Full text of DOI:10.1007/BF03343929

J. Endocrinol. Invest. 24: 796-801, 2001
Loss of heterozygosity of the MEN1 gene in a large series
of TSH-secreting pituitary adenomas
C. Asteria*, M. Anagni**, L. Persani***, and P. Beck-Peccoz*
*Institute of Endocrine Sciences, University of Milan; ***Istituto Auxologico Italiano IRCCS, Milan;
**Department of Internal Medicine, Bellaria Hospital, Bologna, Italy
ABSTRACT. Thyrotropin-secreting pituitary ade-
nomas (TSH-omas) are rare tumors (0.5% of all
pituitary adenomas) showing an invasive behav-
ior and usually sporadic, although a few cases
are associated with multiple endocrine neopla-
sia type 1 (MEN1), an autosomal dominant in-
herited syndrome. This disorder is linked to loss
of heterozygosity (LOH) on 11q13 and inactivat-
ing mutations of MEN1 gene, which is located in
the same chromosomal region. As other types of
anterior pituitary adenomas, TSH-omas are the
result of a monoclonal outgrowth where the in-
trinsic genetic defects involving oncogenes or tu-
mor suppressor genes occur in a progenitor cell.
However, so far no activating mutations of par-
ticular oncogenes or inactivating mutations of tu-
mor suppressor genes have been identified.
Starting from the observation that 3-30% of spo-
radic pituitary adenomas show LOH on 11q13,
and that allelic losses on the long arms of chro-
mosome 11, beside 10 and 13, are significantly as-
sociated with the transition from the non-invasive
to the invasive phenotype, we decided to inves-
tigate LOH on 11q13 and mutations of menin in
a large series of TSH-omas. Thirteen tumors were
evaluated. DNA was extracted from tumors by
standard methods and genomic DNA from pe-
ripheral blood leukocytes was used as control.
LOH was screened by using 3 polymorphic mark-
ers on 11q13: D11S956, PYGM, INT-2. In 3 out of
15 cases we could demonstrate LOH on 11q13,
but none of the tumors showed menin mutation
after sequence analysis. These data strongly sug-
gest that menin does not play a causative role in
the development of TSH-omas, and are in agree-
ment with other studies demonstrating a limit-
ed role of menin in pituitary sporadic tumorige-
nesis.
(J. Endocrinol. Invest. 24: 796-801, 2001)
©2001, Editrice Kurtis
INTRODUCTION
nisms responsible for both tumor initiation and pro-
gression. By the means of molecular biological tech-
niques it was demonstrated that anterior pituitary
adenomas are the result of a monoclonal outgrowth
where the intrinsic genetic defects involving onco-
genes or tumor suppressor genes occur in a progen-
itor cell (2, 3). In TSH-omas, X-chromosomal inacti-
vating analysis in female patients has confirmed their
monoclonal origin (4), but neither activation of cellu-
lar protooncogenes (G-protein ꢀ-subunit, TRH-re-
ceptor, Pit-1, c-myc, c-fos, c-myb) (5-14), nor loss of
function of tumor suppressor genes, such as p53 (15),
has been identified as responsible for the develop-
ment of this subgroup of pituitary tumors.
Although the majority of pituitary tumors are benign,
thyrotropin-secreting pituitary adenomas (TSH-omas)
usually present an invasive behavior over time, as ex-
emplified by the tendency to become macroadeno-
mas and to suprasellar extension, so that symptoms
and signs of expanding tumor mass may accompa-
ny those of thyroid hyperfunction (1). Nowadays, it is
not possible to determine those tumors that are des-
tined to show the invasive phenotype, using current
routine histological criteria. Therefore, several stud-
ies have been performed in recent years in order to
advance the knowledge of the underlying mecha-
Moreover, several lines of evidence have suggested
that allelic loss on different chromosomes represents
another important genetic event usually observed in
pituitary tumors, especially in those presenting an
aggressive behavior. In particular, loss of heterozy-
gosity (LOH) on the long arms of chromosome 11,
beside 10 and 13, seems to be significantly associ-
ated with the transition from the non-invasive to the
Key-words: TSH-secreting pituitary adenomas, menin, LOH, sequence
analysis.
Correspondence: Prof. Paolo Beck-Peccoz, Istituto di Scienze Endocrine,
Università di Milano, Ospedale Maggiore IRCCS, Via F. Sforza 35, 20122
Milano, Italy.
E-mail: paolo.beckpeccoz@galactica.it
Accepted May 29, 2001.
796

C. Asteria, M. Anagni, L. Persani, et al.
invasive phenotype (16, 17). More recently, the at-
tention of the researchers has been focused on the
newly discovered multiple endocrine neoplasia type
1 (MEN1) gene located at 11q13 because allelic de-
letion and inactivating mutations of this gene are im-
plicated in the etiopathogenesis of a variable per-
centage of MEN1-associated (10-18%) as well as
sporadic pituitary tumors (3-30%) (8, 18-20). How-
ever, until now only few cases of TSH-omas have
been tested for LOH on 11q13/MEN1 gene inacti-
vating mutations and have been found to be nega-
tive (8, 19, 21). The aim of our study was to screen a
large series of sporadic TSH-omas for menin inacti-
vation, in order to evaluate whether this tumor sup-
pressor gene may play a role in the initiation and
transition to an aggressive phenotype of this partic-
ular subgroup of tumors.
mas at the nuclear magnetic resonance (NMR) study
of the pituitary region.
All the patients were subjected to adenomectomy by
sphenoidal surgery. Fresh tumor tissue obtained at
surgery was divided in separate parts. A part of the
tissues was fixed in formalin and embedded in paraf-
fin for histological and immunoistochemical analysis,
which allowed the classification of the tumors as TSH-
omas. For light microscopy, tumor sections were
stained with hematossilin-eosine (H&E), periodic acid-
Schiff, and the Gordon-Sweet silver reticulin stain. The
avidin-biotin-peroxidase complex technique was used
to localize ꢁ- and ꢀ-subunits of TSH.
The remaining part of the tumors was snap frozen
and stored at –70 C for molecular analysis.
DNA isolation
For each patient DNA was isolated from frozen tis-
sue of surgically resected tumor using TRIREAGENT
kit (Molecular Research Center, Cincinnati, USA) and
from 5 ml of peripheral blood lymphocytes using
Nucleon DNA extraction kit (Amersham Life Science),
according to the manufacturer’s instructions. Peri-
pheral blood samples were collected in order to ob-
tain matched normal DNA from the patients.
MATERIALS AND METHODS
Patients and tumor characterization
A total of 13 patients affected with TSH-secreting pi-
tuitary tumors were studied. All the patients pre-
sented symptoms and signs of thyroid hyperfunction
and 8 out of 13 showed headache and visual field
defects. The biochemical phenotype was character-
ized by elevated serum thyroid hormone levels in the
presence of measurable TSH, elevated concentra-
tions of circulating free ꢀ-subunit, and an increased
ꢀ-subunit/TSH molar ratio. TRH injection test (200
μg, iv) failed to increase TSH and ꢀ-subunit circulat-
ing levels in all the patients. Eight of 13 patients
(61%) presented macroadenomas with an exstrasel-
lar extension and 5 showed intrasellar microadeno-
PCR amplification
DNA extracted from the peripheral blood lympho-
cytes and from the tumors was amplified by PCR.
Eleven intronic primer pairs were appropriately se-
lected for the amplification of the coding exons (2-
10) and the intron/exon boundaries of the MEN1
gene. These primer pairs, their relative annealing
temperature and PCR product sizes are shown in
Table 1 - Primer pairs used to amplify by PCR the exons (2-10) and the intron/exon boundaries of the multiple endocrine neoplasia
type 1 (MEN1) gene.
Pair no. Exon
Sequence of forward primer
TTGCCTTGCAGGCCGCCGCC
GGCTTCGTGGAGCATTTTCT
TTCACCGCCCAGATCCGAGG
GGAGTGTGGCCCATCACTA
CCATCACCACCCACATAGGA
CGTGGCTCATAACTCTCTCC
ATTTGTGCCAGCAGGGCAGC
CCTTCAGACCCTACAGAGAC
AGAGACTGATCTGTGCCCTC
CACTGGCCGGCAACCTTGCT
CGGAAGCCTCCTGGGACTGT
Sequence of reverse primer
*AT C
62 C
62 C
58 C
60 C
60 C
56 C
60 C
56 C
56 C
66 C
66 C
Product size
203 bp
203 bp
185 bp
359 bp
291 bp
279 bp
279 bp
242 bp
320 bp
260 bp
317 bp
1
2
2
2
TGGTAGGGATGACGCGGTTG
CTCGAGGATAGAGGGACAGG
TAAGATTCCCACCTACTGGG
TGGAGTCCCTTGGGTGGCTTG
TCAAGTCTGGCCTAGCCAG
TAGGGTCTCCCTTCTGCACC
CAGTCCTGGACGAGGGTGGTT
CCATGGCCCTGTGGAAGGGA
TCAGTCCCATCGGCACCGAAG
ACAGTCCCAGGAGGCTTCCG
CCCACAAGCGGTCCGAAGTC
3
2
4
3
5
4
6
5-6
7
7
8
8
9
9
10
11
10
10
*AT°C: annealing temperature of the primer pairs.
797

LOH of the MEN1 gene in TSH-secreting pituitary adenomas
B1
T1
B2
T2
B3
T3
*
D11S956
B1
T1
B2
T2
B3
T3
*
*
PYGM
B1
T1
B2
T2
B3
T3
*
INT-2
*
Fig. 1 - Loss of heterozygosity in 3 TSH-
secreting pituitary adenomas compared
to matched blood sample at polymorphic
markers D11S956, PYGM and INT-2 on
chromosome 11q13. B: blood; T: tumor;
*: deleted allele.
Table 1. PCR conditions were as follows: 50 μl of
reaction containing 150 ng genomic DNA, 1xPCR
buffer, 1.5 mmol/l MgCl2, 0.2 mmol/l dNTPS, 10
pmol primers, and 2.5 U AmpliTaq (Perkin-Elmer).
After incubation at 94 C for 3 min the mixture was
subjected to 35 amplification cycles of 1 min at 94
C, 45 s at 56-66 C (depending on the primer pair
used) and 1 min at 72 C.
automated method (PE Applied Biosystem, ABI
PRISM 310 DNA sequencer, Perkin-Elmer) using
specific primers.
RESULTS
One copy of the MEN1 gene was found to be
deleted in 3 out of13 sporadic TSH-omas evalu-
ated by LOH analysis. As shown in Figure 1, a
complete LOH with all three polymorphic markers
tested was detected in tumor 1 (T1) as compared
to normal blood DNA (B1), while tumors 2 (T2) and
3 (T3) showed a partial allelic loss, demonstrated
by 50% reduction of the signal intensity, with one
polymorphic marker: T2 with PYGM marker and
T3 with INT-2 marker. D11S956 and INT-2 were
not informative in tumors 3 and 2, respectively. All
the other tumors, 10 cases, presented allelic re-
Loss of heterozygosity
DNA from peripheral blood lymphocytes and tumor
samples was screened for LOH using three polymor-
phic markers on 11q13 as described previously (22).
MEN1 gene mutational analysis
After verifying the amplification by agarose gel
electrophoresis, each exon of the MEN1 gene was
subjected to double-stranded direct sequencing by
798

C. Asteria, M. Anagni, L. Persani, et al.
tention with all three polymorphic markers (data
not shown).
As far the sequence analysis of the MEN1 gene is
concerned, none of the 13 TSH-omas showed mu-
tations in the coding regions. In 2 of 13 tumors we
found the previously described polymorphism
(D418D) in exon 9 of the MEN1 gene (23, 24).
tain a mixture of adenomatous and normal cells.
No mutations of the MEN1 gene were identified by
sequence analysis in these 3 tumors with LOH. The
same result was obtained in the remaining 10 tu-
mors analyzed in the study, which were also nega-
tive for allelic deletion on 11q13.
Our results are consistent with previous reports
suggesting that menin inactivation is a rare event
in sporadic pituitary adenomas (19, 20, 25). In-
deed, Zhuang et al. (19) using single strand con-
formational polymorphism analysis found only 2
missense mutations among 4 pituitary adenomas
with LOH for MEN1 in a sample of 39 sporadic tu-
mors. Prezant et al. (20) using dideoxy finger-
printing analysis studied 45 sporadic tumors but
failed to reveal any mutations in the coding se-
quence of MEN1. Tanaka et al. (25), in a series of
31 sporadic tumors detected only 1 nonsense mu-
tation in a GH/PRL-secreting adenoma with LOH
on 11q13.
These data are difficult to understand especially
taking into account the discrepancy between al-
lelic loss on 11q13 and mutations of the MEN1
gene. At least three different hypotheses could be
postulated in order to explain this discrepancy: 1)
tumors may contain mutations in regions of the
MEN1 gene that were not screened, such as pro-
moter, introns and untraslated regions; 2) the hy-
permetilation of CpG islands in the promoter re-
gion, as reported for other tumor suppressor genes
DISCUSSION
We tested 13 sporadic TSH-omas for allelic dele-
tions and mutations at the MEN1 gene (Table 2).
LOH analysis with 3 polymorphic markers (D11S956,
PYGM, INT-2) on 11q13 showed in 3 of 13 tumor
tissues (2.3%) allelic loss of one copy of the MEN1
gene. In particular a complete LOH was observed in
one tumor (T1) and a partial allelic loss in two tu-
mors (T2 and T3). No correlation between LOH on
11q13 and the aggressive behavior of the tumors,
as exemplified by the tendency to become macro-
adenomas, has been observed in our series (Table
2). This finding suggests that other mechanisms are
involved in tumor progression and transition from
non-invasive to invasive phenotype.
As far as the partial allelic loss is concerned, this
result could be explained by the fact that allelic
deletions may be restricted to a subclone of neo-
plastic cells, thus representing a second event in
the tumorigenesis. Alternatively, it is conceivable
that tumor tissues used for DNA extraction con-
Table 2 - Clinical and genetic features of 13 patients with TSH-secreting pituitary adenomas.
Patients
Clinical phenotype
LOH on 11q13
MEN1 gene
mutation/polymorphism
1
HT1+macroadenoma
Yes with PYGM,
INT-2, D11S956
None
2
HT+microadenoma
HT+macroadenoma
HT+macroadenoma
HT+microadenoma
HT+microadenoma
HT+macroadenoma
HT+macroadenoma
HT+microadenoma
HT+macroadenoma
HT+microadenoma
HT+macroadenoma
HT+macroadenoma
Yes with PYGM
D418D
None
None
None
None
D418D
None
None
None
None
None
None
3
Yes with INT-2
4
No
No
No
No
No
No
No
No
No
No
5
6
7
8
9
10
11
12
13
HT: hyperthyroidism; LOH: loss of heterozygosity; MEN1: multiple endocrine neoplasia type 1.
799

LOH of the MEN1 gene in TSH-secreting pituitary adenomas
6. Landis C., Masters S.B., Spada A., Pace A.M.,
Bourne H.R., Vallar L.
(26, 27), may inhibit the transcription of the sec-
ond copy of the MEN1 gene. However, Prezant et
al. addressed this point by studying MEN1 mRNA
expression in pituitary tumors which was found to
be normal, and Asa et al. (28) demonstrated by
competitive reverse transcription-PCR that there
was a lack of menin down-regulation in the major-
ity of tumors with LOH on 11q13; 3) another
unidentified tumor suppressor gene may be locat-
ed at the MEN1 locus; 4) other factors (growth fac-
tors, oncogenes, tumor suppressor genes, hy-
pophysiotropic factors) different from MEN1 may
be altered.
However, over the past years several studies have
been performed, but they failed to identify intrinsic
genetic defects causing the initiation and the pro-
gression of TSH-omas. This issue remains still un-
explained probably because a complicate interac-
tion of factors and multiple steps is required for the
pathogenesis of these tumors. Our results con-
tribute to exclude menin as the unique gene re-
sponsible for such a complex process.
GTPase inhibiting mutations activate the alpha chain
of Gs and stimulate adenylyl cyclase in human pitu-
itary tumors.
Nature 1989, 340: 692-696.
7. Lyons J., Landis C.A., Harsh G., Vallar L., Grünewald
K., Feichtinger H., Duh Q.Y., Clark O.H., Kawasaki
E., Bourne H.R, McCormick F.
Two G protein oncogenes in human endocrine tu-
mors.
Science 1990, 249: 655-659.
8. Boggil M.D., Jenkinson S., Pistorello M., Boscaro
M., Scanarini M., Mc Ternan P., Perrett C.W.,
Thakker R.V., Clayton R.N.
Molecular genetic studies of sporadic pituitary tu-
mors.
J. Clin. Endocrinol. Metab. 1994, 78: 387-392.
9. Dong Q., Bruker-Davis F., Weintraub B.D.,
Smallridge R.C., Carr F.E., Battey J., Spiegel A.M.,
Shenker A.
Screening of candidate oncogenes in human thy-
rotroph tumors: absence of activating mutations of
the Gaq, Ga11, Gas, or thyrotropin-releasing hor-
mone receptor genes.
ACKNOWLEDGMENTS
J. Clin. Endocrinol. Metab. 1996, 81: 1134-1140.
This work was partially supported by the current research from
Ospedale Maggiore IRCCS, Milan, and by MURST (9806243848),
Rome, Italy.
10. Delhase M., Vergani P., Malur A., Velkeniers B.,
Teugels E., Trouillas J., Hooghe-Peters E.L.
Pit1/GHF-1 expression in pituitary adenomas. Fur-
ther analogy between humans adenomas and rat
tumors.
J. Mol. Endocrinol. 1993, 11: 129-139.
11. Pellegrini I., Barlier A., Gunz G., Figarella-Branger
D., Enjalbert A., Grisoli F., Jaquet P.
REFERENCES
Pit-1 gene expression in the human pituitary and pi-
tuitary adenomas.
1. Beck-Peccoz P., Bruker-Davis F., Persani L.,
Smallridge R.C., Weintraub B.D.
Thyrotropin secreting pituitary tumors.
Endocr. Rev. 1996, 17: 610-638.
2. Alexander J.M., Biller M.B.K., Bikkal H., Zervas N.T.,
Arnold A., Klibanski A.
J. Clin. Endocrinol. Metab. 1994, 79: 189-196.
12. Sanno N., Teramoto A., Matsuno A., Inada K., Itoh
J., Osamura R.J.
Clinical and immunoistochemical studies on TSH-
secreting pituitary adenoma: its multihormonality
and expression of Pit-1.
Clinically nonfunctioning pituitary tumors are mon-
oclonal in origin.
J. Clin. Invest. 1990, 86: 336-340.
Mod. Pathol. 1994, 7: 893-899.
13. Sanno N., Teramoto A., Matsuno A., Takekoshi S.,
Osamura R.J.
3. Herman V., Fagin J., Gonsky R., Kovacs K.,
Melmed S.
Clonal origin of pituitary adenomas.
J. Clin. Endocrinol. Metab. 1990, 71: 1427-1433.
4. Mantovani S., Beck-Peccoz P., Saccomanno K.,
Spada A., Faglia G., Barbetti F.
GH and PRL gene expression by nonradioisotopic
in situ hybridization in TSH-secreting pituitary ade-
nomas.
J. Clin. Endocrinol. Metab. 1995, 80: 2518-2522.
14. Woloschak M., Roberts J.L., Post K.
c-myc, c-fos, and c-myb gene expression in human
pituitary adenomas.
TSH-secreting pituitary adenomas are monoclonal
in origin. In Book of Abstracts of the 77th Annual
Meeting of the Endocrine Society, June 14-17,
1995, Washington, DC, Abstract P2-485, p. 412.
J. Clin. Endocrinol. Metab. 1992, 79: 253-257.
15. Sumi T., Stefaneanu L., Kovacs K., Asa S.L., Rindi G.
Immunohistochemical study of p53 protein in hu-
man and animal pituitary tumors.
5. Vallar L., Spada V., Giannattasio G.
Altered Gs and adenylate cyclase activity in human
GH-secreting pituitary adenomas.
Endocr. Pathol. 1993, 4: 95-99.
Nature 1987, 330: 566-568.
800

C. Asteria, M. Anagni, L. Persani, et al.
16. Bates A.S., Talbot A.J., Buckley N., Bickness J.,
Farrell W.E., Clayton R.N.
Molecular tools for presymptomatic testing in mul-
tiple endocrine neoplasia type 1.
Tumor suppressor genes as a marker of invasive be-
havior in pituitary tumors.
J. Endocrinol. 1995, (Suppl. 1) 144.
J. Intern. Med. 1995, 238: 239-244.
23. Chandrasekharappa S.C., Guru S.C., Manickam P.,
Olufemi S-E., Collins F.S., Emmert-Buck M.R., Debelenko
L.V., Zhuang Z., Lubensky I.A., Liotta L.A., Crabtree J.S.,
Wang Y., Roe B.A., Weisemann J., Boguski M.S.,
Agarwal S.K., Kester M.B., Kim J.S. Heppner C., Dong
Q., Spiegel A.M., Burns A.L., Marx S.J.
17. Bates A.S., Farrell W.E., Bicknell E.J., McNicol A.M.,
Talbot A.J., Broome J., Perret C.W., Thakker R.V.,
Clayton R.N.
Allelic deletion in pituitary adenomas reflects ag-
gressive biological activity and has potential value as
a prognostic marker.
Positional cloning of the gene for multiple endocrine
neoplasia-type 1.
Science 1997, 276: 404-407.
J. Clin. Endocrinol. Metab. 1997, 82: 818-824.
18. Dong Q., Debelenko L.V., Chandrasekharappa S.C.,
Emmert-Buck M., Zhuang Z., Guru S.C., Manickam
P., Skarulis M., Lubensky I.A., Liotta L.A., Collins F.S.,
Marx S.J., Spiegel A.M.
24. Agarwal S., Kester M.B., Debelenko L.V., Heppner
C., Emmert-Buck M., Skarulis M.C., Doppman J.L.,
Kim Y.S., Lubensky I.A., Zhuang Z., Green J.S., Guru
S.C., Manickam P., Olufemi S.-E., Liotta L.A.,
Chandrasekharappa S.C., Collins F.S., Spiegel A.M.,
Burns A.L., Marx S.J.
Loss of heterozygosity at 11q13 analysis of pituitary
tumors, lung carcinoids, lipomas, and other un-
common tumors of subjects with familial multiple
endocrine neoplasia type 1.
Germline mutations of the MEN1 gene in familial
MEN1 and related states.
Hum. Mol. Genet. 1997, 6: 1169-1175.
J. Clin. Endocrinol. Metab. 1997, 82: 1416-1420.
19. Zhuang Z., Ezzat S.Z., Vortmeyer A.O., Weil R.,
Oldfield E.H., Park W-S.S., Huang S., Agarwal S.K.,
Guru S.C., Manickam P., Debelenko L.V., Kester
M.B., Olufemi S.-E., Heppner C., Crabtree J.S.,
Burns A.L., Spiegel A.M., Marx S.J., Chandrase-
kharappa S.C., Collins F.S., Emmert-Buck M.R.,
Liotta L.A., Asa S.L., Lubensky I.A.
25. Tanaka C., Kimura T., Yang P., Moritani M., Yamaoka
T., Yamada S., Sano T., Yoshimoto K., Itakura M.
Analysis of loss of heterozygosity on chromosome
11 and infrequent inactivation of the MEN1 gene in
sporadic pituitary adenomas.
J. Clin. Endocrinol. Metab. 1998, 83: 2631-2634.
26. Herman J.G., Latif F., Weng Y., Lerman M.I., Zbar
B., Liu S., Samid D.S., Gnarra J.R., Linehan W.M.
Silencing of the VHL tumor-suppressor gene by
DNA metylation in renal carcinoma.
Mutations of the MEN1 tumor suppressor gene in
pituitary tumors.
Cancer Res. 1997, 57: 5446-5451.
20. Prezant T.R., Levine J., Melmed S.
Proc. Natl. Acad. Sci. USA 1994, 91: 9700-9704.
Molecular characterization of the MEN1 tumor sup-
pressor gene in sporadic pituitary tumors.
J. Clin. Endocrinol. Metab. 1998, 83: 1338-1391.
27. Merlo A., Herman J.G., Mao L., Lee D.J., Gabrielson
E., Burger P.C., Baylin S.B., Sidransky D.
5’ CpG island methylation is associated with tran-
scriptional silencing of the tumor suppressor p16/
CDKN2/MTS1 in human cancers.
21. Poncin J., Stevenaert A., Beckers A.
Somatic MEN1 gene mutation does not contri-
bute significantly to sporadic pituitary tumorige-
nesis.
Eur. J. Endocrinol. 1999, 140: 573-576.
22. Larsson C., Calender A., Grimmond S., Giraud S.,
Hayward N.K., Teh F., Farnebo F.
Nat. Med. 1995, 1: 686-692.
28. Asa S.L., Somers K., Ezzat S.
The MEN1 gene is rarely downregulated in pituitary
adenomas.
J. Clin. Endocrinol. Metab. 1998, 83: 3210-3212.
801