Design and synthesis of potent inhibitors of the malaria parasite dihydroorotate dehydrogenase

Article abstract of DOI:10.1021/jm060687j

Pyrimidine biosynthesis presents an attractive drug target in malaria parasites due to the absence of a pyrimidine salvage pathway. A set of compounds designed to inhibit the Plasmodium falciparum pyrimidine biosynthetic enzyme dihydroorotate dehydrogenase (PfDHODH) was synthesized. PfDHODH-specific inhibitors with low nanomolar binding affinities were identified that bind in the N-terminal hydrophobic channel of dihydroorotate dehydrogenase, the presumed site of ubiquinone binding during oxidation of dihydroorotate to orotate. These compounds also prevented growth of cultured parasites at low micromolar concentrations. Models that suggest the mode of inhibitor binding is based on shape complementarity, matching hydrophobic regions of inhibitor and enzyme, and interaction of inhibitors with amino acid residues F188, H185, and R265 are supported by mutagenesis data. These results further highlight PfDHODH as a promising new target for chemotherapeutic intervention in prevention of malaria and provide better understanding of the factors that determine specificity over human dihydroorotate dehydrogenase.

Full text of DOI:10.1021/jm060687j

186
J. Med. Chem. 2007, 50, 186-191
Articles
Design and Synthesis of Potent Inhibitors of the Malaria Parasite Dihydroorotate
Dehydrogenase
Timo Heikkila¨,† Christopher Ramsey,† Matthew Davies,† Christophe Galtier,‡ Andrew M. W. Stead,† A. Peter Johnson,*,†
Colin W. G. Fishwick,*,† Andrew N. Boa,*,‡ and Glenn A. McConkey*,†
School of Chemistry and the Astbury Centre for Structural Molecular Biology, and Faculty of Biological Sciences, UniVersity of Leeds,
Leeds LS2 9JT, UK, and Department of Chemistry, UniVersity of Hull, Cottingham Road, Hull HU6 7RX, UK
ReceiVed June 8, 2006
Pyrimidine biosynthesis presents an attractive drug target in malaria parasites due to the absence of a
pyrimidine salvage pathway. A set of compounds designed to inhibit the Plasmodium falciparum pyrimidine
biosynthetic enzyme dihydroorotate dehydrogenase (PfDHODH) was synthesized. PfDHODH-specific
inhibitors with low nanomolar binding affinities were identified that bind in the N-terminal hydrophobic
channel of dihydroorotate dehydrogenase, the presumed site of ubiquinone binding during oxidation of
dihydroorotate to orotate. These compounds also prevented growth of cultured parasites at low micromolar
concentrations. Models that suggest the mode of inhibitor binding is based on shape complementarity,
matching hydrophobic regions of inhibitor and enzyme, and interaction of inhibitors with amino acid residues
F188, H185, and R265 are supported by mutagenesis data. These results further highlight PfDHODH as a
promising new target for chemotherapeutic intervention in prevention of malaria and provide better
understanding of the factors that determine specificity over human dihydroorotate dehydrogenase.
Introduction
leflunomide (Arava) is in clinical use [the active metabolite is
1 (A77 1726) in Figure 1] for treatment of rheumatoid arthritis.8,9
Inhibitors of Helicobacter pylori DHODH and Enterococcus
faecalis DHODH have been described that inhibit bacterial
growth.10,11 P. falciparum DHODH (PfDHODHa) is also an
attractive target for drug development, since disrupting PfD-
HODH activity using inhibitors or lowering the expression levels
of PfDHODH inhibits parasite growth.12-14 PfDHODH has been
localized to the inner mitochondrial membrane in blood stage
parasites.12 Interestingly, the antimalarial drug atovaquone, an
ubiquinone mimic, is thought to disrupt the transfer of electrons
at cytochrome BC1, and parasites treated with atovaquone have
reduced levels of orotate.15,16 Cocrystal structures of human,
rat, and P. falciparum DHODH show that A77 1726 and
atovaquone bind within the putative ubiquinone binding
channel.5-7 Therefore, this channel is the logical target for
development of new chemotherapeutics against PfDHODH and
has already been used for structure-based drug design applica-
tions.17 It has also been found to be the binding site of novel
inhibitors identified from a high-throughput screen (2 and 3,
Figure 1).18 In this study, we report a new class of PfDHODH-
specific inhibitors with high binding affinities and analyze the
mode of binding through modeling and mutagenesis.
Nucleic acid synthesis in species of Plasmodium differs from
most organisms by the complete reliance on purine salvage due
to the absence of de novo purine synthesis and, conversely, the
absence of salvage of pyrimidine nucleobases and nucelosides.
Genes encoding enzymes for purine ring synthesis are not
identifiable in the Plasmodium falciparum genome. In contrast,
genes encoding the eight enzymes in de novo pyrimidine
synthesis have been identified.1 The dependence of Plasmodia
on pyrimidine biosynthesis renders the pathway a valid target
for development of novel antimalarial drugs.2,3 Dihydroorotate
dehydrogenase (DHODH) catalyzes the oxidation of the inter-
mediate dihydroorotate to orotate. The type 2 DHODHs, found
in Gram-negative bacteria and eukaryotes, catalyze the reaction
by a two-site “ping-pong” mechanism with flavin mononucle-
otide (FMN) serving as an intermediate in the electron transfer
and ubiquinone acting as the final electron acceptor. The type
2 DHODHs feature a conserved R/â barrel core structure, which
contains the catalytic site that binds substrate dihydroorotate
and FMN, and an N-terminal hydrophobic domain as shown
by the crystal structures of Escherichia coli, human, rat, and,
most recently, P. falciparum DHODH.4-7 The N-terminal
domain is thought to be the site of ubiquinone binding and is
the site of action of a number of DHODH inhibitors.
Results and Discussion
DHODH is an established target for antibiotics and treatment
for autoimmune diseases. The potent human DHODH inhibitor
Chemistry. The tetracyclic compound 4 (3,4-dimethyl-1,5-
dihydropyrrolo[3,2-b]carbazole-2-carboxylic acid ethyl ester)
was originally prepared by Shannon and found to inhibit cell
growth in a similar fashion to 1 and brequinar.19 As part of a
* Corresponding authors. G.A.M.: phone, +44 113 3432908; fax, +44
113 3432835; e-mail, g.a.mcconkey@leeds.ac.uk. A.N.B.: phone, +44 1482
465022; fax, +44 1482 466410; e-mail, a.n.boa@hull.ac.uk. A.P.J.: phone,
+44 113 3436515; fax, +44 113 3436530; e-mail, a.p.johnson@leeds.ac.uk.
C.W.G.F.: phone, +44 113 3436510; fax, +44 113 343653; e-mail,
c.w.g.fishwick@leeds.ac.uk.
a Abbreviations: PfDHODH, Plasmodium falciparum dihydroorotate
dehydrogenase; HsDHODH, human dihydroorotate dehydrogenase; DCIP,
2,6-dichloroindophenol; DHO, dihydroorotate; CoQ, ubiquinone coenzyme,
CoQD, decylubiquinone.
† University of Leeds.
‡ University of Hull.
10.1021/jm060687j CCC: $37.00 © 2007 American Chemical Society
Published on Web 12/29/2006

Inhibitors of Dihydroorotate Dehydrogenase
Journal of Medicinal Chemistry, 2007, Vol. 50, No. 2 187
Scheme 1
pound 6 was prepared with the intention of subsequent cycliza-
tion to a pyridocarbazole. However, during a routine screen it
was found to be quite active against PfDHODH. Following this
discovery, a set of compounds based loosely on this lead
structure was synthesized from a range of commercially
available monocyclic, bicyclic, or tricyclic aromatic amines. In
the case of compounds 11-14, the biphenyl amines were
obtained by Suzuki cross-coupling of the appropriate bromo-
aniline and benzeneboronic acid in the presence of palladium
acetate and triphenylphosphine. The amines were coupled with
diethyl ethoxymethylenemalonate or ethyl 3-ethoxy-2-cyanoacryl-
ate by simply stirring in refluxing toluene for 2 h (Scheme 1)
to produce a set of analogues containing common “head” groups
but with variations in the aromatic portion of the molecule.
Compounds 2 and 3, previously identified as potent inhibitors
of PfDHODH,18 were also synthesized as reference compounds.
Compound 2 was obtained in 49% yield from commercially
available 15 (2-naphthoyl chloride) and 16 (4-bromo-2-methyl-
aniline) (Scheme 2). Compound 3 was synthesized from 17 (2-
methyl-3-nitrobenzoic acid) in 52% yield by conversion to 18
(2-methyl-3-nitrobenzoyl chloride) and subsequent treatment
with 19 (3,5-dichloroaniline; Scheme 3).
Figure 1. A77 1726 (1), two of the most potent PfDHODH inhibitors
identified in a high-throughput screen by Baldwin et al.18 (2 and 3),
and the lead compound (4).
larger program, where analogues of inhibitors of human
DHODH are being evaluated against PfDHODH,20 we set out
to resynthesize this derivative and subsequently found it to have
modest activity against PfDHODH. However, the preparation
of this heterocycle is not straightforward using Shannon’s
method and, as we required access to a range of similar
derivatives, we envisioned a general strategy starting from the
3-aminocarbazole nucleus. During this work the derivative 6
(Figure 2) was prepared by simple condensation between N-ethyl
3-aminocarbazole and ethyl 3-ethoxy-2-cyanoacrylate. Com-
Biological Data and Structure-Activity Relationships. The
compounds were tested against a recombinant PfDHODH
expressed from a synthetic gene in which codon usage has been
optimized for expression in E. coli. From the initial screening
of 17 synthesized compounds, six (5-10; Figure 2) inhibited
PfDHODH activity with detectable levels (>10% at 10 µM).
Figure 2. List of the compounds that were found to inhibit PfDHODH.

188 Journal of Medicinal Chemistry, 2007, Vol. 50, No. 2
Heikkila¨ et al.
Scheme 2
Scheme 3
Table 1. Activity of Compounds against P. falciparum and Human
DHODH
binding channel by making up half of the first N-terminal
R-helix.7 Additionally, residues E164 and E182 form a salt
bridge that seems to anchor the N-terminal helix to the R/â barrel
as also seen in the HsDHODH structure.5,7 The use in the
previous study of a truncated enzyme that does not include these
N-terminal residues may explain the differences in the measured
affinities observed in the two studies.
PfDHODH
HsDHODH
selectivity
(fold)
inhibitor IC50 µM (SE) KI (µM) IC50 (µM) KI (µM)
5
6
7
8
9
10
11
12
0.16 ( 0.05
0.44 ( 0.06
27.78 ( 3.2
40.00 ( 5.2
345.6 ( 29.4
349.1 ( 26.4
>500
0.02 29.57 ( 5.9
3.63
182
0.05 491.4 ( 42.4 60.40 1208
3.20 123.3 ( 26.3 15.10
4.60 145.7 ( 31.2 17.90
39.70 292.2 ( 41.6 35.90
5
4
1
na
na
na
10
1
2308
2280
Competition analysis supports binding of inhibitors in the
N-terminal hydrophobic channel of PfDHODH. The Michaelis
constants, KM, for DHO and the synthetic ubiquinone CoQD
measured in our assays were 31.4 ( 2.8 and 13.4 ( 0.8 µM,
respectively, in agreement with published values.14 In experi-
ments varying CoQD concentrations in the presence of set
concentrations of 5 there was an increase in apparent KM but
unchanged Vmax, consistent with competitive inhibition of
binding of CoQD (Figure 3A). Analysis of competition with
CoQD via global fitting of the data set found the best fit with
curves generated using the equation for competitive inhibition
(goodness of fit R2 of 0.92). It was not possible to fit a curve
that converges to the data using the equation for noncompetitive
inhibition. The results of nonlinear regression using the equation
for uncompetitive inhibition were extremely discordant with
Lineweaver-Burk analysis. Hence, competition with CoQ for
binding was supported as has been found with most other
DHODH inhibitors.18,21,22 In contrast, varying DHO concentra-
tion with set concentrations of 5 and saturating CoQD exhibited
no change in KM and a decrease in Vmax of PfDHODH, indicating
uncompetitive inhibition (Figure 3B). These data strongly
support the ligand binding site being within the hydrophobic
ubiquinone channel. In structures of mammalian DHODH and
PfDHODH cocrystallized with ligands, the ligands bind within
the hydrophobic channel between two R-helices at the N-
terminus of DHODH. This binding appears to impair the ability
of ubiquinone to diffuse into the enzyme during catalysis to
reoxidize FMN.
Importantly, compounds 5 and 6 were also found to be active
against cultured malaria parasites with IC50 of 1.8 ( 1.1 and
4.0 ( 1.2 µM, respectively. These results further emphasize
the potential for using DHODH as a target for developing
antimalarials.
Modeling the Binding of Inhibitors 5 and 6. Structural
binding models of compounds 5 and 6 were constructed using
the X-ray crystal coordinates of PfDHODH in complex with
DHO and A77 1726 (PDB ID 1TV5). Two different docking
systems, Autodock 3.023 in combination with the graphical user
interface Autodock Tools and eHITS,24 were used for docking
5 and 6 into DHODH structures with DHO and A77 1726
removed. Using precalculated grids of affinity potentials,
Autodock evaluated suitable ligand positions on DHODH
40.20 >500
naa
na
na
na
na
>500
>500
>500
13
14
21.3 ( 8.2
86.7 ( 11.2
0.18 ( 0.09
0.23 ( 0.12
2.45 219.8 ( 33.2 27.0
10.0
104.2 ( 21.3 12.8
0.02 415.4 ( 53.5 50.9
0.03 524.4 ( 43.5 64.4
2/no. 2b
3/no. 6b
1/A77 1726 190.1 ( 10.32 23.35 0.26 ( 0.10
0.03
0.001
a na ) not applicable. b high-throughput screening compounds from
Baldwin et al.18
The six compounds all contain a polar “head group” linked
through a nitrogen to an aromatic or heteroaromatic moiety.
We noted immediately the similarity between these structures,
most notably 8 and 1, which both contain an amino aromatic
unit with a polar substituent of roughly similar functionality
and dimensions. The six compounds exhibited a range of
apparent inhibition coefficients (KIapp) between 20 nM and 40
µM. Five of the six active compounds (5, 7-10) have a
methylenemalonate group, and interestingly, the tricyclic com-
pounds (5 and 6) are more active than the monocyclic or bicyclic
compounds. To determine the specificity for PfDHODH, the
affinity of these inhibitors was also measured for HsDHODH.
The compounds had considerably lower affinity for the human
enzyme, showing up to 1200-fold higher relative affinity for
the parasite enzyme. Furthermore, the biphenyl analogues of
compounds 5 and 6 (11 and 12) displayed reduced activity in
both enzymes (IC50 > 500 µM). The m-biphenyl structures 13
and 14 displayed activity at low micromolar concentrations but
with loss of selectivity, with respect to compounds 5 and 6.
A series of simple aromatic amide-based inhibitors of
PfDHODH has also recently been identified through a high-
throughput screening approach.18 In parallel assays, we find that
5 and 6 bind PfDHODH with similar affinity to the two most
active compounds reported in the previous study (2 and 3; Table
1).
It is noteworthy that although a truncated enzyme was used
in both studies, the expressed enzyme in our assay contained
additional N-terminal amino acids derived from the native
protein (F158-Y169). In the X-ray crystal structure of PfD-
HODH, these residues have a well-defined structure, forming
the entrance and partially lining the hydrophobic ubiquinone

Inhibitors of Dihydroorotate Dehydrogenase
Journal of Medicinal Chemistry, 2007, Vol. 50, No. 2 189
Figure 3. (A and B) Double-reciprocal plots of enzymatic rate as a function of substrate concentration. Substrates coenzyme CoQD (A) and
dihydroorotate (B) were varied in steady-state kinetic assays. The rates were measured in the absence of inhibitor (9) and with 0.25 µM (2) and
0.50 µM (1) of compound 5. Convergent lines (A) indicate competition of CoQD by compound 5, whereas parallel lines (B) indicate uncompetitive
inhibition of DHO.
Figure 4. Models obtained from automated docking of 5 (A) and 6 (B) to PfDHODH. The predicted hydrogen bonds between the inhibitor and
amino acid residues are show as green dashed lines. Also highlighted is the Plasmodium-specific F188. Figures were generated with Pymol.
allowing random movements of the ligand conformations on
the surface. Free-energy scores were calculated on the basis of
a linear regression analysis, the AMBER force field, and the
results of training on a large set of diverse protein-ligand
complexes with known inhibition constants that are incorporated
in the program. The predicted binding affinity was also
calculated using the ligand scoring function in the HIPPO
module from the de novo molecular design software SPROUT.25
Here, each of the individual best-docked ligand structures was
used as the cavity file, and a 6-Å layer of protein centered on
this structure was used as the receptor file.
The docked poses with the lowest energies suggest that both
these high affinity compounds bind in the hydrophobic channel
(Figure 4A,B). Each inhibitor is predicted to make hydrogen-
bonding contacts with conserved amino acid residues (residues
H185, R265, and Y528) as well as gaining a significant binding
contribution from hydrophobic interactions due to the continuous
nature of the hydrophobic cavity.
The role of hydrophobicity upon the measured affinities of
compounds 5-10 for PfDHODH is underlined by their relatively
high calculated log P values (data not shown).26 Modeling of
the binding of 5 in HsDHODH indicates that the side chain of
the conserved histidine (H56 in HsDHODH and H185 in
PfDHODH, respectively) is locked in a conformation that
prevents formation of the hydrogen bond observed in PfD-
HODH. Furthermore, the surface complementarity is not as good
as it is for PfDHODH. The tricyclic hydrophobic moiety fits
very well into the hydrophobic pocket of the N-terminal channel
in PfDHODH, and the binding model indicates a staggered
stacking interaction with F188, whereas in HsDHODH the
Table 2. Kinetics of the Mutant PfDHODH
kinetic constants for PfDHODH
Kmapp (M)
PfDHODH
CoQD
DHO
k
cat (s-1
)
wild type
H185A
F188A
13 ( 1
19 ( 1
17 ( 1
13 ( 1
31 ( 3
33 ( 3
35 ( 2
33 ( 4
15.8 ( 2
1.4 ( 2.3
12.3 ( 4
16.1 ( 5
R265K
corresponding residue is A59. The difference in activity between
carbazoles 5 and 6 and the biphenyl analogues 11-14 suggests
an important hydrophobic requirement for selectivity such that
the planar carbazole moiety is preferred in PfDHODH. In
particular, the m-biphenyls 13 and 14, which only differ from
6 and 5 by lack of the N- and S-links, respectively, are less
active and less selective than 6 and 5, perhaps indicating a
nonplanar arrangement between the aromatic rings that does
not satisfy the hydrophobic binding region as efficiently. Figure
4 shows the binding model of compounds 5 and 6, with the
planar carbazole moiety stacked against residue F188. A
nonplanar biphenyl would clearly lack this favorable hydro-
phobic stacking interaction.
Analysis of Protein-Inhibitor Interactions by Mutagen-
esis. The predicted H-bonding and hydrophobic interactions of
5 and 6 with the amino acid residues were tested by generating
point mutants of residues H185, F188, and R265 (Tables 2 and
3; The Y528F mutant could not be tested due to the low catalytic
activity of the enzyme) of the PfDHODH. Substitutions of these
residues led to considerable changes in the binding affinities of

190 Journal of Medicinal Chemistry, 2007, Vol. 50, No. 2
Heikkila¨ et al.
Table 3. Effect of Mutations in PfDHODH on Inhibitor Activitya
mixture of 3-amino-9-ethylcarbazole (1.00 g, 4.8 mmol) and ethyl
ethoxymethylenecyanoacrylate (1.04 g, 4.8 mmol), mixed with the
aid of some toluene (5 mL), was heated slowly to 120 °C in an
open flask over a period of 1-2 h. The reaction mixture was then
cooled and filtered and the solid obtained was washed thoroughly
with hexane to remove all the residual cyanoacrylate. Further
purification using silica gel column chromatography with dichlo-
romethane as eluent gave the title compound as a yellow-green
IC50 against PfDHODH (M)
inhibitor
wild type
H185A
F188A
R265K
5
6
0.16 ( 0.04
0.44 ( 0.08
124 ( 10
128 ( 8
82 ( 6
70 ( 6
5.4 ( 0.8
32 ( 5
the inhibitors without dramatically affecting the substrate binding
affinities. Hence, consistent with our modeling predictions, these
residues are involved in binding 5 and 6, although other
interactions are likely to contribute. Interestingly, the unique
conformation observed for the conserved histidine (H185) in
PfDHODH seems to be the key for specificity over the human
DHODH, as also shown for a previous group of PfDHODH
inhibitors.18 Additionally, these results confirm that the most
potent inhibitors reported here benefit from specific hydrophobic
interaction with F188. The binding affinities of A77 1726 (1),
2, and 3 were not affected by the F188A substitution (data not
shown).
1
crystalline solid (50%): mp 187-188 °C; H NMR (CDCl3, 400
MHz) δ 10.96 (1H, bd, J 13.7 Hz, dCH-NH), 8.07 (1H, d, J 7.8
Hz, ArH), 7.93 (1H, d, J 13.7 Hz, dCH-NH), 7.81 (1H, s, ArH),
7.52 (1H, t, J 8.2 Hz, ArH), 7.43 (1H, d, J 8.2 Hz, ArH), 7.40 (1H,
d, J 8.6 Hz, ArH), 7.27 (1H, t, J 7.8 Hz, ArH), 7.21 (1H, d, J 8.6
Hz, ArH), 4.37 (2H, q, J 7.2 Hz, OCH2 or NCH2), 4.32 (2H, q, J
7.2 Hz, NCH2 or OCH2), 1.45 (3H, t, J 7.2 Hz, CH2CH3), 1.40
(3H, t, J 7.2 Hz, CH2CH3); MS (EI) m/z 333 (M+, 75), 287 (50),
272 (100). Anal. (C20H19N3O2) C, H, N.
N-(4-Bromo-2-methylphenyl)-2-naphthamide (2). 2-Naphthoyl
chloride (1.0 g, 5.25 mmol) was dissolved in anhydrous DCM (25
mL). 4-Bromo-2-methylaniline (0.98 g, 5,25 mmol, 1.0 equiv) and
triethylamine (1.10 mL, 7.87 mmol, 1.5 equiv) were added, and
the reaction mixture was stirred at room temperature overnight.
After this time, a solid precipitated out of solution and this was
filtered and washed with several portions of DCM and water to
give pure N-(4-bromo-2-methylphenyl)-2-naphthamide as a color-
less microcrystalline solid (0.88 g, 2.59 mmol, 49%): mp 168-
170 °C; 1H NMR (300 MHz; CDCl3) δ 8.38 (1H, bs, NH), 7.96-
7.82 (6H, m, ArH), 7.63-7.54 (2H, m, ArH), 7.38-7.36 (2H, m,
ArH), 2.34 (3H, s, CH3); MS (ES+) m/z 340 (C18H1479BrNO, MH+,
100), 342 (C18H1481BrNO, MH+, 100), 362 (C18H1479BrNO, M+ +
Conclusion
On the basis of an initial lead, a set of compounds was derived
in which the members had a common hydrophilic portion linked
to a variety of hydrophobic aromatic or heteroaromatic rings.
From this series, compounds with nanomolar affinity for
PfDHODH were identified that compete with ubiquinone for
binding within the N-terminal channel. This mode of binding
in the ubiquinone channel is supported by docking studies. The
ligand/enzyme models predict that the inhibitors form H-bonds
with amino acids (H185, R265, and Y528) in a similar manner
to that observed for 1 binding in the PfDHODH crystal structure.
Our mutagenesis studies further emphasize that H185 and R265
are involved in binding these inhibitors. It is interesting to note
that similar mutagenesis studies on inhibitors identified by high-
throughput screening also indicated a critical role for H185,
whereas mutation of R265 had much less effect.18 Significantly,
two of the most potent compounds identified in the current study
were also shown to be the first PfDHODH inhibitors that inhibit
the growth of cultured parasites at low micromolar levels. These
results further highlight PfDHODH as a good target for
antimalarial chemotherapeutics.
H2O, 100), 364 (C18H1481BrNO, M+ + H2O, 100); IR (solid, cm-1
3262, 3054, 1640, 1599, 1572. Anal. (C18H14BrNO) C, H, N.
)
N-(3,5-Dichlorophenyl)-2-methyl-3-nitrobenzamide (3). 2-Meth-
yl-3-nitrobenzoic acid (1.0 g, 5.52 mmol) was added to neat thionyl
chloride (20 mL 0.28 mol, 50 equiv) at room temperature. The
reaction mixture was heated at reflux for 2 h, followed by removal
of the excess thionyl chloride by rotary evaporator. The acid
chloride was then dissolved in anhydrous DCM (20 mL), 3,5-
dichloroaniline (0.89 g, 5.52 mmol, 1.0 equiv) and triethylamine
(1.20 mL, 8.28 mmol, 1.5 equiv) were added, and the reaction
mixture was stirred at room temperature overnight. The mixture
was then washed with 2 M NaOH (3 × 20 mL), 2 M HCl (3 × 20
mL), and brine (3 × 20 mL). The DCM layer was then dried
(MgSO4), filtered, and evaporated to leave crude product which
was purified by silica gel flash chromatography (eluent 20%
EtOAc-petroleum ether) and recrystallization from chloroform-
hexane. N-(3,5-Dichlorophenyl)-2-methyl-3-nitrobenzamide was
afforded as colorless needles (0.93 g, 2.87 mmol, 52%): mp 170-
Experimental Section
General Methods. All solvents and reagents were used as
purchased. Reactions were monitored by thin layer chromatography
using aluminum-backed plates coated with silica gel (60 F254
Merck), and purification of products by column chromatography
was accomplished using standard silica gel 60 (200-400 mesh)
obtained from a variety of suppliers. 1H NMR spectra were recorded
using a JEOL Lambda 400 spectrometer (referenced to CHCl3),
and mass spectra were recorded using a QP5050A Shimadzu GC/
MS spectrometer. Elemental analysis was carried out using a Fisons
EA 1108 CHN machine.
1
172 °C; H NMR (300 MHz; CDCl3) δ 7.91 (1H, d, J 7.9, ArH),
7.64 (1H, d, J 7.9, ArH), 7.59 (3H, bs, NH and 2×ArH), 7.44 (1H,
t, J 7.9, ArH), 7.19 (1H, s, ArH), 2.58 (3H, s, CH3); MS (ES+)
m/z 325 (C14H1035Cl2N2O3, M+, 50), 327 (C14H1037Cl35ClN2O3, M+,
30), 329 (C14H1037Cl2N2O3, M+, 5), 366 (C14H1035Cl2N2O3, M+
+
MeCN, 100), 368 (C14H1037Cl35ClN2O3, M+ + MeCN, 60), 370
(C14H1037Cl2N2O3, M+ + MeCN, 10); HRMS (ES+, m/z) for
C14H1135Cl2N2O3 calcd 325.0147, found 325.0151; IR (solid, cm-1
)
3279-3079, 1661, 1589, 1574, 1525.
Inhibitors were prepared using the general procedure given below
for compound 6, unless otherwise stated. A similar method was
applied to the synthesis of the other compounds, using diethyl
ethoxymethylenemalonate in place of the acrylate where appropriate,
giving yields of 40-60% (unoptimized). The yields were not
adversely affected by use of excess acrylate or malonate (2-3
equiv), which could also be used as solvent in place of the toluene,
except in the case of compound 7, where further alkylation at the
heterocyclic nitrogen was observed. If no precipitate formed on
cooling to room temperature, then precipitation could be induced
by cooling the reaction mixture to -20 °C for a period of several
hours.
Biological Assays. Protein Purification, Expression, and
Analysis. Recombinant PfDHODH and HsDHODH truncated at
the homologous location (amino acid residue 158 for PfDHODH
and amino acid residue 30 for HsDHODH) were expressed in E.
coli pyrD strain SØ6745 (kindly provided by K.F. Jensen) using a
construct with a His-tag fusion as used in crystallographic studies
(kindly provided by J. Clardy).5,7 These maintain the intact structure
for the channel with both N-terminal R helices. After overnight
incubation with 10 µM IPTG, cells were harvested and lysed by
sonicating cell pellets in lysis buffer (50 mM NaH2PO4, 300 mM
NaCl, 10 mM imidazole, adjusted to pH 8.0 with NaOH) containing
15 µL/mL protease inhibitor cocktail (Sigma-Aldrich), 1 mg/mL
lysozyme (Sigma-Aldrich), and 2.5 mM DHO (Sigma-Aldrich), and
the enzyme was purified by nickel agarose chromatography
Synthesis. General Procedure: Synthesis of 2-Cyano-3-(9-
ethyl-9H-carbazol-3-ylamino)acrylic Acid Ethyl Ester (6). A

Inhibitors of Dihydroorotate Dehydrogenase
Journal of Medicinal Chemistry, 2007, Vol. 50, No. 2 191
(10) Copeland, R. A.; Marcinkeviciene, J.; Haque, T. S.; Kopcho, L. M.;
Jiang, W.; Wang, K.; Ecret, L. D.; Sizemore, C.; Amsler, K. A.;
Foster, L.; Tadesse, S.; Combs, A. P.; Stern, A. M.; Trainor, G. L.;
Slee, A.; Rogers, M. J.; Hobbs, F. Helicobacter pylori-selective
antibacterials based on inhibition of pyrimidine biosynthesis. J. Biol.
Chem. 2000, 275, 33373-8.
(11) Marcinkeviciene, J.; Rogers, M. J.; Kopcho, L.; Jiang, W.; Wang,
K.; Murphy, D. J.; Lippy, J.; Link, S.; Chung, T. D.; Hobbs, F.;
Haque, T.; Trainor, G. L.; Slee, A.; Stern, A. M.; Copeland, R. A.
Selective inhibition of bacterial dihydroorotate dehydrogenases by
thiadiazolidinediones. Biochem. Pharmacol. 2000, 60, 339-42.
(12) Krungkrai, J. Purification, characterization and localization of mi-
tochondrial dihydroorotate dehydrogenase in Plasmodium falciparum,
human malaria parasite. Biochim. Biophys. Acta 1995, 1243, 351-
60.
(Qiagen). Enzyme purity was monitored by SDS-PAGE and
concentration was determined spectrophotometrically using the
Bradford protein assay (Bio-Rad).
Single amino acid substitutions were generated in the synthetic
PfDHODH gene by introducing point mutations with the Quikchange
PCR method (Stratagene). The following oligonucleotides were used
for generating the amino acid substitutions (only the sense-strand
primer shown): H185A, CGATGGTGAAATTTGCGCCGACCT-
GTTTTTGCTGCTTGG; F188A, GTGAAATTTGCCATGAC-
CTGGCCTTGCTGCTTGGGAAATATAAC; R265K, GCGAAAC-
CGCGGATTTTTAAGGACGTCGAATCTCGC. Base substitutions
were verified by DNA sequencing.
Acknowledgment. We are indebted to J. Clardy for his
assistance and willingness in the sharing of reagents and data
on the crystal structure of PfDHODH. Parasite cultivation was
greatly aided by the technical expertise of M. Looker. Thanks
are also due to R. Westwood and J. Coombes for helpful input
in the early stages of the project. This work was supported in
part by WHO Tropical Diseases Research Grant (to G.A.M.)
and Medicines for Malaria Venture (to G.A.M.), Geneva,
Switzerland. The authors thank the Wellcome Trust for a
studentship to T.H. and the EPSRC for a studentship to M.D.
The current address for A.M.W.S. is the School of Pharmacol-
ogy, University of Puerto Rico, San Juan, PR.
(13) McRobert, L.; McConkey, G. A. RNA interference (RNAi) inhibits
growth of Plasmodium falciparum. Mol. Biochem. Parasitol. 2002,
119, 273-8.
(14) Baldwin, J.; Farajallah, A. M.; Malmquist, N. A.; Rathod, P. K.;
Phillips, M. A. Malarial dihydroorotate dehydrogenase. Substrate and
inhibitor specificity. J. Biol. Chem. 2000, 277, 41827-34.
(15) Kessl, J. J.; Lange, B. B.; Merbitz-Zahradnik, T.; Zwicker, K.; Hill,
P.; Meunier, B.; Palsdottir, H.; Hunte, C.; Meshnick, S.; Trumpower,
B. L. Molecular basis for atovaquone binding to the cytochrome bc1
complex. J. Biol. Chem. 2003, 278, 31312-8.
(16) Hudson, A. T.; Dickins, M.; Ginger, C. D.; Gutteridge, W. E.;
Holdich, T.; Hutchinson, D. B.; Pudney, M.; Randall, A. W.; Latter,
V. S. 566C80: A potent broad spectrum anti-infective agent with
activity against malaria and opportunistic infections in AIDS patients.
Drugs Exp. Clin. Res. 2003, 17, 427-35.
Supporting Information Available: A table listing the degree
of purity for all target compounds (area percent and retention time),
a table listing the elemental analyses, details of the experimental
procedures and spectroscopic data for each compound, and details
of the biological assays. This material is available free of charge
via the Internet at http://pubs.acs.org.
(17) Heikkila, T.; Thirumalairajan, S.; Davies, M.; Parsons, M. R.;
McConkey, A. G.; Fishwick, C. W.; Johnson, A. P. The first de novo
designed inhibitors of Plasmodium falciparum dihydroorotate dehy-
drogenase. Bioorg. Med. Chem. Lett. 2006, 16, 88-92.
(18) Baldwin, J.; Michnoff, C. H.; Malmquist, N. A.; White, J.; Roth, M.
G.; Rathod, P. K.; Phillips, M. A. High-throughput screening for
potent and selective inhibitors of Plasmodium falciparum dihydro-
orotate dehydrogenase. J. Biol. Chem. 2005, 280, 21847-53.
(19) Shannon, P. V. R.; Eichholtz, T.; Linstead, D.; Masdin, P.; Skinner,
R. Condensed heterocyclic compounds as anti-inflammatory and
immunomodulatory agents. International patent number WO 99/
45926, 1999.
(20) Boa, A. N.; Canavan, S. P.; Hirst, P. R.; Ramsey, C.; Stead, A. M.
W.; McConkey, G. A. Synthesis of brequinar analogue inhibitors of
malaria parasite dihydroorotate dehydrogenase. Bioorg. Med. Chem.
2005, 13, 1945-67.
(21) McLean, J. E.; Neidhardt, E. A.; Grossman, T. H.; Hedstrom, L.
Multiple inhibitor analysis of the brequinar and leflunomide binding
sites on human dihydroorotate dehydrogenase. Biochemistry 2001,
40, 2194-200.
References
(1) Gardner, M. J.; Hall, N.; Fung, E.; White, O.; Berriman, M.; Hyman,
R. W.; Carlton, J. M.; Pain, A.; Nelson, K. E.; Bowman, S.; Paulsen,
I. T.; James, K.; Eisen, J. A.; Rutherford, K.; Salzberg, S. L.; Craig,
A.; Kyes, S.; Chan, M. S.; Nene, V.; Shallom, S. J.; Suh, B.; Peterson,
J.; Angiuoli, S.; Pertea, M.; Allen, J.; Selengut, J.; Haft, D.; Mather,
M. W.; Vaidya, A. B.; Martin, D. M.; Fairlamb, A. H.; Fraunholz,
M. J.; Roos, D. S.; Ralph, S. A.; McFadden, G. I.; Cummings, L.
M.; Subramanian, G. M.; Mungall, C.; Venter, J. C.; Carucci, D. J.;
Hoffman, S. L.; Newbold, C.; Davis, R. W.; Fraser, C. M.; Barrell,
B. Genome sequence of the human malaria parasite Plasmodium
falciparum. Nature 2002, 419, 498-511.
(2) Pink, R.; Hudson, A.; Mouries, M. A.; Bendig, M. Opportunities
and challenges in antiparasitic drug discovery. Nat. ReV. Drug
DiscoVery 2005, 4, 727-740.
(3) Tamta, H.; Mukhopadhyay, A. K. Biochemical targets for malaria
chemotherapy. CRIPS 2003, 4, 6-9.
(22) Knecht, W.; Henseling, J.; Loffler, M. Kinetics of inhibition of human
and rat dihydroorotate dehydrogenase by atovaquone, lawsone
derivatives, brequinar sodium and polyporic acid. Chem. Biol.
Interact. 2001, 124, 61-76.
(4) Norager, S.; Jensen, K. F.; Bjornberg, O.; Larsen, S. E. coli
dihydroorotate dehydrogenase reveals structural and functional
distinctions between different classes of dihydroorotate dehydroge-
nases. Structure 2002, 10, 1211-23.
(23) Morris, G. M.; Goodsell, D. S.; Halliday, R. S.; Huey, R.; Hart, W.
E.; Belew, R. K.; Olson, A. J. Automated docking using a lamarckian
genetic algorithm and empirical binding free energy function. J.
Comput. Chem. 1998, 19, 1639-62.
(24) Zsoldos, Z.; Szabo. I.; Szabo, Z.; Johnson, A. P. Software tools for
structure based rational drug design. J. Mol. Struct.: THEOCHEM
2003, 666-667, 659-65.
(25) Gillet, V. J.; Newell, W.; Mata, P.; Myatt, G.; Sike, S.; Zsoldos, Z.;
Johnson, A. P. SPROUT: Recent developments in the de novo design
of molecules. J. Chem. Inf. Comput. Sci. 1994, 34, 207-17.
(26) Wang, R.; Fu, Y.; Lai, L. A new atom-additive method for calculating
partition coefficients. J. Chem. Inf. Comput. Sci. 1997, 37, 615-621.
(27) Copeland, R. A.; Davis, J. P.; Dowling, R. L.; Lombardo, D.; Murphy,
K. B.; Patterson, T. A. Recombinant human dihydroorotate dehy-
drogenase: Expression, purification, and characterization of a
catalytically functional truncated enzyme. Arch. Biochem. Biophys.
1995, 323, 79-86.
(5) Liu, S.; Neidhardt, E. A.; Grossman, T. H.; Ocain, T.; Clardy, J.
Structures of human dihydroorotate dehydrogenase in complex with
antiproliferative agents. Structure 2000, 8, 25-33.
(6) Hansen, M.; Le Nours, J.; Johansson, E.; Antal, T.; Ullrich, A.;
Loffler, M.; Larsen, S. Inhibitor binding in a class 2 dihydroorotate
dehydrogenase causes variations in the membrane-associated N-
terminal domain. Protein Sci. 2004, 13, 1031-42.
(7) Hurt, D. E.; Widom, J.; Clardy, J. Structure of Plasmodium falciparum
dihydroorotate dehydrogenase with a bound inhibitor. Acta Crystal-
logr. D 2006, 62, 312-323.
(8) Fox, R. I.; Herrmann, M. L.; Frangou, C. G.; Wahl, G. M.; Morris,
R. E.; Strand, V.; Kirschbaum, B. J. Mechanism of action for
leflunomide in rheumatoid arthritis. Clin. Immunol. 1999, 93, 198-
208.
(9) Williamson, R. A.; Yea, C. M.; Robson, P. A.; Curnock, A. P.;
Gadher, S.; Hambleton, A. B.; Woodward, K.; Bruneau, J. M.;
Hambleton, P.; Spinella-Jaegle, S.; Morand, P.; Courtin, O.; Sautes,
C.; Westwood, R.; Hercend, T.; Kuo, E. A.; Ruuth, E. Dihydroorotate
dehydrogenase is a target for the biological effects of leflunomide.
Transplant. Proc. 1996, 28, 3088-91.
(28) Cheng, Y.; Prusoff, W. H. Relationship between the inhibition
constant (Ki) and the concentration of inhibitor which causes 50 per
cent inhibition (I50) of an enzymatic reaction. Biochem. Pharmacol.
1973, 22, 3099-108.
JM060687J