Highly nuclease-resistant phosphodiester-type oligodeoxynucleotides containing 4′α-C-aminoalkylthymidines form thermally stable duplexes with DNA and RNA. A candidate for potent antisense molecules

Article abstract of DOI:10.1021/ja9934706

The properties of phosphodiester oligodeoxynucleotides (ODNs) containing 4′α-C-aminomethyl, -ethyl, -propyl, and -N-(2-aminoethyl)carbamoylthymidines (1, 2, 4, and 5) as potential antisense molecules are investigated in detail. We developed new radical ch

Full text of DOI:10.1021/ja9934706

2422
J. Am. Chem. Soc. 2000, 122, 2422-2432
Highly Nuclease-Resistant Phosphodiester-Type
Oligodeoxynucleotides Containing 4′R-C-Aminoalkylthymidines Form
Thermally Stable Duplexes with DNA and RNA. A Candidate for
Potent Antisense Molecules†
Makiko Kanazaki, Yoshihito Ueno, Satoshi Shuto, and Akira Matsuda*
Contribution from the Graduate School of Pharmaceutical Sciences, Hokkaido UniVersity, Kita-12, Nishi-6,
Kita-ku, Sapporo 060-0812, Japan
ReceiVed September 27, 1999
Abstract: The properties of phosphodiester oligodeoxynucleotides (ODNs) containing 4′R-C-aminomethyl,
-ethyl, -propyl, and -N-(2-aminoethyl)carbamoylthymidines (1, 2, 4, and 5) as potential antisense molecules
are investigated in detail. We developed new radical chemistry with a vinylsilyl or an allylsilyl group as a
temporary radical acceptor tether to synthesize the required 4′R-branched thymidines. Thus, an intramolecular
radical cyclization of 4′-phenylseleno nucleosides 7a and 7b, which have a dimethylvinylsilyl and a
dimethylallylsilyl group at the 3′-hydroxyl, respectively, with Bu3SnH/AIBN and subsequent Tamao oxidation
provided 5′-O-[dimethoxytrityl(DMTr)]-4′R-C-(2-hydroxyethyl)thymidine (8a) and 5′-O-DMTr-4′R-C-(3-
hydroxypropyl)thymidine (8b). Compounds 8a and 8b were then converted into 4′R-C-(2-trifluoroacetami-
doethyl)thymidine 12a and 4′R-C-(3-trifluoroacetamidopropyl)thymidine 12b, which were phosphitylated to
give the phosphoramidite units 14a and 14b. The phosphoramidite units of 1 and 5 were prepared by previous
methods. The nucleosides 1, 2, 4, and 5 were incorporated into the 18-mer, 5′-d[MTMTMTMTMTMTMT-
MTMT]-3′, where M is 5-methyl-2′-deoxycytidine, instead of T at various positions. We also prepared a 21-
mer ODN 29 with a mixed sequence containing five residues of 2. The ODNs containing the modified
nucleosides formed more stable duplexes with complementary DNA than the corresponding unmodified ODN.
These ODNs also formed stable duplexes with the complimentary RNA. The ODNs containing the modified
nucleosides were significantly resistant to nucleolytic hydrolysis by both snake venom phosphodiesterase (a
3′-exonuclease) and DNase I (an endonuclease) and were also very stable in PBS containing 50% human
serum. It is worthwhile to note that these ODNs contain natural phosphodiester linkages. Furthermore, the
duplexes formed by the ODNs containing the modified nucleosides and their complementary RNAs were
good substrates for Escherichia coli RNase H and HeLa cell nuclear extracts as a source of human RNase H.
Thus, these ODNs were identified as candidates for antisense molecules.
Introduction
and used for antisense and antigene studies.1,2 However, the
benefits of such stabilization against enzymatic degradations
are sometimes counteracted by the loss of other properties that
are important for antisense activity. Phosphorothioate ODNs
tend to have lower binding affinity for their complementary
RNA targets than unmodified phosphodiester ODNs, presumably
because they are diastereomeric mixtures at the thiophosphodi-
ester linkages.3 Although RNase H cleavage is important in
antisense strategy, RNA is not a substrate for the enzyme when
methylphosphonate ODN is the complementary strand.4 Fur-
thermore, phosphorothioate ODNs have been reported to exhibit
non-sequence-specific activity.5
Oligodeoxynucleotides (ODNs) and their analogues have been
shown to specifically inhibit gene expression.1 Because of their
potential to control diseases of known genetic etiology, develop-
ment of these compounds as therapeutic agents is of great
interest. Antisense ODNs bind to mRNAs by Watson-Crick
base-pairing and inhibit translation of mRNAs in a sequence-
specific manner. One of the major problems encountered when
using naturally occurring phosphodiester ODNs as antisense or
antigene molecules is their rapid degradation by nucleases found
in cell culture media and inside cells.1 Therefore, many types
of backbone-modified ODNs such as methylphosphonates,
phosphoramidates, and phosphorothioates have been synthesized
(2) (a) Beaucage, S. L.; Iyer, R. P. Tetrahedron 1993, 49, 1925-1963.
(b) Beaucage, S. L.; Iyer, R. P. Tetrahedron 1993, 49, 6123-6194.
(3) (a) Cosstick, R.; Eckstein, E. Biochemistry 1985, 24, 3630-3638.
(b) LaPlanche, L. A.; James, T. L.; Powell, C.; Wilson, W. D.; Uznanski,
B.; Stec, W. J.; Summers, M. F.; Zon, G. Nucleic Acids Res. 1986, 14,
9081-9093. (c) Latimer, L. J. P.; Hampel, K.; Lee, J. S. Nucleic Acids
Res. 1989, 17, 1549-1561. (d) Hacia, J. G.; Wold, B. J.; Dervan, P. B.
Biochemistry 1994, 33, 5367-5369.
(4) (a) Tidd, S. M.; Hawley, P.; Warenius, H. M.; Gibson, I. Anti-Cancer
Drug Des. 1988, 3, 117-127. (b) Walder, R. Y.; Walder, J. A. Proc. Natl.
Acad. Sci. U.S.A. 1988, 85, 5011-5015.
(5) (a) Stein, C. A. Antisense Res. DeV. 1995, 5, 241 and references
therein. (b) Agrawal, S. Trends Biotechnol. 1996, 14, 376-387.
* To whom correspondence should be addressed. Phone: +81-11-706-
3228. Fax: +81-11-706-4980. E-mail: matuda@pharm.hokudai.ac.jp.
† This paper constitutes Nucleosides and Nucleosides. 193. Part 192:
Sumita, Y.; Ueno, Y.; Matsuda, A.; Shuto, S. Nucleosides Nucleotides, in
press.
(1) (a) Uhlmann, E.; Peyman, A. Chem. ReV. 1990, 90, 544-584. (b)
Milligan, J. F.; Matteucci, M. D.; Martin, J. C. J. Med. Chem. 1993, 36,
1923-1937. (c) Crooke, S. T., Lebleu, B., Eds. 1993 Antisense research
and applications; CRC Press: Boca Raton, FL. (d) Agrawal, S., Ed.
Antisense therapeutics; Humana Press: Totowa, NJ 1996. (e) Thuong, N.
T.; He´le`ne, C. Angew. Chim. Int. Ed. 1993, 32, 666-690.
10.1021/ja9934706 CCC: $19.00 © 2000 American Chemical Society
Published on Web 03/02/2000

4′R-C-Aminoalkylthymidine
J. Am. Chem. Soc., Vol. 122, No. 11, 2000 2423
ODNs having natural phosphodiester linkages have also been
studied as antisense molecules. These ODNs form a stable
duplex specifically with complementary RNA and also elicit
significant RNase H activity in the duplex with their comple-
mentary RNA strands but are often rapidly hydrolyzed by
nucleases because of their natural phosphodiester linkages.1 We
hypothesized that the natural phosphodiester ODNs carrying
basic amino alkyl chains near their phosphodiester moieties
might be resistant to nucleases. Nucleases hydrolyze phosphodi-
ester linkages by a general acid-base catalysis mechanism,
including acidic and/or basic amino acid residues at their active
sites. The presence of a basic amino group very near the
phosphodiester moiety of ODNs may prevent nucleolytic
hydrolysis by forming an ionic bond with the acidic phosphodi-
ester moiety of ODNs. It is also possible that the amino group
attached to ODNs interrupts the catalytic system of nucleases
by bonding with an acidic amino acid residue or by repulsing
a basic amino acid residue at the enzyme active sites.
On the other hand, naturally occurring polyamines, such as
spermidine and spermine, are known to bind strongly to DNAs
and to stabilize duplex and triplex formation.6 The enhanced
thermal stability of duplexes and triplexes is explained by the
reduction of the anionic electrostatic repulsion between the
phosphate moieties by the cationic amino groups. Therefore,
attaching amino groups to ODNs should effectively increase
the thermal stability of the duplexes and triplexes.7
Figure 1. Structures of the modified nucleoside analogues.
phosphodiester linkages in ODNs. As expected, we found that
ODNs containing 5 were more resistant to nucleolytic hydrolysis
by both snake venom phosphodiesterase (a 3′-exonuclease) and
DNase I (an endonuclease) than unmodified parent ODNs, while
the modified ODNs only slightly destabilized duplexes with both
complementary DNA and RNA strands.9
Wang and Seifert reported that ODNs containing 4′-C-
(aminomethyl)thymidine (1) exhibited hybridization to both
complementary DNA and RNA strands that were similar to or
better than those of unmodified ODNs and were more resistant
to nucleolytic hydrolysis by snake venom phosphodiesterase
than unmodified ODNs, although endonuclease resistance was
not examined (Figure 1).8
Based on these findings and considerations, we designed 4′-
C-[2-[[N-(2-aminoethyl)carbamoyl]oxy]ethyl]thymidine (5) as
a nucleoside unit for introducing into ODNs,9 since the 4′R-
position of nucleosides is very close to the internucleotide
These results suggest that ODNs containing nucleosides with
an aminoalkyl chain at the 4′R-position, which would be
accommodated in the minor groove of B-type DNA, are good
candidates for novel antisense molecules and prompted us to
further our study. If it is indeed true that the aminoalkyl chain
attached to the 4′R-position of ODNs interrupts the hydrolysis
of phosphodiester linkage by nucleases and/or stabilizes du-
plexes, then the three-dimensional positioning of the amino
group in ODNs is pivotal to its functioning. Thus, we designed
the thymidine analogues 2 and 4 with different lengths of
aminoalkyl chains at their 4′R-C-positions as possible nucleoside
units for our antisense study. We synthesized ODNs containing
thymidine analogues 2 and 4, as well as the previously reported
analogues 1 and 5, with natural phosphodiester linkages. The
thermal stability of duplexes containing these ODNs and their
complementary DNA and RNA strands was studied as well as
the resistance of these ODNs to nucleolytic hydrolysis by snake
venom phosphodiesterase and DNase I (an endonuclease). In
addition, we also examined whether the duplexes of these ODNs
with their complementary RNA strands could elicit RNase H
activity. This report describes the detailed results of these
studies.
(6) (a) Tabor, C. W.; Tabor, H. Annu. ReV. Biochem. 1976 45, 285-
306. (b) Tabor, C. W.; Tabor, H. Annu. ReV. Biochem. 1984, 53, 749-790.
(c) Etter, M. C. Acc. Chem. Res. 1990, 23, 120-126. (d) Tabor, H.
Biochemistry 1962, 1, 496-501. (e) Thomas, T. J.; Bloomfield, V. A.
Biopolymers 1984, 23, 1295-1306.
(7) Examples of ODNs carrying amines: (a) Tung, C.-H.; Breslauer, K.
J.; Stein, S. Nucleic Acids Res. 1993, 21, 5489-5494. (b) Prakash, T. P.;
Barawkar, D. A.; Kumar, V. A.; Ganesh, K. N. Bioorg. Med. Chem. Lett.
1994, 4, 1733-1738. (c) Barawkar, D. A.; Kumar, V. A.; Ganesh, K. N.
Biochem. Biophys. Res. Commun. 1994, 205, 1665-1670. (d) Barawkar,
D. A.; Rajeev, K. G.; Kumar, V. A.; Ganesh, K. N. Nucleic Acids Res.
1996, 24, 1229-1237. (e) Schmid, N.; Behr, J.-P. Tetrahedron Lett. 1995,
36, 1447-1450. (f) Sund, C.; Puri, N.; Chattopadhyaya, J. Tetrahedron
1996, 52, 12275-12290. (g) Hashimoto, H.; Nelson, M. G.; Switzer, C. J.
Org. Chem. 1993, 58, 4194-4195. (h) Hashimoto, H.; Nelson, M. G.;
Switzer, C. J. Am. Chem. Soc. 1993, 115, 7128-7134. (i) Ozaki, H.;
Nakamura, A.; Arai, M.; Endo, M.; Sawai, H. Bull. Chem. Soc. Jpn. 1995,
68, 1981-1987. (j) Shinozuka, K.; Umeda, A.; Aoki, T.; Sawai, H.
Nucleosides Nucleotides 1998, 17, 291-300. (k) Griffey, R. H.; Monia, B.
P.; Cummins, L. L.; Freier, S.; Greig, M. J.; Guinosso, C. J.; Lesnik, E.;
Manalili, S. M.; Mohan, V.; Owens, S.; Ross, B. R.; Sasmor, H.;
Wancewicz, E.; Weiler, K.; Wheeler, P. D.; Cook, P. D. J. Med. Chem.
1996, 39, 5100-5109. (l) Cuenoud, B.; Casset, F.; Hu¨sken, D.; Natt, F.;
Wolf, R. M.; Altmann, K.-H.; Martin, P.; Moser, H. E. Angew. Chem., Int.
Ed. Engl. 1998, 37, 1288-1291. (m) Dan, A.; Yoshimura, Y.; Ono, A.;
Matsuda, A. Bioorg. Med. Chem. Lett. 1993, 3, 615-618. (n) Ono, A.;
Dan, A.; Matsuda, A. Bioconjugate Chem. 1993, 4, 499-508. (o) Ono, A.;
Haginoya, N.; Kiyokawa, M.; Minakawa, N.; Matsuda, A. Bioorg. Med.
Chem. Lett. 1994, 4, 361-366. (p) Haginoya, N.; Ono, A.; Nomura, Y.;
Ueno, Y.; Matsuda, A. Bioconjugate Chem. 1997, 8, 271-280. (q) Nomura,
Y.; Ueno, Y.; Matsuda, A. Nucleic Acids Res. 1997, 25, 2784-2791. (r)
Ueno, Y.; Kumagai, I.; Haginoya, N.; Matsuda, A. Nucleic Acids Res. 1997,
25, 3777-3782. (s) Ueno, Y.; Mikawa, M.; Matsuda, A. Bioconjugate
Chem. 1998, 9, 33-39.
Results and Discussion
Synthesis. A general method for preparing 4′R-aminoalkyl
nucleosides was needed for our antisense study, since an
efficient method for preparing 4′R-branched nucleoside did not
exist.10 Consequently, we developed new radical chemistry using
a vinylsilyl11 or an allylsily group as a temporary radical
acceptor tether.
Thus, an intramolecular radical cyclization reaction of 7a,
which has a dimethylvinylsilyl group at the 3′-hydroxyl, with
Bu3SnH/AIBN and subsequent Tamao oxidation12 readily
provided the 5′-O-[dimethoxytrityl(DMTr)]-4′R-C-(2-hydroxy-
ethyl)thymidine (8a).9,11 The 5′-O-DMTr-4′R-C-(3-hydroxypro-
pyl)thymidine (8b) was also synthesized by a similar intramo-
(9) Ueno, Y.; Nagasawa, Y.; Sugimoto, I.; Kojima, N.; Kanazaki, M.;
Shuto, S.; Matsuda, A. J. Org. Chem. 1998, 63, 1660-1667.
(8) Wang, G.; Seifert, W. F. Tetrahedron Lett. 1996, 37, 6515-6518.

2424 J. Am. Chem. Soc., Vol. 122, No. 11, 2000
Kanazaki et al.
Scheme 1
lecular radical cyclization reaction at the 4′-position with an
allyldimethylsilyl group13 as a radical acceptor tether. The 4′-
phenylselenothymidine derivative 614 was treated with allyl-
chlorodimethylsilane and Et3N in the presence of DMAP in
toluene to afford an allylsilyl derivative 7b, the substrate for
the radical reaction, in 92% yield. When a solution of 1.5 equiv
of Bu3SnH and AIBN (0.05 equiv) in benzene was added slowly
over 8 h to a solution of 7b in benzene (0.01 M) at 80 °C, the
desired 4′R-(3-hydroxypropyl)thymidine 8b, which was derived
from the 7-endo-cyclized product, was isolated in 66% yield,
after treatment of the radical reaction products under Tamao
oxidation conditions.
thymidine derivatives 12a and 12b, respectively. After protection
of the primary hydroxyl group of 8a with a benzoyl (Bz) group,
the 3′-hydroxyl group was then protected with a tert-butyldi-
methylsilyl (TBS) group. Subsequent removal of the Bz group
gave the properly protected thymidine derivative 9a in 70% yield
from 8a. Methanesulfonylation of 9a followed by displacement
with azide ion afforded the azidoethyl derivative 10a, which
was then treated with tetrabutylammonium fluoride (TBAF) to
give 11a in high yield. Catalytic hydrogenation of 11a with
Pd-C in MeOH and subsequent protection of the generated
amino group with a trifluoroacetyl group afforded the desired
4′-branched thymidine derivative 12a in 73% yield. In a similar
manner, the corresponding trifluoroacetamidopropyl derivative
12b was synthesized from 8b.
Compounds 8a and 8b were converted into the 4′R-C-
trifluoroacetamidoethyl- and 4′R-C-trifluoroacetamidopropyl-
The 4′R-branched nucleosides 12a and 12b were phosphi-
tylated by the standard procedure15 to give the corresponding
phosphoramidites 13a and 13b in 91% and 62% yields,
respectively, which were used as the nucleotide units for the
DNA synthesizer. To incorporate 2 and 4 into the 3′-end of the
ODNs, 12a and 12b were further modified to produce the
corresponding 3′-succinates 14a and 14b, which were then
reacted with controlled pore glass (CPG) to give a solid support
containing 2 (28 µmol/g) and 4 (38 µmol/g), respectively
(Scheme 1).
The ODNs used in this study were synthesized on a DNA
synthesizer by the phosphoramidite method.16 The nucleosides
1, 2, 4, and 5 were incorporated into the 18-mer, 5′-d[MTMT-
MTMTMTMTMTMTMT]-3′, where M is 5-methyl-2′-deoxy-
cytidine, instead of T at various positions. We also prepared a
21-mer ODN 29 with a mixed sequence [5′-d[ACETGATEG-
CAEAAAECTTAE]-3′, where E is 2]. The sequences of the
(10) Although several approaches to the introduction of carbon substit-
uents at the 4′-position of nucleosides have been reported, these methods
were not stereoselective and the type of carbon substituents introduced was
limited: (a) Secrist, J. A., III; Winter, W. J. A., Jr. J. Am. Chem. Soc.
1978, 100, 2554-2556. (b) Youssefyeh, R. D.; Verheyden, P. H.; Moffat,
J. G. J. Org. Chem. 1979, 44, 1301-1309. (c) Haraguch, K.; Tanaka, H.;
Miyasaka, T. Tetrahedron Lett. 1990, 31, 227-230. (d) Haraguchi, K.;
Tanaka, H.; Itoh, Y.; Saito, S.; Miyasaka, T. Tetrahedron Lett. 1992, 33,
2841-2844. (e) Johnson, C. R.; Esker, J. L.; Van Zandt, M. C. J. Org.
Chem. 1994, 59, 5854-5855. (f) Haraguchi, K.; Tanaka, H.; Itoh, Y.;
Yamaguchi, K.; Miyasaka, T. J. Org. Chem. 1996, 61, 851-858. (g) Marx,
A.; Erdmann, P.; Senn, M.; Korner, S.; Jungo, T.; Petretta, M.; Imwinkelried,
P.; Dussy, A.; Kulicke, K. J.; Macko, L.; Zehnder, M.; Giese, B. HelV.
Chim. Acta 1996, 79, 1980-1994.
(11) (a) Shuto, S.; Kanazaki, M.; Ichikawa, S.; Matsuda, A. J. Org. Chem.
1997, 62, 5676-5677. (b) Shuto, S.; Kanazaki, M.; Ichikawa, S.; Minakawa,
N.; Matsuda, A. J. Org. Chem. 1998, 63, 746-754. (c) Sugimoto, I.; Shuto,
S.; Mori, S.; Shigeta, S.; Matsuda, A. Bioorg. Med. Chem. Lett. 1999, 9,
385-388. (d) Shuto, S.; Sugimoto, I.; Abe, H.; Matsuda, A. J. Am. Chem.
Soc., in press.
(12) Tamao, K.; Ishida, N.; Kumada, M. J. Org. Chem. 1983, 48, 2122-
2124.
(13) Xi, Z.; Agback, P.; Plavec, J.; Sandstro¨m, A.; Chattopadhyaya, J.
Tetrahedron 1992, 48, 349-370.
(14) Giese, B.; Erdmann, P.; Schafer, T.; Schwitter, U. Synthesis 1994,
1310-1312.
(15) Gait, M. J., Ed. Oligonucleotides synthesis: a practical approach;
IRL Press: Oxford, UK; 1984.
(16) Beaucage, S. L.; Caruthers, M. H. Tetrahedron Lett. 1981, 22, 1859-
1862.

4′R-C-Aminoalkylthymidine
J. Am. Chem. Soc., Vol. 122, No. 11, 2000 2425
Table 2. Hybridization Dataa
ODN/DNb
Table 1. Sequences of ODNsa
ODN/RNc
ODNs
d
e
d
1
1
2
0.01 M NaCl ∆Tm
0.1 M NaCl ∆Tm
0.1 M NaCl ∆Tm
15
5′-MTMTMTMTMTMTMTMTMT-3′
ODN
Tm, °C
°C
Tm, °C
°C
Tm, °C
°C
16-Y, -E, -P, or -Z 5′-MTMTMTMTMTMTMTMTMT-3′
17-Y, -E, -P, or -Z 5′-MTMTMTMTMTMTMTMTMT-3′
18-Y, -E, -P, or -Z 5′-MTMTMTMTMTMTMTMTMT-3′
19-Y, -E, -P, or -Z 5′-MTMTMTMTMTMTMTMTMT-3′
20-Y, -E, -P, or -Z 5′-MTMTMTMTMTMTMTMTMT-3′
21-Y, -E, -P, or -Z 5′-MTMTMTMTMTMTMTMTMT-3′
22-Y, -E, -P, or -Z 5′-MTMTMTMTMTMTMTMTMT-3′
23
24
25
26
27
28
29
15
54.5
65.6
+11.2
73.9
16-Y
17-Y
18-Y
19-Y
20-Y
21-Y
22-Y
54.4
54.4
54.5
55.4
56.8
57.5
58.9
+0.0
+0.0
+0.1
+1.0
+2.4
+3.1
+4.5
73.9
73.7
73.3
72.9
73.0
72.3
71.7
+0.0
-0.2
-0.6
-1.0
-0.9
-1.6
-2.2
65.9
66.9
68.7
+11.4
+10.1
+9.8
5′-MTMTMTMTMTMTMTMTMT-3′
5′-d[TG(GA)9GGT]-3′
5′-r[(AG)9A]-3′
5′-d[ACTTGATTGCATAAATCTTAT]-3′
5′-d[ATAAGATTTATGCAATCAAGT]-3′
5′-r[AUAAGAUUUAUGCAAUCAAGU]-3′
5′-d[ACETGATEGCAEAAAECTTAE]-3′
16-E
17-E
18-E
19-E
20-E
21-E
22-E
55.0
54.5
55.5
55.7
56.9
58.1
60.1
+0.6
+0.1
+1.1
+1.3
+2.5
+3.7
+5.7
73.7
73.8
73.5
72.1
72.3
71.5
71.2
-0.2
-0.1
-0.4
-1.8
-1.6
-2.4
-2.7
67.2
67.7
70.1
+11.7
+10.8
+10.0
a Y ) (T ) 1); E ) (T ) 2); P ) (T ) 4); Z ) (T ) 5); 23 ) (T
) 3); M ) 5-methyl-2′-deoxycytidine.
16-P
17-P
18-P
19-P
20-P
21-P
22-P
54.4
54.6
55.1
55.6
56.4
58.3
58.5
+0.0
+0.2
+0.7
+1.2
+2.0
+3.9
+4.1
73.3
73.4
73.1
72.5
72.5
72.0
71.2
-0.6
-0.5
-0.8
-1.4
-1.4
-1.9
-2.7
ODN analogues synthesized are shown in Table 1. The ODNs
containing the nucleoside 1 were synthesized according to the
method reported by Wang and Seifert.8 The ODNs containing
the nucleoside 5 were also synthesized by a previously described
method.9 The average coupling yields of 13a and 13b were 92%
and 93%, respectively, using 0.12 M solutions of the amidites
in CH3CN and a coupling time of 300 s. The fully protected
ODNs (1 µmol) linked to the solid supports were treated with
concentrated NH4OH at 55 °C for 16 h, followed by C-18
column chromatography; detritylation gave the ODNs in 10-
48 OD260 units. The ODN 22-E, which contains five residues
of 2, was treated with Ac2O in 0.2 M HEPES buffer to give the
ODN 23. Each ODN analogue obtained showed a single peak
on reversed-phase HPLC. Furthermore, these ODNs were
analyzed by electrospray ionization (ESI) mass spectrometry,
and the observed molecular weights supported their structures
(see Experimental Section).
65.8
67.3
68.5
+10.7
+10.9
+10.0
16-Z
17-Z
18-Z
19-Z
20-Z
21-Z
22-Z
52.1
52.7
50.8
53.9
54.9
55.6
56.8
-2.3
-1.7
-3.6
-0.5
+0.5
+1.2
+2.4
73.2
73.5
72.8
72.3
72.6
71.8
71.4
-0.7
-0.4
-1.1
-1.6
-1.3
-2.1
-2.5
64.9
65.7
+14.1
+10.8
68.5
63.1
+11.7
+14.8
23
48.3
-6.1
26
29
42.3
49.1
-
+6.8
-49.8
49.4
-0.4
a Experimental conditions are described in the Experimental Section.
b The complementary DNA: 24 for 15-23; 27 for 26 and 29. c The
1
complementary RNA: 25 for 15-23; 28 for 26 and 29. d ∆Tm
)
[Tm(each ODN) - Tm(the control ODN 15)]. e ∆Tm2 ) [Tm(0.1 M NaCl)
- Tm (0.01 M NaCl)].
Thermal Stability. Thermal stability of duplexes formed by
these ODNs and the complementary DNA, 5′-d[TG(GA)9GGT]-
3′ (24), was studied by thermal denaturation in a buffer of 0.01
M sodium phosphate (pH 7.0) containing 0.01 M NaCl. Each
profile of the thermal denaturation showed a single transition
corresponding to a helix-to-coil transition (data not shown).
Melting temperatures (Tms) are listed in Table 2. The Tm of the
control ODN 15 was 54.4 °C. All of the ODNs containing 1, 2,
or 4 stabilized the ODN/DNA duplexes. The stability of the
duplexes was dependent on the position, number, and length of
the aminoalkyl linkers of the modified nucleosides. The ODNs,
which contained one residue of 1, 2, or 4 at their center,
stabilized the duplexes more than the ODNs containing one
residue of 1, 2, or 4 at their 3′-ends or near their 5′-ends. The
duplexes became more stable as the number of 1, 2, or 4
increased. The ∆Tm1 values [Tm (each ODN) - Tm (the control
ODN 15)] for the ODNs containing five residues of 1, 2, or 4
were +4.5, +5.7, or +4.1 °C, respectively. The ODNs contain-
ing one or two residues of 5 destabilized the duplexes, whereas
the ODNs containing three, four, or five residues of 5 stabilized
On the other hand, the ODN 23 containing five residues of
3, which has an acetamidoethyl chain at the 4′-position,
destabilized the ODN/DNA duplex as compared with the control
duplex (∆Tm1 ) -6.1 °C). Thus, the enhanced thermal stability
of the duplexes containing 2 was likely due to the effect of the
terminal ammonium ion.
To confirm the effects of the ammonium ions at the end of
the alkyl chains of 1, 2, 4, and 5 on the thermal stabilities of
the duplexes, thermal denaturation was also performed under
higher ionic strength (0.1 M NaCl). The ∆Tm2 values obtained
[Tm (0.1 M NaCl) - Tm (0.01 M NaCl)] were compared, as
shown in Table 2. The ∆Tm values for the ODNs containing
three or five residues of 1, 2, or 4 were smaller than those for
the control ODN 15 (+11.2 °C), whereas the ∆Tm values for
the ODNs containing 5 or 3 were similar to or lower than those
for the control ODN 15. These results suggest that the terminal
ammonium ions in 1, 2, and 4 effectively neutralize the
phosphate negative charges.17
2
2
1
the duplexes. The ∆Tm value for the ODNs containing five
1
residues of 5 was +2.4 °C. The ∆Tm value for the ODNs
(17) Models of ODN/DNA and ODN/RNA duplexes containing 2 were
derived from molecular dynamics (MD) simulations. Initial structures of
ODN/DNA (B-form) and ODN/RNA (A-form) duplexes were generated
using Biopolymer’s molecular modeling system (Molecular Simulations Inc.,
San Diego, CA). In the ODN containing the 2/DNA duplex, the ammonium
ion at the end of the aminoethyl chain of 2 forms an intramolecular ionic
bond with the pro-S-oxygen atom of the phosphodiester linked to the 3′-
position of 2. In the ODN containing 2/RNA duplex, the ammonium ion of
2 intramolecularly interacts with the pro-S-oxygen atoms of both the 3′-
and 5′-phosphate groups of 2.
containing 2 was greater than those for the ODNs containing
the same numbers of 1, 4, or 5 except for the ODNs 17-P and
21-P. Additionally, the ∆Tm1 value for the 21-mer ODN 29 with
a mixed sequence, which has five residues of 2, was +6.8 °C.
Therefore, analogues containing 2 with an aminoethyl chain at
the 4′R-position seemed to efficiently stabilize the ODN/DNA
duplexes.

2426 J. Am. Chem. Soc., Vol. 122, No. 11, 2000
Kanazaki et al.
Figure 2. Polyacrylamide gel electrophoresis of 5′-32P-labeled ODNs hydrolyzed by snake venom phosphodiesterase: (a) 15; (b) 22-Y; (c) 22-E;
(d) 22-P; (e) 22-Z. ODNs were incubated with snake venom phosphodiesterase for 0 min (lane 1), 10 min (lane 2), 30 min (lane 3), 60 min (lane
4), and 120 min (lane 5). Experimental conditions are described in the Experimental Section.
Stable duplex formation with mRNA is one of the most
important factors in antisense research. The thermal stability
of the duplexes between these ODNs and a complementary
RNA, 5′-r[(AG)9A]-3′ (25), was next studied by thermal
denaturation in a buffer of 0.01 M sodium phosphate containing
0.1 M NaCl. Each profile of the thermal denaturation showed
a single transition corresponding to a helix-to-coil transition (data
not shown). Melting temperatures (Tms) are listed in Table 2.
The Tm of the control ODN 15 was 73.9 °C. All of the ODNs
containing 1, 2, 4, or 5 slightly destabilized the ODN/RNA
duplexes. The stability of the duplexes was dependent on the
position and number of the modified nucleosides. The ODNs
which contained one residue of 1, 2, 4, or 5 at their center
destabilized the duplexes more than the ODNs containing one
residue of 1, 2, 4, or 5 at their 3′-ends or near their 5′-ends,
respectively. The duplexes became less stable as the number
of the modified nucleosides increased. However, even when five
residues of 1, 2, 4, or 5 were incorporated into the 18-mers, the
∆Tm1 values for these ODNs were -2.2, -2.7, -2.7, and -2.5
°C, respectively. The ∆Tm1 value for the ODN 29 with a mixed
sequence, which has five residues of 2, was only -0.4 °C.
Therefore, DNA/RNA duplexes formed by the ODNs containing
1, 2, 4, or 5 are stable enough for use in antisense studies.
Circular Dichroism. To study the global conformation of
the duplexes, we measured the circular dichroism (CD) spectra
of duplexes composed of ODNs containing five residues of 1,
2, 4, or 5 (ODNs 22-Y, 22-E, 22-P, and 22-Z, respectively)
and either the complementary DNA (24) or RNA (25) at 15
°C.
With DNA (24) as a complementary strand, the spectrum of
the control duplex (15) showed a positive CD band at 281 nm
and a negative CD band at 239 nm which were attributable to
a B-like DNA conformation (Supporting Information). The
shapes of the spectra of the duplexes containing 1, 2, 4, or 5
were similar to those of the control duplex. However, the
positive CD bands in the spectra of the duplexes containing 1,
2, 4, or 5 were slightly shifted to longer wavelengths (ca. 1-3
nm) and the intensity of the negative bands at around 240 nm
was increased compared with those for the control duplex.
Furthermore, the intensity of the positive bands in the spectra
of the duplexes containing 1, 2, or 4 was slightly reduced and
that of the duplex containing 5 was slightly increased, relative
to that of the control duplex.
On the other hand, when RNA (25) was used as a comple-
mentary strand, the spectrum of the control duplex (15) showed
positive CD bands at 231 and 267 nm and a large negative CD
band at 212 nm (Supporting Information). The spectra of the
ODNs containing 1, 2, 4, or 5 were slightly different from those
of the control duplex (Supporting Information). The spectra of
the ODNs containing 1, 2, 4, or 5 showed red shifts (ca. 16
nm) of the positive CD bands to around 283 nm and slight
reductions in the intensity of the negative bands at 212 nm,
relative to that of the control duplex. Furthermore, the intensity
of the positive bands in the spectra of the duplexes containing
1, 2, or 4 was slightly reduced while that of the duplex
containing 5 was slightly increased, relative to that of the control
duplex.
These results suggest that the modified nucleosides only
slightly affect the global conformations of both ODN-DNA and
ODN-RNA duplexes.
Nuclease Resistance. The susceptibility of the ODNs to
nucleolytic digestion was examined. Two kinds of nucleases,
snake venom phosphodiesterase and DNase I, were used in this
study as models for a 3′-exonuclease and an endonuclease,
respectively. The stability of the ODNs in human serum was
also investigated.
The ODNs 22-Y, 22-E, 22-P, and 22-Z containing five
residues of each nucleoside analogue were labeled at the 5′-
end with 32P and incubated with snake venom phosphodiesterase
or DNase I. The reactions were then analyzed by polyacrylamide
gel electrophoresis under denaturing conditions.18
Figure 2 shows the results with snake venom phosphodi-
esterase. Although the control 15 was hydrolyzed randomly
within 10 min, the phosphodiester linkages at the 5′-sides of
the modified nucleosides were resistant to the nuclease. After
1 h, no enzymatic degradation of the ODNs containing 2 or 4
was observed at all. The half-lives of ODNs 15, 22-Y, 22-E,
22-P, and 22-Z were about 2 min, 2.9 h, 14.4 h, 17.8 h, and
5.2 h, respectively. Among the ODNs, the ODNs 22-E contain-
ing 2 and 22-P containing 4 were highly resistant to snake
venom phosphodiesterase.
The phosphodiester linkages around the modified nucleosides
were also highly resistant to the endo-hydrolysis by DNase I.
(18) Maniatis, T.; Fritsch, E. F.; Sambrook, J. 1982 Molecular cloning:
a laboratory manual; Cold Spring Harbor University Press: Cold Spring
Harbor, NY.

4′R-C-Aminoalkylthymidine
J. Am. Chem. Soc., Vol. 122, No. 11, 2000 2427
Figure 3. Polyacrylamide gel electrophoresis of 5′-32P-labeled ODNs hydrolyzed by DNase I: 15 (lanes 1-6); 22-Y (lanes 7-12); 22-E (lanes
13-18); 22-P (lanes 19-24); 22-Z (lanes 25-30). ODNs were incubated with DNase I for 0 min (lanes 1, 7, 13, 19, and 25), 6 min (lane 2), 18
min (lane 3), 30 min (lane 4), 1 h (lane 5), 2 h (lanes 6, 8, 14, 20, and 26), 6 h (lanes 9, 15, 21, and 27), 12 h (lanes 10, 16, 22, and 28), 24 h (lanes
11, 17, 23, and 29), and 48 h (lanes 12, 18, 24, and 30). Experimental conditions are described in the Experimental Section.
Figure 4. Polyacrylamide gel electrophoresis of 5′-32P-labeled ODNs incubated in PBS containing 50% human serum: (a) 15; (b) 22-Y; (c) 22-E;
(d) 22-P; (e) 22-Z. ODNs were incubated for 0 min (lane 1), 15 min (lane 2), 30 min (lane 3), 1 h (lane 4), 3 h (lane 5), 6 h (lane 6), 12 h (lane
7), 24 h (lane 8), and 48 h (lane 9). Experimental conditions are described in the Experimental Section.
The half-lives of the ODNs 22-Y, 22-E, 22-P, and 22-Z were
about 27, 29, 28, and 13 h, respectively, while that of the control
was 20 min (Figure 3). Interestingly, the ODNs 22-Y, 22-E,
and 22-P having relatively shorter aminoalkyl chains were more
resistant to the nuclease than the ODN 22-Z with a longer
aminoalkyl chain.
incubated separately in PBS containing 50% human serum and
analyzed by 20% PAGE under denaturing conditions (Figure
4). While the half-life of the control 15 was 27 min, it was 1.7,
2.5, 7.3, and 2.7 days respectively for ODN 22-Y, 22-E, 22-P,
or 22-Z. This experiment clearly shows that the ODNs contain-
ing the modified nucleosides are extremely stable in human
serum.
We also investigated the susceptibility of the ODN 29 with
a mixed sequence against DNase I and human serum. While
the half-life of the control ODN 26 was 7 min, the ODN 29
was not hydrolyzed after 48 h incubation against DNase I under
the same conditions described above. The ODN 29 was also
about 21-fold more stable than the control ODN 26 during
incubation in human serum described above (t1/2 of 26 and 29,
37 min and 13 h, respectively; supporting information).
From these results, the ODNs containing nucleosides with
the aminoalkyl chains at the 4′R-position, especially those
containing nucleosides with the aminoethyl and aminopropyl
chains, were found to be resistant enough to enzymatic
degradations to be used as antisense molecules.
Next, we examined the effects of the terminal ammonium
cations of the aminoalkyl chains on the resistance of the ODNs
to an endonuclease. We compared the susceptibility of ODN
23 containing 3 having an acetamidoethyl chain at the 4′R-
position to nucleolytic digestion by DNase I with that of ODN
22-E containing 2 having an aminoethyl chain (Supporting
Information). The half-lives of the ODN 15, 22-E, and 23 were
35 min, 30 h, and 3.4 h, respectively. The ODN 23 containing
3 was much less resistant to the nuclease than the ODN
containing 2. Therefore, this suggested to us that the effects of
the terminal ammonium ions of the aminoalkyl linkers played
an important role in nuclease resistance of the ODNs.
Antisense ODNs should be stable in blood, which contains
various enzymes including nucleases. Therefore, we investigated
the stabilities of ODNs 22-Y, 22-E, 22-P, and 22-Z in human
serum. A mixture of 32P-labeled ODN 22-Y, 22-E, 22-P, or
22-Z (at their 5′-ends) with their unlabeled ODN (25 µM) was
Degradation by RNase H. It has been postulated that
antisense activity of antisense ODNs is due, at least in part, to
cleavage of the RNA strand of a DNA/RNA duplex by RNase

2428 J. Am. Chem. Soc., Vol. 122, No. 11, 2000
Kanazaki et al.
Figure 5. Polyacrylamide gel electrophoresis of 5′-32P-labeled RNA 25 hydrolyzed by E. coli RNase H in the presence or in the absence of
complementary strands: (a) lane 1, 25; lane 2, 25 + 15; lane 3, 25 + 20-Y; lane 4, 25 + 20-E; lane 5, 25 + 20-P; lane 6, 25 + 20-Z; lane 7, 25
+ 15 + enzyme; lane 8, 25 + 20-Y + enzyme; lane 9, 25 + 20-E + enzyme; lane 10, 25 + 20-P + enzyme; lane 11, 25 + 20-Z + enzyme; (b)
lane 1, 25; lane 2, 25 + 15; lane 3, 25 + 22-Y; lane 4, 25 + 22-E; lane 5, 25 + 22-P; lane 6, 25 + 22-Z; lane 7, 25 + 15 + enzyme; lane 8, 25
+ 22-Y + enzyme; lane 9, 25 + 22-E + enzyme; lane 10, 25 + 22-P + enzyme; lane 11, 25 + 22-Z + enzyme. RNAs were incubated with E.
coli RNase H in the presence or in the absence of the complementary strands at 30 °C for 20 min (a) or 40 min (b). Experimental conditions are
described in the Experimental Section.
H.1c,19 We therefore examined whether the ODN/RNA hetero-
duplex between an ODN containing three residues (20-Y, 20-
E, 20-P, or 20-Z, respectively) and five residues (22-Y, 22-E,
22-P, or 22-Z, respectively) of 1, 2, 4, or 5 and its comple-
mentary RNA 25 could elicit RNase H activity. The duplexes
consisting of these ODNs and RNA 25 labeled with 32P at the
5′-end were incubated with Escherichia coli RNase H, and the
products were analyzed by polyacrylamide gel electrophoresis
(Figure 5). The RNAs in the duplexes with the ODNs containing
three residues of the modified nucleosides were completely
hydrolyzed after 20 min, and the rates were similar to those of
a control experiment with 15. When the ODNs contained five
residues of the modified nucleosides, the complementary RNAs
in the duplexes were also degraded, although the rates were
slightly decreased compared with those in the unmodified
duplex. The ODN 29 with a mixed sequence also elicited
effective cleavage of the complementary RNA 28 (supporting
information).
For oligonucleotide therapeutics, antisense ODNs are often
required to elicit RNase H activity in human cells. Therefore,
we next examined cleavage of RNAs by HeLa cell nuclear
extracts as a source of human RNase H.20 The experiments were
carried out using the same heteroduplexes described above. All
the RNA strands in the duplexes were found to be effectively
cleaved by HeLa cell nuclear extracts (Figure 6).
E. coli RNase H requires at least four contiguous unmodified
2′-deoxyribonucleotide residues to elicit cleavage of the RNA
strand,21 and a minimum of five contiguous unmodified 2′-
deoxyribonucleotides was required for efficient activation of
HeLa RNase H.20b Therefore, it is noteworthy that ODNs 22
elicit efficient cleavage of the RNA strand by RNase H, although
they have four regions of three contiguous unmodified 2′-
deoxyribonucleotide residues in the antisense strand.
Conclusion
To develop the nuclease-resistant antisense and antigene
ODNs with natural phosphodiester linkages, we designed and
synthesized ODNs containing 4′R-C-aminoalkylthymidines. The
nucleoside units 2, 4, and 5 were efficiently synthesized, using
novel radical chemistry as the key step.
The ODNs containing these nucleosides increased the thermal
stability of the duplexes with their complementary DNAs.
Among the ODNs, the one containing 2 with the aminoethyl
chain thermally stabilized the ODN/DNA duplex the most. The
∆Tm1 value [Tm (the duplex containing the modified nucleoside)
- Tm (the control duplex)] for the ODN/DNA duplex 22-E and
29 containing five residues of 2 was +5.7 and +6.8 °C,
respectively.
The ODNs containing these nucleosides formed stable
duplexes with the complimentary RNA, although the thermal
stability was slightly decreased compared with that of the control
duplex. The ∆Tm1 values for the ODN/RNA duplexes containing
five residues of 1, 2, 4, or 5 were about -2 °C. However, the
1
∆Tm value for the 21 mer duplex between mixed sequence
ODN 29 and RNA 28 was reduced to -0.4 °C. Therefore, the
DNA/RNA duplexes formed by the ODNs would be stable
enough for exhibiting antisense activities.
(19) (a) Chiang, M.-Y.; Chan, H.; Zounes, M. A.; Freier, S. M.; Lima,
W. F.; Bennett, C. F. J. Biol. Chem. 1991, 255, 9434-9443. (b) Neckers,
L.; Whitesell, L.; Rosolen, A.; Geselowitz, D, A. Crit. ReV. Oncol. 1991,
3, 175-231. (c) Monia, B. P.; Johnson, J. F.; Ecker. D. J.; Zounes, M. A.;
Lima, W. F.; Freier, S. M. J. Biol. Chem. 1992, 267, 19954-19962.
(20) (a) Agrawal, S.; Mayrarrd, S. H.; Zamecnik, P. C.; Pederson, T.
Proc. Natl. Acad. Sci. U.S.A. 1990, 87, 1401-1405. (b) Monia, B. P.; Lesnik,
E. A.; Gonzalez, C.; Lima, W. F.; McGee, D.; Guinosso, C. J.; Kawasaki,
A. K.; Cook, P. D.; Freier, S. M. J. Biol. Chem. 1993, 268, 14514-14522.
(21) (a) Inoue, H.; Hayase, Y.; Iwai, S.; Ohtsuka, E. FEBS Lett. 1987,
215, 327-330. (b) Furdon, P. J.; Dominaki, Z.; Kole, R. Nucleic Acids
Res. 1989, 17, 9193-9204.
The ODNs containing 1, 2, 4, or 5 were significantly resistant
to both snake venom phosphodiesterase and DNase I, and were
also very stable in human serum. The stability of these ODNs
against enzymatic hydrolyses is noteworthy, since they have
natural phosphodiester linkages. Furthermore, the duplexes
formed by the ODNs containing 1, 2, 4, or 5 and their
complementary RNAs were good substrates for E. coli and
human RNase H.

4′R-C-Aminoalkylthymidine
J. Am. Chem. Soc., Vol. 122, No. 11, 2000 2429
Figure 6. Polyacrylamide gel electrophoresis of 5′-32P-labeled RNA 25 hydrolyzed by HeLa RNase H in the presence or in the absence of
complementary strands: (a) lane 1, 25; lane 2, 25 + 15; lane 3, 25 + 20-Y; lane 4, 25 + 20-E; lane 5, 25 + 20-P; lane 6, 25 + 20-Z; lane 7, 25
+ 15 + enzyme; lane 8, 25 + 20-Y + enzyme; lane 9, 25 + 20-E + enzyme; lane 10, 25 + 20-P + enzyme; lane 11, 25 + 20-Z + enzyme; (b)
lane 1, 25; lane 2, 25 + 15; lane 3, 25 + 22-Y; lane 4, 25 + 22-E; lane 5, 25 + 22-P; lane 6, 25 + 22-Z; lane 7, 25 + 15 + enzyme; lane 8, 25
+ 22-Y + enzyme; lane 9, 25 + 22-E + enzyme; lane 10, 25 + 22-P + enzyme; lane 11, 25 + 22-Z + enzyme. RNAs were incubated with HeLa
cell nucleoar extracts in the presence or in the absence of the complementary strands at 30 °C for 20 min. Experimental conditions are described
in the Experimental Section.
mmol) in benzene (20 mL) was added slowly over 8 h to a solution of
7b (2.0 g, 2.5 mmol) in benzene (250 mL) at 80 °C. The solvent was
evaporated under reduced pressure, and the residue was partitioned
between MeCN and hexane. The MeCN layer was evaporated under
reduced pressure. The residue was dissolved in MeOH/THF (1:1, 50
mL), and aqueous H2O2 (30%, 1.4 mL, 12.5 mmol), KF (750 mg, 12.5
mmol), and KHCO3 (400 mg, 0.4 mmol) were added to the above
solution. The resulting mixture was stirred at room temperature
overnight. Aqueous Na2S2O3 (1 M, 60 mL) was added, and the resulting
insoluble materials were filtered off. The filtrate was evaporated under
reduced pressure, and the residue was purified by column chromatog-
raphy (SiO2, 4% MeOH in CHCl3) to give 8b (995 mg, 66% as a white
foam): FAB-MS m/z 603 (MH+); 1H NMR (270 MHz, CDCl3) δ 8.77
(br s, 1 H), 7.51 (s, 1 H), 7.41-6.82 (m, 13 H), 6.35 (t, 1 H, J ) 6.3),
4.53 (m, 1 H), 3.79 (s, 6 H), 3.58 (m, 2 H), 3.28 (s, 2 H), 2.41 (br d,
2 H, J ) 6.3), 1.79-1.38 (m, 4 H), 1.49 (s, 3 H); 13C NMR (100 MHz,
CDCl3) δ 163.70, 158.60, 150.53, 144.15, 135.60, 135.25, 130.04,
128.09, 127.92, 127.09, 113.22, 111.14, 88.60, 87.15, 83.70, 77.21,
73.58, 66.64, 62.74, 55.27, 40.76, 28.39, 26.67, 11.94. HRMS (FAB)
calcd for C34H39N2O8: 603.2704. Found: 603.2715. Anal. Calcd for
C34H38N2O8‚7/4H2O: C, 64.39; H, 6.60; N, 4.42. Found: C, 64.51; H,
6.43; N, 4.43.
These results demonstrated that the natural phosphodiester
ODNs containing the 4′R-aminoalkyl nucleosides, especially the
nucleoside 2 with the aminoethyl chain, possess the desired
properties for an antisense and/or antigene molecule: (1)
formation of the stable duplex with complimentary DNA and
RNA, (2) resistance to nucleases, and (3) RNase H activity in
the duplex with RNA. Thus, the ODNs are good candidates for
antisense and antigene molecules. Applications of the ODN
containing 2 as an antisense ODN are currently being studied.
Experimental Section
NMR spectra were recorded at 270 or 500 (1H), at 100 or 125 (13C),
and at 202 MHz (31P) and are reported in ppm downfield from TMS
or 85% H3PO4. J values are given in hertz. Mass spectra were obtained
by the fast atom bombardment (FAB) method. Thin-layer chromatog-
raphy was done on Merck coated plates 60F254. The silica gel or the
neutralized silica gel used for column chromatography were Merck silica
gel 5715 or ICN silica 60A, respectively.
1-[3-O-(Allyldimethylsilyl)-2-deoxy-5-O-(dimethoxytrityl)-4-C-
(phenylseleno)-r-L-threo-pento-1,4-furanosyl]thymine (7b). A mix-
ture of 6 (2.8 g, 4.0 mmol), allylchlorodimethylsilane (1.2 mL, 8.0
mmol), DMAP (100 mg, 0.8 mmol), and Et3N (1.1 mL, 8.0 mmol) in
toluene (100 mL) was stirred at room temperature for 30 min. After
insoluble materials were filtered off, the filtrate was partitioned between
EtOAc and H2O. The organic layer was washed with brine, dried (Na2-
SO4), and evaporated under reduced pressure. The residue was purified
by column chromatography (SiO2, 50% EtOAc in hexane) to give 7b
3′-O-(tert-Butyldimethylsilyl)-5′-O-(dimethoxytrityl)-4′-C-(2-hy-
droxyethyl)thymidine (9a). To a solution of 8a (588 mg, 1.0 mmol)
in CH2Cl2 (20 mL) at -78 °C was added a solution of DMAP (18 mg,
0.15 mmol), Et3N (181 µL, 1.3 mmol), and BzCl (151 µL, 1.3 mmol)
in CH2Cl2 (5 mL) slowly, and the resulting mixture was stirred at -78
°C for 10 min. After H2O was added, the resulting mixture was diluted
with CHCl3. The organic layer was washed with H2O and brine, dried
(Na2SO4), and evaporated under reduced pressure. The residue was
purified by column chromatography (SiO2, 50% EtOAc in hexane) to
give the 4′-C-(benzoyloxyethyl)thymidine derivative. To a solution of
the above compound in CH2Cl2 (10 mL) at -18 °C was added N,N-
diisopropylethylamine (410 µL, 2.4 mmol), and TBSOTf (550 µL, 2.4
mmol, 3.0), and the resulting mixture was stirred at room temperature
for 1 h. After MeOH was added, the resulting mixture was evaporated
under reduced pressure, and the residue was partitioned between EtOAc
and H2O. The organic layer was washed with brine, dried (Na2SO4),
and evaporated under reduced pressure. A mixture of the residue and
K2CO3 (166 mg, 1.2 mmol) in MeOH (30 mL) was stirred at room
1
(2.98 g, 92% as a white foam): FAB-MS m/z 799 (MH+); H NMR
(270 MHz, CDCl3) δ 8.55 (br s, 1 H), 7.54-6.79 (m, 19 H), 6.54 (dd,
1 H, J ) 7.4, 6.2), 5.53 (ddd, 1 H, J ) 7.9, 11.2, 15.9), 4.76 (dd, 2 H,
J ) 11.2, 15.9), 4.44 (dd, 1 H, J ) 5.5, 3.3), 3.78 (s, 6 H), 3.60 (d, 1
H, J ) 10.5), 3.00 (d, 1 H, J ) 10.5), 2.48 (ddd, 1 H, J ) 7.4, 5.5,
13.2), 2.35 (ddd, 1 H, J ) 6.2, 3.3, 13.2), 1.96 (s, 3 H), 1.35 (d, 2 H,
J ) 7.9), -0.16, -0.17 (each s, each 3 H). HRMS (FAB) calcd for
C42H47N2O7SeSi: 799.2314. Found: 799.2302. Anal. Calcd for
C42H46N2O7SeSi‚1/4H2O: C, 62.87; H, 5.84; N, 3.49. Found: C, 62.95;
H, 6.01; N, 3.46.
5′-O-(Dimethoxytrityl)-4′-C-(3-hydroxypropyl)thymidine (8b). A
solution of Bu3SnH (1.0 mL, 3.75 mmol) and AIBN (20 mg, 0.12

2430 J. Am. Chem. Soc., Vol. 122, No. 11, 2000
Kanazaki et al.
temperature overnight. The solvent was evaporated under reduced
pressure, and the residue was purified by column chromatography (SiO2,
50% EtOAc in hexane) to give 9a (494 mg, 70% as a white foam):
FAB-MS m/z 703 (MH+); 1H NMR (270 MHz, CDCl3) δ 8.30 (br s, 1
H), 57.54 (s, 1 H), 7.41-6.82 (m, 13 H), 6.29 (t, 1 H, J ) 6.6), 4.61
(dd, 1 H, J ) 4.9, 6.6), 3.79 (s, 6 H), 3.70 (m, 2 H), 3.38 (d, 1 H, J )
10.3), 3.16 (d, 1 H, J ) 10.3), 2.32 (ddd, 1 H, J ) 6.6, 4.9, 10.5), 2.21
(ddd, 1 H, J ) 6.6, 6.6, 10.5), 1.70-1.59 (m, 2 H), 1.47 (s, 3 H), 0.85
(s, 9 H), 0.05, -0.02 (each s, each 3 H). HRMS (FAB) calcd for
C39H51N2O8Si: 703.3411. Found: 703.3438. Anal. Calcd for C39H50N2O8-
Si: C, 66.64; H, 7.17; N, 3.99. Found: C, 66.71; H, 7.23; N, 3.89.
4′-C-(Azidoethyl)-3′-O-(tert-butyldimethylsilyl)-5′-O-(dimethoxy-
trityl)thymidine (10a). To a solution of 9a (562 mg, 0.8 mmol) in
CH2Cl2 (15 mL) at 0 °C was added Et3N (223 µL, 1.6 mmol) and MsCl
(124 µL, 1.6 mmol), and the resulting mixture was stirred at room
temperature for 1.5 h. After H2O was added, the resulting mixture was
diluted with CHCl3. The organic layer was washed with H2O and brine,
dried (Na2SO4), and evaporated under reduced pressure. A solution of
the residue and NaN3 (520 mg, 8.0 mmol) in DMF (10 mL) was stirred
at room temperature overnight. After H2O was added, the resulting
mixture was diluted with EtOAc. The organic layer was washed with
H2O and brine, dried (Na2SO4), and evaporated under reduced pressure.
The residue was purified by column chromatography (SiO2, 30% EtOAc
in hexane) to give 10a (488 mg, 83% as a white foam): FAB-MS m/z
84.26, 77.21, 73.77, 66.63, 55.22, 40.52, 35.79, 30.76, 11.91. HRMS
(FAB) calcd for C35H37N3O8F3: 684.253. Found: 684.2544. Anal. Calcd
for C35H36N3O8F3‚8/5H2O: C, 59.00; H, 5.54; N, 5.89. Found: C, 58.84;
H, 5.28; N, 5.79.
3′-O-(tert-Butyldimethylsilyl)-5′-O-(dimethoxytrityl)-4′-C-(3-hy-
droxypropyl)thymidine (9b). To a solution of 8b (1.28 g, 2.1 mmol)
in CH2Cl2 (80 mL) at -78 °C was added a solution of DMAP (30 mg,
0.25 mmol), Et3N (380 µL, 2.73 mmol), and BzCl (316 µL, 2.73 mmol)
in CH2Cl2 (10 mL) slowly, and the resulting mixture was stirred at
-78 °C for 1 h and then at 0 °C for 1 h. After H2O was added, the
resulting mixture was diluted with CHCl3. The organic layer was
washed with H2O, aqueous NaHCO3 (saturated), and brine, dried (Na2-
SO4), and evaporated under reduced pressure. The residue was purified
by column chromatography (SiO2, 1% MeOH in CHCl3) to give the
4′-C-(benzoyloxypropyl)thymidine derivative. A mixture of the above
compound, imidazole (849 mg, 12.5 mmol), and TBSCl (468 mg, 3.12
mmol) in DMF (20 mL) was stirred at room temperature overnight.
After H2O was added, the resulting mixture was evaporated under
reduced pressure, and the residue was partitioned between EtOAc and
H2O. The organic layer was washed with brine, dried (Na2SO4), and
evaporated under reduced pressure. A mixture of the residue and K2-
CO3 (216 mg, 1.56 mmol) in MeOH (30 mL) was stirred at room
temperature overnight. The solvent was evaporated under reduced
pressure, and the residue was purified by column chromatography (SiO2,
1% MeOH in CHCl3) to give 9b (845 mg, 54% as a white foam): FAB-
1
728 (MH); H NMR (270 MHz, CDCl3) δ 8.08 (br s, 1 H), 7.54 (s, 1
1
H), 7.42-6.82 (m, 13 H), 6.23 (t, 1 H, J ) 6.4), 4.61 (dd, 1 H, J )
4.5, 6.5), 3.80 (s, 6 H), 3.39 (ddd, 1 H, J ) 6.6, 9.3, 12.1), 3.33 (d, 1
H, J ) 10.2), 3.24 (ddd, 1 H, J ) 5.7, 9.3, 12.1), 3.11 (d, 1 H, J )
10.2), 2.29 (dd × 2, 2 H, J ) 6.4, 4.5, 6.5), 2.00 (ddd, 1 H, J ) 9.3,
5.7, 14.6), 1.68 (ddd, 1 H, J ) 6.6, 9.3, 14.6), 1.48 (s, 3 H), 0.87 (s,
9 H), 0.06, 0.008 (each s, each 3 H); 13C NMR (125 Mz, CDCl3) δ
163.95, 159.05, 150.50, 144.34, 135.61, 135.41, 135.38, 130.35, 130.33,
128.40, 128.25, 127.48, 113.55, 111.34, 87.83, 87.32, 84.17, 73.26,
65.86, 55.50, 47.20, 41.23, 31.56, 25.56, 18.20, 12.12, 11.69, -4.42,
-4.83; IR (Nujol) 2095 cm-1 (-N3). HRMS (FAB) calcd for
C39H50N5O7Si: 728.3479. Found: 728.3455. Anal. Calcd for C39H49N5O7-
Si‚1/4H2O: C, 63.95; H, 6.81; N, 9.56. Found: C, 63.95; H, 6.84; N,
9.57.
MS m/z 716 (M+); H NMR (270 MHz, CDCl3) δ 8.40 (br s, 1 H),
7.66 (s, 1 H), 7.41-9.82 (m, 13 H), 6.24 (t, 1 H, J ) 6.3), 4.68 (dd,
1 H, J ) 5.3, 6.9), 3.79 (s, 6 H), 3.58 (m, 2 H), 3.20 (d, 1 H, J )
10.0), 3.08 (d, 1 H, J ) 10.0), 2.35 (ddd, 1 H, J ) 6.3, 5.3, 13.5), 2.24
(ddd, 1 H, J ) 6.3, 6.9, 13.5), 1.75-1.45 (m, 4 H), 1.42 (s, 3 H), 0.84
(s, 9 H), 0.04, -0.04 (each s, each 3H); 13C NMR (100 MHz, CDCl3)
δ 163.73, 158.55, 150.23, 144.11, 135.48, 135.22, 130.02, 130.01,
128.11, 127.84, 127.06, 113.15, 113.11, 110.91, 88.49, 86.79, 83.43,
72.17, 65.23, 63.21, 55.24, 41.22, 28.45, 26.86, 25.73, 17.99, 11.83,
-4.55, -4.98. HRMS (FAB) calcd for C40H52N2O8Si: 716.3489. Found:
716.3464. Anal. Calcd for C40H52N2O8Si‚3/4H2O: C, 65.77; H, 7.38;
N, 3.84. Found: C, 65.75; H, 7.25; N, 3.92.
4′-C-(Azidopropyl)-3′-O-(tert-butyldimethylsilyl)-5′-O-(dimeth-
oxytrityl)thymidine (10b). To a solution of 9b (716 mg, 1.0 mmol)
in CH2Cl2 (20 mL) at 0 °C was added Et3N (279 µL, 2.0 mmol) and
MsCl (155 µL, 2.0 mmol), and the resulting mixture was stirred at
room temperature for 2 h. After H2O was added, the resulting mixture
was diluted with CHCl3. The organic layer was washed with H2O and
brine, dried (Na2SO4), and evaporated under reduced pressure. A
solution of the residue and NaN3 (650 mg, 10 mmol) in DMF (10 mL)
was stirred at room temperature overnight. After MeOH was added,
the resulting mixture was evaporated under reduced pressure, and the
residue was partitioned between EtOAc and H2O. The organic layer
was washed with brine, dried (Na2SO4), and evaporated under reduced
pressure. The residue was purified by column chromatography (SiO2,
30% EtOAc in hexane) to give 10b (669 mg, 90% as a white foam):
4′-C-(Azidoethyl)-5′-O-(dimethoxytrityl)thymidine (11a). A mix-
ture of 10a (73 mg, 0.1 mmol) and TBAF (1 M in THF, 200 µL, 0.2
mmol) in THF (5 mL) was stirred at room temperature for 3 h. The
resulting mixture was evaporated under reduced pressure, and the
residue was purified by column chromatography (SiO2, 2% MeOH in
CHCl3) to give 11a (53 mg, 86% as a white foam): FAB-MS m/z 613
1
(M+); H NMR (270 MHz, CDCl3) δ 8.20 (br s, 1 H), 7.43 (s, 1 H),
7.39-6.85 (m, 13 H), 6.31 (t, 1 H, J ) 6.6), 4.45 (dd, 1 H, J ) 9.9,
4.2), 3.81 (s, 6 H), 3.44 (dd, 1 H, J ) 6.2, 12.6), 3.30 (d, 1 H, J )
10.0), 3.26 (d, 1 H, J ) 10.0), 3.21 (dd, 1 H, J ) 6.2, 12.6), 2.47 (d,
1 H, J ) 4.2), 2.43 (dd, 2 H, J ) 6.6, 9.9), 1.98 (t, 2 H, J ) 6.2), 1.56
(s, 3 H); 13C NMR (100 MHz, CDCl3) δ 158.66, 144.00, 135.04, 135.04,
134.94, 130.00, 128.01, 127.95, 127.15, 113.26, 111.12, 87.59, 87.20,
84.10, 73.68, 66.55, 47.03, 140.49, 31.07, 12.04; IR (Nujol) 2093 cm-1
(-N3). HRMS (FAB) calcd for C33H35N5O7: 613.2534. Found: 613.2528.
Anal. Calcd for C33H35N5O7‚3/4H2O: C, 63.89; H, 5.76; N, 10.96.
Found: C, 63.78; H, 5.93; N, 11.22.
5′-O-(Dimethoxytrityl)-4′-C-[(2-N-trifluoroacetyl)aminoethyl]-
thymidine (12a). A mixture of 11a (44 mg, 72 mmol) and Pd-C (10%,
10 mg) in MeOH (5 mL) was stirred under atmospheric pressure of H2
at room temperature overnight. The catalyst was filtered off with Celite,
and the filtrate was evaporated under reduced pressure. A solution of
the residue, Et3N (50 µL, 0.36 mmol), and ethyl trifluoroacetate (43
µL, 0.16 mmol) in MeOH (10 mL) was stirred at room temperature
for 2 h. The solvent was evaporated under reduced pressure, and the
residue was purified by column chromatography (SiO2, 2% MeOH in
CHCl3) to give 12a (36 mg, 73% as a white foam): FAB-MS m/z 684
(MH+); 1H NMR (270 MHz, CDCl3) δ 8.23 (br s, 1 H), 7.40 (s, 1 H),
7.38-6.84 (m, 13 H), 7.12 (br s, 1 H), 6.34 (t, 1 H, J ) 7.1), 4.52 (t,
1 H, J ) 4.5), 3.81 (s, 6 H), 3.47-3.34 (m, 2 H), 3.26 (m, 2 H), 2.41
(dd × 2, 2 H, J ) 7.1, 4.5), 2.00 (m, 2 H), 1.58 (s, 3 H); 13C NMR
(100 MHz, CDCl3) δ 163.87, 158.65, 150.75, 143.94, 135.44, 134.94,
134.85, 129.98, 127.98, 127.94, 127.15, 113.26, 111.43, 88.24, 87.33,
1
FAB-MS m/z 741 (M+); H NMR (270 MHz, CDCl3) δ 8.82 (br s, 1
H), 7.59 (s, 1 H), 7.58-6.82 (m, 13 H), 6.23 (dd, 1 H, J ) 6.3, 6.6),
4.63 (dd, 1 H, J ) 4.6, 6.6), 3.80 (s, 6 H), 3.32 (d, 1 H, J ) 10.2),
3.22 (m, 2 H), 3.08 (d, 1 H, J ) 10.2), 2.33 (ddd, 1 H, J ) 6.3, 4.6,
13.5), 2.22 (ddd, 1 H, J ) 6.6, 6.6, 13.5), 1.76-1.47 (m, 4 H), 1.46 (s,
3 H), 0.85 (s, 9 H), 0.063, -0.02 (each s, each 3 H); 13C NMR (100
MHz, CDCl3) δ 163.67, 158.61, 150.19, 144.07, 135.37, 135.15, 130.01,
128.08, 127.87, 127.09, 113.19, 113.17, 110.94, 88.38, 86.87, 83.63,
72.62, 65.33, 55.25, 52.00, 41.26, 29.48, 25.74, 23.46, 18.01, 11.90,
-4.56, -4.98; IR (Nujol) 2095 cm-1 (-N3). HRMS (FAB) calcd for
C40H51N5O7Si: 741.3555. Found: 741.3530. Anal. Calcd for C40H51N5O7-
Si: C, 64.75; H, 6.92; N, 9.44. Found: C, 64.84; H, 7.04; N, 9.21.
4′-C-(Azidopropyl)-5′-O-(dimethoxytrityl)thymidine (11b). A mix-
ture of 10b (532 mg, 0.72 mmol) and TBAF (1 M in THF, 1.4 mL,
1.4 mmol) in THF (20 mL) was stirred at room temperature for 3 h.
The resulting mixture was evaporated under reduced pressure, and the
residue was purified by column chromatography (SiO2, 60% EtOAc
in hexane) to give 11b (390 mg, 86% as a white foam): FAB-MS m/z
1
627 (M+); H NMR (270 MHz, CDCl3) δ 8.33 (br s, 1 H), 7.38 (s, 1
H), 7.41-6.83 (m, 13 H), 6.26 (t, 1 H, J ) 6.8), 4.53 (dd, 1 H, J )

4′R-C-Aminoalkylthymidine
J. Am. Chem. Soc., Vol. 122, No. 11, 2000 2431
10.6, 4.3), 3.80 (s, 6 H), 3.24 (m, 4 H), 2.37 (ddd, 2 H, J ) 6.8, 10.6,
13.8), 2.03 (d, 1 H, J ) 4.3), 1.74-1.45 (m, 4 H), 1.55 (s, 3 H); 13C
NMR (100 MHz, CDCl3) δ 163.57, 158.63, 150.28, 144.09, 135.38,
135.13, 135.07, 129.99, 128.02, 127.95, 127.12, 113.25, 111.09, 87.91,
87.10, 83.69, 73.63, 66.20, 55.26, 51.85, 40.60, 28.96, 23.32, 12.06;
IR (Nujor) 2093 cm-1 (-N3). HRMS (FAB) calcd for C34H37N5O7:
627.2690. Found: 627.2712. Anal. Calcd for C34H37N5O7: C, 65.06;
H, 5.94; N, 11.16. Found: C, 65.04; H, 6.05; N, 10.99.
4 H), 2.45-2.34 (m, 2 H), 1.81-1.40 (m, 4 H), 1.50 (s, 3 H). HRMS
(FAB) calcd for C40H42F3N3O11: 797.2769. Found: 797.2763.
Synthesis of the Controlled Pore Glass Support with 14a or 14b.
Aminopropyl controlled pore glass (390 mg, 35.0 µmol, 89.8 µmol/g,
CPG Inc.) was added to a solution of 14a (110 mg, 0.14 mmol) and
1-ethyl-3-(3-dimethylaminopropyl)carbodiimido hydrochloride (WSCI)
(27 mg, 0.14 mmol) in DMF (4 mL), and the mixture was kept at room
temperature for 2 days. After the resin was washed with pyridine, 3
mL of a capping solution (0.1 M DMAP in pyridine:Ac2O ) 9:1) was
added, and the whole was kept at room temperature for 12 h. The resin
was washed with EtOH and acetone and was dried under vacuum. The
amount of loaded nucleoside 14a to the solid support is 28 µmol/g
from the calculation of released dimethoxytrityl cation by a solution
of 70% HClO4:EtOH (3:2, v/v). In a similar manner, the solid supports
with 14b were obtained in 38 µmol/g of loading amounts.
Synthesis of ODNs. ODNs were synthesized on a DNA synthesizer
(Applied Biosystem model 392) by the phosphoramidite method. The
fully protected ODNs were then deblocked and purified by the same
procedure as for the purification of normal ODNs. That is, each ODN
linked to the resin was treated with concentrated NH4OH at 55 °C for
16 h, and the released ODN protected by a DMTr group at the 5′-end
was chromatographed on a C-18 silica gel column (1 × 10 cm, Waters)
with a linear gradient of MeCN from 0 to 30% in 0.1 M TEAA buffer
(pH 7.0). The fractions were concentrated, and the residue was treated
with aqueous 80% AcOH at room temperature for 20 min, then the
solution was concentrated, and the residue was coevaporated with H2O.
The residue was dissolved in H2O and the solution was washed with
Et2O, then the H2O layer was concentrated to give a deprotected ODN
16-Y (16), ODN 17-Y (30), ODN 18-Y (30), ODN 19-Y (24), ODN
20-Y (23), ODN 21-Y (22), ODN 22-Y (20), ODN 16-E (22), ODN
17-E (48), ODN 18-E (39), ODN 19-E (22), ODN 20-E (20), ODN
21-E (22), ODN 22-E (34), ODN 16-P (14), ODN 17-P (13), ODN
18-P (19), ODN 19-P (40), ODN 20-P (17), ODN 21-P (10), ODN
22-P (12), ODN 16-Z (19), ODN 17-Z (26), ODN 18-Z (26), ODN
19-Z (20), ODN 20-Z (27), ODN 21-Z (23), ODN 22-Z (20), and ODN
29 (49). The yields are indicated in parentheses as OD units at 260 nm
starting from 1-µmol scale.
Acetylation of ODN 22-E. A solution containing ODN 22-E (1.0
OD unit at 260 nm) and Ac2O (2 µL) in 0.2 M HEPES buffer (200 µL,
pH 7.2) was kept for 1 h at room temperature. Concentrated NH4OH
(400 µL) was added to the mixture, and the whole was kept overnight
at 4 °C. The solvent was removed in vacuo, and the residue was purified
by HPLC with a C18 column to give ODN 23 (0.7 OD 260 units).
Matrix-Assisted Laser Desorption/Ionization Time-of-Flight Mass
Spectrometry. Spectra were obtained on a Voyager Elite reflection
time-of-flight mass spectrometry (PerSeptive Biosystems, Inc., Framing-
ham, MA) equipped with a nitrogen laser (337 nm, 3-ns pulse) in the
negative ion mode. 3-Hydroxypicolinic acid (HPA), dissolved in H2O
to give a saturated solution at room temperature, was used as the matrix.
Time-to-mass conversion was achieved by calibration by using the peak
representing the C+ cation of the charged derivative to be analyzed.
ODN 16-Y: calculated mass, 5433.7; observed mass, 5430.7. ODN
17-Y: calculated mass, 5433.7; observed mass, 5431.7. ODN 18-Y:
calculated mass, 5433.7; observed mass, 5429.4. ODN 19-Y: calculated
mass, 5462.8; observed mass, 5460.3. ODN 20-Y: calculated mass,
5491.8; observed mass, 5488.6. ODN 21-Y: calculated mass, 5520.9;
observed mass, 5519.7. ODN 22-Y: calculated mass, 5549.9; observed
mass, 5546.0. ODN 16-E: calculated mass, 5447.8; observed mass,
5445.1. ODN 17-E: calculated mass, 5447.8; observed mass, 5445.8.
ODN 18-E: calculated mass, 5447.8; observed mass, 5445.3. ODN
19-E: calculated mass, 5490.8; observed mass, 5487.6. ODN 20-E:
calculated mass, 5533.9; observed mass, 5530.5. ODN 21-E: calculated
mass, 5577.0; observed mass, 5568.6. ODN 22-E: calculated mass,
5620.0; observed mass, 5617.8. ODN 16-P: calculated mass, 5461.8;
observed mass, 5458.8. ODN 17-P: calculated mass, 5461.8; observed
mass, 5457.6. ODN 18-P: calculated mass, 5461.8; observed mass,
5457.0. ODN 19-P: calculated mass, 5518.9; observed mass, 5515.5.
ODN 20-P: calculated mass, 5576.0; observed mass, 5575.3. ODN
21-P: calculated mass, 5633.1; observed mass, 5629.1. ODN 22-P:
calculated mass, 5690.2; observed mass, 5686.1. ODN 16-Z: calculated
mass, 5534.8; observed mass, 5532.0. ODN 17-Z: calculated mass,
5′-O-(Dimethoxytrityl)-4′-C-[(2-N-trifluoroacetyl)aminopropyl]-
thymidine (12b). A mixture of 11b (390 mg, 0.62 mmol) and Pd-C
(10%, 40 mg) in MeOH (15 mL) was stirred under atmospheric pressure
of H2 at room temperature overnight. The catalyst was filtered off with
Celite, and the filtrate was evaporated under reduced pressure. A
solution of the residue, Et3N (431 µL, 3.1 mmol), and ethyl trifluoro-
acetate (370 µL, 3.1 mmol) in MeOH (10 mL) was stirred at room
temperature overnight. The solvent was evaporated under reduced
pressure, and the residue was purified by column chromatography (SiO2,
1% MeOH in CHCl3) to give 12b (343 mg, 79% as a white foam):
1
FAB-MS m/z 697 (M+); H NMR (270 MHz, CDCl3) δ 8.33 (br s, 1
H), 7.36 (s, 1 H), 7.39-6.83 (m, 13 H), 6.70 (br s, 1 H), 6.31 (t, 1 H,
J ) 6.7), 4.54 (dd, 1 H, J ) 5.0, 3.7), 3.80 (s, 6 H), 3.29 (m, 2 H),
3.24 (s, 2 H), 2.39 (m, 2 H, J ) 6.7, 5.0), 2.22 (d, 1 H, J ) 3.7),
1.74-1.57 (m, 4 H), 1.54 (s, 3 H); 13C NMR (100 MHz, CDCl3) δ
163.80, 158.63, 150.73, 144.06, 135.47, 135.07, 135.02, 130.01, 129.99,
128.01, 127.92, 127.12, 113.35, 88.47, 87.18, 83.93, 77.21, 73.77, 66.47,
55.24, 40.78, 40.33, 29.25, 23.06, 11.90. HRMS (FAB) calcd for
C36H38F3N3O8: 697.2608. Found: 697.2617. Anal. Calcd for
C36H38F3N3O8‚3/2H2O: C, 59.66; H, 5.70; N, 5.80. Found: C, 59.64;
H, 5.46; N, 5.71.
5′-O-(Dimethoxytrityl)-4′-C-[(2-N-trifluoroacetyl)aminoethyl]-
thymidine 3′-O-(2-Cyanoethyl) N,N-Diisopropylphosphoramidite
(13a). After successive coevaporation with pyridine, 12a (410 mg, 0.60
mmol) was dissolved in CH2Cl2 (10 mL) containing N,N-diisopropyl-
ethylamine (210 µL, 1.2 mmol). Chloro(2-cyanoethoxy)(N,N-diisopro-
pylamino)phosphine (200 µL, 0.90 mmol) was added to the solution,
and the reaction mixture was stirred at room temperature for 1 h.
Aqueous NaHCO3 (saturated) and CHCl3 were added to the mixture,
and the separated organic layer was washed with aqueous NaHCO3
(saturated) and brine, dried (Na2SO4), and concentrated. The residue
was purified by column chromatography (a neutralized SiO2, 40%
EtOAc in hexane) to give 13a (481 mg, 91% as a white foam): FAB-
MS m/z 884 (MH+); 31P NMR δ 150.39, 149.86. HRMS (FAB) calcd
for C44H56F3N5O9P: 884.3608. Found: 884.3605.
5′-O-(Dimethoxytrityl)-4′-C-[(2-N-trifluoroacetyl)aminoethyl]-3′-
O-(succinyl)thymidine (14a). After successive coevaporation with
pyridine, 12a (136 mg, 200 µmol) was dissolved in pyridine (3 mL).
Succinic anhydride (40 mg, 400 µmol) and DMAP (4.0 mg, 33 µmol)
were added to the solution, and the mixture was stirred at room
temperature for 3 days. The mixture was diluted with EtOAc and
washed with H2O, aqueous KH2PO4 (saturated), and then brine. The
separated organic phase was dried (Na2SO4) and evaporated. The residue
was purified by column chromatography (SiO2, 5% MeOH in CHCl3)
to give 14a (115 mg, 73% as a white powder): FAB-MS m/z 783 (M+);
1H NMR (270 MHz, CDCl3) δ 7.36 (s, 1 H), 7.41-6.80 (m, 13 H),
6.27 (dd, 1 H, J ) 6.4, 7.6), 5.50 (m, 1 H), 3.77 (s, 6 H), 3.37-3.23
(m, 4 H), 2.62 (m, 4 H), 2.43 (br dd, 2 H, J ) 6.4, 7.6), 2.01 (m, 1 H),
1.81 (m, 1 H), 1.47 (s, 3 H). HRMS (FAB) calcd for C39H40F3N3O11:
783.2612. Found: 783.2613.
5′-O-(Dimethoxytrityl)-4′-C-[(2-N-trifluoroacetyl)aminopropyl]-
thymidine 3′-O-(2-Cyanoethyl) N,N-Diisopropylphosphoramidite
(13b). Compound 12b (343 mg, 0.49 mmol) was phosphitylated as
described in the preparation of 13a to give 13b (273 mg, 62% as a
white foam): FAB-MS m/z 898 (MH+); 31P NMR δ 149.76, 149.24.
HRMS (FAB) calcd for C45H56F3N5O9P: 898.3764. Found: 898.3780.
5′-O-(Dimethoxytrityl)-4′-C-[(2-N-trifluoroacetyl)aminopropyl]-
3′-O-(succinyl)thymidine (14b). Compound 12b (139 mg, 0.2 mmol)
was succinylated as described in the preparation of 14a to give 14b
1
(52 mg, 33% as a white powder): FAB-MS m/z 797 (M+); H NMR
(270 MHz, CDCl3) δ 7.39 (s, 1 H), 7.51-6.73 (m, 13 H), 6.23 (m, 1
H), 5.42 (m, 1 H), 3.79 (m, 6 H), 3.38-3.19 (m, 4 H), 2.70-2.48 (m,

2432 J. Am. Chem. Soc., Vol. 122, No. 11, 2000
Kanazaki et al.
5534.8; observed mass, 5532.0. ODN 18-Z: calculated mass, 5534.8;
observed mass, 5528.4. ODN 19-Z: calculated mass, 5665.0; observed
mass, 5662.1. ODN 20-Z: calculated mass, 5795.1; observed mass,
5796.3. ODN 21-Z: calculated mass, 5925.3; observed mass, 5922.4.
ODN 22-Z: calculated mass, 6055.4; observed mass, 6051.6. ODN
23: calculated mass, 5830.2; observed mass, 5826.1.
Shuzo) in the presence of Torula RNA (0.39 OD units at 260 nm,
Sigma, St. Louis, MO) in a buffer containing 100 mM sodium acetate
(pH 6.0) and 5 mM MgCl2 (total 30 µL) at 37 °C. At appropriate
periods, aliquots (4 µL) of the reaction mixture were separated and
added to a solution of EDTA (5mM, 10 µL), then the mixtures were
heated for 5 min at 90 °C. The solutions were analyzed by gel
electrophoresis as described above.
Hydrolysis of Duplexes with RNase H. RNA labeled with 32P at
the 5′-end (50 pmol) was incubated with E. coli RNase H (6 units,
Takara Shuzo) in the presence or in the absence of the complementary
strand (50 pmol) in a buffer containing 10 mM Tris-HCl (pH 7.9), 10
mM MgCl2, 1 mM DTT, 50 mM NaCl, and 0.01% bovine serum
albumin (total 10 µL) at 30 °C. At appropriate periods, the reaction
mixtures were heated for 1 min at 90 °C; then the reactions were
analyzed by gel electrophoresis as described above.
Hydrolysis of Duplexes with HeLa Cell Nuclear Extracts. RNA
labeled with 32P at the 5′-end (50 pmol) was incubated with HeLa
nuclear extracts (10 units, Seikagaku Kogyo) in the presence or in the
absence of the complementary strand (50 pmol) in a buffer containing
10 mM Tris-HCl (pH 7.9), 10 mM MgCl2, 1 mM DTT, 50 mM NaCl,
and 0.01% bovine serum albumin (total 10 µL) at 30 °C. After being
incubated for 30 min, the reaction mixtures were heated for 3 min at
90 °C; then the reactions were analyzed by gel electrophoresis as
described above.
Thermal Denaturation and CD Spectroscopy. Each solution
contains each ODN (3 µM) and the complementary DNA 24 (3 µM),
RNA 25 (3 µM), or target duplex 26 (3 µM) in an appropriate buffer.
The solution containing each ODN was heated at 90 °C for 5 min,
then cooled gradually to an appropriate temperature, and used for the
thermal denaturation studies. Thermal-induced transitions of each
mixture were monitored at 260 nm on a Perkin-Elmer Lambda2S.
Sample temperature was increased 0.5 °C/min. Samples for CD
spectroscopy were prepared by the same procedure used in the thermal
denaturation study, and spectra were measured on a JASCO J720
spectropolarimeter at 15 °C. The ellipticities of duplexes were recorded
from 200 to 320 nm in a cuvette with a path length of 1 mm. CD data
were converted into mdeg‚mol of residues-1‚cm-1
.
Partial Hydrolysis of ODN with Snake Venom Phosphodi-
esterase. Each ODN labeled with 32P at the 5′-end (10 pmol) was
incubated with snake venom phosphodiesterase (20 ng, Boeringer
Mannheim) in the presence of Torula RNA (0.15 OD units at 260 nm,
Sigma, St. Louis, MO) in a buffer containing 37.5 mM Tris-HCl (pH
8.0) and 7.5 mM MgCl2 (total 20 µL) at 37 °C. At appropriate periods,
aliquots (4 µL) of the reaction mixture were separated and added to a
solution of EDTA (5 mM, 10 µL); then the mixture was heated for 5
min at 90 °C. The solutions were analyzed by electrophoresis on 20%
polyacrylamide gel containing 7 M urea. Densities of radioactivity of
the gel were visualized by a Bio-imaging analyzer (Bas 2000, Fuji Co.,
Ltd).
Stability of ODN in the PBS Containing Human Serum. Each
ODN labeled with 32P at the 5′-end (5 pmol) was mixed with the
corresponding unlabeled ODN (1 nmol). The mixture was incubated
in PBS (40 µL) containing 50% human serum at 37 °C. At appropriate
periods, aliquots (4 µL) of the reaction mixture were separated and
added to a solution of 10 M urea (16 µL). The mixtures were then
analyzed by gel electrophoresis as described above.
Acknowledgment. This investigation was supported in part
by a Grant-in-Aid for Scientific Research on Priority Areas
(08281105) from the Ministry of Education, Science, Sports,
and Culture of Japan and a Grant from “Research for the Future”
Program of the Japan Society for the Promotion of Science
(JSPS-RFTF97I00301).
Supporting Information Available: CD spectral data,
polyacrylamide gel electrophoresis data of ODNs 22-E, 23, and
29 with DNase I, ODN 29 with human serum, and ODN 29
with E. coli and HeLa RNase H (PDF). This material is available
free of charge via the Internet at http://pubs.acs.org.
Partial Hydrolysis of ODN with DNase I. Each ODN labeled with
32P at the 5′-end (15 pmol) was incubated with DNase I (15 unit, Takara
JA9934706