5-Hydroxyferulic acid methyl ester isolated from wasabi leaves inhibits 3T3-L1 adipocyte differentiation

Article abstract of DOI:10.1002/ptr.6060

To investigate the compounds present in wasabi leaves (Wasabia japonica Matsumura) that inhibit the adipocyte differentiation, activity-guided fractionation was performed on these leaves. 5-Hydroxyferulic acid methyl ester (1: 5-HFA ester), one of the phenylpropanoids, was isolated from wasabi leaves as a compound that inhibits the adipocyte differentiation. Compound 1 suppressed the intracellular lipid accumulation of 3T3-L1 cells without significant cytotoxicity. Gene expression analysis revealed that 1 suppressed the mRNA expression of 2 master regulators of adipocyte differentiation, PPARγ and C/EBPα. Furthermore, 1 downregulated the expression of adipogenesis-related genes, GLUT4, LPL, SREBP-1c, ACC, and FAS. Protein expression analysis revealed that 1 suppressed PPARγ protein expression. Moreover, to investigate the relationship between the structure and activity of inhibiting the adipocyte differentiation, we synthesized 12 kinds of phenylpropanoid analog. Comparison of the activity among 1 and its analogs suggested that the compound containing the substructure that possess a common functional group at the ortho position such as a catechol group exhibits the activity of inhibiting the adipocyte differentiation. Taken together, our findings suggest that 1 from wasabi leaves inhibits adipocyte differentiation via the downregulation of PPARγ.

Full text of DOI:10.1002/ptr.6060

Received: 9 November 2017
DOI: 10.1002/ptr.6060
Revised: 27 December 2017
Accepted: 23 January 2018
R E S E A R C H A R T I C L E
5‐Hydroxyferulic acid methyl ester isolated from wasabi leaves
inhibits 3T3‐L1 adipocyte differentiation
Naoki Misawa1* Takahiro Hosoya1* Shuhei Yoshida1 Osamu Sugimoto1
|
|
|
|
Tomoe Yamada‐Kato2 Shigenori Kumazawa1
|
1 Department of Food and Nutritional
To investigate the compounds present in wasabi leaves (Wasabia japonica Matsumura) that
inhibit the adipocyte differentiation, activity‐guided fractionation was performed on these
leaves. 5‐Hydroxyferulic acid methyl ester (1: 5‐HFA ester), one of the phenylpropanoids, was
isolated from wasabi leaves as a compound that inhibits the adipocyte differentiation.
Compound 1 suppressed the intracellular lipid accumulation of 3T3‐L1 cells without significant
cytotoxicity. Gene expression analysis revealed that 1 suppressed the mRNA expression of 2
master regulators of adipocyte differentiation, PPARγ and C/EBPα. Furthermore, 1 downregu-
lated the expression of adipogenesis‐related genes, GLUT4, LPL, SREBP‐1c, ACC, and FAS.
Protein expression analysis revealed that 1 suppressed PPARγ protein expression. Moreover,
to investigate the relationship between the structure and activity of inhibiting the adipocyte
differentiation, we synthesized 12 kinds of phenylpropanoid analog. Comparison of the activity
among 1 and its analogs suggested that the compound containing the substructure that possess
a common functional group at the ortho position such as a catechol group exhibits the activity
of inhibiting the adipocyte differentiation. Taken together, our findings suggest that 1 from
wasabi leaves inhibits adipocyte differentiation via the downregulation of PPARγ.
Sciences, University of Shizuoka, 52‐1 Yada,
Suruga‐ku, Shizuoka 422‐8526, Japan
2 Research and Development Division,
Kinjirushi Co. Ltd., 2‐61 Yahata‐hontori,
Nakagawa‐ku, Nagoya 454‐8526, Japan
Correspondence
Shigenori Kumazawa, Department of Food and
Nutritional Sciences, University of Shizuoka,
52‐1 Yada, Suruga‐ku, Shizuoka 422‐8526,
Japan.
Email: kumazawa@u‐shizuoka‐ken.ac.jp
KEYWORDS
3T3‐L1, 5‐hydroxyferulic acid methyl ester, adipocyte differentiation, leaf, phenylpropanoid,
Wasabia japonica Matsumura
|
1
INTRODUCTION
found (Moon et al., 2007; Yang et al., 2015). Treatment of 3T3‐L1
preadipocytes with dexamethasone, 3‐isobutyl‐1‐methylxanthine,
Excessive accumulation of fat leads to obesity. Obesity has become a
serious health problem mainly in developed countries as a risk factor
of hypertension (Uno et al., 2012), dyslipidemia (Klop, Elte, & Cabezas,
2013), and Type II diabetes (Kahn, Hull, & Utzschneider, 2006). There
is thus a need to prevent obesity to reduce the risk of these diseases.
Against this background, in spite of the differentiation of
preadipocytes into adipocytes eventually lead to the obesity, it was
revealed that thiazolidine derivatives used for the treatment of
diabetes promote the differentiation of preadipocytes into adipocytes
(Bhattarai et al., 2010). For these reasons, adipocyte differentiation
has attracted attention. 3T3‐L1 preadipocytes have generally been
used for studies of adipocyte differentiation, and numerous anti‐
differentiation compounds such as EGCg and soyasaponin have been
and insulin enhances the activities of peroxisome proliferator‐
activated receptor (PPAR) and CCAAT/enhancer binding protein
(C/EBP) gene families (Cao, Umek, & McKnight, 1991; Wu, Bucher,
& Farmer, 1996) and leads to their differentiation into adipocytes.
PPARγ and C/EBPα are well‐known as master regulators of
adipocyte differentiation (Rosen & MacDougald, 2006). In particu-
lar, PPARγ is necessary for adipocyte differentiation (Rosen et al.,
1999). Moreover, the expression of PPARγ and C/EBPα genes
has been shown to lead to the expression of adipogenesis‐related
genes including glucose transporter type 4 (GLUT4), lipoprotein
lipase (LPL), acetyl‐CoA carboxylase (ACC), and fatty acid synthase
(FAS) (Auwerx, Schoonjans, Fruchart,
& Staels, 1996; Rosen &
Spiegelman, 2000; Wu, Xie, Morrison, Bucher, & Farmer, 1998).
Therefore, the regulation of PPARγ expression is important in
controlling adipocyte differentiation.
*These authors contributed equally to this work.
Phytotherapy Research. 2018;1–7.
wileyonlinelibrary.com/journal/ptr
Copyright © 2018 John Wiley & Sons, Ltd.
1

2
MISAWA ET AL.
Wasabia japonica Matsumura is
a
plant of Japanese origin
preadipocytes. Furthermore, Yamasaki et al. (2013) reported that
hot‐water extract of wasabi leaves exhibited an anti‐obesity effect
in a study using C57/BL mice. Additionally, Yamada‐Kato et al.
(2016) reported that 50% ethanol extract of wasabi leaves showed
an anti‐obesity effect via upregulation of the mRNA expression of
β3‐adrenergic receptor (β3AR) in interscapular brown adipose tissue.
These studies have boosted interest in the potential beneficial
effects of wasabi leaves, including those against obesity. Therefore,
we investigated the compounds present in wasabi leaves that inhibit
the adipocyte differentiation and the molecular mechanisms underly-
ing such activity using 3T3‐L1 preadipocytes.
belonging to the Brassicaceae family. Wasabi rhizome is widely
eaten as a garnish of sushi or sashimi in Japan, because it exhibits
strong pungency derived from allyl isothiocyanates produced by
the reaction of myrosinase and sinigrin. In addition, wasabi rhizome
contains various isothiocyanates, which have been reported to
exhibit many physiological functions, including antimicrobial (Inoue
et al., 1983), antiplatelet (Morimitsu et al., 2000), anticancer
(Morimitsu et al., 2000), and anti‐allergic activities (Nagai & Okunishi,
2009; Yamada‐Kato, Nagai, Ohnishi, & Yoshida, 2012). In contrast,
wasabi leaves are mostly discarded because they contain little
isothiocyanates. However, several studies on the components and
functionalities of wasabi leaves have been conducted recently,
|
2
MATERIALS AND METHODS
Materials
showing that they contain flavonoids (Hosoya, Yun,
& Kunugi,
2005), phenylpropanoids (Hosoya, Yun, & Kunugi, 2008), terpenoids
(Yoshida, Hosoya, Inui, Masuda, & Kumazawa, 2015), and caroten-
oids (Yoshida et al., 2015). Meanwhile, the functional studies
revealed that their effects include antioxidant (Hosoya et al., 2008)
and anti‐inflammatory activities (Yoshida et al., 2015). Interestingly,
5‐hydroxyferulic acid methyl ester (1: 5‐HFA ester; Figure 1), one
of the phenylpropanoids isolated from wasabi leaves, but not
isolated from other plants, showed both of these types of activity
(Hosoya et al., 2008; Yoshida et al., 2015). Studies have also
revealed that wasabi leaves exert various types of anti‐obesity
activity. For example, Ogawa et al. (2010) reported that a hot‐water
extract of wasabi leaves suppressed the differentiation of 3T3‐L1
|
2.1
The W. japonica Matsumura leaves used in this study were collected in
Shizuoka, Japan, in April 2012.
|
2.2
NMR spectroscopy
1H (400 MHz) and 13C nuclear magnetic resonance (NMR; 100 MHz)
spectra, as well as all 2D NMR spectra, were recorded on a Bruker
AVANCE III 400 spectrometer (Bruker BioSpin, Billerica, MA, USA).
Standard pulse sequences and parameters were used for the
experiments. The chemical shift values (δ) are reported in ppm, and
the coupling constants (J) are reported in Hz. The chemical shifts in
the 1H and 13C NMR spectra have been corrected using the residual
solvent signals of methanol‐d4 (δH 3.31, δC 49.0).
|
2.3
Cell culture and adipocyte differentiation
Murine preadipocyte 3T3‐L1 cells were cultured in Dulbecco's
modified Eagle's medium (Wako Pure Chemicals, Osaka, Japan) supple-
mented with 10% fetal bovine serum and penicillin (10 U/ml)/strepto-
mycin (100 μg/ml). 3T3‐L1 cells were seeded into a 96‐well plate at
1 × 105 cells in 100 μl per well and preincubated for 1 day at 37 °C
in a humidified atmosphere containing 5% CO2. After the medium
had been removed (Day 0), cells were cultured in the differentiation
medium (containing 1 μM dexamethasone and 0.5 mM 3‐isobutyl‐1‐
methylxanthine) with or without various concentrations of the test
samples dissolved in dimethyl sulfoxide (DMSO) for 2 days. The con-
centration of DMSO in the medium was 0.1%. After 2 days (Day 2),
the medium was removed and replaced with 100 μl of the
maintenance medium (containing 10 μg/ml insulin) with or without
the test samples. After incubating the cells for 3 days (Day 5), the
medium was changed to fresh maintenance medium, followed by
3 days of incubation.
FIGURE 1 Chemical structures of phenylpropanoid analogs and their
IC50 values of lipid accumulation (%). Compounds 2, 5, and 7 were
purchased from Sigma‐Aldrich (Tokyo, Japan). Compounds 4 and 9
were obtained by the demethylation of 2 with BBr3. Compound 1
was obtained by the methylation of 4 with
|
2.4
Cell viability assay
Cell viability was determined using a Cell Counting Kit‐8 (Dojindo
Laboratories, Kumamoto, Japan). After the culture medium had been
removed, 100 μl of phosphate‐buffered saline containing 2 μl of
WST‐8 solution was added to each well, and the cells were incubated
trimethylsilyldiazomethane. Compounds 3, 6, 8, 10, 11, and 12 were
synthesized by methylation using trimethylsilyldiazomethane. The
IC50 values of lipid accumulation were calculated as 100% cell
viability and are presented as the mean (n = 3)

MISAWA ET AL.
3
for 3 hr at 37 °C. The absorbance at 450 nm was measured using a
Spectra Max 190 microplate reader (Molecular Devices, Sunnyvale,
CA, USA). All experiments were performed in triplicate for each
sample. The proportion of living cells was determined from the
difference in the absorbance values of the samples and the controls
(0.1% DMSO).
by 10% polyacrylamide gel and transferred to
a
polyvinylidine
difluoride membrane. After blocking with TBST (10 mM Tris, 100 mM
NaCl, and 0.1% Tween 20) that contained 5% skimmed milk for 1 hr
at room temperature, the membrane was incubated with dilute solu-
tions of primary antibodies against β‐actin and PPARγ (Santa Cruz Bio-
technology, Santa Cruz, CA, USA) overnight at 4 °C. β‐actin was used
as an internal control. The membrane was then incubated with dilute
solutions of horseradish‐peroxidase‐conjugated secondary antibodies
for 1 hr at room temperature. The protein bands were visualized using
a chemiluminescent detection reagent.
|
2.5
Oil Red O staining
After the measurement of cell viability, intracellular lipid droplets were
stained with Oil Red O (Sigma‐Aldrich, Tokyo, Japan), as described
below. The cells were fixed with 100 μl of 4% formalin overnight at
4 °C. After removing the formalin, the cells were washed with 60%
isopropanol and incubated with 50 μl of Oil Red O solution for
10 min at room temperature. Each well was washed with Milli‐Q water
3 times and dried. Fifty microliters of isopropanol was added to each
well, and the absorbance of each well was measured at 520 nm using
a Spectra Max 190 microplate reader. All experiments were performed
in triplicate for each sample. The level of lipid production was
determined from the difference in the absorbance values of the
samples and the controls (0.1% DMSO).
|
2.8
Quantitative analysis of 5‐HFA ester using
LC–MS
The high‐resolution electrospray ionization mass spectra were
recorded using an Accela liquid chromatography (LC) system
(Thermo Fisher Scientific, Waltham, MA, USA) equipped with a
quadrupole mass spectrometer, Q‐Exactive (Thermo Fisher Scien-
tific). Xcalibur software was used for system control and data analy-
sis. LC separation was performed on an ACQUITY UPLC BEH C18
column (2.1 × 100 mm, 1.7 μm; Waters, Milford, MA, USA). The
mobile phase consisted of (a) 0.1% formic acid in H2O and (b)
0.1% formic acid in acetonitrile. The gradient elution program was
as follows: 0–1 min, 2% B; 1–16 min, 2–98% B. The column temper-
ature was maintained at 40 °C. The flow rate was 0.4 ml/min, and
the injection volume was 5 μl. MS detection was performed on a
quadrupole mass spectrometer, Q‐Exactive, equipped with an ESI
interface. Compound 1 was monitored under negative ion mode
and quantified in selected ion monitoring mode: m/z 223.0587–
223.0631. Other parameters of the mass spectrometer were as
follows: sheath gas, 40 Arb; auxiliary gas, 10 Arb; spray voltage,
2,000 V; vaporizer temperature, 300 °C; capillary temperature,
350 °C; and resolution, 70,000.
|
2.6
Real‐time reverse transcription‐polymerase
chain reaction
Total RNA was extracted from 3T3‐L1 cells using CellAmp Direct RNA
Prep Kit for reverse transcription‐polymerase chain reaction (Takara
Bio, Kusatsu, Japan), in accordance with the manufacturer's
instructions and was reverse‐transcribed into cDNA using
a
PrimeScript® RT reagent kit (Takara Bio). The generated cDNA was
subjected to PCR using SYBR® Premix DimerEraser (Takara Bio) and
primers (Table 1). The PCR amplification was carried out in a Thermal
Cycler Dice Real Time System II (Takara Bio) under the following
conditions: 95 °C for 30 s followed by 45 cycles of 95 °C for 5 s,
60 °C for 30 s, 72 °C for 30 s. The relative levels of mRNA expression
were normalized to β‐actin in each sample and expressed as a
proportion relative to that in uninduced cells (preadipocytes, Day 0),
as calculated by the ΔΔCt method.
Dried wasabi leaves (10 mg) were extracted with 500 μl of
MeOH by stirring for 30 s, sonication for 5 min, and centrifugation
for 5 min twice. The supernatant was dried with nitrogen gas. The
MeOH extract was redissolved with 1 ml of MeOH, filtered through
a 0.20‐μm membrane filter, and then injected into the LC–MS. To
correct the obtained results by the rate of recovery of 1 from the
wasabi leaves, 1 was spiked to the wasabi leaves, and the same
preparation was carried out. The content of 1 was determined by
an external standard method. Calibration curves in the 5‐ to 100‐
|
2.7
Western blot analysis
Total cellular proteins from 3T3‐L1 cells were extracted with RIPA
buffer (Nacalai Tesque, Kyoto, Japan). Protein extracts were separated
TABLE 1 Sequences of primers used for reverse transcription‐polymerase chain reaction
Gene name
Accession no.
Forward primer (5′–3′)
Reverse primer (5′–3′)
β‐actin
PPARγ
C/EBPα
GLUT4
LPL
NM_007393
NM_011146
NC_000073
NM_009204
M60845
CCTGTGCTGCTCACCGAGGC
TGTCGGTTTCAGAAGTGCCTTG
CGCAAGAGCCGAGATAAAGC
ACGACGGACACTCCATCTGTTG
TGGATGAGCGACTCCTACTTCA
CAGCACAGCAACCAGAAGC
GGGCACAGACCGTGGTAGTT
GTGACCGCCATCTATATCG
GACCCCGTCTCTCCGGAGTCCATC
TTCAGCTGGTCGATATCACTGGAG
CACGGCTCAGCTGTTCCA
GGAGACATAGCTCATGGCTGGAA
CGGATCCTCTCGATGACGAA
CCTCCTCCACTGCCACAAG
SREBP‐1c
ACC
NM_011481
NM_133360
NM_007989
CAGGATCAGCTGGGATACTGAGT
CTGTCGTCTGTAGTCTTGAG
FAS

4
MISAWA ET AL.
ng/ml range had good linearity (R2 > 0.999) for a three‐point plot.
The lower limit of quantification was set as a signal‐to‐noise ratio
of 10.
|
3
RESULTS
|
3.1
Identification and quantification of compounds
in wasabi leaves that inhibit the adipocyte
differentiation
|
2.9
Chemical synthesis of 5‐HFA ester and its analogs
Activity‐guided fractionation from the MeOH extract of wasabi leaves
obtained from the study by Yoshida et al. (2015) was performed.
Compound 1 was isolated from the EtOAc extract. To determine the
Sinapic acid (2, 900 mg, 4 mmol) was suspended in 30 ml of
super‐dehydrated CH2Cl2 (Wako Pure Chemicals) under argon
atmosphere. Boron tribromide (BBr3, 6.6 ml of 1 M) in CH2Cl2
solution (Wako Pure Chemicals) was then added dropwise with
constant stirring at −78 °C. The solution was further stirred at
room temperature for 24 hr. Then hydrochloric acid (6 ml of
1 M) was added and subjected to continuous stirring at room tem-
perature for 2 hr. After the reaction, the production of a precipi-
tate was observed. The biphasic solution and precipitate were
divided by decantation to obtain the precipitate, which was then
dissolved in H2O. Next, the H2O fraction, CH2Cl2 fraction, and pre-
cipitate solution were analysed by thin layer chromatography (TLC)
to confirm which fraction contained 5‐HFA (4). The results con-
firmed that the H2O fraction and the precipitate solution contained
4. Thus, the H2O fraction and the precipitate solution were
adjusted to pH 3 with 0.1 M sodium hydroxide, and then EtOAc
was added to transfer 4 from H2O to EtOAc. After confirmation
by TLC analysis that 4 had been transferred to EtOAc, the EtOAc
fraction was dehydrated using anhydrous sodium sulfate. High‐per-
formance liquid chromatography (HPLC) chromatograms of EtOAc
fractions derived from the H2O fraction and the precipitate
solution were similar, and hence, these fractions were combined,
and 4 was purified by HPLC. Compound 4 (87.2 mg, 0.42 mmol)
was obtained in a 10.4% yield. Moreover, 3,4,5‐trihydroxycinnamic
acid (9, 85.6 mg, 0.44 mmol) was obtained as a byproduct in a
10.9% yield. Then 4 (35 mg, 0.17 mmol) was dissolved in 3.5 ml
of MeOH. Trimethylsilyldiazomethane (TMSD; 2.2 ml of 10%) in
hexane solution (Tokyo Chemical Industry, Tokyo, Japan) was then
added dropwise with constant stirring at room temperature. After
confirmation by TLC analysis that the spot of 4 had disappeared,
the solution after the reaction had its solvent removed and was
redissolved in MeOH for the purification of 1 by HPLC. Com-
pound 1 (24.1 mg, 0.11 mmol) was obtained in a 64.6% yield.
Sinapic acid (2), caffeic acid (5), and ferulic acid (7) were purchased
from Sigma‐Aldrich. Sinapic acid methyl ester (3) and trimethoxy-
cinnamic acid methyl ester (12) were synthesized by methylation
of 2 using TMSD. Caffeic acid methyl ester (6), isoferulic acid
methyl ester (8), and dimethoxycinnamic acid methyl ester (11)
cytotoxicity of
1 and its activity of inhibiting the adipocyte
differentiation, 3T3‐L1 cells were treated with it at a concentration
of 25–100 μM. As shown in Figure 2, 1 decreased lipid accumulation
in a dose‐dependent manner at concentrations of 25–100 μM with
no cytotoxicity. The IC50 value of 1 was determined to be 63 μM.
Quantitative analysis using LC–MS revealed that 2.2 0.1 μg of 1
was present in 1 g of dried wasabi leaves.
|
3.2
Effect of 5‐HFA ester (1) on the expression of
adipocyte differentiation‐ and adipogenesis‐related
genes in 3T3‐L1 cells
To identify the mechanism involved in the activity of inhibiting the
adipocyte differentiation of 1, gene expression was analysed by
reverse transcription‐polymerase chain reaction. As shown in
Figure 3a, the mRNA expression of PPARγ and C/EBPα, two transcrip-
tion factors that are important in the regulation of adipocyte
differentiation, was suppressed significantly by treatment with
100 μM 1. Next, we examined the protein expression level of PPARγ
using western blot analysis. Treatment with 100 μM 1 suppressed
the protein expression of PPARγ (Figure 3b). We also evaluated the
mRNA expression of adipogenesis‐related genes, including GLUT4,
LPL, SREBP‐1c, ACC, and FAS. The expression of all of these genes
was suppressed by treatment with 100 μM 1 (Figure 4).
were synthesized by methylation of
5 using TMSD. 3,4,5‐
Trihydroxycinnamic acid methyl ester (10) were synthesized by
methylation of 9 using TMSD.
FIGURE 2 Effect of 1 on lipid accumulation and cell viability in 3T3‐L1
cells. 3T3‐L1 cells were incubated with 25–100 μM 1 for 8 days. Cell
viability was evaluated using a Cell Counting Kit‐8 on Day 8. The
intracellular lipid accumulation was measured by Oil Red O staining on
Day 9. The results are expressed as a percentage relative to that of
control cells and are presented as mean standard deviation (n = 3)
|
2.10
Statistical analysis
Experimental values are expressed as the mean standard deviation.
Statistical analysis was performed using Student's t test. Values of
p < .05 were considered to represent statistical significance.

MISAWA ET AL.
5
FIGURE 3 Effect of 1 on the expression of adipocyte differentiation‐
related genes in 3T3‐L1 cells. 3T3‐L1 cells were incubated with
100 μM 1 for 8 days. (a) Total RNA was extracted from 3T3‐L1 cells on
Days 1 and 6. The mRNA expression levels of adipocyte
differentiation‐related genes, PPARγ and C/EBPα, were analysed by
reverse transcription‐polymerase chain reaction and normalized to β‐
actin. The results are expressed relative to the levels of uninduced cells
(Day 0 control) and are presented as mean standard deviation (n = 3).
**p < .01 and ***p < .001, compared with the control. (b) Total cellular
proteins were extracted from 3T3‐L1 cells on Day 8. The level of
PPARγ protein expression was analysed by western blotting
FIGURE 4 Effect of 1 on the expression of adipogenesis‐related genes
in 3T3‐L1 cells. 3T3‐L1 cells were incubated with 100 μM 1 for 6 days.
Total RNA was extracted from 3T3‐L1 cells on Days 1 and 6. The
mRNA expression levels of adipogenesis‐related genes, GLUT4, LPL,
SREBP‐1c, ACC, and FAS, were analysed by reverse transcription‐
polymerase chain reaction and normalized to β‐actin. The results are
expressed relative to the levels of uninduced cells (Day 0 control) and
are presented as mean standard deviation (n = 3). *p < .05, **p < .01,
and ***p < .001, compared with the control
|
3.3
Activities of phenylpropanoid analogs against
the adipocyte differentiation
To investigate the relationship between the structure and activity of
inhibiting the adipocyte differentiation, a cell viability assay and Oil
Red O staining using 3T3‐L1 cells treated with 25–100 μM of the 11
different analogs of 1 were performed (Figure 1). Among these ana-
logs, the IC50 values of 4, 6, 9, and 12 were determined to be less than
100 μM. Compound 6 (IC50 = 46 μM) showed the highest activity of
inhibiting the adipocyte differentiation among the 12 kinds of
phenylpropanoid. Slight effects were observed in the treatment with
10 and 11. Compounds 2, 3, 5, 7, and 8 had little effect on the activity
of inhibiting the adipocyte differentiation.
regulation of adipocyte differentiation, namely, PPARγ and C/EBPα,
as shown in Figure 3. Moreover, 1 suppressed expression of the
PPARγ protein. These results suggested that 1 exerts its anti‐
differentiation effects by regulating PPARγ expression. However, it
is not clear whether 1 directly acts on PPARγ. It is thus necessary
to clarify the target molecule of 1 by evaluating the expression of
genes located upstream of PPARγ, such as C/EBPβ, C/EBPδ, the
KLF family, and the GATA family (Matsuo, Kondo, Kawasaki,
Tokuyama, & Imamura, 2015). Incidentally, Ilavenil et al. (2016)
reported that coumaric acid, an analog of 1, might downregulate
|
4
DISCUSSION
In the present study, we found that 1 is one of the compounds in
wasabi leaves that inhibit the adipocyte differentiation. Compound 1
suppressed two transcription factors that are important in the

6
MISAWA ET AL.
PPARγ2 expression through hydrogen and hydrophobic interactions
with the PPARγ2 receptor domain. Thus, among the active
compounds found in this study, there may be compounds showing
a similar mechanism of action to exert their activity of inhibiting
the adipocyte differentiation. Compound 1 also inhibited the mRNA
expression of adipogenesis‐related genes, including GLUT4, LPL,
SREBP‐1c, ACC, and FAS. Ji, Doumit, and Hill (2015) reported that
increased expression of SREBP‐1c leads to the activation of PPARγ.
Therefore, it is possible that 1 acts on SREBP‐1c. In addition,
SREBP‐1c is regulated by insulin signaling (Czech, Tencerova,
In conclusion, 1 present in wasabi leaves was revealed to inhibit
adipocyte differentiation. Future investigations of wasabi leaves and
1 as anti‐obesity agents are anticipated.
ACKNOWLEDGEMENTS
We thank Dr. Toshiro Ohta (University of Shizuoka) for technical
assistance with the experiments. We also thank Dr. Yuko
Shimamura and Prof. Shuichi Masuda (University of Shizuoka) for
providing PCR primers.
Pedersen, & Aouadi, 2013), so examining the effects of
1 on
CONFLICT OF INTEREST
SREBP‐1c regulatory factors may reveal the mechanism behind the
activity of inhibiting the adipocyte differentiation of 1.
The authors have declared that there is no conflict of interest.
Comparison of the activity between 1 and its analogs revealed
that almost all active compounds contain the substructure that
possesses a common functional group at the ortho position such as
catechol and veratrole groups. However, Nishina et al. (2015) reported
that among the flavonoids containing the catechol group, luteolin
suppressed lipid accumulation of 3T3‐L1 cells, whereas tricetin
promoted lipid accumulation. Therefore, we think that further
investigation is necessary to elucidate the structure–activity
relationship applicable to compounds of several skeletons. In
phenylpropanoids, as with 6 and 10, the intensity of activity changed
depending on the number of functional groups. The intensity of
activity also changed in association with structural differences of the
carboxylic acid moiety, as in the case of 5 and 6. Thus, it was suggested
that the activity depends not only on the catechol or veratrole groups
but also on the polarity of the whole structure. Juman et al. (2010)
reported that caffeic acid 2‐phenylethyl ester significantly inhibited
lipid accumulation of 3T3‐L1 cells at 50 μM. Furthermore, Imai et al.
(2015) reported that caffeic acid 6‐phenylhexyl ester and caffeic acid
decyl ester, both at a concentration of 4 μM, suppressed lipid
accumulation by 46% and 75%, respectively. Additionally, 3,4,5‐
trihydroxycinnamic acid decyl ester at a concentration of 4 μM also
suppressed lipid accumulation by 84%. Therefore, it is considered that
the activity is strengthened by replacing the carboxylic acid moiety
with a low‐polarity alkyl group. Caffeic acid derivatives are present in
wasabi leaves as glycosides (Yoshida et al., 2015); thus, there may be
a need to perform further investigation of wasabi leaves, including of
the extraction conditions and the sample treatment, to discover com-
pounds that are more effective at inhibiting adipocyte differentiation.
Regarding studies on the anti‐obesity effect of wasabi leaves,
Ogawa et al. (2010) reported that a hot‐water extract of wasabi leaves
suppressed the differentiation of 3T3‐L1 preadipocytes. Moreover,
Yamasaki et al. (2013) reported that an anti‐obesity effect was
observed in C57/BL mice fed a high‐fat diet containing a hot‐water
extract of wasabi leaves, possibly due to the suppression of lipid
accumulation in liver and white adipose tissue. Although 1 may exert
these effects, its content was determined to be 2.2 0.1 μg/g of dried
wasabi leaves in this study. Therefore, it is unable to explain the whole
activity of crude extract of wasabi leaves with 1 only. We consider that
1 is just only one of the active compounds present in wasabi leaves.
However, we confirmed that several other fractions showed the activ-
ity of inhibiting the adipocyte differentiation. Studies of the elucidation
of other active compounds present in these fractions are in progress.
ORCID
Shigenori Kumazawa http://orcid.org/0000-0001-9687-9619
REFERENCES
Auwerx, J., Schoonjans, K., Fruchart, J. C., & Staels, B. (1996). Regulation of
triglyceride metabolism by PPARs: Fibrates and thiazolidinediones have
distinct effects. Journal of Atherosclerosis and Thrombosis, 3(2), 81–89.
Bhattarai, B. R., Kafle, B., Hwang, J. S., Ham, S. W., Lee, K. H., Park, H., …
Cho, H. (2010). Novel thiazolidinedione derivatives with anti‐obesity
effects: Dual action as PTP1B inhibitors and PPAR‐γ activators.
Bioorganic & Medicinal Chemistry Letters, 20(22), 6758–6763.
Cao, Z., Umek, R. M., & McKnight, S. L. (1991). Regulated expression of
three C/EBP isoforms during adipose conversion of 3T3‐L1 cells. Genes
& Development, 5(9), 1538–1552.
Czech, M. P., Tencerova, M., Pedersen, D. J., & Aouadi, M. (2013). Insulin
signalling mechanisms for triacylglycerol storage. Diabetologia, 56(5),
949–964.
Hosoya, T., Yun, Y. S., & Kunugi, A. (2005). Five novel flavonoids from
Wasabia japonica. Tetrahedron, 61(29), 7037–7044.
Hosoya, T., Yun, Y. S., & Kunugi, A. (2008). Antioxidant phenylpropanoid
glycosides from the leaves of Wasabia japonica. Phytochemistry, 69(3),
827–832.
Ilavenil, S., da Kim, H., Srigopalram, S., Arasu, M. V., Lee, K. D., Lee, J. C., …
Choi, K. C. (2016). Potential application of p‐coumaric acid on differen-
tiation of C2C12 skeletal muscle and 3T3‐L1 preadipocytes‐an in vitro
and in silico approach. Molecules, 21(8), 997.
Imai, M., Kumaoka, T., Hosaka, M., Sato, Y., Li, C., Sudoh, M., … Takahashi,
N. (2015). Inhibitory effects of hydroxylated cinnamoyl esters on lipid
absorption and accumulation. Bioorganic
23(13), 3788–3795.
& Medicinal Chemistry,
Inoue, S., Goi, H., Miyauchi, K., Muraki, S., Ogihara, M., & Iwatani, Y. (1983).
Inhibitory effect of volatile constituents of plants on the proliferation of
bacteria. Journal of antibacterial and antifungal agents, 11(11), 609–615.
Ji, S., Doumit, M. E., & Hill, R. A. (2015). Regulation of adipogenesis and key
adipogenic gene expression by 1, 25‐dihydroxyvitamin D in 3T3‐L1
cells. PLoS One, 10(6), e0126142.
Juman, S., Yasui, N., Okuda, H., Ueda, A., Negishi, H., Miki, T., & Ikeda, K.
(2010). Caffeic acid phenethyl ester inhibits differentiation to adipo-
cytes in 3T3‐L1 mouse fibroblasts. Biological and Pharmaceutical
Bulletin, 33(9), 1484–1488.
Kahn, S. E., Hull, R. L., & Utzschneider, K. M. (2006). Mechanisms linking
obesity to insulin resistance and type 2 diabetes. Nature, 444(7121),
840–846.
Klop, B., Elte, J. W., & Cabezas, M. C. (2013). Dyslipidemia in obesity:
Mechanisms and potential targets. Nutrients, 5(4), 1218–1240.
Matsuo, H., Kondo, Y., Kawasaki, T., Tokuyama, S., & Imamura, N. (2015).
Borrelidin isolated from Streptomyces sp. inhibited adipocyte

MISAWA ET AL.
7
differentiation in 3T3‐L1 cells via several factors including GATA‐bind-
ing protein 3. Biological and Pharmaceutical Bulletin, 38(10), 1504–1511.
fibroblasts into adipocytes is mediated by C/EBPβ, C/EBPδ, and gluco-
corticoids. Molecular and Cellular Biology, 16(8), 4128–4136.
Moon, H. S., Chung, C. S., Lee, H. G., Kim, T. G., Choi, Y. J., & Cho, C. S.
(2007). Inhibitory effect of (−)‐epigallocatechin‐3‐gallate on lipid accu-
mulation of 3T3‐L1 cells. Obesity, 15(11), 2571–2582.
Wu, Z., Xie, Y., Morrison, R. F., Bucher, N. L., & Farmer, S. R. (1998). PPARγ
induces the insulin‐dependent glucose transporter GLUT4 in the
absence of C/EBPα during the conversion of 3T3 fibroblasts into adipo-
cytes. Journal of Clinical Investigation, 101(1), 22–32.
Morimitsu, Y., Hayashi, K., Nakagawa, Y., Fujii, H., Horio, F., Uchida, K., &
Osawa, T. (2000). Antiplatelet and anticancer isothiocyanates in
Japanese domestic horseradish, wasabi. Mechanisms of Ageing and
Development, 116(2–3), 125–134.
Yamada‐Kato, T., Momoi, S., Okunishi, I., Minami, M., Oishi, Y., Osawa, T., &
Naito, M. (2016). Anti‐obesity effects of wasabi leaf extract on rats fed
a high‐fat diet are related to upregulation of mRNA expression of β3‐
adrenergic receptors in interscapular brown adipose tissue. Food Sci-
ence and Technology Research, 22(5), 665–671.
Nagai, M., & Okunishi, I. (2009). The effect of wasabi rhizome extract on
atopic dermatitis‐like symptoms in HR‐1 hairless mice. Journal of Nutri-
tional Science and Vitaminology, 55(2), 195–200.
Yamada‐Kato, T., Nagai, M., Ohnishi, M., & Yoshida, K. (2012). Inhibitory
effects of wasabi isothiocyanates on chemical mediator release in
RBL‐2H3 rat basophilic leukemia cells. Journal of Nutritional Science
and Vitaminology, 58(4), 303–307.
Nishina, A., Ukiya, M., Fukatsu, M., Koketsu, M., Ninomiya, M., Sato, D., …
Kimura, H. (2015). Effects of various 5,7‐dihydroxyflavone analogs on
adipogenesis in 3T3‐L1 cells. Biological and Pharmaceutical Bulletin,
38(11), 1794–1800.
Yamasaki, M., Ogawa, T., Wang, L., Katsube, T., Yamasaki, Y., Sun, X., &
Shiwaku, K. (2013). Anti‐obesity effects of hot water extract from
Wasabi (Wasabia japonica Matsum.) leaves in mice fed high‐fat diets.
Nutrition research and practice, 7(4), 267–272.
Ogawa, T., Tabata, H., Katsube, T., Ohta, Y., Yamasaki, Y., Yamasaki, M., &
Shiwaku, K. (2010). Suppressive effect of hot water extract of wasabi
(Wasabia japonica Matsum.) leaves on the differentiation of 3T3‐L1
preadipocytes. Food Chemistry, 118(2), 239–244.
Yang, S. H., Ahn, E. K., Lee, J. A., Shin, T. S., Tsukamoto, C., Suh, J. W., …
Chung, G. (2015). Soyasaponins Aa and Ab exert an anti‐obesity effect
in 3T3‐L1 adipocytes through downregulation of PPARγ. Phytotherapy
Research, 29(2), 281–287.
Rosen, E. D., & MacDougald, O. A. (2006). Adipocyte differentiation
from the inside out. Nature Reviews Molecular Cell Biology, 7(12),
885–896.
Yoshida, S., Hosoya, T., Inui, S., Masuda, H., & Kumazawa, S. (2015). Com-
ponent analysis of wasabi leaves and an evaluation of their anti‐
inflammatory activity. Food Science and Technology Research, 21(2),
247–253.
Rosen, E. D., Sarraf, P., Troy, A. E., Bradwin, G., Moore, K., Milstone, D.
S., … Mortensen, R. M. (1999). PPARγ is required for the differen-
tiation of adipose tissue in vivo and in vitro. Molecular Cell, 4(4),
611–617.
Rosen, E. D., & Spiegelman, B. M. (2000). Molecular regulation of adipogen-
esis. Annual Review of Cell and Developmental Biology, 16, 145–171.
How to cite this article: Misawa N, Hosoya T, Yoshida S,
Sugimoto O, Yamada‐Kato T, Kumazawa S. 5‐Hydroxyferulic
acid methyl ester isolated from wasabi leaves inhibits 3T3‐L1
adipocyte differentiation. Phytotherapy Research. 2018;1–7.
https://doi.org/10.1002/ptr.6060
Uno, K., Yamada, T., Ishigaki, Y., Imai, J., Hasegawa, Y., Gao, J., …
Katagiri, H. (2012). Hepatic peroxisome proliferator‐activated
receptor‐γ‐fat‐specific protein 27 pathway contributes to obesity‐
related hypertension via afferent vagal signals. European Heart Jour-
nal, 33(10), 1279–1289.
Wu, Z., Bucher, N. L., & Farmer, S. R. (1996). Induction of peroxisome
proliferator‐activated receptor
γ during the conversion of 3T3