Carboxypeptidase from Streptomyces bikiniensis: Primary structure, isolation, and properties

Article abstract of DOI:10.1134/S0006297910080122

A metallocarboxypeptidase produced by Streptomyces bikiniensis 27 strain (VKPM Ac-1783) (CPSb) was purified and characterized. The enzyme cleaves both basic and hydrophobic C-terminal amino acid residues from synthetic peptides, that is, it possesses specificity of mammalian carboxypeptidases A and B. The enzyme also hydrolyzes peptides bearing glutamic acid at the C-end. CPSb exhibits its maximal activity at pH 7.0-7.6 and 55°C. The nucleotide sequence encoding the mature CPSb in S. bikiniensis 27 (VKPM Ac-1783) genome (Accession No. GU362077) was determined. It is shown that the primary structure of the mature enzyme has a moderate degree of identity with orthologs from Streptomyces griseus (79% identity) and Streptomyces avermitilis (85% identity).

Full text of DOI:10.1134/S0006297910080122

ISSN 0006ꢀ2979, Biochemistry (Moscow), 2010, Vol. 75, No. 8, pp. 1032ꢀ1038. © Pleiades Publishing, Ltd., 2010.
Original Russian Text © A. V. Serkina, I. A. Zalunin, E. I. Levitin, T. A. Voejkova, B. V. Tyaglov, L. M. Novikova, L. K. Emeljanova, G. E. Konstantinova, G. G. Chestukhina,
2010, published in Biokhimiya, 2010, Vol. 75, No. 8, pp. 1142ꢀ1149.
Carboxypeptidase from Streptomyces bikiniensis:
Primary Structure, Isolation, and Properties
A. V. Serkina, I. A. Zalunin*, E. I. Levitin, T. A. Voejkova, B. V. Tyaglov,
L. M. Novikova, L. K. Emeljanova, G. E. Konstantinova, and G. G. Chestukhina
Institute for Genetics and Selection of Industrial Microorganisms, 1ꢀyi Dorozhnyi Proezd 1,
117545 Moscow, Russia; fax: (495) 315ꢀ0347; Eꢀmail: ingvarzal@mail.ru; zalunin@genetika.ru
Received January 22, 2010
Revision received March 22, 2010
Abstract—A metallocarboxypeptidase produced by Streptomyces bikiniensis 27 strain (VKPM Acꢀ1783) (CPSb) was purified
and characterized. The enzyme cleaves both basic and hydrophobic Cꢀterminal amino acid residues from synthetic peptides,
that is, it possesses specificity of mammalian carboxypeptidases A and B. The enzyme also hydrolyzes peptides bearing gluꢀ
tamic acid at the Cꢀend. CPSb exhibits its maximal activity at pH 7.0ꢀ7.6 and 55°C. The nucleotide sequence encoding the
mature CPSb in S. bikiniensis 27 (VKPM Acꢀ1783) genome (Accession No. GU362077) was determined. It is shown that
the primary structure of the mature enzyme has a moderate degree of identity with orthologs from Streptomyces griseus (79%
identity) and Streptomyces avermitilis (85% identity).
DOI: 10.1134/S0006297910080122
Key words: Streptomyces bikiniensis, metallocarboxypeptidase, substitution therapy
Assimilation of proteins in the intestines of animals assimilation of proteins. In this case substitution therapy
requires their cleavage to amino acids by the action of is widely used: enzyme preparations of various origins
endoꢀ and exopeptidases of various specificities. Two compensate the lack of the patient’s own digestive
enzymes with carboxypeptidase activity, carboxypeptidasꢀ enzymes [9]. Although most drugs thus used are based on
es A and B (CPA and CPB), are present in human panꢀ pancreatin (copying of the natural situation) [10], proꢀ
creatic fluid. These metallocarboxypeptidases belong to teolytic enzymes of other origin can also be used.
the A/B subfamily of the M14 peptidases family [1, 2]. Catalytic properties of such enzymes can differ from
CPB cleaves basic amino acid residues from the Cꢀend of those of pancreas components. In particular, it is of interꢀ
peptides, whereas CPA cleaves aromatic and branched est to use carboxypeptidase of wide specificity combining
aliphatic residues [1, 2]. CPA and CPB cooperate and the properties of CPA and CPB and also able to cleave
exhibit wide total specificity, although “inconvenient” some “inconvenient” amino acid residues, e.g. Glu and
amino acid residues still remain, e.g. glutamic and asparꢀ Asp. Such carboxypeptidase is absent among animal carꢀ
tic acid residues. CPB is unable to cleave these residues, boxypeptidases similar to CPA (e.g. CPA3 [11] and CPA5
and CPA cleaves them very slowly [3]. An enzyme able to [12]) or CPB (e.g. CPU [13] and CPN [14]).
cleave glutamic acid residues from the Cꢀend of peptides
Carboxypeptidases of microorganisms are more promꢀ
was found in the alimentary canal of insects [4]. Moreover, ising. For example, serine carboxypeptidases produced by
a carboxypeptidase specifically cleaving glutamic acid was fungi of the Aspergillus genus, e.g. Aspergillus saitoi, cleaves
isolated from the midgut of Helicoverpa armigera [5]. Also, basic, neutral, and acidic amino acids and even proline
carboxypeptidases specific to glutamate have been found from the Cꢀend of the substrates [15ꢀ17]. Carboxypeptidase
in several pseudomonad strains [6ꢀ8].
T (CPT) from Thermoactynomyces vulgaris [18, 19], CPSG
Biosynthesis of digestive enzymes is violated in variꢀ composing the proteolytic complex of Streptomyces griseus
ous gastrointestinal diseases; this results in decreased [20ꢀ22], and carboxypeptidases from Sulfolobus solfataricus
archaea [23] also demonstrate wide specificity.
In this work we isolated and studied the physicoꢀ
* To whom correspondence should be addressed.
chemical and catalytic properties of a carboxypeptidase
1032

CARBOXYPEPTIDASE FROM Streptomyces bikiniensis
1033
from S. bikiniensis (CPSb) and also cloned the correꢀ used to separate the reaction product from nonꢀ
sponding gene from the genome of this microorganism.
MATERIALS AND METHODS
hydrolyzed substrate. The reaction product was eluted
with 1 M acetic acid. Carboxypeptidase activity (A) was
estimated using molar extinction coefficient of the Dnp
group (15 mM−1·cm−1). The amount of enzyme catalyzing
conversion of 1 µmol of substrate in 1 min was taken as
Cultivation of microorganisms. Streptomyces bikinienꢀ the activity unit.
sis 27 strain (VKPM Acꢀ1783) was used in this work. The
SDSꢀPAGE. Electrophoresis was performed accordꢀ
microorganism was grown in 750ꢀml flasks containing ing to Laemmli [26] in a slab of 12.5% polyacrylamide gel
30 ml of fermentation medium of the following composiꢀ at 150 V. The following molecular mass standards from
tion (g/liter): bacteriological peptone from Sigma (USA), SigmaꢀAldrich (USA) were used: bovine serum albumin
50; maize extract, 5.0; glucose, 10.0; chalk, 0.5; NaCl, (66 kDa), ovalbumin (45 kDa), phosphoglycerol aldeꢀ
5.0; pH 7.0ꢀ7.2. Flasks were placed on a rotary shaker hyde dehydrogenase (36 kDa), carbonic anhydrase
(220 rpm) and cultivated for 96 h at 30°C. Then the (29 kDa), and soybean trypsin inhibitor (20.1 kDa).
micellae was precipitated by centrifugation of the culture
liquid for 20 min at 15,000g.
Massꢀspectroscopy. Enzyme sample (4.8 µg in 3 ml)
was subjected to HPLC on a C4 column (4.6 × 250 mm)
Isolation of CPSb. After centrifugation, (NH4)2SO4 from Vydac (USA) in 25ꢀ60% acetonitrile gradient for
was added to 450 ml of the culture liquid to 80% saturaꢀ 40 min. The mass spectrum of the compound with the
tion. The resulting suspension was stored overnight at protein peak was recorded using a MALDI Ultimate mass
4°C, then the precipitate was separated by centrifugation spectrometer from Bruker (Germany).
(20 min at 15,000g) and dissolved in 40 ml of 10 mM Trisꢀ
Determination of Nꢀterminal amino acid sequence.
HCl, pH 8.2, containing 10 mM CaCl2 (buffer A). The Purified carboxypeptidase (3.5 µg in 2.2 ml of solution)
solution was then centrifuged as described above, and the was chromatographed on a Vydac C4 column (4.6 ×
supernatant was dialyzed overnight against the same 250 mm) as described above. The compound composing
buffer.
the protein peak was sequenced using a Procise
The dialysate was applied onto a column with baciꢀ Sequencing System automatic sequencer (model 492)
tracinꢀSilochrom (synthesized in our laboratory accordꢀ from Applied Biosystems (USA).
ing to [24]) equilibrated with buffer A and then eluted
Dependence of CPSb activity on pH was studied using
with 1 M NaCl in the same buffer. To separate trypsin substrate (I). The following buffers (50 mM) were used:
admixture, the eluate was applied onto a column with Na acetate, pH 4.4ꢀ5.5; bis(trisꢀ(hydroxymethyl)ꢀmethylꢀ
benzamidineꢀSepharose from GE Healthcare (Sweden) amino)propaneꢀHCl from BIOMOL (Germany), pH 5.5ꢀ
equilibrated with buffer A containing 1 M NaCl. The carꢀ 9.5; TrisꢀHCl from DiaM (Russia), pH 7.0ꢀ7.9; and
boxypeptidase remained in the nonꢀabsorbed fraction. 30 mM universal buffer (boric and citric acids, KH2PO4,
This fraction was dialyzed overnight against 5 mM Trisꢀ diethylbarbituric acid from Reanal (Hungary)), pH 4.5ꢀ
HCl, pH 7.0, containing 5 mM CaCl2 (buffer B). The 9.2. All buffers contained 1 mM CaCl2. Enzyme (20 µl, in
dialyzate was applied onto a HiTrap SP column (GE case of universal buffer – 50 µl) was added to 180 µl (in
Healthcare) equilibrated with buffer B. The protein was case of universal buffer – 150 µl) of buffer with the correꢀ
eluted with a gradient of NaCl concentration (0ꢀ1 M) in sponding pH value. Then 200 µl of substrate solution
buffer B. Fraction with enzymatic activity was applied (0.5 mg/ml) was added to this mixture. The reaction was
onto a column with ArgꢀSepharose (GE Healthcare) run for 10 min at 37°C.
equilibrated with 50 mM TrisꢀHCl, pH 7.0, containing
Determination of CPSb temperature optimum.
100 mM NaCl and 1 mM CaCl2. The enzyme was eluted Substrate (I) (200 µl, 0.5 mg/ml) was added to 190 µl of
with the same buffer with salt concentration increased to buffer C. The mixture was heated for 2 min in water bath
0.5 M. All procedures were performed at 4°C.
to the specified temperature. Then 10 µl of enzyme was
Estimation of carboxypeptidase activity. Carboxyꢀ added, and the reaction was run for 10 min at the same
peptidase activity of various fractions obtained in the temperature.
course of enzyme isolation was estimated by hydrolysis of
Study of thermal stability of CPSb. Enzyme (100 µl)
DnpꢀAlaꢀAlaꢀArg (synthesized in our laboratory accordꢀ was added to 150 µl of buffer C and incubated at 37 or
ing to [25], hereafter called substrate (I)). Protein soluꢀ 50°C. Aliquots (50 µl) of this mixture were taken after 15,
tion (1ꢀ20 µl) was added to 180ꢀ200 µl of 50 mM Trisꢀ 30, 45, 60, and 120 min and added to a mixture of buffer
HCl, pH 7.6, containing 1 mM CaCl2 (buffer C). (150 µl) and substrate (I) (200 µl) preincubated for 2 min
Substrate solution (200 µl) at concentration 0.5 mg/ml at 37°C. The reaction was run for 10 min (for study of
was added to this mixture. The reaction time and temperꢀ thermal stability at 37°C) or 15 min (for study of thermal
ature were 5ꢀ20 min and 37°C. The reaction was stopped stability at 55°C) at 37°C. In both cases, in order to obtain
by addition of 50% acetic acid (40 µl). A column with SPꢀ the “zero point”, 20 µl of enzyme solution was added to a
Sephadex Cꢀ25 equilibrated with 1 M acetic acid was mixture of buffer (180 µl) and substrate (200 µl) heated
BIOCHEMISTRY (Moscow) Vol. 75 No. 8 2010

1034
SERKINA et al.
for 2 min at 37°C. The reaction was run as described CPSb. Based on the resulting sequence, bik3b (cctgcagcꢀ
above. The residual activity is expressed as percentage of cccacttgtagttccagttgcggtt) and bik5b (gaattcGGCGꢀ
activity at the “zero point”.
GCTTCTACCCGCCCGACGAGGT) primers were
Effect of inhibitors on CPSb activity. An aliquot of synthesized; their elongation results in replication of
the enzyme (20 µl) was added to 180 µl of buffer C conꢀ flanking DNA sequences outside the fragment. Genome
taining one of the inhibitors, and the mixture was incuꢀ DNA of S. bikiniensis VKPM Acꢀ1783 was subjected to
bated for 60 min at room temperature. Then 200 µl of incomplete restriction by TaqI restrictase according to the
substrate (I) at concentration 0.5 mg/ml was added, and producer’s protocol (Fermentas, Lithuania). The prodꢀ
the resulting solution was incubated for 10 min at 37°C. ucts of restriction were converted into circular form by
In each case enzyme activity was expressed as percent of ligation at low concentrations (0.005 mg/ml) using DNA
that in the absence of the inhibitor. All inhibitors used ligase from Fermentas in a standard buffer for DNA ligase
were from Sigma.
using the producer’s conditions (Fermentas). The prodꢀ
Determination of catalytic characteristics of hydrolyꢀ ucts of subsequent PCR amplification of circular ligation
sis of peptide substrates. The following Nꢀsubstituted products (inverted PCR) were sequenced; this allowed us
peptide substrates synthesized in our laboratory were to determine the sequence of the DNA fragment correꢀ
used: DnpꢀAlaꢀAlaꢀArg (I), ZꢀAlaꢀAlaꢀArg (II), ZꢀAlaꢀ sponding to mature CPSb.
AlaꢀLeu (III), and ZꢀAlaꢀAlaꢀGlu (IV). If substrate (I)
We searched for protein sequences orthologous to
was hydrolyzed, 10 µl of 6.81·10−8 M enzyme was added to that experimentally established using “BLAST search for
400 µl of buffer C containing substrate at various concenꢀ short, nearly extract matches” software and NCBI
trations (from 0.052 to 5.2 mM). Reactions were run for GenBank. BLASTN and BLASTP softwares were used
5ꢀ30 min at 37°C. The amount of product was determined for alignment nucleotide and amino acid sequences.
as described earlier. If substrates (II)ꢀ(IV) were
hydrolyzed, 2.8 ml of buffer C containing substrate at varꢀ
ious concentrations (0.025ꢀ0.4 mM for (II) and (III) and
0.2ꢀ4 mM for (IV)) were placed in a thermostable (37°C)
cuvette of a Shimadzu UVꢀmini 1240 spectrophotometer
RESULTS AND DISCUSSION
Isolation of carboxypeptidase from S. bikiniensis 27
(Japan). After 5 min, 200 µl of enzyme solution at conꢀ strain (VKPM Acꢀ1783). The data on isolation of the
centration 2.7·10−8 M (1.7·10−7 M for substrate (IV)) was enzyme from culture liquid obtained on S. bikiniensis
added. Product concentration was determined via growth are presented in Table 1. The specific activity of
decrease in optical absorption at 225 nm using ε225
=
CPSb increased 180ꢀfold in the course of the isolation
376 M−1⋅cm−1. The reaction rates were measured thrice (since it was impossible to determine protein in the initial
for 4ꢀ7 concentrations in the given range. Results were centrifugate accurately, the specific activity of the precipꢀ
processed by nonlinear regression using Origin software itate obtained with (NH4)2SO4 was used for comparison).
(Origin Lab Corporation, USA).
The yield of the enzyme was 3.2% of its initial content in
Cloning of the CPSb gene. Using bik6a (gggatccgtcaꢀ the culture liquid.
ggtgcagtactgcgcttccttgccga) and bik7a (gaattCACCAGꢀ
Purity of the preparation was checked by SDSꢀ
CACGCCCGCGAGCACCTGAC) with genome DNA PAGE (Fig. 1). There is only one protein band with
of S. bikiniensis 27 strain (VKPM Acꢀ1783), we amplified molecular mass 36 kDa. The presence of only one protein
a DNA fragment inside the site corresponding to mature peak was shown also by HPLC of the CPSb preparation
Table 1. Isolation of carboxypeptidase produced by S. bikiniensis 27 strain (VKPM Acꢀ1783)
Isolation stage
Volume, ml
Protein, mg/ml
Specific activity,
U/mg
Activity yield, %
Centrifugate of culture liquid
Dissolved precipitate after (NH4)2SO4
BacitracinꢀSilochrom
BenzamidineꢀSepharose
HiTrap SP
600
57
100
78.6
64.0
46.3
14.2
3.2
0.57
0.12
0.73
2.67
2.3
60
120
15.5
7.5
0.047
0.039
0.001
7.05
129
DꢀArgꢀSepharose
BIOCHEMISTRY (Moscow) Vol. 75 No. 8 2010

CARBOXYPEPTIDASE FROM Streptomyces bikiniensis
1035
from S. avermitilis and S. griseus, in the Primary
Structure Bank. However, comparison of the corresponꢀ
ding genes showed that the degree of identity of two
DNA sequences in the conservative region of mature
enzyme is 82%, but it is significantly lower in other
regions – only 50%. That is why we chose a twoꢀstage
strategy for cloning the CPSb gene. First, we obtained
fragments of conservative regions of this gene by amplifiꢀ
cation. Based on these fragments, we planned specific
primers allowing cloning of flanking gene sequences
according to the inverted PCR strategy (see “Materials
and Methods”).
It was finally demonstrated that the gene fragment
encoding mature CPSb contains 990 nucleotide pairs
(np) (GenBank GU3620077). Comparison of nucleotide
sequence with analogous regions of orthologous genes
from the genomes of S. griseus and S. avermitilis gives 81
and 87% identity, respectively. The primary structure of
CPSb is presented in Fig. 2. It contains 329 amino acid
residues (a.a.), and its molecular mass is 37,006.7 Da.
Comparison of the protein sequence with that of
orthologs gives 79% identity for the enzyme from S.
griseus (YP_001824303) and 85% identity for the carꢀ
boxypeptidase from S. avermitilis (NP_824442). These
values are close to the degree of identity of the latter two
enzymes (75%) and are significantly higher than the
degree of identity between CPSb and carboxypeptidases
CPT (CAA40219), CPA (CAA83955), and CPB
(ACA96505): 61, 29, and 31%, respectively.
Amino acid residues composing the active site of the
S. griseus enzyme are also present in corresponding places
in the CPSb sequence. First of all, these are Glu400
(Glu278 in CPSb sequence, nucleophile) and Tyr378
(Tyr256, proton donor) residues and His327 (His205),
Glu195 (Glu73), and His192 (His70) residues binding a
zinc ion.
So, CPSb is a new enzyme close but not identical to
two known carboxypeptidases from Streptomyces species.
Determination of pH optimum of CPSb activity. The
data presented in Fig. 3 indicate that CPSb is active in the
pH range 6.0ꢀ9.5 with maximal activity at pH 7.0ꢀ7.6
(depending on buffer content). This is close to the value
1
2
kDa
66
45
36
29
24
20
Fig. 1. Electrophoregram of purified CPSb (0.2 µg). Lanes: 1)
CPSb; 2) molecular mass markers.
on a Vydac C4 column; its molecular mass determined by
mass spectroscopy was 36.699 kDa.
NꢀTerminal sequence of CPSb. The Nꢀterminal
amino acid sequence of CPSb (AspꢀPheꢀProꢀSerꢀAlaꢀ
AspꢀSerꢀArgꢀTyrꢀHisꢀAsnꢀTyrꢀAlaꢀGluꢀThr) appeared
to be essentially similar to the primary structure of carꢀ
boxypeptidases from S. griseus and Streptomyces avermiꢀ
tilis MAꢀ4680 in the sites between residues 124 and 138.
Residue 124 begins the sequence of the mature enzyme in
the mentioned proteins. This indicates that processing of
CPSb and carboxypeptidases of other actinomyces occurs
at the same site.
Characteristics of primary structure of CPSb estabꢀ
lished from nucleotide sequence of the corresponding
gene. Based on the Nꢀterminal sequence of CPSb, we
identified orthologs of this protein, carboxypeptidases
Fig. 2. Amino acid sequence of mature carboxypeptidase from S. bikiniensis 27 strain (VKPM Acꢀ1783) determined from the nucleotide
sequence of its gene.
BIOCHEMISTRY (Moscow) Vol. 75 No. 8 2010

1036
SERKINA et al.
that the carboxypeptidase from S. bikiniensis is a metalꢀ
0.8
loenzyme. Iodoacetamide significantly suppresses the
carboxypeptidase activity, and this indicates the presence
of a sulfhydryl group that affects CPSb activity. But pꢀ
chloromercuribenzoate, also a sulfhydryl group agent,
does not inhibit CPSb. This is possibly due to steric hinꢀ
drance, but the contradictory data prevent a firm concluꢀ
sion that CPSb is an SHꢀdependent enzyme. Of bivalent
ions of heavy metals, only Cu2+ and Hg2+ inhibit CPSb,
whereas Mn2+, Mg2+, and Co2+ have practically no effect
on its activity. According to its sensitivity to the studied
inhibitors, CPSb is much like CPSG [20, 21].
Catalytic properties of CPSb. Experiments with subꢀ
strates (I) and (II) demonstrate that CPSb efficiently
cleaves basic amino acid residue (Arg) from the Cꢀend of
Nꢀsubstituted synthetic peptides. Values of Km, kcat, and
kcat/Km are 0.16 mM, 48.8 sec−1, and 3.05·105 M−1·sec−1
for substrate (I) and 0.05 mM, 52.9 sec−1, and 10.6·105 M−1·
sec−1 for substrate (II), respectively (Table 3). As for effiꢀ
ciency of substrate (I) hydrolysis, CPSb is almost equal to
mammalian CPB (kcat/Km = 5·105 M−1·sec−1) and signifiꢀ
cantly more efficient than CPT (kcat/Km = 3.3·103 M−1·
sec−1) (Table 3). CPSb more efficiently hydrolyzes subꢀ
strate (II) than substrate (I); this indicates that the nature
of protective group of the substrate influences hydroꢀ
lysis.
1
2
0.6
0.4
0.2
0
3
4
4
6
8
10
рН
Fig. 3. CPSb activity versus pH. Activity was estimated in the folꢀ
lowing buffers: 1) 1,3ꢀbis(trisꢀ(hydroxymethyl)ꢀmethylꢀamino)proꢀ
paneꢀHCl; 2) TrisꢀHCl; 3) universal buffer system; 4) Naꢀacetate.
0.7
0.5
0.3
0.1
0
20
40
60
80
Temperature, °C
CPSb cleaves hydrophobic amino acid residue (Leu)
from the Cꢀend of peptides with the same efficiency. For
hydrolysis of substrate (III), Km, kcat, and kcat/Km values
are 0.03 mM, 57.2 sec−1, and 19.1·105 M−1·sec−1, respecꢀ
tively (Table 3). The value of kcat/Km for CPSb is compaꢀ
Fig. 4. Temperature dependence of CPSb activity.
obtained for CPSG (7.3ꢀ8.2 depending on substrate) [20ꢀ rable with that for CPA (29·105 M−1·sec−1) and larger than
22].
that for CPT (2.2·105 M−1·sec−1).
Enzyme activity varies depending on the buffer.
Finally, CPSb cleaves acidic amino acid residue
Although in experiments with universal buffer 2.5ꢀfold (Glu) from the Cꢀend of Nꢀsubstituted peptide. For
more enzyme was used than with the other buffers, A360 hydrolysis of substrate (IV), Km, kcat, and kcat/Km values
values in the pH range 6.0ꢀ8.5 were significantly lower
(Fig. 3). Polyvalent anions present in universal buffer
seem to inhibit CPSb, e.g. due to binding of Ca2+.
120
However, buffer content negligibly influences the pH
100
80
optimum.
Temperature optimum and thermal stability of CPSb.
As shown in Fig. 4, CPSb is active in the temperature
range 30ꢀ70°C with the optimum at 55°C. This is a differꢀ
ence between CPSb and CPSG, whose activity increases
up to 70°C [22]. CPSb is rapidly inactivated at 55°C.
Residual activity after incubation for 15 and 45 min is
22.4 and 5.3%, respectively (Fig. 5). However, the
enzyme is relatively stable at 37°C (Fig. 5), the residual
activity after incubation for 120 min being 80%.
Inhibitor analysis of CPSb. The data presented in
Table 2 indicate that phenylmethylsulfonyl fluoride, an
inhibitor of serine proteinases, does not inactivate CPSb.
However, chelators of metal ions inhibit the enzyme
activity: orthoꢀphenanthroline – completely, and EDTA
and EGTA – significantly. It follows from these results
60
37°C
55°C
40
20
0
50
Time, min
100
150
Fig. 5. Thermal stability of CPSb.
BIOCHEMISTRY (Moscow) Vol. 75 No. 8 2010

CARBOXYPEPTIDASE FROM Streptomyces bikiniensis
1037
ble with that of CPT, and the degree of this cleavage indiꢀ
cates that CPSb specificity covers also cleavage of acidic
Cꢀterminal amino acid residues.
Table 2. Effect of inhibitors on CPSb activity
Inhibitor
Concentration,
mM
Residual
activity, %
It is difficult to compare catalytic properties of CPSb
and carboxypeptidase from Sulfolobus solfataricus because
their substrates are different. However, for hydrolysis of
ZꢀGlyꢀGlyꢀPhe, kcat/Km value of the enzyme from the
archaean is one order of magnitude lower than that of
CPA [23]. Moreover, this enzyme cleaves aliphatic amino
acid residues significantly less efficiently than aromatic
ones.
Carboxypeptidase from T. vulgaris (CPT) and CPSb
cleave acidic amino acid residues with approximately
equal efficiency (Table 3). However, in contrast to CPSb,
CPT cleaves basic amino acid residues two orders of magꢀ
nitude slower than hydrophobic ones [27]. Besides this,
absolute efficiency of hydrolysis of DnpꢀAlaꢀAlaꢀArg and
ZꢀAlaꢀAlaꢀLeu by CPT is significantly lower than that by
CPSb and pancreatic enzymes.
CPSb is very similar to CPSG in substrate specificiꢀ
ty. When the latter hydrolyzes such substrates as ZꢀGluꢀ
Leu, BzꢀGlyꢀArg, and BzꢀGlyꢀLys, kcat/Km values are 41,
7.5, and 82.6 M−1·sec−1, respectively [22]. The rates of
hydrolysis of hippurylꢀArg and hippurylꢀPhe by this
enzyme are similar [20]. Unfortunately, we failed to find
any data on the ability of this enzyme to cleave acidic
Phenylmethylsulfonyl
fluoride
5
95
orthoꢀPhenanthroline
EDTA
2.5
10
10
1
3.9
55.2
24
EGTA
Iodoacetamide
pꢀChloromercuribenzoate
Hg(CH3COO)2
Сu(CH3COO)2
CoCl2
3.9
83
1
5
5
9.3
11.5
93.7
91.7
86.6
2
MnCl2
2
MgCl2
20
are 7.6·10−4 M, 5.3 sec−1, and 6.97·103 M−1·sec−1, respecꢀ amino acid residues from peptides.
tively (Table 3). Cleavage of this peptide is two orders of
magnitude less efficient than that of substrates (I)ꢀ(III).
In conclusion, we isolated and characterized an
However, cleavage of substrate (IV) by CPSb is comparaꢀ extracellular metallocarboxypeptidase produced by S.
Table 3. Kinetic parameters of carboxypeptidases from various sources (data on CPA [19], CPB [19], and CPT [27]
are taken from the literature)
Substrate
Kinetic parameter
CPA
CPB
CPT
CPSb
DnpꢀAlaꢀAlaꢀArg (I)
Km, mM
kcat, sec−1
0.07
35
4.4
14.6
0.16
48.8
kcat/Km, M−1·sec−1
5⋅105
3.3⋅103
3.05⋅105
ZꢀAlaꢀAlaꢀArg (II)
ZꢀAlaꢀAlaꢀLeu (III)
ZꢀAlaꢀAlaꢀGlu (IV)
Km, mM
kcat, sec−1
kcat/Km, M−1·sec−1
0.05
52.9
10.6⋅105
Km, mM
kcat, sec−1
kcat/Km, M−1·sec−1
0.012
35
29⋅105
0.046
10.3
2.2⋅105
0.03
57.2
19.1⋅105
Km, mM
kcat, sec−1
0
0.76
5.3
kcat/Km, M−1·sec−1
6.1⋅103
6.97⋅103
BIOCHEMISTRY (Moscow) Vol. 75 No. 8 2010

1038
SERKINA et al.
12. Wei, S., Segura, S., Vendrell, J., Aviles, F. X., Lanoue, E.,
Day, R., Feng, Y., and Fricker, L. D. (2002) J. Biol. Chem.,
277, 14954ꢀ14964.
13. Hendriks, D., Scharpe, S., and van Sande, M. (1988) J.
Clin. Chem. Clin. Biochem., 26, 305.
14. Skidgel, R. A., and Erdos, S. G. (2002) in Handbook of
Proteolytic Enzymes, 2nd Edn. (Barret, A. J., Rawlings,
N. D., and Woessner, J. F., eds.) Academic Press, pp. 837ꢀ
840.
15. Ichishima, E. (1972) Biochim. Biophys. Acta, 258, 274ꢀ288.
16. Ichishima, E., Sonoki, S., Hirai, K., Torii, Y., and
Yokoyama, S. (1972) J. Biochem., 72, 1045ꢀ1048.
17. Ichishima, E., and Arai, T. (1973) Biochim. Biophys. Acta,
293, 444ꢀ450.
bikiniensis 27 (VKPM Acꢀ1783) strain. This enzyme
hydrolyzes substrates of pancreatic carboxypeptidases
(CPA and CPB) with high efficiency and possesses wide
substrate specificity, cleaving not only hydrophobic and
positively charged amino acid residues but also Glu. By
this criterion CPSb differs from other known carboxypepꢀ
tidases including CPT and CPSG. This property and also
thermal stability and the character of pH dependence of
the enzyme activity recommend CPSb for use in substituꢀ
tion therapy.
REFERENCES
18. Smulevitch, S. V., Osterman, A. L., Galperina, O. V.,
Matz, M. V., Zagnitko, O. P., Kadyrov, R. M., Tsaplina, I.
A., Grishin, N. V., Chestukhina, G. G., and Stepanov, V.
M. (1991) FEBS Lett., 291, 75ꢀ78.
1. Auld, D. S. (2002) in Handbook of Proteolytic Enzymes, 2nd
Edn. (Barret, A. J., Rawlings, N. D., and Woessner, J. F.,
eds.) Academic Press, pp. 812ꢀ821.
2. Aviles, F. X., and Vendrell, J. (1997) in Handbook of
Proteolytic Enzymes (Barret, A. J., Rawlings, N. D., and
Woessner, J. F., eds.) Academic Press, pp. 1333ꢀ1335.
3. Ambler, R. P. (1967) Meth. Ezymol., 11, 155.
4. Bayes, A., Sonnenschein, A., Daura, X., Vendrell, J., and
Aviles, F. X. (2003) Eur. J. Biochem., 270, 3026ꢀ3035.
5. Bown, D. P., and Gatehouse, J. A. (2004) Eur. J. Biochem.,
271, 2000ꢀ2011.
6. McCullough, J. L., Chabner, B. A., and Bertino, J. R.
(1971) J. Biol. Chem., 246, 7207ꢀ7213.
7. Sherwood, R. F., Melton, R. G., Alwan, S. M., and
Hughes, P. (1985) Eur. J. Biochem., 148, 447ꢀ453.
8. Yasuda, N., Kaneko, M., and Kimura, Y. (1992) Biosci.
Biotechnol. Biochem., 56, 1536ꢀ1540.
19. Trachuk, L. A., Bushueva, A. M., Shevelev, A. B.,
Novgorodova, S. A., Akparov, V. H., and Chestukhina, G.
G. (2002) Vopr. Med. Khim., 48, 577ꢀ585.
20. Tsyperovich, A. S., Pilyavskaya, A. S., Lysenkov, N. V., and
Kastrikina, T. F. (1976) Biokhimiya, 41, 328ꢀ334.
21. Seber, J. F., Toomey, T. P., Powell, J. T., Brew, K., and
Awad, W. M., Jr. (1976) J. Biol. Chem., 251, 204ꢀ208.
22. Narahashi, Y., and Yoda, K. (1979) J. Biochem., 86, 683ꢀ
694.
23. Colombo, S., D’Auria, S., Fusi, P., Zecca, L., Raia, C. A.,
and Tortora, P. (1992) Eur. J. Biochem., 206, 349ꢀ357.
24. Chestukhina, G. G., Zagnit’ko, O. P., Revina, L. P.,
Klepikova, F. S., and Stepanov, V. M. (1985) Biokhimiya,
50, 1724ꢀ1732.
9. Rudmann, M. A. (1994) Kreon. Pancreatic Enzymes for
Replacement Therapy, Hannover.
25. Stepanov, V. M., and Rudenskaya, G. N. (1979) Author’s
Certificate No. 644796.04.03.977, Byul. Izobret., No. 4
(1979).
26. Laemmli, U. K. (1970) Nature, 227, 680ꢀ685.
27. Akparov, V. H., Grishin, A. M., Yusupova, M. P., Ivanova,
N. M., and Chestukhina, G. G. (2007) Biochemistry
(Moscow), 72, 416ꢀ423.
10. British Pharmacopoeia (2007), Vols. 1ꢀ11, Monographs:
Medicinal and Pharmaceutical Substances. Pancreatin.
11. Springman, E. B. (2002) in Handbook of Proteolytic
Enzymes, 2nd Edn. (Barret, A. J., Rawlings, N. D., and
Woessner, J. F., eds.) Academic Press, pp. 828ꢀ830.
BIOCHEMISTRY (Moscow) Vol. 75 No. 8 2010