control of identical
length and sequence, corresponding to an increase of ‡3.58C
per modification (Figure 1B). The magnitude of the differ-
ence in Tm (DTm) was not significantly affected by changes in
KCl concentration, replacement of KCl by NaCl, use of other
buffers, or addition of MgCl2 or spermine. Moreover, the
modified oligonucleotide remains sensitive to a single base-
pair mismatch.[6]
[*] Dr. B. Cuenoud, Dr. H. E. Moser
Novartis Horsham Research Centre
Wimblehurst road, Horsham, West Sussex, RH12 4AB (UK)
Fax: (‡44)1403-32 33 07
E-mail: bernard.cuenoud@pharma.novartis.com
Dr. F. Casset, Dr. D. Hüsken, Dr. F. Natt, Dr. R. M. Wolf,
Dr. K.-H. Altmann, Dr. P. Martin
Novartis Pharma Ltd., Basel (Switzerland)
[**] We thank Arlette Garnier for excellent technical assistance, Sue
Freier (ISIS Pharmaceuticals) for assistance with the nuclease experi-
ment, and Professors Albert Eschenmoser and Christian Leumann for
advice and encouragment.
1288
ꢀ WILEY-VCH Verlag GmbH, D-69451 Weinheim, 1998
1433-7851/98/3709-1288 $ 17.50+.50/0
Angew. Chem. Int. Ed. 1998, 37, No. 9

COMMUNICATIONS
To explore the molecular basis of this
pronounced enhancement in binding af-
finity, we investigated the affinity of a
series of other related 2'-O-modified oli-
gonucleotides for double-stranded DNA
(Figure 1B). Extension of the spacer be-
tween the protonated amine group and the
2'-oxygen atom by one additional methyl-
ene group (2'-aminopropoxy substitu-
ent)[7] resulted in a significant decrease in
triplex stability. This indicates that the
protonated aminoethoxy side chain is
ideally positioned to interact specifically
with the nearby phosphate group, and that
the enhanced triplex stability is not the
result of a mere nonspecific electrostatic
effect. Replacement of the amino group by
an uncharged hydrogen-bond donor (2'-
hydroxyethoxy substituent) also led to a
considerable increase in binding affinity as
compared to an unmodified DNA third
strand, but the magnitude of the effect was
significantly smaller than that observed for
the 2'-aminoethoxy-modified oligonucleo-
tide. This finding is consistent with the
proposed intermolecular contact, as the
positively charged amino moiety should
interact with the negatively charged phos-
phate backbone more strongly than the
uncharged hydroxyl group. Moreover,
complete removal of the hydrogen bond
donor capacity of the side chain (2'-
methoxy-ethoxy substituent)[8] reduced
the affinity of the modified oligonucleo-
tide for the DNA duplex to a level similar
to that of the 2'-methoxy analogue. This
effect is unlikely to be the result of an
unfavorable steric interaction between
the added methyl group and the major
groove of the DNA, as 2'-aminoethoxy
and 2'-monomethylaminoethoxy deriva-
tives display the same binding enhance-
ment with respect to the oligonucleotide
control.
Figure 1. Affinity of modified oligonucleotides for duplex DNA. A) A pentadecameric
oligonucleotide containing five 2'-aminoethoxy-modified thymidines (boldface, lower-case
letters, strand 3) was hybridized to its duplex DNA target (strands 1 and 2) in a solution with
‡
180mm KCl, 20mm Na , 10mm phosphate (pH 7.0), and 0.1mm ethylenediamine tetraacetate
(EDTA). Thermal denaturation resulted in two UV transitions. The first transition corresponds
to the melting of the triple helix (dissociation of strand 3), and the second to melting of the
DNA duplex (dissociation of strands 1 and 2). The Tm values for the triplex helices with
*
modified oligonucleotides ( ) were compared to that obtained for an unmodified DNA
&
oligonucleotide control ( ). A260 ˆ absorption at 260 nm. B) Structure ± affinity relationships
for different 2'-substituted oligonucleotides. The Tm values were obtained by mathematical
curve fitting assuming a two-state model for each UV transition; calculated DTm/modifications
are within 0.18C uncertainty. The purity and identity of each oligonucleotide were determined
by capillary electrophoresis and matrix assisted laser desorption time of flight (MALDI-TOF)
mass spectroscopy.[13] A pKa of 8.7 was determined for the 2'-aminoethoxy modified thymidine,
indicating that the 2' side chain is protonated under physiological conditions.
To gain further insight into the origins
of this large improvement in binding
affinity, we determined the kinetic and
thermodynamic parameters for the bind-
ing of a fully modified 2'-aminoethoxy
oligonucleotide to
a double-stranded
DNA target. Measurement of hybridiza-
tion kinetics by real-time surface plasmon
resonance[9] revealed that the association
rate constant of the fully modified 2'-
aminoethoxy oligonucleotide I was more
than a 1000 times greater than that of the
unmodified oligonucleotide control II
(Figure 2 and Table 1). The magnitude of
the increase in association rate suggests
Figure 2. Real-time detection of triplex association and dissociation with the surface plasmon
resonance sensor BIAcore 2000 system (Pharmacia Biosensor). A) A 5'-biotinylated DNA hairpin
containing the duplex target sequence (boldface) was immobilized on
a chip coated with
streptavidine (S). Binding of the fully modified 2'-aminoethoxy oligonucleotide I to the hairpin
was compared to the DNA oligonucleotide control II. Binding buffer: 150mm NaCl, 10mm 2-[4-(2-
hydroxyethyl)-1-piperazinyl]ethanesulfonic acid (HEPES, pH 7.4), 3.4mm EDTA, 0.05% Tween20.
Both oligonucleotides contained C5-methylcytidines (italics) instead of natural cytosine bases owing
to their more favorable DNA-binding properties under physiological conditions.[14] B) Sensograms
showing changes (in resonance units, RU) upon association and dissociation of the third
oligonucleotide strand to the double-stranded DNA hairpin.
Angew. Chem. Int. Ed. 1998, 37, No. 9
ꢀ WILEY-VCH Verlag GmbH, D-69451 Weinheim, 1998
1433-7851/98/3709-1289 $ 17.50+.50/0
1289

COMMUNICATIONS
Table 1. Association (ka) and dissociation rate constants (kd), calculated
dissociation binding constants KD, and dissociation free energies DG
(258C) for the 2'-aminoethoxy-modified oligonucleotide I and DNA
control II.[a]
1
1
1
Oligo-
ka [m 1s
]
kd [s
]
KD [m]
DG [kcalmol ]
nucleotide
5
3
9
I
II
3.6 Æ 1.6 Â 104 3.3 Æ 1.3 Â 10
0.91 Â 10
12.2
5.9
5
33 Æ 19
1.4 Æ 0.2 Â 10
4.2 Â 10
[a] By a quantitative DNase I footprint experiment,[16] KD was determined
to be 4.8 Â 10 9 m for oligonucleotide I (buffer: 140mm KCl, 10mm NaCl,
1mm MgCl2, 1mm spermine, 20mm 3-(N-morpholine)propanesulfonic acid
(MOPS), pH 7.2), which is similar to that obtained by the surface plasmon
experiment.
that the formation of specific contacts between the 2'-amino-
ethoxy side chains and the phosphate backbone of the DNA
duplex contributes actively to the nucleation-zipping associ-
ation process.[10] Consistent with the stabilizing effect of
additional specific interstrand contacts, the rate constant for
dissociation of the third strand indicated that the modified
oligonucleotide I dissociates 40 times more slowly from its
target duplex than the oligonucleotide control II. Remark-
ably, the equilibrium dissociation constant calculated from the
rate constants for modified oligonucleotide I (10 9 m) is
46000-fold smaller than that obtained with II, which repre-
sents a gain of 6.3 kcalmol 1 in binding energy.
Figure 3. Molecular model showing the interaction of the 2'-aminoethoxy
side chains (yellow) with the pro-R-phosphate oxygen atoms (red); with a
N ± O distance of 2.8 Š. For clarity, only four residues of the second (pink)
and third strand (orange) are shown. This model was obtained from the
average MD structure after 1-ns simulation performed on a T10:A10:t10
triple-helical complex with a fully modified 2'-aminoethoxy third strand
(boldface, lower-case letters). A distance-dependent dielectric function was
used to simulate an aqueous environment, and counterions were not
included; an approximation was judged sufficient for the geometrical
factors analyzed here.[15]
A model of a triple helix containing a fully modified 2'-
aminoethoxy third strand was derived from molecular-dy-
namics (MD) simulations, and revealed that the protonated
2'-aminoethoxy residue is indeed capable of interacting with
an adjacent phosphate group of the second strand without
compromising the overall triplex architecture (Figure 3).[11]
Throughout the MD trajectory, several observations pointed
toward a specific interaction. The protonated aminoethoxy
side chain (in a low-energy (‡)-gauche conformation) always
interacts with the pro-R-oxygen atom of residue i 1, but not
of residue i, regardless of whether the orientation is originally
trans or gauche. Similar MD experiments performed with a 2'-
aminopropoxy-modified third strand indicated that in this
case the amino group did not exhibit any preference for an
interaction with either the i or i 1 pro-R oxygen atom and, in
addition, could make contacts with its own 2'-oxygen atom.
Overall, these results are consistent with the specific effects
displayed by the 2'-aminoethoxy-modified oligonucleotides
for DNA binding, and support the existence of a novel
interstrand contact with stringent geometrical requirements
between the protonated aminoethoxy side chain and one
phosphodiester oxygen atom of the DNA backbone. More-
over, they confirm the energetically important role of back-
bone contacts often seen in protein ± DNA complexes.
and reference [12]). Therefore, they should compete effec-
tively for DNA binding with proteins such as transcription
factors, and eventually provide powerful compounds for the
regulation of gene expression.
Experimental Section
Kinetic measurements: A biotinylated DNA hairpin (2mm) in binding
buffer was applied to a chip coated with streptavidine (SA-5, Pharmacia
Biosensor) and extensively washed. The association curve was obtained by
1
injection of the oligonucleotide in binding buffer at a rate of 5mLmin for
10 min at 258C. The oligonucleotide solution was then substituted by
binding buffer alone, and the dissociation curve was recorded for 10 min.
The jump (in resonance units, RU) between the association and the
dissociation curve corresponds to a change in refractive index between the
two solutions. To completely remove the third strand oligonucleotide
from the chip, a denaturing step (10mm NaOH, 1 min) followed by a
washing step with binding buffer was performed after each measurement.
Rate constants were evaluated with a nonlinear curve fitting program (BIA
Evaluation, Pharmacia Biosensor) assuming first-order kinetics.
A range of oligonucleotide concentrations was tested (oligonucleotide I:
0.1 ± 1.0mm, oligonucleotide II: 10 ± 100mm) as well as different amounts of
immobilized biotinylated hairpin. The rate constants reported correspond
to the average of at least twelve measurements at these various concen-
trations. Control experiments indicated that oligonucleotide I or II did not
bind to the streptavidine chip alone.
Modulation of gene expression by oligonucleotide-directed
formation of triple helices has been limited in part by weak
affinity, slow association rate, and lack of nuclease resistance
of the unmodified oligonucleotides. 2'-Aminoethoxy-modi-
fied oligonucleotides, for the first time, offer an efficient
solution to these problems by combining high affinity, fast rate
of association, and high nuclease resistance (data not shown
Received: November 3, 1997 [Z11115IE]
German version: Angew. Chem. 1998, 110, 1350 ± 153
Keywords: bioorganic chemistry ´ DNA recognition ´ mo-
lecular recognition ´ oligonucleotides ´ triple helices
1290
ꢀ WILEY-VCH Verlag GmbH, D-69451 Weinheim, 1998
1433-7851/98/3709-1290 $ 17.50+.50/0
Angew. Chem. Int. Ed. 1998, 37, No. 9

COMMUNICATIONS
[1] C. O. Pabo, R. T. Sauer, Annu. Rev. Biochem. 1992, 61, 1053 ± 1095; D.
Rhodes, J. W. R. Schwabe, L. Chapman, L. Fairall, Phil. Trans. R. Soc.
London B 1996, 351, 501 ± 509.
[2] P. E. Nielsen, Chem. Eur. J. 1997, 3, 505 ± 508; H. E. Moser, P. B.
Dervan, Science 1987, 238, 645 ± 650; J. W. Trauger, E. E. Baird, P. B.
Dervan, Nature 1986, 382, 559 ± 561.
halides with silylated derivatives of selenium and tellurium
led to the isolation and characterization of many Cu ± Se
clusters such as [Cu146Se72(PPh3)30],[2] and a large number of
Ag ± Te clusters such as [Ag48(nBuTe)24Te12(PEt3)14].[3] This
method was applied recently for the synthesis and subsequent
structure determination of [Cd32Se14(SePh)36(PPh3)4] and
[Hg32Se14(SePh)36].[4] These compounds have similar struc-
tures to the previously described [Cd32Se14(SR)36(L)4] clusters
(R ˆ organic group; L ˆ H2O, DMF).[5] The compound
[Hg32Se14(SePh)36] can be formed by the treatment of
[Fe(CO)4(HgCl)2] with PhSeSiMe3. The synthesis of
[Fe(CO)4(HgCl)2] was described in 1928 by Hock and
Stuhlmann.[6] Recently the phosphane-bridged mercury clus-
ter [{(HgPtBu)4}3] was synthesized by the treatment of
[Fe(CO)4(HgOAc)2] with tBuP(SiMe3)2;[7] this cluster is not
accessible from the reaction of HgCl2 with silylated phos-
phanes.
In this work we present the reactions of [Fe(CO)4(HgX)2]
(X ˆ Cl, Br) with the silylated sulfur derivative tBuSSiMe3.
Only a few examples of metal-rich chalcogen-bridged mer-
cury complexes, such as the adamantane-like compounds
[Hg4(SPh)6(PPh3)4](ClO4)2, [Hg4(SPh)5(m2-Br)Br4](PPh4)2,[8]
and the complex [Hg4(tBuS)4(m2-Cl)2(Cl)2(py)2][9] have been
reported. Clegg and Sola et al.[10] have isolated the compound
[Hg7(SC6H11)12Br2], and characterized it by X-ray crystallog-
raphy.
[3] S. Neidel, Anti-Cancer Drug Des. 1997, 12, 433 ± 442; C. Giovannan-
 Á
geli, C. Helene, Antisense Nucleic Acid Drug Dev. 1997, 7, 413 ± 421;
L. J. Maher, Cancer Invest. 1996, 14, 66 ± 82.
Â
[4] C. Escude, J.-C. François, J.-S. Sun, G. Ott, M. Sprinzl, T. Garestier, C.
 Á
Helene, Nucleic Acids Res. 1993, 21, 5547 ± 5553.
[5] W. T. Markiewicz, J. Chem. Res. Synop. 1979, 24 ± 25; M. Krecmerova,
H. Hrebacebecky, A. Holly, Collect. Czech. Chem. Commun. 1990, 55,
2521 ± 2536.
[6] The difference in melting temperature between the fully matched
triplex and a complex containing one G:C mismatch in the double
stranded DNA ds(GCTAAGAAGAGAGAGAGATCG) indicates a
decrease of 9.98C for the 2'-aminoethoxy-modified oligonucleotide
and a decrease of 2.48C for the unmodified DNA oligonucleotide
control.
[7] C. J. Guinosso, G. D. Hoke, S. Frier, J. F. Martin, D. J. Ecker, C. K.
Mirabelli, S. T. Crooke, P. D. Cook, Nucl. Nucleotides 1991, 10, 259 ±
262.
[8] P. Martin, Helv. Chim. Acta 1995, 78, 486 ± 504.
[9] A. Szabo, L. Stolz, R. Granzow, Curr. Opin. Struct. Biol. 1995, 5, 699 ±
705.
Â
[10] M. Rougee, B. Faucon, J.-L. Mergny, F. Barcelo, C. Giovannangeli, T.
 Á
Garestier, C. Helene, Biochemistry 1992, 31, 9269 ± 9278; L. E. Xodo,
Eur. J. Biochem. 1995, 228, 918 ± 926.
[11] Upon binding of oligonucleotide I to its duplex DNA target, we
observed by circular dichroism the appearance of two strong minima
at 220 and 265 nm, indicative of the formation of a triple-strand
complex: V. N. Soyfwer, V. N. Potaman, Triple-Helical Nucleic Acids,
1st ed., Springer, New York, 1995, pp. 54 ± 55.
[12] R. H. Griffey, B. P. Monia, L. L. Cummins, S. Freier, M. J. Greig, C. J.
Guinosso, E. Lesnik, S. M. Manalili, V. Mohan, S. Owens, B. R. Ross,
H. Sasmor, E. Wancewicz, K. Weiler, P. D. Wheeler, P. D. Cook, J.
Med. Chem. 1996, 39, 5100 ± 5109.
Treatment of a suspension of [Fe(CO)4(HgX)2] (X ˆ Cl, Br)
in toluene with tBuSSiMe3 affords a yellow-red solution
within a few days. Crystals of the iron ± mercury clusters 1 ± 3,
which were characterized by X-ray crystallography, were
grown directly from this solution or by layering with n-
heptane (Scheme 1).[11]
[13] U. Pieles, W. Zürcher, M. Schär, H. E. Moser, Nucleic Acids Res. 1993,
21, 3191 ± 3196.
[14] T. J. Povsic, P. B. Dervan, J. Am. Chem. Soc. 1989, 111, 3059 ± 3061.
[15] V. Fritsch, R. Wolf, J. Biomol. Struct. Dyn. 1994, 11, 1161 ± 1174.
[16] E. S. Priestley, P. B. Dervan, J. Am. Chem. Soc. 1995, 117, 4761 ± 4765.
New Iron ± Mercury Clusters:
[Hg7{Fe(CO)4}5(StBu)3Cl],
[Hg14Fe12{Fe(CO)4}6S6(StBu)8Br18], and
[Hg39Fe8{Fe(CO)4}18S8(StBu)14Br28]**
Scheme 1. Synthesis of the iron ± mercury clusters 1 ± 3.
Dieter Fenske* and Marco Bettenhausen
The reaction of [Fe(CO)4(HgCl)2] with tBuSSiMe3 leads to
a yellow solution from which orange needles of 1 (Figure 1)
crystallize. Compound 1 consists of an Hg3Fe2 (Hg5-Fe4-Hg6-
Fe5-Hg7) and an Hg4Fe3 fragment (Hg1-Fe1-Hg2-Fe2-Hg3-
Fe3-Hg4). These Hg ± Fe chains are linked together by three
sulfur atoms from the tBuS groups and a chlorine atom. The
chlorine atom is in the center of the molecule with Hg ± Cl
bond lengths of 298.2(7) ± 359.6(7) pm. These values lie
significantly above the sum of the ionic radii of Hg2‡ and
The reaction of coinage-metal salts with phosphanes and
silylated chalcogen derivatives has already led to a great
number of new compounds.[1] For example, the reaction of
PR3 complexes (R ˆ organic group) of copper and silver
[*] Prof. Dr. D. Fenske, Dipl.-Chem. M. Bettenhausen
Institut für Anorganische Chemie der Universität
Engesserstrasse Gebäude-Nr. 30.45, D-76128 Karlsruhe (Germany)
Fax: (‡49)721-661921
[**] This work was supported by the Deutsche Forschungsgemeinschaft
(SFB 195) and the Bundesministerium für Bildung, Wissenschaft,
Forschung und Technologie. We thank G. Baum for the preparation of
Figure 3.
Cl (Cl ± Hg1
302.5(7),
Cl ± Hg5
303.5(7),
Cl ± Hg7
298.2(7) pm) or in the range of the van der Waals radii (Cl ±
Hg2 3596(7), Cl ± Hg3 330.4(7), Cl ± Hg4 337.0(7), Cl ± Hg6:
348.7(7) pm). Thus, the Hg ± Cl bonds are very weak. In
Angew. Chem. Int. Ed. 1998, 37, No. 9
ꢀ WILEY-VCH Verlag GmbH, D-69451 Weinheim, 1998
1433-7851/98/3709-1291 $ 17.50+.50/0
1291