Structure-based discovery of triphenylmethane derivatives as inhibitors of hepatitis C virus helicase

Article abstract of DOI:10.1021/jm8011905

Hepatitis C virus nonstructural protein 3 (HCV NS3) helicase is believed to be essential for viral replication and has become an attractive target for the development of antiviral drugs. A fluorescence resonant energy transfer helicase assay was establish

Full text of DOI:10.1021/jm8011905

2716
J. Med. Chem. 2009, 52, 2716–2723
Structure-Based Discovery of Triphenylmethane Derivatives as Inhibitors of Hepatitis C Virus
Helicase∞
Chien-Shu Chen,†,# Chun-Tang Chiou,†,b Grace Shiahuy Chen,‡ Sheng-Chia Chen,§ Chih-Yung Hu,§ Wei-Kuang Chi,¶
Yi-Ding Chu,¶ Lih-Hwa Hwang,| Pei-Jer Chen,| Ding-Shinn Chen,*,| Shwu-Huey Liaw,*,§ and Ji-Wang Chern*,†,
School of Pharmacy, College of Medicine, National Taiwan UniVersity, Taipei, Taiwan, Department of Applied Chemistry, ProVidence
UniVersity, Shalu, Taiwan, Structural Biology Program, Faculty of Life Science, National Yang-Ming UniVersity, Taipei, Taiwan, Process
DeVelopment DiVision, DeVelopment Center for Biotechnology, Taipei, Taiwan, Department of Internal Medicine, College of Medicine,
Hepatitis Research Center, National Taiwan UniVersity Hospital, National Taiwan UniVersity, Taipei, Taiwan, and Department of Life Science,
College of Life Science, National Taiwan UniVersity, Taipei, Taiwan
ReceiVed September 20, 2008
Hepatitis C virus nonstructural protein 3 (HCV NS3) helicase is believed to be essential for viral replication
and has become an attractive target for the development of antiviral drugs. A fluorescence resonant energy
transfer helicase assay was established for fast screening of putative inhibitors selected from virtual screening
using the program DOCK. Soluble blue HT (1) was first identified as a novel HCV helicase inhibitor.
Crystal structure of the NS3 helicase in complex with soluble blue HT shows that the inhibitor bears a
significantly higher binding affinity mainly through a 4-sulfonatophenylaminophenyl group, and this is
consistent with the activity assay. Subsequently, fragment-based searches were utilized to identify
triphenylmethane derivatives for more potent inhibitors. Lead optimization resulted in a 3-bromo-4-hydroxyl
substituted derivative 12 with an EC50 value of 2.72 µM to Ava.5/Huh-7 cells and a lower cytotoxicity to
parental Huh-7 cells (CC50 ) 10.5 µM), and it indeed suppressed HCV replication in the HCV replicon
cells. Therefore, these inhibitors with structural novelty may serve as a useful scaffold for the discovery of
new HCV NS3 helicase inhibitors.
Introduction
Although rapid and potent in inhibition of HCV replication,
the development of resistance becomes the main issue just
like with most antiviral drugs. Some of the potent HCV
protease inhibitors10 or NS5B polymerase inhibitors11 have
encountered drug resistance. Targeting a viral helicase
required for viral replication might overcome the resistance
problem.12 HCV nonstructural protein 3 (HCV NS3) helicase
plays an essential role in viral replication and, therefore,
represents a potential antiviral drug target. Bisbenzimidazole
derivatives were the first HCV helicase inhibitors reported
with IC50 values ranging from 0.7 to 10 µM,13 while their
interactive mode is still uncertain.14 Several 5-amino-1,2,4-
thiadiazoliums were also reported as HCV helicase inhibitors
with modest potency (IC50 ) 25-75 µM).15 By random
sampling, halogenated benzotriazole16 and benzotriazole
nucleoside analogues17 have been identified as HCV helicase
inhibitors with IC50 values of 20 and 1.5 µM, respectively.
Recently, a nucleotide-mimicking inhibitor QU663 was found
as a potent selective HCV helicase inhibitor (Ki ) 0.75 µM)
by competing with the substrate.18 In addition, intercalating
agents epirubicin and nogalamycin are effective helicase
inhibitors through the inhibition of RNA unwinding.19
However, the high cytotoxicity excludes their application in
HCV therapy.
Hepatitis C virus (HCVa) is the major causative agent of
chronic non-A and non-B hepatitis.1 Patients with persistent
HCV infection are at risk of developing liver cirrhosis and
hepatocellular carcinoma.2 The current recommended HCV
treatment is a combination of interferon and ribavirin,3 which,
although effective, still has limitations of unsatisfactory response
rates and significant adverse reactions.4 Although pegylated
interferon further improved the effectiveness, adverse reactions
still exist and the cost is high.5 In fact, around 50% of HCV
genotype 1-infected patients fail to achieve a sustained virologi-
cal response. Clearly, there is still a great need to develop more
effective agents for the treatment of HCV infection.
The development of HCV antiviral agents has focused
mainlyonNS3/4AserineproteaseandNS5BRNApolymerase.6-9
∞
The coordinates and structure factors of HCV NS3 helicase in complex
with compound 1 have been deposited in the RCSB Protein Data Bank,
www.pdb.org (PDB code 2ZJO).
* To whom correspondence should be addressed. For S.-H.L.: phone,
+886-2-28267278; fax, +886-2-28202449; e-mail, shliaw@ym.edu.tw. For
D.-S.C.: phone, +886-2-23562176; fax, +886-23317624; e-mail, chends@
ntu.edu.tw. For J.-W.C.: phone, +886-2-23939462; fax, +886-2-23934221;
e-mail, jwchern@ntu.edu.tw.
†
School of Pharmacy, College of Medicine, National Taiwan University.
Current address: School of Pharmacy, College of Pharmacy, China
#
Medical University, Taichung, Taiwan.
b
Current address: Division of Herbal Drugs and Natural Products,
Even though high-throughput screening has been used suc-
cessfully toward the identification of new leads in drug
discovery, it remains a costly and time-consuming process.
Alternatively, virtual screening has emerged as a complementary
approach.20 The program DOCK21 has been successfully applied
in diverse protein systems for virtual screening. In the present
study, we attempted to identify novel HCV NS3 helicase
inhibitors by virtual screening of compound libraries using the
National Research Institute of Chinese Medicine, Taipei, Taiwan.
‡
Providence University.
National Yang-Ming University.
Development Center for Biotechnology.
National Taiwan University Hospital, National Taiwan University.
§
¶
|
College of Life Science, National Taiwan University.
a Abbreviations: HCV, hepatitis C virus; NS3, nonstructural protein 3;
NS5B, nonstructural protein 5B; NTP, nucleoside triphosphate; FRET,
fluorescence resonant energy transfer; ATP, adenosine triphosphate; ss RNA,
single-stranded RNA; RT-PCR, reverse transcription-PCR.
10.1021/jm8011905 CCC: $40.75
2009 American Chemical Society
Published on Web 04/14/2009

Triphenylmethane DeriVatiVes as Inhibitors
Journal of Medicinal Chemistry, 2009, Vol. 52, No. 9 2717
stranded deoxyoligonucleotide dU8 complex that can be de-
scribed as a “closed” conformation. Superimposition of the
available HCV NS3 helicase structures revealed two conforma-
tions with a rigid-body rotation of domain 2 (20-25°) relative
to domains 1 and 3 (Figure 2B).
In the initial Fo - Fc omit map contoured at the 5σ level,
only one strong electron density was observed and assigned as
the 4-sulfonatophenylaminophenyl group and an adjacent phenyl
ring. Significant density maps for the two adjacent 3-sul-
fonatophenylamino moieties were observed at 4σ and 3σ levels,
respectively (Figure 3A). The 4-sulfonatophenylaminophenyl
group is the key component for the inhibitor binding through
its interaction with the conserved motif I (residues 207-212)
and the second helix (residues 233-241) (Figure 3B). The most
significant interactions are hydrogen bonds formed between the
sulfonate group and the backbone NH groups of Gly207,
Gly209, Lys210, Ser211, and Thr212 and Thr212 Oγ1. The
phenyl ring between the sulfonate and amino groups makes close
contacts with Thr206 Cγ2, Phe238 Cε1 and Tyr241 Cγ. The amino
group interacts with Gly237 O, and the second phenyl group
has close interactions with Ala234 Cꢀ and Gly237 CR. A phenyl
ring in one adjacent 3-sulfonatophenylamino group makes
contact with Ala233 Cꢀ and Ala234 CR. The remaining parts of
blue HT have no significant interactions with this “open”
conformation. However, in the “closed” conformation, the other
3-sulfonatophenylamino group might interact with the conserved
motif V such as Met415 and Thr416 in domain 2. The enzyme
undergoes only minor conformational changes upon inhibitor
binding. In addition to the physical interactions mentioned
above, shape complementarity also plays an important role in
facilitating the specific binding between protein and inhibitor
(Figure 3C). The inhibitor was bound in a shallow binding
groove made up of the conserved motif I and the first two
helices. One of the main topological features is that the sulfonate
group is situated at the 4-position of the phenylamino group.
Figure 1. DOCK screens were carried out in docking sites I and II.
The docking site was defined with a set of spheres (green and yellow
for sites I and II, respectively) that were used to orient a putative ligand
molecule.
program DOCK, followed by activity assay and structural
characterization.
Results and Discussion
Virtual Screening. The crystal structures of HCV NS3 show
aY-shapedconfigurationconsistingofthreestructuraldomains.22,23
Domains 1 and 3 share an extensive interface mainly through
packing of the three helices, and they form a hollow interface.
On the other hand, domain 2 is distinctly separated from the
other two domains and gives rise to a series of clefts. All the
conserved motifs are clustered around the interdomain interfaces.
Two conserved residues, Arg464 and Arg467, in domain 2 are
expected to move toward the conserved NTP-binding loops in
domain 1, leading to closure of the interdomain cleft upon
nucleoside triphosphate (NTP) binding.24 Crystal structure23 and
mutagenesis25 studies revealed that some critical amino acid
residues, such as Thr269, Trp501, Arg393, and Thr411, are
important for nucleic acid binding. It was our intention to find
potential inhibitors by blocking the closing of the interface
between domains 1 and 2. Therefore, two docking sites I and
II close to the conserved motifs and the putative substrate-
binding residues were defined (Figure 1).
Fourteen compounds were chosen and subjected to HCV
helicase inhibition assays. Among them, soluble blue HT (1,
Chart 1), screened from site II, inhibited the HCV NS3 helicase
activity with an IC50 value of 40 µM, and N-(2-pyrimidinyl)-
benzenesulfonamide derivative 2, screened from site I, possessed
a 46% inhibition at 100 µM against HCV NS3 helicase (Table
1). The other 12 compounds had no inhibitory effects. To
identify the attenuation mechanism of soluble blue HT, the
complex structure with a HCV NS3H helicase domain was
determined.
Establishment of Helicase Assay System. A fluorescence
resonant energy transfer (FRET) helicase assay system was
established for fast screening of the HCV NS3/4A helicase
inhibitors selected from virtual screening. The fluorescence
intensity increased in a time-dependent manner in the reaction
with NS3/4A, while it remained at the basal level in the reaction
without NS3/4A. The solvent dimethyl sulfoxide had no effect
on the helicase activity.
Soluble Blue HT-Binding Site. The present inhibitor com-
plex possesses a wider cleft between domains 1 and 2 and hence
can be described as an “open” conformation (Figure 2A),
whereas there is a narrower cleft in the NS3 and a single-
Triphenylmethane Derivatives as Novel Inhibitors of
HCV NS3 Helicase. Soluble blue HT (1) represents a novel
lead compound for HCV NS3 helicase inhibitors. Therefore, a
fragment-based search was commenced to find compounds
related to the 4-sulfonatophenylaminophenyl group, the key
character binding to the enzyme, as a query (fragment A in Chart
1). Among the hits, compound 3 was found to be more potent
than compound 1 with an IC50 value of 12.6 µM against HCV
NS3 helicase. The structures of compounds 1 and 3 suggest
that the triphenylmethyl moiety may be essential for the
inhibitory activity. Hence, another fragment-based search was
carried out using fragment B (Chart 1), in which the triphenyl-
methyl moiety is linked to a phenyl ring through one atom.
Compounds 4 and 6 showed moderate HCV helicase inhibition
with IC50 values of 29.7 and 13.9 µM, respectively, while 5
was not active. The inactivity of the 4-nitrophenyloxytriphenyl
derivative 5 reveals that a nitro group and a bridging oxygen
are not appropriate at the positions.
Compounds 7-10 (Chart 2) were used to study the structural
characteristics for the inhibitory activity of compound 6.
Compounds containing tri(4-hydroxylphenyl)methyl (7) and
tri(4-aminophenyl)methyl skeleton (8) showed weak HCV
helicase inhibition (39% and 30% inhibition at 100 µM,
respectively, Table 1). These results indicate that the triphenyl-
methyl moiety alone could not achieve a high-affinity binding
to the enzyme. An extended phenyl moiety, such as the
4-sulfonatophenylamino group in compounds 1 and 3, would
improve the binding affinity. As a result, the 2-(4-hydroxy-
phenyl)propane moiety of compound 6 might play an important

2718 Journal of Medicinal Chemistry, 2009, Vol. 52, No. 9
Chen et al.
Chart 1. Compounds 1 and 2 Identified from the DOCK Screening and Fragments A and B Used for the Fragment Search
role responsible for the potency. Further evidence was attained
by compound 10 in which a hydroxyphenyl group was replaced
by a methyl group. Compound 10 exhibited less potency (IC50
) 60.7 µM), but it was more potent than compounds 7-9.
Therefore, the triphenylmethane moiety can serve as a basic
scaffold for the inhibitory potency against HCV helicase.
Together with extended moieties, compound 6 may represent a
novel lead structure for the HCV helicase inhibitors.
Attenuation Mechanism. The unwinding ability of HCV
helicase is dependent on adenosine triphosphate (ATP) binding,
ATP hydrolysis, and RNA binding. To examine the inhibition
mechanism of compounds 1, 3, 4, and 6, their inhibitory effects
on ATPase activity and RNA substrate binding were examined.
Compounds 1, 4, and 6 inhibited the ATP activity with IC50
values of about 25 µM in a mixed type mode, while compound
3 had little effect (Figure 4A and Table 1). Compound 1, 3, 4,
and 6 all inhibited the RNA substrate binding to the HCV NS3/
4A helicase in a dose dependent manner (Figure 4B). Compound
1 showed high interference on the RNA substrate binding.
Compounds 4 and 6 exhibited a similar effect, while compound
3 had the weakest interfering effect.
Unexpectedly, compound 3, the most potent compound in
the FRET helicase activity assay, showed little inhibition in ATP
hydrolysis or RNA substrate binding. It was known that DNA
substrate was easier unwound than RNA substrate in the helicase
activity assay. Thus, the inhibitory activity of these compounds
was further investigated by the helicase assay with isotope-
labeled RNA substrates. At a concentration of 100 µM,
compounds 1, 4, and 6 totally blocked the formation of single-
stranded (ss) RNA (Figure 4C). On the other hand, compound
3 showed little effects on the formation of ss RNA, suggesting
that compound 3 could not inhibit RNA unwinding.
Table 1. Inhibition of the Unwinding Activity of HCV Helicase and
ATPase Activity
IC50 (µM)
compd
helicase
ATPase
compound
IC50 (µM), helicase
Antiviral Activity in HCV Replicon Cells. Antihepatitis C
virus activities of compounds 1, 3, 4, and 6 were further
analyzed in HCV replicon Ava.5/Huh-7 and its parental Huh-7
cells (Table 2). Compounds 1 and 4 were not toxic to either
cells. Compound 3 exhibited high cytotoxicity to HCV replicon
with an EC50 value of 0.69 µM and to parental Huh-7 cells with
a CC50 value of 0.96 µM. Compound 6 showed moderate
1
2
3
4
5
6
40.0
46%a
12.6
29.7
0%a
13.9
23.8
ndb
>100
25.1
ndb
7
8
9
10
11
12
39%a
30%a
43%a
60.7
15%a
10.1
25.9
a Percent inhibition at 100 µM. b Not determined.

Triphenylmethane DeriVatiVes as Inhibitors
Journal of Medicinal Chemistry, 2009, Vol. 52, No. 9 2719
Figure 3. Blue HT-binding site. (A) The initial simulated annealing
omitting Fo - Fc map for the blue HT (1) bound to NS3H contoured
at the 3σ level and shown in cyan. (B) The NS3 helicase-blue HT
interactions. Hydrogen bonds are indicated by dashed lines. (C)
Molecular surfaces of NS3H colored for electrostatic potential from
-10 kBT (red) to 10 kBT (blue).
Figure 2. (A) Present HCV NS3 helicase structure in complex with
blue HT (1) and models of the cofactor ATP and a single-stranded
deoxyoligonucleotide dU8 (cyan). The dU8 and ATP models were
generated through superposition with the NS3-dU8 complex (PDB
1A1V) and the helicase RecQ (PDB 1OYY), respectively. The
4-sulfonatophenylaminophenyl group contributes most to the binding,
and it is bound in a shallow groove constituted by the conserved motif
I, the first two helices (RA and ꢀB), and the ꢀ-sheet in domain 1. Helices
in the NS3 structure are in red and strands in green, and the motif I is
highlighted in blue. The blue HT, ATP, and dU8 are shown as ball-
and-stick representation with black, purple, and cyan carbons, respec-
tively. (B) Two conformations of NS3H structures. The present structure
is in red and described as an “open” conformation, whereas the NS3H-
dU8 complex in green is described as a “closed” conformation. The
structures are superimposed along domains 1 and 3 to demonstrate the
relative orientation of domain 2.
Chart 2. Compounds for the Identification of the Structural
Characteristics of 6
cytotoxicities to HCV replicon with an EC50 value of 8.37 µM
and to Huh-7 cells with a CC50 value of 12.66 µM.
Lead Optimization. Compound 6 exhibited moderate inhibi-
tory activity against HCV helicase with either DNA or RNA
substrate. Therefore, lead optimization on the structure of
compound 6 was performed. Methylation of the three hydroxyl
groups leading to compound 11 (Chart 2) resulted in the loss
of HCV helicase inhibitory activity (Table 1). This result reveals
the importance of the 4-hydroxyl groups. Among various
derivatives of compound 6, the 3-bromo-4-hydroxyl substituted
derivative 12 appeared to be the best candidate as a HCV
helicase inhibitor. Compound 12 showed a good inhibitory
activity against HCV NS3/4A helicase with an IC50 value of
10.05 µM and presented a better antiviral activity with an EC50
of 2.72 µM to Ava.5/Huh-7 cells and a lower cytotoxicity to
parental Huh-7 cells (CC50 ) 10.5 µM).
compound 12 indeed suppressed HCV replication in the HCV
replicon cells. In addition, a reduction of 20-25% of cell growth
was found in the treatment of compound 12 at 5 µM with Ava.5/
Huh-7 cells for 5 days without G418, an antibiotic blocking
polypeptide synthesis through the inhibition of the elongation
step in both prokaryotic and eukaryotic cells, while a reduction
of 50-60% of cell growth was found in the same experiment
with G418. These results illustrate that compound 12 has only
minimal effects on the growth of proliferating cells but a major
The antihepatitis C virus activity of compound 12 was further
confirmed by real-time reverse transcription-PCR (RT-PCR).
Compared to untreated Ava.5/Huh-7 cells, the HCV RNA
decreased about 40-60% when cells were treated with 5 or 10
µM compound 12 for 2 days (Figure 5), indicating that

2720 Journal of Medicinal Chemistry, 2009, Vol. 52, No. 9
Chen et al.
Figure 4. (A) Inhibition of the ATPase activity at a concentration of 100 µM, (B) inhibition of the RNA substrate (S) binding to the NS3/4A
enzyme (E) at different concentrations, and (C) helicase activity with isotope labeled RNA substrate at a concentration of 100 µM by compounds
1, 3, 4, and 6. In the isotope-labeled helicase assay (C), some intermediate bands between the bands of double-stranded (ds) and single-stranded (ss)
RNA were found.
Table 2. Antiproliferative Effects on Huh-7 and HCV Replicon
Ava.5/Huh-7 Cells
moiety, was identified as a HCV helicase inhibitor through the
inhibition of ATPase hydrolysis and RNA substrate binding.
Lead optimization advanced the discovery of compound 12,
3-bromo substituted derivative of compound 6, as a good anti-
HCV agent with an IC50 value of 10.05 µM and EC50 value of
2.72 µM against HCV NS3 helicase and replicon Ava.5/Huh-7
cells, respectively. Results of real-time RT-PCR confirmed that
compound 12 could suppress HCV RNA replication in the HCV
replicon cells. Therefore, these inhibitors with structural novelty
may serve as novel leads for the discovery of new HCV NS3
helicase inhibitors. Further lead optimization should be carried
out for more potent HCV helicase inhibitors.
compd
CC50 (µM), Huh7
EC50 (µM), Ava.5/Huh-7
specificity
1.39
1
3
>50.00
0.96
>50.00
0.69
4
6
12
>50.00
12.66
10.50
>50.00
8.37
1.51
3.86
2.72
influence on the replicon replication. The inhibition of Ava.5/
Huh-7 cells was a consequence of inhibiting replicon replication.
Conclusion
Triphenylmethane derivatives were discovered as novel HCV
NS3 helicase inhibitors through a consensus virtual screening
of docking and fragment-based search. Compound 6, a triph-
enylmethane derivative linked to a 2-(4-hydroxyphenyl)propane
Experimental Section
Virtual Screening. Docking Screening. The X-ray crystal
structure of HCV helicase (1HEI) was used for docking screening.
The shape complementarity (contact) scoring function in the rigid-
body docking (DOCK 3.5) was used to screen the database
Available Chemicals Directory (ACD, version 99.1, Molecular
Design Limited Information Systems, CA). The three-dimensional
structures of the ACD compounds were generated using the
CONCORD program (Tripos, Inc., MO). The top 1000 ranked
molecules were redocked using the force field (energy) scoring
function. All calculations were performed on a Silicon Graphics
O2 workstation with a 180 MHz R5000 processor (SGI, CA). For
compound selection, the docking models of the 1000 top-ranked
compounds obtained by contact scoring were visually inspected
using the software Insight II (Accelrys Inc., San Diego, CA).
Together with consideration of chemical diversity, the selection of
compounds was assisted by visual analysis of the docking models
with respect to shape fitting and hydrogen-bonding and hydrophobic
interactions. The compounds considered were also inspected for
their favorable docking poses obtained by force field scoring.
Finally, 14 compounds were selected for HCV helicase inhibition
assay: 10 compounds from site I screening and 4 compounds from
site II screening. The compounds for testing were purchased from
chemical suppliers.
Figure 5. HCV RNA. HCV replicon cells were treated at various
concentrations with compound 12 for 1 or 2 days. The amount of HCV
RNA was analyzed by the real-time RT-PCR method. The RNA of
untreated replicon cells was set as 1.0.

Triphenylmethane DeriVatiVes as Inhibitors
Journal of Medicinal Chemistry, 2009, Vol. 52, No. 9 2721
Fragment-Based 2D Database Searching. The fragment-based
2D search was carried out by the program ISIS/Base 2.2 (MDL
Information Systems, Inc., CA). Two MDL databases, Screening
Compounds Directory (SCD, version 2001.2) and ACD (version
2001.1), were searched with query structures. Compounds 3-5 were
retrieved from SCD, and compounds 6-10 were found from ACD.
Synthesis and Characterization. Material and Methods. All
solvents and reagents were used as obtained. Melting points were
determined on a capillary melting point apparatus equipped with a
digital thermometer and are uncorrected. NMR spectra were
recorded at Bruker DPX 400 MHz with solvents as internal
references. Mass spectra were determined using electron spray
impact ionization at 70 eV on Finnigan Mat-TSQ 7000. Compounds
1-10 were used as purchased, and their purity was >90%. Purity
of compounds 11 and 12 was determined using a Hitachi D-7000
HPLC instrument, and these compounds were >95% pure.
annealing of BHQ1-labeled release strand and FITC-labeled
template strand was monitored by the fluorescence quenching of
FITC.
NS3/4A (0.9 µg) was incubated with compounds on ice for 15
min and then mixed with 1 µM DNA substrate and 10 µM trapping
strand in reaction buffer (20 mM HEPES-KOH (pH 7.0), 2 mM
DTT, 0.1 mg/mL BSA, 2.5 mM ATP, and 1.5 mM MgCl2). The
mixture with a final compound concentration of 100 µM was added
to a 384-well microplate and monitored continuously at an excitation
of 485 nm and an emission of 518 nm using a Fluoroskan Ascent
microplate fluorescence reader (LabSystems, VA). The original data
were normalized by the formula “relative helicase activity (%) )
(Fde - Fd0)/(FDe - FD0)” where Fde and Fd0 are the fluorescence
intensity of reaction with compounds at the end point and at the
beginning, respectively, FDe and FD0 are the fluorescence intensity
with dimethyl sulfoxide (DMSO) at the end point and at the
beginning, respectively. When the inhibition of helicase activity
was more than 50% at a concentration of 100 µM, the IC50 values
were determined with the compound concentrations of 100, 50, 20,
and 10 µM by fitting SigmaPlot2000 of logistic with three
parameters.
Helicase Activity Assay with Isotope-Labeled RNA Substrate.
The isotope-labeled partial double-stranded RNA (dsRNA) sub-
strates were prepared, and RNA helicase assays were conducted
following the reported procedures.29,30 NS3/4A (0.45 µg) was
incubated with a compound on ice for 15 min. The reaction mixture
(20 µL) contained 20 mM HEPES-KOH (pH 7.0), 2 mM DTT,
1.5 mM MnCl2, 2.5 mM ATP, 0.1 mg/mL BSA, 20 U of RNasin,
and 30 nM dsRNA substrate. The reaction was carried out at 37
°C for 1 h and then terminated by adding 5 µL of RNA loading
dye (0.1 M Tris-HCl (pH 7.4), 20 mM EDTA, 1% SDS, 0.1%
bromophenol blue, 0.1% xylene cyanol, and 50% glycerol). The
reaction products were analyzed on an 8% native polyacrylamide
gel.
1-[1,1-Bis(4-methoxyphenyl)ethyl]-4-[2-(4-methoxyphenyl)-
propan-2-yl]benzene (11). To a solution of compound 6 (0.5 g,
1.18 mmol) in acetone (15 mL) were added K2CO3 (0.55 g, 3.98
mmol) and CH3I (0.25 mL, 4.02 mmol). The mixture was stirred
at room temperature for 24 h. The mixture was filtered, and the
filtrate was evaporated under reduced pressure. The resulting residue
was subjected to column chromatography on silica gel (70-230
mesh), eluting with hexanes/EtOAc (95:5) to give 11 (75 mg, 14%)
1
as a white solid: mp 98-99 °C; H NMR (400 MHz, CDCl3) δ
1.76 (s, 6H, CH3), 2.22 (s, 3H, CH3), 3.90 (s, 9H, OCH3), 6.90 (d,
J ) 8.6 Hz, 4H, ArH), 6.92 (d, J ) 8.5 Hz, 2H, ArH), 7.07 (d, J
) 8.4 Hz, 2H, ArH), 7.11 (d, J ) 8.7 Hz, 4H, ArH), 7.21 (d, J )
8.4 Hz, 2H, ArH), 7.28 (d, J ) 8.6 Hz, 2H, ArH); MS (ESI+) m/z
489 [M + Na]+.
4-[1-(3-Bromo-4-hydroxyphenyl)-1-[4-[2-(3-bromo-4-hydroxy-
phenyl)propan-2-yl]phenyl]ethyl]-2-bromophenol (12). Accord-
ing to the method by Oberhauser,26 compound 6 (0.8 g, 1.88 mmol)
was dissolved in a mixture of CH3CN (15 mL), CH2Cl2 (5 mL),
and acetone (1 mL). To the stirred solution under ice bath were
added CF3SO3H (0.55 mL, 6.26 mmol) and NBS (0.55 g, 3.09
mmol). Additional NBS (0.55 g, 3.09 mmol) was added to the
mixture after 10 min, and stirring was continued for 10 min under
ice bath and then at room temperature for 3 h. A solution of
NaHSO3 (4 g) in H2O (15 mL) was added, and the mixture was
extracted with CH2Cl2 (20 mL in total). The extract was washed
with H2O (15 mL) twice and brine (15 mL). After evaporation, the
residue was dissolved in 3 N NaOH (10 mL), and the solution was
added dropwise with stirring to 3 N HCl (20 mL). The resulting
precipitate was collected by filtration and washed with H2O to give
12 (1.09 g, 88%). An analytical sample was prepared by flash
chromatography on silica gel (230-400 mesh), eluting with
hexanes/EtOAc (70:30): mp 81-84 °C; 1H NMR (400 MHz,
DMSO-d6) δ 1.56 (s, 6H, CH3), 1.98 (s, 3H, CH3), 6.80-6.87 (m,
5H, ArH), 6.91 (d, J ) 8.4 Hz, 2H, ArH), 6.99-7.01 (m, 3H, ArH),
7.13 (d, J ) 8.5 Hz, 2H, ArH), 7.22 (d, J ) 2.2 Hz, 1H, ArH),
10.00 (brs, 1H, OH), 10.14 (brs, 2H, OH). HRMS (ESI-) calcd for
C29H24Br3O3 [M - H]-: 656.9276 (79Br3), 658.9255 (79Br281Br);
found 656.9304 (79Br3), 658.9296 (79Br281Br).
ATP Activity Assay. Following our previous report,28 com-
pounds were added into the reaction buffer (20 mM HEPES-KOH
(pH 7.0), 1.5 mM MgCl2, 2 mM DTT, 0.1 µg/mL poly-U, and 5
µCi [R-32P]ATP containing 0.067-20 µM ATP). The reaction was
initiated by addition of NS3/4A (0.45 µg) and was terminated after
5 min by addition of 0.5 µL of 0.4 M EDTA (pH 8.0). A sample
of 0.5 µL of reaction mixture was spotted on a PEI-cellulose-F
TLC plate (Merck, Darmstade, Germany) and developed by
ascending chromatography in 0.375 M K2PO4 (pH 3.5) for 20 min.
The TLC plate was then air-dried and applied to autoradiography
measured by the AutoChemi Imaging System (UVP, Inc., CA).
RNA Binding Assay. Partial dsRNA binding to HCV helicase
was analyzed by gel mobility shift assay.30 NS3/4A (0.45 µg) was
incubated with 100 µM tested compounds in 10 µL of helicase
reaction buffer in the absence of ATP for 5 min at 37 °C and then
incubated with 0.66 pmol of isotope-labeled partial dsRNA substrate
for further 15 min. Reaction products were analyzed on a 4%
polyacrylamide gel containing 5% glycerol. The bound complexes
were visualized by autoradiography.
Real-Time RT-PCR. HCV replicon cells Ava.5/Huh-7 carrying
a genotype 1b32 were seeded on culture dishes and cultured with
G-418-free DMEM medium for 24 h. Cells were then treated with
5, 10, or 20 µM compound 12 and cultured for further 24 or 48 h.
Cells were lysed with RNA-Bee (Tel-Test Inc.) to obtain cellular
total RNA. Purified RNA was quantified and frozen at -80 °C.
The synthesis of the first strand cDNA was accomplished by 1
µg of RNA applied to Reverse-iT first strand synthesis kit (ABgene).
A mixture (12 µL) containing RNA and random decamers (400
ng) was heated at 70 °C for 5 min and then placed on ice to remove
secondary structures. Then the mixture was combined with another
mixture (8 µL) containing buffer, dNTP, enzyme, and DTT,
followed by incubation at 47 °C for 50 min. When the reaction
was completed, the mixture was heated at 75 °C for 10 min to
inactivate the enzyme and then stored at -20 °C.
Fluorescence Resonant Energy Transfer (FRET) Helicase
Assay. The high throughput assay system was modified from a
previous report.27 The histidine-tag HCV NS3/4A protein was
expressed and purified as previously described.28 As purified NS3
helicase presents DNA helicase activity,29,30 a double-stranded
oligomeric DNA with a 3′ flanking sequence was used as the
substrate.31 The template strand (5′-CATCATGCAGGACAGTCG-
GATCGCAGTCAG-3′), the release strand (5′-CTGTCCTGCAT-
GATG-3′), and the trapping strand (5′-CATCATGCAGGACAG-
3′) were synthesized by Sigma-Proligo (Singapore). A quencher
BHQ1 was labeled at the 3′ end of the release strand, and a
fluoresceinisothiocyanate (FITC) was labeled at the 5′ end of the
template strand. The release and template strands were mixed in a
molar ratio of 1:1. The mixture (30 µM) was boiled for 10 min
and cooled to room temperature overnight for annealing. The
The first strand cDNA was applied to ABsolute QPCR SYBR
Green Mixes (ABgene) for real-time PCR reaction, and the primer
set was generated by the software of PrismExpress (Applied

2722 Journal of Medicinal Chemistry, 2009, Vol. 52, No. 9
Chen et al.
Table 3. Statistics for Data Collection and Structural Refinement
Acknowledgment. We thank Dr. Bhalchandra V. Bhagwat
and Chao-Wu Yu for their technical assistance and Apath LLC
(St. Louis, MO) for the agreement to use HCV replicon Ava.5
cells. This study was supported by National Science Council
of the Republic of China (Grants NSC91-2321-B-002-002,
NSC93-2323-B-002-015, and NSC95-2323-B-002-009).
parameter
space group
P3121
unit cell (Å)
92.06, 104.71
50-2.5
199 340
17 989
99.8
resolution range (Å)
total observations
unique reflections
completeness (%)
I/σ I
Supporting Information Available: Purity data from HPLC
analysis and 1H NMR spectrum of compound 12. This material is
available free of charge via the Internet at http://pubs.acs.org.
36.3
6.5
Rmerge (%)
Rcryst for 90% data (%)
Rfree for 10% data (%)
rms deviations of bond lengths and bond angles
23.4
28.3
0.08 Å, 1.5°
References
(1) Choo, Q. L.; Kuo, G.; Weiner, A. J.; Overby, L. R.; Bradley, D. W.;
Houghton, M. Isolation of a CDNA clone derived from a blood-borne
non-A, non-B viral-hepatitis genome. Science 1989, 88, 359–362.
(2) Jenny-Avital, E. R. Hepatitis C. Curr. Opin. Infect. Dis. 1998, 11,
293–299.
(3) Chander, G.; Sulkowski, M. S.; Jenckes, M. W.; Torbenson, M. S.;
Herlong, H. F.; Bass, E. B.; Gebo, K. A. Treatment of chronic hepatitis
C: a systematic review. Hepatology 2002, 36, S135–S144.
(4) Lai, M. Y.; Kao, J. H.; Yang, P. M.; Wang, J. T.; Chen, P. J.; Chan,
K. W.; Chu, J. S.; Chen, D. S. Long-term efficacy of ribavirin plus
interferon alfa in the treatment of chronic hepatitic C. Gastroenterology
1996, 111, 1307–1312.
(5) Hadziyannis, S. J.; Sette, H.; Morgan, T. R.; Balan, V.; Diago, M.;
Marcellin, P.; Ramadori, G.; Bodenbeimer, H.; Bemstein, D.; Rizzetto,
M.; Zeuzem, S.; Pockros, P. J.; Lin, A.; Ackrill, A. M. Peginterferon-
alpha 2a and ribavirin combination therapy in chronic hepatitis C. A
randomized study of treatment duration and ribavirin dose. Ann. Intern.
Med. 2004, 140, 346–355.
(6) Steinkuehler, C.; Koch, U.; Narjes, F.; Matassa, V. G. Hepatitis C
virus serine protease inhibitors: current progress and future challenges.
Curr. Med. Chem. 2001, 8, 919–932.
Biosystems, CA). The sequences of the HCV primer set were 5′-
233gtgcccccgcgagact248-3′ (forward) and 5′-305agcaccctatcaggcag-
tacca284-3′ (reverse). The primer set consisting of 5′-943acccactc-
ctccacctttga962-3′ (forward) and 5′-1018cataccaggaaatgagcttgacaa995
-
3′ (reverse) is used for internal control gene GAPDH. A mixture
(12.0 µL) containing 1 µL of the first strand cDNA was mixed
with 12.5 µL of master mix and 0.5 µL of primer set and applied
to ABI Prism 7900 for the real-time PCR reaction. The enzyme of
real-time PCR was activated at 95 °C for 15 min, and then PCR
reaction was performed with 40 cycles of denature at 95 °C for
15 s and annealing/extension at 60 °C for 1 min, followed by a
dissociation stage to verify the specificity of the reaction. The values
for HCV primer set were normalized to those of GAPDH (Applied
Biosystems). Each test was done in triplicate, and averages were
obtained.
Structure Determination. The NS3 helicase domain from a
Taiwanese HCV strain (genotype 1b) was expressed using the
pET21a vector in E. coli BL21 (DE3).29,30 The recombinant enzyme
was crystallized by the hanging-drop vapor diffusion method at 22
°C. The hanging drops were mixtures of 2 µL of reservoir solution
and 2 µL of protein solution (15 mg/mL). Protein crystals were
grown in 0.2 M KCl, 0.1 M Mg(OAc)2, 10% PEG 8000, and 0.05
M sodium cacodylate (pH 6.5). Compound derivatives were
prepared by soaking crystals in reservoir solution containing
compound at various concentrations (1-100 mM) for various
lengths of time ranging from 1 h to a couple of days.
X-ray diffraction data were collected at 100 K with addition
of 30% glycerol as a cryoprotectant, using synchrotron radiation
at beamline 13B1, National Synchrotron Radiation Research
Center, Taiwan. The data were processed using the HKL2000
program.33 The crystals belong to the space group P3121, with
one helicase domain per asymmetric unit. The complex structure
was determined by a combination of molecular replacement and
single isomorphous replacement methods. Initial attempts to
solve the structure using the available NS3H structures as starting
models failed. Structural comparison revealed two conformations,
which differed primarily with regard to the relative orientations
of domains 1 and 3 and domain 2. Thus, the NS3H model was
split into the three structural domains (residues 190-330 for
domain 1; residues 327-435 and residues 450-485 for domain
2; residues 430-450 and residues 485-625 for domain 3).
Rotation and translation function searches were performed with
the program AMORE. Clear solutions for domains 1 and 3 but
not for domain 2 were observed. The phase for the domain 2
was solved together with a thimerosal derivative, in which a
mercury ion was bound at Cys 420. The complex structures were
solved by molecular replacement and underwent straightforward
refinement against the data to 2.5 Å resolution using the program
CNS.34 The N-terminal residues including a 12-residue vector
linker and residues 167-186 as well as the C-terminal hexa-
histidine tag exhibited no electron density and were omitted in
the final model. Only faint electron densities were observed for
residues 393-400 and 416-420. Data collection and refinement
statistics are depicted in Table 3. Figure 2 and Figure 3B were
generated by MolScript.35 Figure 3A was made by BobScript,35
and Figure 3C was obtained by Grasp.36
(7) Gordon, C. P.; Keller, P. A. Control of hepatitis C: a medicinal
chemistry perspective. J. Med. Chem. 2005, 48, 1–20.
(8) Neyts, J. Selective inhibitors of hepatitis C virus replication. AntiViral
Res. 2006, 71, 363–371.
(9) Qureshi, S. A. Hepatitis C virus. Biology, host evasion strategies, and
promising new therapies on the horizon. Med. Res. ReV. 2007, 27,
353–373.
(10) Lin, C.; Lin, K.; Luong, Y. P.; Rao, B. G.; Wei, Y. Y.; Brennan,
D. L.; Fulghum, J. R.; Hsiao, H. M.; Ma, S.; Maxwell, J. P.; Cottrell,
K. M.; Perni, R. B.; Gates, C. A.; Kwong, A. D. In vitro resistance
studies of hepatitis C virus serine protease inhibitors. VX-950 and
BILN 2061: structural analysis indicates different resistance mecha-
nisms. J. Biol. Chem. 2004, 279, 17508–17514.
(11) Nguyen, T. T.; Gates, A. T.; Gutshall, L. L.; Johnston, V. K.; Gu, B.;
Duffy, K. J.; Sarisky, R. T. Resistance profile of a hepatitis C virus
RNA-dependent RNA polymerase benzothiadiazine inhibitor. Anti-
microb. Agents Chemother. 2003, 47, 3525–3530.
(12) Kwong, A. D.; Rao, B. G.; Jeang, K. T. Viral and cellular RNA
helicases as antiviral targets. Nat. ReV. Drug DiscoVery 2005, 4, 845–
853.
(13) Diana, G. D.; Bailey, T. R. Compounds, Compositions and Methods
for Treatment of Hepatitis C. U.S. Patent 5,633,388, 1997.
(14) Phoon, C. W.; Ng, P. Y.; Ting, A. E.; Yeo, S. L.; Sim, M. M.
Biological evaluation of hepatitis C virus helicase inhibitors. Bioorg.
Med. Chem. Lett. 2001, 11, 1647–1650.
(15) Janetka, J. W.; Ledford, B. E.; Mullican, M. D. Pentacyclic Compounds
Useful as Inhibitors of Hepatitis C Virus NS3 Helicase. Patent WO
00/24725, 2000.
(16) Sarno, S.; Reddy, H.; Meggio, F.; Ruzzene, M.; Davies, S. P.; Donella-
Deana, A.; Shugar, D.; Pinna, L. A. Selectivity of 4,5,6,7-tetrabro-
mobenzotrizole, an ATP site-directed inhibitor of protein kinase CK2
(casein kinase-2). FEBS Lett. 2001, 496, 44–48.
(17) Borowski, P.; Deinert, J.; Schalinski, S.; Bretner, M.; Ginalski, K.;
Kulikowski, T.; Shugar, D. Halogenated benzimidazoles and benzo-
trizoles as inhibitors of the NTPase/helicae activities of hepatitis C
and related viruses. Eur. J. Biochem. 2003, 270, 1645–1653.
(18) Maga, G.; Gemma, S.; Fattorusso, C.; Locatelli, G. A.; Butini, S.;
Persico, M.; Kukreja, G.; Romano, M. P.; Chiasserini, L.; Savini, L.;
et al. Specific targeting of hepatitis C virus NS3 RNA helicase.
Discovery of the potent and selective competitive nucleotide-mimick-
ing inhibitor QU663. Biochemistry 2005, 44, 9637–9644.
(19) Bachur, N. R.; Yu, F.; Johnson, R.; Hickey, R.; Wu, Y.; Malkis, L.
Helicase inhibition by anthracycline anticancer agents. Mol. Pharma-
col. 1992, 41, 993–998.
(20) Shoichet, B. K. Virtual screening of chemical libraries. Nature
(London) 2004, 432, 862–865.

Triphenylmethane DeriVatiVes as Inhibitors
Journal of Medicinal Chemistry, 2009, Vol. 52, No. 9 2723
(21) Kuntz, I. D. Structure-based strategies for drug design and discovery.
Science 1992, 257, 1078–1082.
(22) Yao, N. H.; Hesson, T.; Cable, M.; Hong, Z.; Kwong, A. D.; Le, H. V.;
Weber, P. C. Structure of the hepatitis C virus RNA helicase domain.
Nat. Struct. Biol. 1997, 4, 463–467.
(23) Kim, J. L.; Morgenstern, K. A.; Griffith, J. P.; Dwyer, M. D.; Thomson,
J. A.; Murcko, M. A.; Lin, C.; Caron, P. R. Hepatitis C virus NS3
RNA helicase domain with a bound oligonucleotide: the crystal
structure provides insights into the mode of unwinding. Structure 1998,
6, 89–100.
(24) Kim, D. W.; Kim, J.; Gwack, Y.; Han, J. H.; Choe, J. Mutational
analysis of the hepatitis C virus RNA helicase. J. Virol. 1997, 71,
9400–9409.
(25) Lin, C.; Kim, J. L. Structure-based mutagenesis study of hepatitis C
virus NS3 helicase. J. Virol. 1999, 73, 8798–8807.
(26) Oberhauser, T. A new bromination method for phenols and anisoles:
NBS/HBF4 · Et2O in CH3CN. J. Org. Chem. 1997, 62, 4504-
4506.
(27) Boguszewska-Chachulska, A. M.; Krawczyk, M.; Stankiewicza, A.;
Gozdek, A.; Haenni, A. L.; Strokovskaya, L. Direct fluorometric
measurement of hepatitis C virus helicase activity. FEBS Lett. 2004,
567, 253–258.
(28) Kuang, W. F.; Lin, Y. C.; Jean, F.; Huang, Y. W.; Tai, C. L.; Chen,
D. S.; Chen, P. J.; Hwang, L. H. Hepatitis C virus NS3 RNA helicase
activity is modulated by the two domains of NS3 and NS4A. Biochem.
Biophys. Res. Commun. 2004, 317, 211–217.
(29) Tai, C. L.; Chi, W. K.; Chen, D. S.; Hwang, L. H. The helicase activity
associated with hepatitis C virus nonstructural protein 3 (NS3). J. Virol.
1996, 70, 8477–8484.
(30) Tai, C. L.; Pan, W. C.; Liaw, S. H.; Yang, U. C.; Hwang, L. H.; Chen,
D. S. Structure-based mutational analysis of the hepatitis C virus NS3
helicase. J. Virol. 2001, 75, 8289–8297.
(31) Tackett, A. J.; Wei, L.; Cameron, C. E.; Raney, K. D. Unwinding of
nucleic acids by HCV NS3 helicase is sensitive to the structure of the
duplex. Nucleic Acids Res. 2001, 29, 565–572.
(32) Blight, K. J.; Kolykhalov, A. A.; Rice, C. M. Efficient initiation of
HCV RNA replication in cell culture. Science 2000, 290, 1972–1974.
(33) Otwinowski, Z.; Minor, W. Processing of X-ray diffraction data
collected in oscillation mode. Methods Enzymol. 1997, 276, 307–326.
(34) Bru¨nger, A. T.; Adams, P. D.; Clore, G. M.; DeLano, W. L.; Gros,
P.; Grosse-Kunstleve, R. W.; Jiang, J. S.; Kuszewski, J.; Nilges, M.;
Pannu, N. S.; et al. Crystallograph & NMR system: a new software
suite for macromolecular structure determination. Acta Crystallogr.
1998, D54, 905–921.
(35) Esnouf, R. M. Further additions to MolScript version 1.4, inclunding
reading and contouring of electron-density maps. Acta Crystallogr.
1999, D55, 938–940.
(36) Nicholls, A.; Bharadwaj, R.; Honig, B. GRASP: graphical repre-
sentation and analysis of surface properties. Biophys. J. 1993, 64,
166.
JM8011905