Artificial ribonucleases. 5. Synthesis and ribonuclease activity of tripeptides composed of amino acids involved in catalytic centers of natural ribonucleases

Article abstract of DOI:10.1023/B:RUCB.0000030824.26304.cb

The characteristic features of the spatial arrangement of the main functional groups involved in catalytic centers of ribonucleases and nucleases were revealed by computer analysis of the catalytic centers of these enzymes. Based on the results of compute

Full text of DOI:10.1023/B:RUCB.0000030824.26304.cb

Russian Chemical Bulletin, International Edition, Vol. 53, No. 2, pp. 455—462, February, 2004
455
Artificial ribonucleases
5.* Synthesis and ribonuclease activity of tripeptides composed of
amino acids involved in catalytic centers of natural ribonucleases
I. L. Kuznetsova, N. S. Zhdan, M. A. Zenkova,ꢀ V. V. Vlassov, and V. N. Sil´nikov
Institute of Chemical Biology and Fundamental Medicine, Siberian Branch of the Russian Academy of Sciences,
8 prosp. Akad. Lavrent´eva, 630090 Novosibirsk, Russian Federation.
Fax: +7 (383 2) 33 3677. Eꢀmail: marzen@niboch.nsc.ru
The characteristic features of the spatial arrangement of the main functional groups inꢀ
volved in catalytic centers of ribonucleases and nucleases were revealed by computer analysis of
the catalytic centers of these enzymes. Based on the results of computer simulation, tripeptides
containing Lys, Arg, His or Hia, Thr, and Asn in different combinations were synthesized. In
these tripeptides, the distances between the corresponding functional groups are equal to those
observed in natural enzymes. The efficacy of RNA cleavage with Argꢀ and Hisꢀcontaining
tripeptides depends on their structure and correlates with the overall positive charge of these
compounds. Of all the tripeptides under consideration, compounds bearing the overall charge
of +4 exhibit the highest ribonuclease activity.
Key words: artificial ribonucleases, RNase active site, tripeptides.
Lowꢀmolecularꢀweight "chemical" ribonucleases hold
promise as tools for studying the structures of RNAs and
RNAꢀprotein complexes, as reactive groups in conjuꢀ
gates intended for cleavage of particular RNAs, and as
therapeuticals inactivating virus genome RNAs or certain
mRNAs. One of approaches, which allow one to conꢀ
struct compounds capable of cleaving RNA, is based on
the design of mimetics of natural enzymes by organic
chemistry methods.
Earlier,1 it has been demonstrated that diꢀ and triꢀ
peptides containing the lysine and histidine or histamine
residues possess RNase activity. Among these compounds,
LysꢀHis methyl ester (2L2) bearing a charge of +2 exhibꢀ
its the highest activity. Cleavage of the phosphodiester
bond in dinucleoside monophosphate CpA with the latter
compound demonstrated2 that adenine and cytidine
2´,3´ꢀcyclophosphates are produced in this reaction, as in
hydrolysis of RNA with RNase A. Conjugates of short
peptides which mimic elements of the active site of RNase
A with acridine (Acr) as an intercalator, which provides
binding of the constructions to RNA, were synthesized.3
The lysine residue was used as a linker. Experiments on
the replacement of the Nꢀterminal histidine residue
with another amino acid demonstrated that the presence
of histidine is necessary for such conjugates to maniꢀ
fest ribonuclease activity. Tetrapeptides HisꢀGlyꢀHisꢀ
Lys(Acr)NH2 and HisꢀProꢀHisꢀLys(Acr)NH2 exhibit the
highest ribonuclease activity. Synthetic peptides consistꢀ
ing of alternating hydrophobic (alanine, leucine) and baꢀ
sic (lysine, arginine) amino acid residues belong to yet
another group of peptides showing ribonuclease activity.4
It was hypothesized4 that a regular (αꢀhelical or βꢀfolded)
structure is prerequisite for such peptides to perform effiꢀ
cient RNA hydrolysis, because the alignment of the RNA
polynucleotide chain between two parallel series of posiꢀ
tively charged amino acid residues is of major importance
in catalysis of RNA cleavage.
In the present study, we carried out comparative analyꢀ
sis of the structures of the catalytic centers of a series of
ribonucleases and nucleases, synthesized tripeptides that
mimic fragments of the catalytic centers of these enzymes,
and examined the activity of these tripeptides in the cleavꢀ
age of a synthetic 21ꢀmer oligoribonucleotide under physiꢀ
ological conditions.
Experimentally
In the present work, dicyclohexylcarbodiimide (DCC),
Lꢀhistidine dihydrochloride (Chemapol, Poland), histamine
dihydrochloride (Sigma, USA), NωꢀnitroꢀLꢀarginine methyl
ester dihydrochloride, Nꢀhydroxysuccinimide (NHSꢀOH)
(Fluka,
Switzerland),
NαꢀBocꢀNεꢀ(Z(2Cl))ꢀLꢀlysine,
NαꢀBocꢀNωꢀnitroꢀLꢀarginine, NαꢀBocꢀOꢀBzlꢀLꢀthreonine,
NαꢀBocꢀLꢀasparagine (FisherBiotech, USA), Boc2O (Aldrich,
USA), RNase T1 (Boehringer Mannheim, Germany), T4 polyꢀ
nucleotide kinase (Fermentas, Lithuania), and [γꢀ32P]ꢀATP
(Biosan, Russia) were used. The 21ꢀmer oligonucleotide ON21
* For Part 4, see Ref. 1.
Published in Russian in Izvestiya Akademii Nauk. Seriya Khimicheskaya, No. 2, pp. 435—442, February, 2004.
1066ꢀ5285/04/5302ꢀ0455 © 2004 Plenum Publishing Corporation

456
Russ.Chem.Bull., Int.Ed., Vol. 53, No. 2, February, 2004
Kuznetsova et al.
(5´ꢀUCGAAUUUCCACAGAAUUCGUꢀ3´) was synthesized
by M. N. Repkova (Institute of Chemical Biology and Fundaꢀ
mental Medicine, Siberian Branch of the Russian Academy of
Sciences). Triethylamine, trifluoroacetic acid, and dry methaꢀ
nol, ethanol, diethyl ether, ethyl acetate, and DMF were puriꢀ
fied according to standard procedures.5 Thinꢀlayer chromatoꢀ
graphy was performed on DCꢀAlufolien Kieselgel 60 F254 plates
(Merck, Germany) using the following solvent systems:
A, tertꢀbutyl alcohol—ethyl methyl ketone—formic acid—waꢀ
ter, 40 : 30 : 15 : 15; B, dichloromethane—methanol, 1 : 1. The
1H NMR spectra were recorded on a Bruker WPꢀ200ꢀSY specꢀ
trometer (Germany). The chemical shifts were measured in the
δ scale. All biochemical assays were carried out with the use of
MilliꢀQ water (Millipore, USA).
Synthesis of tripeptides. Synthesis of Nꢀhydroxysuccinimide
esters of protected amino acids6 (general procedure). NꢀHydroxyꢀ
succinimide (1.1 mmol, 127 mg) was added to a solution of
Nꢀ or N,Oꢀprotected amino acid (1 mmol) in dry ethyl acetate
(3 mL). The solution was cooled to 0 °C and then DCC
(1.1 mmol, 226 mg) was added with stirring. The temperature of
the reaction mixture was gradually raised to ≈20 °C in 2 h and
the reaction mixture was stirred at ≈20 °C for 0.5 h. The precipiꢀ
tate of dicyclohexylurea was filtered off and the filtrate was
concentrated. The oily residue was dissolved in dry ethyl acetate
(2—3 mL), the precipitate of dicyclohexylurea was again filtered
off, and the solution was concentrated in vacuo to afford the
activated ester, which was used in reactions without additional
purification.
Synthesis of peptides (general procedure). A solution of
Nꢀhydroxysuccinimide ester (1 mmol) in dry ethyl acetate (2 mL)
was added with stirring to a suspension of an appropriately proꢀ
tected amino acid hydrochloride/dihydrochloride, histamine,
or dipeptide (1 mmol) and triethylamine (1.1 mmol, 153 µL) in
dry DMF (2 mL). The reaction mixture was stirred for 12 h. The
precipitate that formed was filtered off and washed with dry
ethyl acetate (2×10 mL). The combined filtrates were concenꢀ
trated in vacuo and a 10% Na2CO3 solution (5 mL) was added to
the oily residue. The reaction mixture was kept at 10 °C for 2 h
and extracted with ethyl acetate (5×5 mL). The organic extracts
were combined and dried with Na2SO4. The solvent was reꢀ
moved in vacuo.
Removal of the Boc group. A. A Bocꢀprotected amino acid or
peptide (1 mmol) was dissolved in CF3COOH (1 mL per Boc
group). The reaction mixture was kept at 40—50 °C for 2 h and
then concentrated with ethanol (3×10 mL). The residue was
dried in vacuo.
B. A Bocꢀprotected peptide or amino acid (1 mmol) was
dissolved in dry MeOH (1 mL) and 4 M methanolic HCl
(1 mL per Boc group) was added. The reaction mixture was
kept at 20 °C for 2 h and concentrated several times with ethaꢀ
nol. The residue was dried in vacuo to afford dipeptides, which
were used in subsequent reactions without additional purifiꢀ
cation.
Removal of N,Oꢀprotective groups in tripeptides. After reꢀ
moval of the Boc protection, tripeptides (0.3—0.5 mmol) were
dissolved in methanol (10 mL) and subjected to hydrogenolysis
in the presence of 5% Pd/C (100 mg). The course of deprotection
was monitored by TLC. After completion of the reaction, the
catalyst was filtered off and the solvent was removed in vacuo.
The final purification of the tripeptides was carried out by reꢀ
versedꢀphase chromatography (1.5×25ꢀcm Preparative C18
column (Waters, USA), 55—105 µm, the methanol concentraꢀ
tion gradient (0→100%) in 0.05% CF3COOH, the flow rate was
2—3 mL min–1).
The structures of the target tripeptides were confirmed by
1H NMR spectroscopy and elemental analysis of salts with
trifluroacetic acid.
Cleavage of RNA in the presence of tripeptides. The [32P] label
was introduced at the 5´ꢀterminus of the 21ꢀmer oligonucleotide
(ON21) using [γꢀ32P]ꢀATP and T4 polynucleotide kinase acꢀ
cording to known procedures.7 Cleavage of the RNA substrate
with tripeptides was carried out at 37 °C for 24 h. The standard
reaction mixture (10 µL) contained a 50 mM imidazole or 50 mM
TrisꢀHCl buffer, pH 7.0, 0.2 M KCl, 0.1 mM EDTA, an RNA
carrier (0.1 mg mL–1) (Escherichia coli total tRNA), and
tripeptides (10–3 mol L–1). The reaction was terminated by addꢀ
ing a 2% LiClO4 solution in acetone (100 µL). The precipitate
of ON21 and its fragments was separated by centrifugation
(14000 rpm, 4 °C, 15 min), washed with acetone (300 µL), and
dissolved in a loading buffer (5 µL) (4 M urea, 0.025% Broꢀ
mophenol Blue, and 0.025% xylene cyanole). The cleavage prodꢀ
ucts were analyzed by electrophoresis in a 15% polyacrylamide
gel containing 8 M urea and a TBEx1 buffer (0.9 M Trisꢀborate,
pH 8.0, 2 mM EDTA). After electrophoresis, the gel was dried in
vacuo and autoradiographed on a RENEKS film. The autoradꢀ
iograph was digitized with the use of the GelꢀPro Analyzer proꢀ
gram (Media Cybernetics, 1993ꢀ97). The cleavage sites of the
oligonucleotide were identified by comparing with the results of
partial hydrolysis with RNase T1 in denaturing conditions7 and
in a 2 M imidazole buffer, pH 7.0, at 90 °C.8 The degree of
cleavage (%) was determined as the ratio of the radioactivity of
the cleavage products to the total radioactivity of the sample
applied onto the lane.
Results and Discussion
The catalytic centers of RNases and nucleases involve
histidine, lysine, arginine, aspartic and glutamic acids and
their amides, as well as hydroxy amino acid residues.9—12
An approach developed in the study13 allowed one to
reveal the role of amino acid residues in the catalytic
centers of enzymes based on comparative structureꢀfuncꢀ
tion analysis of these centers. We used this approach to
perform structureꢀfunction analysis of the active centers
of RNases A and T1, nucleases S and Sm, and binase. We
chose a minimum set of amino acid residues involved in
the catalytic centers responsible for the activation of a
nucleophilic species (B:), protonation of the oxygen atom
of the leaving group (AH), an increase in the electrophiꢀ
licity of the phosphorus atom, and stabilization of the
transition state (S1, S2) whose role in the catalytic proꢀ
cess has been thoroughly investigated.9—12 The scheme of
measurements of the distances between amino acid resiꢀ
dues is presented in Fig. 1, a. The minimum structure of
the active site of RNase A is shown in Fig. 1, b. It is
commonly accepted14 that RNase A functions by the acidꢀ
base catalysis mechanism, according to which the acid
protonates the leaving group and the base deprotonates
the newly formed nucleophile. In the step of transꢀ

RNA cleavage with tripeptides
Russ.Chem.Bull., Int.Ed., Vol. 53, No. 2, February, 2004
457
Fig. 1. Minimum catalytic centers of ribonucleases and nucleases: a, the scheme of measurements of the distances between the
functional groups in the catalytic centers of enzymes (AH is acid, :B is base; S1 and S2 are groups reducing the electron density on
phosphate); b, RNase A; c, RNases T1; d, nuclease S; e, nuclease Sm; f, binase. The enzyme—RNA substrate interaction sites are
indicated by dashed lines.
esterification, the Hisꢀ12 (:B) residue exists in the deꢀ
protonated form and accepts the proton from the 2´ꢀOH
group of ribose, while the Hisꢀ119 (AH) residue protoꢀ
nates the O(5´) atom of the leaving group. In the step of
hydrolysis of cyclophosphate, Hisꢀ119 deprotonates the
water molecule, and Hisꢀ12 protonates the O(2´) atom of
the leaving group. According to the results of Xꢀray difꢀ
fraction analysis, Lysꢀ41 interacts with the 2´ꢀOH group
of ribose, thus facilitating deprotonation of the latter with
Hisꢀ12. In addition, Glnꢀ11 (S1) and Lysꢀ41 (S2) also
interact with the oxygen atoms of phosphate, thus stabiꢀ
lizing the transition state.14
Original data on the organization of the cataꢀ
lytic centers of the enzymes were obtained from the
SWISSꢀPROT database (http://www.expasy.ch). The
minimum structures of the catalytic centers of RNase T1
[EC 3.1.27.3],15,16 staphylococcal nuclease
S
[EC 3.1.31.1],17,18 extracellular endonuclease Sm
[EC 3.1.4.9],19 and binase (Gꢀspecific ribonuclease)
[EC 3.1.27.3]20,21 are shown in Fig. 1, c—f. The distances

458
Russ.Chem.Bull., Int.Ed., Vol. 53, No. 2, February, 2004
Kuznetsova et al.
Table 1. Average structural parameters of the catalytic centers of natural ribonucleases and nucleases*
Functional
domains
RNase A
RNase T1
Binase
Nuclease S
Nuclease Sm
Average
values
AH—:B
:B—S1
6.7
4.0
6.5
6.7
7.2
5.9
8.8
7.7
6.3
4.0
7.1 0.80
5.6
:B—S2
AH—S1
AH—S2
S1—S2
5.3
6.4
8.91
4.46
5.9
3.9
6.00
3.35
5.5
5.9
5.46
7.48
4.4
5.5
7.34
3.75
6.5
4.4
9.91
9.31
5.5 2.3
5.2 1.6
7.5
5.7
PDB refcode
1RBCL, 1RBEL, 2GSP, 1RGA,
1SSAL, 1SRNL 3BU4, 6RNT
1GOU, 1GOV,
1GOY, 1BUJ
1EYO, 1STH,
1STG
1G8T, 1QAE,
1QLO, 1SMN
* The average distances (Å), which were determined from analysis of several (three—four) structures, are given. The structural
parameters characterized by a high degree of correlation are printed in bold type.
Lys
between the corresponding functional groups were deterꢀ
mined using the SwissPdbViewer program (version 3.51)
based on the data available in the Protein Data Bank
(PDB, http://www.rcsb.org). The average distances beꢀ
tween the reactive groups of the aminoꢀacid residues inꢀ
volved in the catalytic centers of the enzymes are given in
Table 1.
a
5.9 Å
4.8 Å
7.4 Å
7.3 Å
Arg
The enzymes under consideration cleave various subꢀ
strates (ribonucleases cleave RNA, nucleases S and Sm
cleave RNA and DNA). Hydrolysis affords various prodꢀ
ucts, viz., 5´ꢀphosphorylated nucleotides in the case of
nuclease Sm and 3´ꢀphosphorylated nucleotides in the
other cases. However, three conserved distances, viz.,
AH—:B, AH—S1, and :B—S2 (7.1, 5.5, and 5.2 Å, reꢀ
spectively), are present in the catalytic centers of all the
enzymes under study (see Table 1). The presence of conꢀ
served domains in the active sites of the enzymes suggests
that the required structural parameters can be achieved by
synthesizing short peptides consisting of amino acids,
which contain carboxy, imidazole, guanidinium, amino,
or hydroxy groups in the side chains. The threeꢀdimenꢀ
sional structures of a series of short peptides consisting of
3—4 aminoꢀacid residues were analyzed using the Hyper
Chem 6.0 program.22 We found that the distances beꢀ
tween the functional groups in the side chains of amino
acids are similar to those in natural enzymes and can be
attained already in tripeptides with particular structures.
Figure 2 exemplifies the structures of the tripeptides
HisꢀLysꢀArg(OMe) and LysꢀThrꢀHia in which the disꢀ
tances between the corresponding functional groups are
similar to conserved structural elements of the catalytic
centers of natural ribonucleases. Based on the results of
computer simulation, we chose the following six triꢀ
peptides: LysꢀHisꢀArg(OMe) (KHR), HisꢀLysꢀArg(OMe)
(HKR), ArgꢀLysꢀHia (RKHa), AsnꢀLysꢀHia (NKHa),
LysꢀAsnꢀHia (KNHa), and LysꢀThrꢀHia (KTHa).
Synthesis of tripeptides. Tripeptides were synthesized
in solution from commercially available αꢀBocꢀprotected
amino acids according to a protocol based on the use of
8.4 Å
His
6.9 Å
6.9 Å
Thr
b
5.0 Å
6.6Å
6.1 Å
4.2 Å
3.2 Å
9.6 Å
Hia
Lys
Fig. 2. Threeꢀdimensional structures of the synthetic tripeptides
HKR (a) and KTHa (b) calculated using the Hyper Chem Pro 6.0
program (Hypercube, Inc., 2000). Semiempirical optimization
of the molecules was carried out using the PM3 Hamiltonian
followed by molecular mechanical simulation with the
MM+ force field.
activated esters. The standard procedure for the preparaꢀ
tion of Nꢀhydroxysuccinimide esters23 of αꢀBocꢀprotected
amino acids was modified as follows: a solution of a proꢀ
tected amino acid and Nꢀhydroxysuccinimide was cooled
to 0—5 °C and then a cooled solution of dicyclohexylꢀ
carbodiimide was added. This procedure allowed us to
increase the yield of the target product, viz., Nꢀhydroxyꢀ
succinimide ester of αꢀBocꢀprotected Lꢀamino acid, to
90—95%. Activated esters prepared according to this proꢀ
cedure were used in condensation without additional puꢀ
rification. The functional groups in the side chains of
amino acids of the tripeptides were deprotected by cataꢀ
lytic hydrogenolysis. Histamine was used in the synthesis
of peptides without protection of the imidazole ring. The

RNA cleavage with tripeptides
Russ.Chem.Bull., Int.Ed., Vol. 53, No. 2, February, 2004
459
schemes of the synthesis of tripeptides and their main
characteristics are given in Scheme 1 and Table 2. The
purities of intermediates were monitored by TLC and
1H NMR spectroscopy. The structures of the tripeptides
synthesized were confirmed by elemental analysis and
1H NMR spectroscopy (see Table 2).
Study of hydrolytic activity. The ability of the peptides
to cleave RNA was assayed using the 5´ꢀ[32P]ꢀlabeled
synthetic oligoribonucleotide (21ꢀmer) (hereinafter,
ON21). The secondary structure of this oligonucleotide is
a hairpin (Fig. 3, a), whose stem is identical to the aminoꢀ
acceptor stem of the yeast tRNAPhe, and the sequence of
the UCCACAG loop is identical to the fragment 59—65
of the same tRNA, which is particularly sensitive to cleavꢀ
age with natural and chemical ribonucleases.24 Treatment
of RNA with tripeptides was carried out in physiological
conditions and the cleavage products were analyzed by
electrophoresis in polyacrylamide gel.
A typical autoradiograph of the gel after separation of
the products of ON21 cleavage with tripeptides is shown
in Fig. 3, b. It can be seen that certain peptides cleave
RNA. The tripeptides KHR, HKR, RKHa, and KTHa at
a concentration of 10–3 M in a 50 mM imidazole buffer
efficiently cleave ON21 at the bonds in two CpA fragꢀ
ments located in the loop, viz., C10ꢀA11 and C12ꢀA13,
whereas the peptides NKHa and KNHa are virtually inꢀ
Scheme 1

460
Russ.Chem.Bull., Int.Ed., Vol. 53, No. 2, February, 2004
Kuznetsova et al.
Table 2. Physicochemical characteristics of the tripeptides synthesized
Triꢀ
peptide
Yield
(%)
Rf
1H NMR (D2O)
Found
Calculated
Molecular
formula*
(%)
δ (J/Hz)
C
H
I
39
0.35
(B)
1.25 (m, 2 H, CHCH2CH2Lys); 1.50 (m, 2 H, CHCH2CH2Arg); 38.70
5.78 C23H37F6N9O8•2H2O
5.76
1.95 (m, 6 H, CHCH2Arg, NH2CH2CH2Lys, CHCH2Lys);
2.65 (m, 2 H, NHCH2Arg); 3.20 (m, 4 H, CH2ꢀim,
NH2CH2Lys); 3.75 (m, 3 H, ОMe); 4.53 (m, 1 H, CHArg);
4.58 (m, 1 H, CHLys); 4.92 (m, 1 H, CHHis); 7.30 (s, 1 H,
H(5)); 8.25 (s, 1 H, H(2))
38.50
Lys
II
51
0.36
(A)
1.50 (m, 10 H, CHCH2CH2Lys, NH2CH2CH2
,
37.71
37.74
5.39 C25H38F9N9O10
4.81
CHCH2CH2Arg, CHCH2Arg, CHCH2Lys); 3.15 (m, 4 H,
CH2ꢀim, CH2Hia); 3.37 (t, 2 H, NHCH2Arg, J = 6.5);
3.39 (t, 2 H, NHCH2Lys, J = 5.5); 3.90 (s, 3 H, ОMe);
4.50 (m, 2 H, CHLys, CHArg); 4.90 (m, 1 H, CHHis);
7.48 (s, 1 H, H(5)); 8.64 (s, 1 H, H(2))
III
IV
V
40
41
25
35
0.35
(A)
1.50 (m, 2 H, CHCH2CH2Lys); 1.79 (m, 6 H, NH2CH2CH2Lys, 38.01 5.88 C21H35F6N9O6•2H2O
CHCH2CH2Arg, CHCH2Arg); 2.01 (m, 2 H, CHCH2Lys); 3.07 38.24 5.96
(m, 4 H, CH2ꢀim, NHCH2Arg); 3.34 (m, 2 H, NHCH2Arg);
3.63 (m, 2 H, CH2Hia); 4.12 (m, 1 H, CHLys); 4.43 (m, 1 H,
CHArg); 7.33 (s, 1 H, H(5)); 8.64 (s, 1 H, H(2))
1.50 (m, 2 H, CHCH2CH2Lys); 1.85 (m, 4 H, NH2CH2CH2Lys, 35.91 4.59 C21H30F9N7O9
0.33
(A)
CHCH2Lys); 3.10 (m, 6 H, CH2Asn, CH2ꢀim, NH2CH2Lys);
3.63 (t, 2 H, CH2Hia, J = 6.5); 4.35 (t, 1 H, CHAsn, J = 6);
4.45 (t, 1 H, CHLys, J = 6); 7.40 (s, 1 H, H(5)); 8.74
(s, 1 H, H(2))
36.27 4.35
Lys
0.23
(A)
1.44 (m, 2 H, CHCH2CH2Lys); 1.70 (t, 2 H, NH2CH2CH2
,
36.18 6.50 C15H27N7O3•2H2O
36.12 6.87
J = 6.5); 1.89 (m, 2 H, CHCH2Lys); 2.73 (m, 2 H,
NH2CH2Lys); 2.95 (m, 4 H, CH2Asn, CH2ꢀim); 3.52 (m, 2 H,
CH2Hia); 4.11 (m, 2 H, CHAsn, CHLys); 7.25 (s, 1 H, H(5));
8.58 (s, 1 H, H(2))
VI
0.35
(A)
1.22 (d, 3 H, Me, J = 3); 1.58 (m, 2 H, CHCH2CH2);
1.82 (m, 2 H, NH2CH2CH2); 2.05 (m, 2 H, CHCH2); 3.10
(m, 4 H, NH2CH2, CH2ꢀim); 3.65 (m, 3 H, CH2CH2ꢀim,
CHLys); 4.18 (m, 2 H, CHMe, CHThr); 7.39 (s, 1 H, H(5));
8.71 (s, 1 H, H(2))
39.76 5.96 C19H30F6N6O7
40.14 5.32
* Salts with trifluoroacetic acid.
active (the degree of cleavage was 1—2%). The efficacy of
ON21 cleavage with tripeptides depends on both the strucꢀ
tures of the compounds and the nature of the buffer in
which the reaction is performed. In an imidazole buffer,
the RNA cleavage proceeds more efficiently than that in a
TrisꢀHCl buffer (Table 3). Since all the tripeptides synꢀ
thesized contain histidine or histamine, it can be assumed
that, in combination with imidazole (a component of the
buffer), imidazole pairs can occur with a certain probabilꢀ
ity in the vicinity of the bonds that are cleaved, as in the
catalytic center of RNase A. An increase in the efficacy of
RNA cleavage in an imidazole buffer compared to a
TrisꢀHCl, HEPES, or potassium phosphate buffer has
been observed earlier for DABCOꢀimidazole conjugates.25
As can be seen from Table 3, tripeptides containing arginꢀ
ine residues (the histidine or histamine residue is present
in all tripeptides) show the highest efficacy in RNA cleavꢀ
age regardless of the buffer; HKR > KHR = RKHa >>
>> KTHa (the degree of cleavage was 55, 31, and 10%,
respectively). The fact that the arginineꢀcontaining triꢀ
peptides exhibit substantially higher ribonuclease activity
compared to other tripeptides and the dipeptide KH (2L2)
described earlier1 can be attributed to an increase in the
affinity of such tripeptides for RNA. As can be seen from
Table 3, the ribonuclease activity of tripeptides correlates
not only with their overall charge. For example, in the
presence of the tripeptides NKHa and KNHa possessing
the overall charge of +3, ON21 is only weakly cleaved
(1—2%) in an imidazole buffer and is not cleaved at all in
a TrisꢀHCl buffer, whereas the tripeptides KHR, HKR,
and RKHa with an overall charge of +4 exhibit the highest
activity. Earlier,26 we have observed a more than 30ꢀfold

RNA cleavage with tripeptides
Russ.Chem.Bull., Int.Ed., Vol. 53, No. 2, February, 2004
461
the position, contributes a charge of either +1 (in the
middle) or +2 to the overall positive charge of the molꢀ
ecule. Formally, arginine possesses a positive charge of +1,
but it can form a network of hydrogen bonds ("arginine
fork") with the adjacent acceptor groups in RNA.27 These
acceptors can involve the oxygen atoms of phosphates,
the 2´ꢀOH group of ribose, and certain groups in bases
(for example, the O(6) and N(7) atoms of guanine, the
O(4) atom of uridine in the major groove, the N(3) atom
of guanine or the O(2) atom of uridine in the minor
groove). Of three arginineꢀcontaining tripeptides (KHR,
HKR, and RKHa), the tripeptide HKR displays the highꢀ
est activity. In this tripeptide, the histidine residue is most
remote from the guanidinium group of arginine. The fact
that the peptide RKHa exhibits lower (compared to HKR)
ribonuclease activity (55 and 31%, respectively) is apparꢀ
ently associated with the replacement of the histidine resiꢀ
due by histamine. A decrease in ribonuclease activity of
the conjugates by a factor 1.5 caused by the replacement of
His by Hia has been observed earlier for DABCOꢀimidꢀ
azole conjugates.28
To summarize, the results of the present study demꢀ
onstrate that of the histidineꢀ or histamineꢀcontaining
compounds, which were synthesized in the present study
and are characterized by a similar arrangement of the
functional groups, only peptides containing the arginine
residues possess pronounced ribonuclease activity. This
fact is apparently associated with a high affinity of the
arginine residue for RNA. The arginine residues are known
to be involved in the formation of RNAꢀbinding sites of
such proteins as tat29 and ribonuclease T1.15,16 Presumꢀ
ably, the arginine residue in a tripeptide enhances the
affinity of chemical ribonuclease for RNA, which is faꢀ
vorable for its more efficient cleavage. It cannot be ruled
out that arginine is directly involved in the catalytic event.
b
T1
L
K
a
C12ꢀA13
C10ꢀA11
Fig. 3. Cleavage of ON21 with tripeptides. (a) The secondary
structure of the 21ꢀmer oligoribonucleotide (ON21). The bonds
that are cleaved in the presence of tripeptides are indicated by
arrows. (b) Analysis of the products of ON21 cleavage with
tripeptides by electrophoresis in 15% denaturing polyacrylamide
gel (PAAG). Lanes L and T1 correspond to random hydrolysis
in an imidazole buffer and with RNase T1 in denaturing condiꢀ
tions, respectively. The ON21 cleavage with tripeptides is deꢀ
scribed in the Experimental section.
increase in the ribonuclease activity of DABCOꢀimidazole
conjugates, when the overall positive charge of the molꢀ
ecules increases from +2 to +4.
In the series of the tripeptides synthesized, each tripꢀ
eptide contains the lysine residue, which, depending on
This study was financially supported by the Russian
Academy of Sciences (Grant No. 219), the Russian Founꢀ
dation for Basic Research (Project No. 02ꢀ04ꢀ48664), the
Wellcome Trust (GRIG No. 063630), the US Civilian
Research and Development Foundation (CRDF, Grant
RECꢀ008), the Siberian Branch of the Russian Academy
of Sciences (Program "GenꢀTargeted Biologically Active
Compounds," Grant for Young Scientists of the Siberian
Branch of the Russian Academy of Sciences), and the
Foundation for Support of National Science.
Table 3. Efficacy of cleavage of the 21ꢀmer oligoribonucleotide
with the tripeptides synthesized and compound 2L2*
Compound
Efficacy of cleavage (%)*
Q**
I
II
KHR
HKR
31
55
31
1
2
10
13
17
8
6
0
0
+4
+4
+4
+3
+3
+3
+2
RKHa
NKHa
KNHa
KTHa
KHa (2L2)
References
4
9
1. N. S. Zhdan, I. L. Kuznetsova, A. V. Vlassov, V. N. Sil´nikov,
M. A. Zenkova, and V. V. Vlassov, Bioorg. Khim., 1999, 10,
723 [Russ. J. Bioorg. Chem., 1999, 10 (Engl. Transl.)].
2. M. A. Zenkova, N. L. Chumakova, A. V. Vlassov, N. I.
Komarova, A. G. Ven´yaminova, V. V. Vlassov, and V. N.
Sil´nikov, Mol. Biol., 2000, 34, 456 [Russ. Mol. Biol., 2000,
34 (Engl. Transl.)].
* The total degree (%) of ON21 cleavage during 24 h is given.
The RNA cleavage was carried out in a 50 mM imidazole (I) or
50 mM TrisꢀHCl buffer (II), pH 7.0, 0.2 M KCl, 0.1 mM EDTA,
an RNA carrier (0.1 mg mL–1) in the presence of tripeptides at a
concentration of 10–3 mol L–1, at 37 °C.
** Q is the overall charge at pH 7.0.

462
Russ.Chem.Bull., Int.Ed., Vol. 53, No. 2, February, 2004
Kuznetsova et al.
3. C. H. Tung, Z. Wei, M. J. Leibowitz, and S. Stein, Proc.
Natl. Acad. Sci. USA, 1992, 89, 7114.
19. M. D. Miller, J. Cai, and K. L. Krause, J. Mol. Biol., 1999,
288, 975.
4. B. Barbier and A. Brak, J. Am. Chem. Soc., 1992, 114, 3511.
5. A. J. Gordon and R. A. Ford, The Chemist´s Companion.
A Handbook of Practical Data, Techniques, and References,
WileyꢀInterscience, New York, 1972.
6. A. A. Gershkovich and V. K. Kibirev, Sintez peptidov.
Reagenty i metody [Synthesis of Peptides. Reagents and
Methods], Naukova dumka, Kiev, 1987 (in Russian).
7. L. G. Tyulkina and A. S. Mankin, Anal. Biochem., 1984,
138, 285.
8. A. V. Vlassov, V. V. Vlassov, and R. Giege, Dokl. Akad.
Nauk, 1996, 349, 411 [Dokl. Chem., 1996 (Engl. Transl.)].
9. N. Strater, W. N. Lipscomb, T. Klabunnde, and B. Krebs,
Angew. Chem., Int. Ed. Engl., 1996, 35, 2024.
20. M. Y. Reibarkh, D. E. Nolde, L. I. Vasilieva, E. V. Bocharov,
A. A. Shulga, M. P. Kirpichnikov, and A. S. Arseniev, FEBS
Lett., 1998, 431, 250.
21. K. M. Polyakov, A. A. Lebedev, A. L. Okorokov, K. I. Panov,
A. A. Schulga, A. G. Pavlovsky, M. Y. Karpeisky, and G. G.
Dodson, Acta Crystallogr. D., 2002, 58, 744.
22. J. M. J. Tronchet and I. Komaromi, Int. J. Biol. Macromol.,
1993, 15, 69.
23. G. W. Anderson, J. E. Zimmerman, and F. M. Callahan,
J. Am. Chem. Soc., 1964, 86, 1839.
24. R. Giege, B. Felden, V. N. Silnikov, M. A. Zenkova, and
V. V. Vlassov, Methods Enzymol., 2000, 318, 147.
25. M. Zenkova, N. Beloglazova, V. Sil´nikov, V. Vlassov, and
R. Giege, Methods Enzymol., 2001, 341, 468.
10. D. E. Wilcox, Chem. Rev., 1996, 96, 2435.
11. J. A. Cowan, Chem. Rev., 1998, 98, 1067.
12. R. A. Kovall and B. W. Matthews, Curr. Opin. Chem. Biol.,
1999, 3, 578.
13. S. V. Shlyapnikov, E. V. Blagova, V. M. Levdikov, V. Yu.
Lunin, V. V. Lunin, A. M. Mikhailov, H. Betzel, K. S.
Raishankar, and M. Perbandt, Mol. Biol., 1999, 33, 454
[Russ. Mol. Biol., 1999, 33 (Engl. Transl.)].
14. R. T. Raines, Chem. Rev., 1998, 7, 1045.
15. T. Nakai, W. Yoshikawa, H. Nakamura, and H. Yoshida,
Eur. J. Biochem., 1992, 208, 41.
16. J. Sevcik, E. J. Dodson, and G. G. Dodson, Acta
Crystallogr. B, 1991, 47, 240.
26. M. A. Zenkova, A. V. Vlassov, D. A. Konevets, V. N.
Sil´nikov, R. Giege, and V. V. Vlassov, Bioorg. Khim.,
2000, 26, 679 [Russ. J. Bioorg. Chem., 2000, 26 (Engl.
Transl.)].
27. B. J. Calnan, B. Tidor, S. Biancalana, D. Hudson, and A. D.
Frankel, Science, 1991, 251, 1167.
28. D. A. Konevetz, I. E. Beck, N. G. Beloglazova, I. V.
Sulimenkov, V. N. Sil´nikov, M. A. Zenkova, G. V. Shishkin,
and V. V. Vlassov, Tetrahedron, 1999, 55, 503.
29. B. J. Calnan, B. Tidor, S. Biansalana, D. Hudson, and A. D.
Frankel, Science, 1991, 251, 1167.
17. J. Chen, Z. Lu, J. Sakon, and W. E. Stites, J. Mol. Biol.,
2000, 303, 125.
18. J. Wang, D. M. Truckses, F. Abildgaard, Z. Dzakula,
Z. Zolnai, and J. L. Markley, J. Biomol. NMR, 1997, 10, 143.
Received June 2, 2003;
in revised form October 1, 2003