Microtubule inhibitors containing immunostimulatory agents promote cancer immunochemotherapy by inhibiting tubulin polymerization and tryptophan-2,3-dioxygenase

Article abstract of DOI:10.1016/j.ejmech.2019.111949

A combination therapeutic regimen via introducing tryptophan 2,3-dioxygenase inhibitors into microtubule inhibitors was performed and evaluated for their antitumor activity. Thereinto, HT2, composed of combretastatin A-4 (CA-4) and tryptophan-2,3-dioxygenase (TDO) inhibitor by a linker, displayed the most potent activity with 10-fold higher than its parent CA-4 against HepG2, A549 and HCT-116 cancer cell lines. Mechanism studies suggested that HT2 inhibited tubulin polymerization and cell migration, caused G2 phase arrest, induced apoptosis by mitochondrial mediated apoptotic pathway, concurrent depolarized the mitochondria membrane potentials and caused reactive oxygen species (ROS) production in HepG2 cells. Moreover, HT2 could enhance T-cell immune responses in vitro by releasing a TDO inhibitor to suppress TDO expression and blockade kynurenine production. As expected, HT2 could remarkably promote the antitumor activity of CA-4 in either immunocompetent H22 or immunodeficient A549 tumor xenograft models without observable toxic effects. More importantly, HT2 increased the level of splenic and tumor-infiltrated T cells and in turn effectively boosted the inhibition effect in H22 xenografted tumor growth. Collectively, this immunochemotherapeutic strategy can be applied to promote chemotherapeutic effect.

Full text of DOI:10.1016/j.ejmech.2019.111949

Journal Pre-proof
Microtubule inhibitors containing immunostimulatory agents promote cancer
immunochemotherapy by inhibiting tubulin polymerization and tryptophan-2,3-
dioxygenase
Shixian Hua, Feihong Chen, Shaohua Gou
PII:
S0223-5234(19)31101-8
DOI:
https://doi.org/10.1016/j.ejmech.2019.111949
EJMECH 111949
Reference:
To appear in: European Journal of Medicinal Chemistry
Received Date: 16 October 2019
Revised Date: 2 December 2019
Accepted Date: 2 December 2019
Please cite this article as: S. Hua, F. Chen, S. Gou, Microtubule inhibitors containing immunostimulatory
agents promote cancer immunochemotherapy by inhibiting tubulin polymerization and tryptophan-2,3-
dioxygenase, European Journal of Medicinal Chemistry (2020), doi: https://doi.org/10.1016/
j.ejmech.2019.111949.
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition
of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of
record. This version will undergo additional copyediting, typesetting and review before it is published
in its final form, but we are providing this version to give early visibility of the article. Please note that,
during the production process, errors may be discovered which could affect the content, and all legal
disclaimers that apply to the journal pertain.
© 2019 Published by Elsevier Masson SAS.

Graphical abstract
Microtubule inhibitors containing immunostimulatory agents promote
cancer immunochemotherapy by inhibiting tubulin polymerization and
tryptophan-2,3-dioxygenase
Shixian Hua a, b, Feihong Chen a, b, Shaohua Gou a, b,
*
An immunochemical strategy consisting of both TDO and microtubule inhibitors, which could
hydrolyze to release a tubulin inhibitor CA-4 to inhibit tubulin polymerization and induce cancer
cell death, concurrently release a TDO inhibitor to block TDO protein expression to promote T-cell
proliferation and enhance cancer cells apoptosis. In vivo study indicated HT2 could remarkably
promote the antitumor activity of CA-4 in either immunocompetent H22 or immunodeficient A549
tumor xenograft models. Moreover, HT2 could increase the level of T cells and in turn effectively
boosted the inhibition effect in H22 xenografted tumor growth.
1

Microtubule inhibitors containing immunostimulatory agents
promote cancer immunochemotherapy by inhibiting tubulin
polymerization and tryptophan-2,3-dioxygenase
Shixian Hua,a,b Feihong Chen,a,b Shaohua Gou,a,b,*
a
Pharmaceutical Research Center and School of Chemistry and Chemical
Engineering
b
Jiangsu Province Hi-Tech Key Laboratory for Biomedical Research, Southeast
University, Nanjing 211189, China.
ABSTRCT: A combination therapeutic regimen via introducing tryptophan
2,3-dioxygenase inhibitors into microtubule inhibitors was performed and evaluated
for their antitumor activity. Thereinto, HT2, composed of combretastatin A-4 (CA-4)
and tryptophan-2,3-dioxygenase (TDO) inhibitor by a linker, displayed the most
potent activity with 10-fold higher than its parent CA-4 against HepG2, A549 and
HCT-116 cancer cell lines. Mechanism studies suggested that HT2 inhibited tubulin
polymerization and cell migration, caused G2 phase arrest, induced apoptosis by
mitochondrial mediated apoptotic pathway, concurrent depolarized the mitochondria
membrane potentials and caused reactive oxygen species (ROS) production in HepG2
cells. Moreover, HT2 could enhance T-cell immune responses in vitro by releasing a
TDO inhibitor to suppress TDO expression and blockade kynurenine production. As
expected, HT2 could remarkably promote the antitumor activity of CA-4 in either
immunocompetent H22 or immunodeficient A549 tumor xenograft models without
observable toxic effects. More importantly, HT2 increased the level of splenic and
tumor-infiltrated T cells and in turn effectively boosted the inhibition effect in
H22 xenografted tumor growth. Collectively, this immunochemotherapeutic strategy
can be applied to promote chemotherapeutic effect.
* Corresponding author. Jiangsu Province Hi-Tech Key Laboratory for Biomedical
Research, Southeast University, Nanjing 211189, China
E-mail address: sgou@seu.edu.cn (S. Gou).

Keywords: combretastatin-A4, tryptophan-2,3-dioxygenase, immunomodulator,
anticancer, immunochemotherapy
1. Introduction
Microtubules are filamentous cytoskeleton protein polymers consisting of α- and
β-tubulin dimers, which play an important role in a wide range of cellular processes
including cell shape organization, intracellular transport, cell division, cell signaling,
and mitosis [1,2]. As microtubules carry out the physiologic function by equilibrium
between the polymerization and depolymerization of α, β-tubulin heterodimers, they
have become an attractive and promising molecular target in cancer therapy [3,4]. So
far, microtubule targeting agents (MTAs) are classified into two groups, one is a kind
of microtubule-stabilizing drugs promoting microtubule polymerization, the other is a
kind of microtubule-destabilizing drugs inducing microtubule depolymerization. Both
of them can cause mitotic arrest and lead to cell apoptosis by promoting or
suppressing the polymerization of microtubule [4-7], and some of which are now
under clinical trials or have been applied in clinical for treating cancer. Among the
known MTAs, combretastatin-A4 (CA-4, Fig. 1), a natural cis-stilbene product
isolated from the bark of African willow tree named combretum caffrum, is one of the
most active tubulin-binding compounds that exhibit strong cytotoxicity against the
majority of human cancer cell lines [8-11]. As a microtubule-destabilizing drug, CA-4
displays extremely potent effects on inhibition of tubulin polymerization by strongly
binding to the colchicine site of β-tubulinand and causes rapid vascular disruption in
tumor microenvironment, resulting in the inhibition of tumor growth [9-11]. Notably,
its water-soluble prodrug of CA-4 phosphate (CA-4P) and serine amino acid analogue
(AVE8062) have been in clinical trials as a single drug and in combination with other
drugs [12,13]. Similarly, chalcone derivatives like compounds 14 and 14a containing
an α,β-unsaturated ketone moiety can also interact with the colchicine binding site of
tubulin and show remarkable antiproliferative activities [14]. However, some
drawbacks such as intrinsic resistance, toxicity and lack of efficacy have been found
with these agents in clinic [15,16].

Recently, immunotherapy has emerged as a highly effective and promising
strategy for cancer therapy, which exploits the host’s immune system to treat with
cancer [17]. Thereinto, of particular attractive is immune checkpoint therapy that can
modulate T cells activation and proliferation to enhance antitumor immune responses
by varying biological functions, protein expression levels, and signaling pathways in
tumor microenvironment [17b,18]. Tryptophan 2,3-dioxygenase (TDO) is one of
well-known immune checkpoint that induces tumor immune tolerance and promotes
cancer cell survival by involving in the immunosuppressive microenvironment
generation [19]. TDO is an immunoregulatory homotetrameric enzyme mainly
expressed in liver to regulate systemic tryptophan levels and in brain to regulate
neuroactive tryptophan metabolites production, which is usually induced by
kynurenine, tryptophan, and glucocorticoids [20-23]. In addition, several researches
revealed that TDO is also expressed in a variety of cancer cells including gliomas,
hepatocarcinoma, melanoma, breast, colorectal and lung cancers [21,24]. Similar to
indoleamine 2,3-dioxygenase (IDO), TDO catalyses the degradation of tryptophan
(Trp) to produce kynurenine along the kynurenine pathway causing tryptophan
shortage and accumulation of kynurenine, which leads to suppressing the activation
and proliferation of effector T cells but increasing regulatory T cells [25,26].
Therefore, the immunotherapy of targeting at TDO is also an attractive approach to
treat cancer by activating antitumor immunity [27]. So far, a few TDO inhibitors such
as 19 and 22 as well as their derivatives (Fig. 2) have been reported, which could
inhibit TDO protein expression and induce antitumor immune response [19-21].
Intriguingly, some studies also demonstrated that combination of IDO/TDO inhibitors
with chemotherapy could improve the effectiveness of cancer treatment [28,29].
We herein report a strategy to improve the therapeutic effect of MATs by
combining with immunotherapeutic TDO inhibitors that are introduced to microtubule
inhibitors directly or by linkers. The resulting compounds are expected to release
TDO and microtubule inhibitors at tumor acidic microenvironment, aiming at killing
cancer cells directly by inhibition of tubulin polymerization and stimulating and
enhancing immune response to promote cancer cells apoptosis by suppression of TDO

expression. By taking advantage of the potential synergism of immunotherapy and
chemotherapy, such a strategy is expected to provide a new approach for
drug development.
2. Results and discussion
2.1. Chemistry
Compounds HT1-HT8 were designed and synthesized according to the synthetic
routes described in Schemes S1-S3. 6 (CA-4) and chalcone analogue (14) were
synthesized by the procedures reported [30-31]. The TDO inhibitors and compound
23 were prepared in agreement with the known methods reported previously
[20-21,29]. Compounds 9 and 15 were obtained by treatment of compound 6 or 14
with 8 in the presence of EDCI and catalytic amount of DMAP in DMF. Interaction of
compound 9 or 15 with 3-butyn-1-ol produced compound 10 or 16 by
copper-catalyzed click reactions. The targeted compounds (Fig. 3) were divided into
two groups, those derived from CA-4 (6) were achieved by esterification between
compound 6 or 10 and 19 or 23 in the presence of EDCI/DMAP, the others derived
from chalcone derivative (14) were made by a similar reaction between compound 14
or 16 and 19 or 23. All the resulting compounds were characterized by 1H NMR, 13C
NMR spectra and high resolution mass (HR-MS) spectroscopy together with
microanalysis.
2.2. Biological evaluation.
2.2.1. In vitro cytotoxicity
The in vitro antiproliferative efficacy of HTI-HT8 were first assessed by MTT
assays against four different human cancer cell lines with TDO expression including
U87 (glioma), HCT-116 (colon), HepG2 (hepatoma) and A549 (lung) together with a
human non-tumoral liver cell line of LO2. CA-4 and compound 14 were used as the
reference compounds. As shown in Table 1, two TDO inhibitors (compounds 19 with
IC50 value from 21.03 to 25.45 µM and 22 with IC50 >50 µM) displayed moderate or
poor antiproliferative activity against the tested cancer cell lines, and they showed low

cytotoxicity toward non-tumoral LO2 cells. Whereas all the targeted compounds
exhibited potent antiproliferative activities (IC50 value from 0.036 to 4.11 µM) against
these four cancer cell lines. In the CA-4 group, HT1 and HT2 containing 19, showed
stronger cytotoxicity than HT3 and HT4 containing 22 against the tested cancer cells
and the non-tumoral cells. In the group of the chalcone derivative, HT5 and HT6
containing 19 also displayed stronger anticancer activities than HT7 and HT8
containing 22 against the tested cancer cells. These four compounds (HT5-HT8)
showed potent cytotoxicity comparable to their parent compound 14 (0.59-1.89 µM).
It is noted that no matter compounds in the CA-4 group or in the chalcone derivative
group are, those with a linker containing a triazole unit to connect a TDO inhibitor via
ester bonding exhibit better anticancer activity than their counterparts with a linker
without a triazole moiety except an individual case in HCT-116 cells incubated with
HT3. As for the TDO inhibitors used, compounds derived from 19 turned out to have
better cytotoxicity against all the tested cancer cells than those obtained from 23.
Notably, the former compounds in the CA-4 group were more toxic toward LO2 cells
than the latter ones, while the four compounds in the chalcone derivative group had
almost the same toxicity toward the non-tumoral liver cells.
Among our targeted compounds, HT2 displayed the most potent cytotoxicity
with IC50 values between 0.036 and 0.43 µM against four cancer cell lines, it was
about 10-fold stronger than its parent compound CA-4 toward HCT-116, HepG2 and
A549 cancer cells. As HT2 could release CA-4 and a TDO inhibitor of 19 at weakly
acidic environment (pH=5.0, Fig. S1), the superior cytotoxicity of HT2 was likely
owing to its better cellular uptake and/or the inhibition of tryptophan degradation [32].
In view of the strong cytotoxicity and selectivity index of HT2 in the cells with the
expression level of TDO protein, further mechanism research on HT2 was focused on
HepG2 cancer cells that exhibited the highest TDO expression among the tested
cancer cells [29].
2.2.2. Inhibition of tubulin assembly assay.
It is well known that the tubulin-microtubule system plays a major role in
maintaining cell shape and CA-4 can bind the colchicine site on β-tubulin to inhibit

tubulin assembly [1-2,8]. Thus, the capacity of HT2 to inhibit tubulin polymerization
in HepG2 cells was evaluated using immunofluorescence assay by staining DNA and
tubulin. As shown in Fig. 4, in the control group, the microtubule network from
HepG2 cells showed regular assembly and arrangement. In contrast, after incubation
with CA-4 for 24 h, the microtubules were disorderly dispersed in the cytoplasm,
indicating that cellular microtubules were depolymerized. Interestingly, cells
incubation with HT2 displayed strongly disrupted interphase microtubule compared
with CA-4 and control groups. Particularly, the irregularity of microtubule
organization was more obvious at 0.1 µM than at lower concentration of 0.05 µM.
These results indicated that HT2 could inhibit tubulin polymerization, which might
eventually result in cell apoptosis.
2.2.3. Effects on cell cycle distribution.
The cell cycle distribution of HepG2 cells was further analyzed by flow
cytometry after incubation with HT2. By the flow cytometry study, typical results
(Fig. 5) were obtained after cells co-cultured with the indicated compounds at 0.1 µM
for 24 h. In comparison with a normal cell cycle distribution in the control cells, after
incubation with CA-4, the accumulation of cells in the G1 phase of the cell cycle
decreased from 60.73% to 7.73%, however, the percentage of G2 phase increased
from 16.23% to 56.34%. Analogously, HepG2 cells incubated with HT2 (0.1 µM)
exhibited a significant accumulation of cells in G2 phase form 16.23% to 68.53%, and
the percentage of G1 phase decreased from 60.73% to 15.66%. These results
demonstrated that HT2 arrested the HepG2 cells cycle mainly at the G2 phase.
2.2.4. Induced apoptosis assay.
In order to characterize the mode of cell death induced by the targeted
compounds, a biparametric cytofluorimetric analysis was performed by using
propidium iodide (PI) and fluorescent immunolabeling of the protein annexin-V.
HepG2 cells were incubated with the tested compounds at 0.1 µM for 24 h, the
percentages of apoptotic cells were assessed by flow cytometry. As shown in Fig. 6,
the percentage of cell apoptosis was 43.6% after incubation with CA-4, while that
was 4.0% in the group as the control. After incubation with HT2, the percentage of

apoptosis cells increased to 54%, which was much higher than that of CA-4,
comparable to the fact that the IC50 values of HT2 were higher than CA-4. These
results proved that HT2 could effectively cause cell apoptosis.
2.2.5. Apoptosis detection by AO/EB dual staining assay.
To gain more evidence of the cell death induced by HT2, we further analyzed its
apoptosis-inducing properties by fluorescence microscopy using acridine orange (AO)
and ethidium bromide (EB) staining to identify the live and apoptotic HepG2 cells.
CA-4 co-cultured cells were used as positive control, and group without incubation as
negative control. In this assay, AO can penetrate into the intact cell membrane of
viable cells and emit green fluorescence by binding to double-standard nucleic acid,
while EB can emit orange fluorescence by staining fragmented DNA of nuclear
membrane ruptured cells. As shown in Fig. 7, after 24 h incubation with HT2 and
CA-4, cells stained green fluorescence represented viable cells that were markedly
weakened in comparison with the without incubation cells. In contrast, the presence
and enhancement of the orange fluorescence denoted that the apoptosis cells increased,
demonstrating that HT2 caused cell apoptosis in a higher degree than CA-4. The cell
morphological changes and apoptotic body formation after incubation with HT2
further confirmed that the compound could induce efficient cell death in HepG2
cancer cells.
2.2.6. HT2 induces mitochondrial depolarization.
Accumulating evidences indicated that mitochondria play a key role in regulating
cellular functions, and the decreased mitochondrial membrane potential (MMP) is
involved in many pathological processes such as cell apoptosis [33-35]. In this study,
the MMP assay by using fluorescent probe JC-1 staining of mitochondria in HepG2
was undertaken to analyze whether HT2 could induce mitochondrial dysfunction. As
shown in Fig. 8, after incubation with the indicated compounds, the fluorescence
intensity was correspondingly increased in comparison with the control group
(5.96%), and notably, the induction percentage of HT2 (59.1%) was higher than that
of CA-4 (47.5%). Similar results were also obtained by fluorescent microscope (Fig.
8B), the decrease of red fluorescence and the increase of green-emitting

fluorescence demonstrated the disruption of the mitochondrial transmembrane
potential (∆ᴪm) by the tested compounds. These results illustrated that HT2 could
cause MMP collapse and mitochondrial dysfunction of HepG2 cells, leading to
HepG2 cancer cells apoptosis.
2.2.7. HT2 triggered ROS generation.
Increasing evidences have indicated that the increased levels of reactive oxygen
species (ROS) is often associated with altering cell function or inducing apoptosis,
and mitochondrial membrane depolarization is concerned with mitochondrial
production of ROS [33,36]. Thus, the intracellular ROS levels were evaluated using
the fluorescent probe 2′,7′-dichlorofluorescein diacetate (DCF-DA) by flow cytometry
after incubation with HT2 (0.1 µM) for 24 h, with CA-4 and without incubation
groups as control. As shown in Fig. 9, CA-4 induced significant amounts of
intracellular ROS (21.3%) generation in HepG2 cells in comparison with the control
(7.86%), while the effect of HT2 on the ROS generation was 2.5 times (53.2%)
higher than CA-4 (21.3%). These results were compatible to the dissipation of the
mitochondrial trans-membrane potential, revealing that HT2 induced apoptosis via
the mitochondrial pathway to cause oxidative imbalance.
2.2.8. Western blotting analysis on the expression of apoptosis-related proteins.
The mitochondria related apoptotic proteins of bcl-2-associated X protein (Bax),
B-cell lymphoma/leukemia 2 (Bcl-2), caspase-3, and poly ADP-ribose polymerase
(PARP) in HepG2 cells after incubated with HT2 were investigated by the western
bloting analysis. After co-incubation with HT2 for 24 h, the expression of
apoptosis-related proteins was observed. As illustrated in Fig. 10, the expression of
Bax protein was strongly upregulated, while that of Bcl-2 protein was robustly
suppressed in the presence of HT2 compared with the other compounds. In addition,
HT2 showed strongly effects on inducing the proteolytic cleavage of PARP and
up-regulating the expression level of caspase-3, which could lead to cell death at last.
This study further revealed that HT2 could kill HepG2 cells via a mitochondrial
mediated apoptotic pathway.
2.2.9. HT2 inhibited the migration of HepG2 cells.

Cell migration is very essential for embryogenesis, development of immune
response, wound healing, etc. Especially in tumor, cancer cell migration may lead to
invasion and metastasis, which is the most common cause of morbidity and mortality
in cancer patients [37,38]. Here, we also investigated the inhibitory effect of HT2 on
the cancer cell migration by using scratch wound healing assay, with CA-4 and
without incubation group as control. As shown in Fig. 11, after 12 h of scratching the
cell monolayer, HepG2 cells in the without incubation group filled in the most of the
wounded area, whereas those incubated with compounds HT2 and CA-4 markedly
inhibited migration of HepG2 cells compared to the without incubation group. These
results indicated that HT2 was much more powerful than CA-4 to inhibit the
migration of cancer cells.
2.2.10. Detection of TDO protein expression level in HepG2 cells.
It is known that TDO can catalyze tryptophan catabolism to produce kynurenine,
resulting in the suppression of antitumor immune response [26,39]. Therefore, the
TDO inhibitory potency of HT2 and the level of kynurenine in HepG2 cells were
investigated. Firstly, the expression level of TDO protein in HepG2 cells after
incubation with the tested compounds was evaluated by western blotting and
qRT-PCR analyses. As shown in Fig. 12A and 12B, no TDO inhibition was observed
when cells incubated with CA-4. In contrast, 19, HT2 and the mixture of 19/CA-4
could effectively inhibit the expression of TDO protein, particularly, the inhibitory
potency of HT2 was even stronger than 19 and the mixture. Furthermore, the result by
qRT-PCR analyses also showed that the mRNA expression level of TDO was
markedly decreased at a time-dependent manner (24, 48, 72 h) (Fig. 12C).
Subsequently, the kynurenine production level was detected by using HPLC after
HepG2 cells incubated with HT2. As shown in Fig. 13A, both 19 (5 µM) and HT2
(0.05 µM) showed remarkable inhibitory effect on the kynurenine production in
comparison to the control group. Intriguingly, the ability of HT2 to block kynurenine
production was much superior to that of 19. Summing up, our research confirmed that
HT2 could interrupt the kynurenine pathway by inhibiting TDO protein expression.
2.2.11. AHR inhibition assay.

The transcription factor aryl hydrocarbon receptor (AHR) is a cytosolic sensor
that can be activated by the xenobiotic ligands kynurenine to alter antitumor immune
responses and promote tumor-cell survival and motility [19,40]. The above
experiments illustrated that HT2 could not only inhibit TDO expression but decrease
the kynurenine production. Here, we wanted to ensure whether HT2 could deactivate
the downstream AHR of TDO pathway by quantitative (q) RT-PCR after incubation
HepG2 cells with the compound (0.05 µM) for 24 h. As shown in Fig. 13B, the
mRNA expression levels of AHR were effectively decreased by HT2 relative to the
control, especially in a time-dependent manner (after incubation for 24 h, 48 h, 72 h).
These data indicated that HT2 could inactivate the downstream of AHR by
interrupting the TDO–kynurenine–AHR signal pathway.
2.2.12. Evaluation on T-cell immune responses.
With the reduction of kynurenine production, more tryptophan can be provided
to T cells activation and proliferation and then reverse of tumoral immune resistance
[26]. Therefore, the mixed leukocyte reactions (MLRs) [28] were carried out to
measure the proliferation of T cells in vitro. In this experiment, human peripheral
blood mononuclear cells (PBMCs) from unrelated healthy donors were employed to
detect T cells proliferation by staining flow cytometric assay. PBMCs were stimulated
for T cells activation with phytohemagglutinin-M and stained with carboxyfluorescein
succinimidyl ester (CFSE, a cell-permeable fluorescent dye), and subsequently
co-cultured with adherent HepG2 cells. After incubation with the compounds, PBMCs
were harvested by centrifugation and stained with anti-CD3 or anti-CD4/8 (T-cell
surface marker), and analyzed T-cell proliferation by flow cytometry. As shown in Fig.
14A and B, the control group, HepG2 cells co-cultured with PBMCs without any
incubation, showed a low of T cells proliferation (5.2%). Significantly, HepG2/MLR
co-cultured with compound 19 displayed 28.64% of T cells proliferation, and the
percentage value was increased to 36.15% when incubation with a mixture of 19 and
CA-4, indicating that the capacity of the TDO inhibitor (19) in stimulating T cells
activity. Remarkably, the group of HT2, with 56.30% of T cells proliferation, showed
the most effective system than the other groups, indicating that the targeted compound

was effective in stimulating the proliferation of T cells. In addition, the activation of
CD4+ and CD8+ T cells was also evaluated by flow cytometry. As shown in Fig. 14C,
after co-cultured with HepG2/MLR, HT2 also showed the most potent effect among
all the groups in stimulating the activation of CD4+/8+T cells. Together with the
antitumor activity, all of these results demonstrated that HT2 could enhance immune
response by improving T-cell activation and proliferation.
2.2.13. In vivo inhibition of tumor growth in ICR mice.
To explore the antitumor immune response of HT2 in vivo, we used H22 (with
expressed TDO protein, no showed data) mouse liver tumor xenograft models for
further study. The model was established by subcutaneous inoculation of H22 cells
into ICR mice. All mice were randomly divided into four groups: (1) vehicle treated
group; (2) CA-4 treated group (30 mg/kg); (3) CA-4+19 treated group (CA-4 15.4
mg/kg + 19 14.6 mg/kg); (4) HT2 treated group (30 mg/kg). The mice were
intravenously injected upon the above-mentioned formulations per day for 21 days.
The body weight and tumor size of the mice were monitored and recorded every 2
days. As shown in Fig. 15 and S2A, all the groups except the control one exhibited
significant tumor growth inhibition. As expected, compound HT2 showed the
optimum inhibition effect on the tumor growth with a tumor inhibitory rate of 69.82%,
higher than those of the CA-4 group (58.67%) at the same dose and the CA-4/19
mixture group (61.26%) at the equivalent molar dose. Importantly, it was observed
that there was no obvious difference in body weight change among the sample groups.
In addition, H&E staining assay was also carried out to investigate the toxicity of
major organs by histological images. Significantly, there was negligible damage or
inflammation to the main organs including liver, lung, kidney, spleen, and heart (Fig.
16). In short, HT2 was a high-efficiency antitumor agent with low toxicity in vivo.
2.2.14. Assessment of T-cell response.
In order to investigate the underlying mechanism of antitumor activity promotion
of HT2 that can cause TDO blockade, immune cells from the tumor tissues and
spleen were collected and analyzed by the immunofluorescence and flow cytometry
after treatments with HT2 for 21 days. The tumor tissues were harvested for analysis

by immunohistochemical (IHC) staining assay after different treatments (Fig. 17). The
results confirmed that CA-4 treated group limited or even decreased T-cell infltration
in the tumor tissue compared to the control group. In contrast, both the mixture and
HT2 treated groups significantly enhanced the density of tumor-infiltrated
CD8+/CD4+ T cells. Interestingly, tumor tissues treated with HT2 that displayed the
most potent in vivo antitumor activity showed the highest T cells infltration compared
with other groups.
In addition, spleen, a crucial reservoir for lymphocytes, can recruit lymphocytes
to the tumor tissues and directly involve in antitumor immune response. Therefore we
studied the behavior of immune cells in the spleen. The results were illustrated in Fig.
18. H&E staining of spleens revealed that no distinguished pathological changes after
different treatments (Fig. 16), but a slight weight change was observed in comparison
with the control, especially in the CA-4 treated group (Fig. 18 A and 18B). Flow
cytometry analysis of splenocytes indicated that the group treated with either HT2 or
the mixture significantly increased the percentage of proliferative CD8+ and CD4+ T
cells in the spleens as compared with the control group (Fig. 18 C and 18D). Similar
to the therapeutic efficacy, HT2 treated group showed higher percentage of CD8+ and
CD4+ T cells than the mixture treated one. Collectively, these data indicated that HT2
could induce an effective T-cell-mediated immune response to improve chemotherapy.
2.2.15. In vivo antitumor activity of HT2 in BALB/c nude mice.
Finally, the antitumor effect of HT2 was further investigated in A549 tumor
xenograft BALB/c nude mice (immunodeficient mice). A549 tumor xenograft model
was established by subcutaneous injection of A549 cells into the right flank of mice.
As tumor volumes reached ~150 mm3, HT2 and CA-4 at the same dose of 30 mg/kg
were intravenously administered per day with normal saline as negative controls. The
tumor size and body weight of the mice were detected and recorded every 2 days.
After 29 days, none of the mice was died, and both HT2 and CA-4 groups
significantly decreased the tumor volume as compared to the negative control. As
shown in Fig. 19 and S2B, the inhibitory rate of HT2 treatment group (64.29%) was
higher than that of the CA-4 group (58.85%). Notably, no obvious body weight loss

of the animals was observed in all groups. In addition, the H&E staining assay further
indicated that the main organs (liver, lung, kidney, spleen, and heart) showed
negligible damage or inflammation (Fig. 20). In comparison with the antitumor
efficacy of HT2 in H22 tumor xenograft mice models (immunity of mice), the
reduction in tumor weight in A549 tumor xenograft models was weaker with an
inhibitory rate of 64.29%, further indicating that the antitumor immunity ability of
HT2 was effective to promote the tumor therapeutic efficacy.
3. Conclusions
In this study, an immunochemical strategy consisting of both TDO and
microtubule inhibitors was adopted to effectively promote the therapeutic effect of
microtubule targeting chemotherapy. All of the targeted compounds displayed
comparable or superior antiproliferative activity against all the tested human cancer
cell lines compared with that of the well known microtubule inhibitor CA-4, with low
cytotoxicity toward LO2 cells. Among them, the representative compound HT2
showed excellent cytotoxic activity, about 10-fold enhancement of cytotoxicity with
IC50 values ranging from 0.036 to 0.095 µM in comparison with CA-4 (0.39-0.93 µM)
against HepG2, A549 and HCT-116 cancer cells, which was proved to produce 19 and
CA-4 via hydrolyzation in the micro-acidic environment. In addition,
immunofluorescence analysis of intracellular microtubules indicated that HT2 could
effectively inhibit tubulin polymerization. Further biological assays demonstrated that
HT2 arrested HepG2 cancer cells at the G2 phase and induced cell apoptosis by
mitochondrial mediated apoptotic pathway. Moreover, HT2 could also depolarize the
mitochondria membrane potentials, cause ROS production and inhibit the migration
of HepG2 cells. Significantly as expected, HT2 was found to inhibit TDO protein
expression and decrease kynurenine production by releasing the TDO inhibitor 19,
leading to inactivation of AHR, which prompted T-cell activation and proliferation to
enhance the antitumor immunity. Furthermore, in vivo tests demonstrated that HT2
had potent antitumor effects on either imminocompetent H22 or imminodeficient
A549 tumor xenograft models with reducing tumor volume of 69.82% (21 days) and
64.29% (29 days), respectively, much more potent than those of its parent compound

CA-4. In particular, after treatment with HT2, the levels of splenic and
tumor-infiltrated T cells in ICR immunocompetent mice were increased, leading to the
antitumor immune response and the antitumor activity promotion, which contributed
to the superior antitumor activity on H22 mice.
Consequently, all of the results reveal that HT2 has a potential to be developed as
a potent immunomodulator agent for cancer treatment, and demonstrate that this
strategy is a feasible way to promote tumor therapeutic effect of chemotherapy.
4. Experimental section
4.1. Chemistry.
All the chemicals and reagents were commercially available at local chemical
agents. The solvents and reagents were analytically pure and used without further
purification unless noted specifically. TLC analysis was performed on 0.20 mm silica
gel plates GF-254, and column chromatography was carried out using silica gel
(200-300 mesh, Qingdao Haiyang Chemical, China). Mass spectroscopy was made on
an Agilent 6224 TOF LC/MS instrument. Elemental analyses of C, H, and N were
performed by a Vario MICRO CHNOS elemental analyzer (Elementary). The purity
of compound HT2 (>95%) were detected by HPLC with mobile phase of solvent
acetonitrile/water at the flow rate of 1.0 mL/min and peak detection at 254 nm of UV
wavelength, the results were given in Supporting Information (Fig. S1). 1H NMR and
13C NMR spectra were performed on a Bruker 600 MHz spectrometer (Bruker
Company, Germany) in CDCl3 or DMSO-d6, using TMS as an internal standard.
4.1.1. 2-Methoxy-5-[2-(3,4,5-trimethoxy-phenyl)-vinyl]-phenol (CA-4).
CA-4 was synthesized as a white solid according to the reported method
previously [30]. 1H NMR (600 MHz, CDCl3) δ 6.92 (d, J = 2.0 Hz, 1H), 6.80 (dd, J =
8.3, 1.9 Hz, 1H), 6.73 (d, J = 8.3 Hz, 1H), 6.53 (s, 2H), 6.47 (d, J = 12.2 Hz, 1H),
6.41 (d, J = 12.2 Hz, 1H), 5.52 (s, 1H), 3.87 (s, 3H), 3.84 (s, 3H), 3.70 (s, 6H).
4.1.2. 3-(3-Hydroxy-4-methoxy-phenyl)-1-(3,4,5-trimethoxy-phenyl)-propenone (14).
Compound 14, as a yellow solid, was prepared in agreement with a known
1
method [31]. H NMR (600 MHz, CDCl3) δ 7.75 (d, J = 15.5 Hz, 1H), 7.36 (d, J =

15.5 Hz, 1H), 7.31 (d, J = 2.1 Hz, 1H), 7.28 (s, 2H), 7.14 (dd, J = 8.3, 2.1 Hz, 1H),
6.89 (d, J = 8.3 Hz, 1H), 5.72 (s, 1H), 3.96 (s, 6H), 3.95 (s, 3H), 3.94 (s, 3H).
4.1.3. Synthesis of compounds 10 and 16.
Compound 8 (5.65 mmol) and EDCI (8.47 mmol) were dissolved in dried DMF
(10 mL), the resulting solution was stirred at room temperature. Then, CA-4 or 14
(5.65 mmol) and DMAP (2.82 mmol) were added into the solution. After the mixture
was stirred at room temperature for 24 h, it was poured into CH2Cl2 and extracted
twice with water. The crude product was dried and purified by column chromatograph
eluted with CH2Cl2:CH3OH (30:1 v/v). After removal of the solvents, the product was
collected to give compound 9 or 15. Next, 9 or 15 (2.10 mmol) was treated with
3-butyn-1-ol (2.52 mmol) in the mixture of ethanol/H2O (2:1, v:v) in the presence of
CuSO4.5H2O (0.42 mmol) and ascorbic acid (0.42 mmol), the resulting solution was
stirred at 45 °C for 4 h under N2, and then concentrated under vacuum, added into
water and extracted twice with CH2Cl2 (150 mL), dried over with anhydrous Na2SO4,
the crude product was purified by column chromatograph using CH2Cl2:CH3OH to
give 10 or 16.
3-[4-(2-Hydroxy-ethyl)-[1,2,3]triazol-1-ylmethyl]-benzoic
acid
2-methoxy-5-[2-(3,4,5-trimethoxy-phenyl)-vinyl]-phenyl ester (10), white solid with
85.8% yield. HR-MS (m/z) (ESI): calcd for C30H31N3O7 [M+H]+ = 546.22348; found:
546.23692.
3-[4-(2-Hydroxy-ethyl)-[1,2,3]triazol-1-ylmethyl]-benzoic
acid
2-methoxy-5-[3-oxo-3-(3,4,5-trimethoxy-phenyl)-propenyl]-phenyl ester (16), 80.1%
yield as a yellow solid. HR-MS (m/z) (ESI): calcd for C31H31N3O8 [M+H]+:
574.21839; found: 574.22134.
4.1.4.
3-(4,9-Dioxo-4,9-dihydro-naphtho[2,3-d][1,2,3]triazol-1-ylmethyl)-benzoic
acid 2-methoxy-5-[2-(3,4,5-trimethoxy-phenyl)-vinyl]-phenyl ester (HT1).
To a stirring solution of compound 19 (116 mg, 0.35 mmol) and EDCI (80 mg,
0.42 mmol) in dried DMF (10 mL) at room temperature, CA-4 (100 mg, 0.32 mmol)
and DMAP (42 mg, 0.35 mmol) were added. The resulting mixture was stirred at
room temperature for overnight and monitored by TLC. After completed, the reaction

was diluted with CH2Cl2 (120 mL) and washed with water (150 mL). The organic
phase was collected and dried with anhydrous Na2SO4. The crude product was
concentrated under reduced pressure and purified by column chromatograph by using
CH2Cl2/CH3OH as the eluent. The product was obtained as a light brown solid (150
mg, 69.4%). 1H NMR (600 MHz, CDCl3) δ 8.35 – 8.29 (m, 2H), 8.22 (dd, J = 7.6, 1.0
Hz, 1H), 8.14 (d, J = 7.8 Hz, 1H), 7.83 (dtd, J = 23.5, 7.4, 1.2 Hz, 2H), 7.75 (d, J = 7.8
Hz, 1H), 7.50 (t, J = 7.8 Hz, 1H), 7.17 (dd, J = 8.5, 1.9 Hz, 1H), 7.11 (d, J = 2.0 Hz,
1H), 6.89 (d, J = 8.5 Hz, 1H), 6.52 (s, 2H), 6.47 (q, J = 12.2 Hz, 2H), 6.10 (s, 2H),
3.80 (s, 3H), 3.77 (s, 3H), 3.72 (s, 6H). 13C NMR (150 MHz, CDCl3) δ 176.70, 175.39,
163.84, 152.98, 150.34, 145.67, 139.46, 137.15, 135.31, 134.39, 134.37, 133.58,
133.43, 133.19, 132.77, 132.43, 130.90, 130.39, 130.25, 130.15, 129.61, 129.39,
128.54, 127.91, 127.48, 123.24, 112.11, 105.85, 60.90, 55.99, 55.97, 53.34. HR-MS
(m/z) (ESI): calcd for C36H29N3O8 [M+H]+: 632.20274; found: 632.20422. Elemental
analysis calcd (%) for C36H29N3O8: C, 68.46; H, 4.63; N, 6.65; found: C, 68.28; H,
4.69; N, 6.49.
4.1.5.2-(1-(3-((2-methoxy-5-(3,4,5-trimethoxystyryl)phenoxy)carbonyl)benzyl)-1H-1,2
,3-triazol-4-yl)ethyl3-((4,9-dioxo-4,9-dihydro-1H-naphtho[2,3-d][1,2,3]triazol-1-yl)m
ethyl)benzoate (HT2).
HT2 was prepared in an analogous way to HT1, in which 10 was used to react
with 19. The product was obtained as a yellowish-brown soid (110 mg, 75.4%). 1H
NMR (600 MHz, CDCl3) δ 8.30 (dd, J = 7.6, 1.0 Hz, 1H), 8.19 (dd, J = 7.6, 1.1 Hz,
1H), 8.12 (dd, J = 14.5, 9.4 Hz, 3H), 7.96 (d, J = 7.8 Hz, 1H), 7.84 – 7.78 (m, 2H),
7.70 (d, J = 7.8 Hz, 1H), 7.55 (s, 1H), 7.51 (d, J = 7.7 Hz, 1H), 7.43 (q, J = 7.8 Hz,
2H), 7.16 (dd, J = 8.5, 2.0 Hz, 1H), 7.07 (d, J = 2.0 Hz, 1H), 6.87 (d, J = 8.5 Hz, 1H),
6.51 (s, 2H), 6.46 (d, J = 2.3 Hz, 2H), 6.02 (s, 2H), 5.70 (s, 2H), 4.57 (t, J = 6.3 Hz,
2H), 3.81 (s, 3H), 3.76 (s, 3H), 3.72 (s, 6H), 3.21 (t, J = 6.3 Hz, 2H). 13C NMR (150
MHz, DMSO) δ 177.34, 175.63, 165.68, 164.00, 153.10, 150.50, 145.47, 144.06,
139.38, 137.72, 137.26, 135.86, 135.55, 134.92, 134.49, 133.82, 133.71, 133.49,
133.41, 132.41, 130.62, 130.10, 129.98, 129.90, 129.75, 129.60, 129.56, 129.45,
129.40, 128.68, 128.11, 127.42, 127.28, 123.59, 123.30, 113.19, 106.39, 64.29, 60.49,

60.23, 56.37, 56.04, 52.86, 52.56, 25.41, 21.23, 14.55. HR-MS (m/z) (ESI): calcd for
C48H40N6O10 [M+H]+: 861.28787; found: 861.29283. Elemental analysis calcd (%) for
C48H40N6O10: C, 66.97; H, 4.68; N, 9.76; found: C, 66.82; H, 4.73; N, 9.65.
4.1.6.2-methoxy-5-((Z)-3,4,5-trimethoxystyryl)phenyl4-oxo-4-(3-((E)-2-(pyridin-3-yl)v
inyl)-1H-indol-1-yl)butanoate (HT3).
HT3 was prepared in a similar way to HT1, in which CA-4 was used to treat
with 23. The product was obtained as a yellow solid (90 mg, 66.2%). 1H NMR (600
MHz, CDCl3) δ 8.78 (s, 1H), 8.52 (d, J = 7.4 Hz, 2H), 7.92 (dd, J = 14.1, 7.8 Hz, 2H),
7.73 (s, 1H), 7.43 (dd, J = 16.1, 8.5 Hz, 3H), 7.32 (d, J = 16.5 Hz, 1H), 7.22 (d, J =
16.6 Hz, 1H), 7.13 (dd, J = 8.4, 1.5 Hz, 1H), 7.06 (d, J = 1.7 Hz, 1H), 6.85 (d, J = 8.5
Hz, 1H), 6.50 (s, 2H), 6.46 (s, 2H), 3.83 (s, 3H), 3.80 (s, 3H), 3.70 (s, 6H), 3.38 (t, J =
6.7 Hz, 2H), 3.13 (t, J = 6.6 Hz, 2H). 13C NMR (150 MHz, CDCl3) δ 170.39, 169.28,
153.01, 150.16, 147.42, 147.22, 139.34, 137.13, 136.61, 133.72, 133.35, 132.47,
130.14, 129.63, 128.56, 128.31, 127.86, 126.00, 125.43, 124.29, 123.99, 123.22,
123.14, 122.45, 120.34, 119.90, 116.97, 112.04, 105.81, 60.94, 56.00, 55.94, 30.87,
28.38. HR-MS (m/z) (ESI): calcd for C37H34N2O7 [M+H]+: 619.24388; found:
619.24736. Elemental analysis calcd (%) for C37H34N2O7: C, 71.83; H, 5.54; N, 4.53;
found: C, 71.71; H, 5.58; N, 4.35.
4.1.7.2-methoxy-5-((Z)-3,4,5-trimethoxystyryl)phenyl3-((4-(2-((4-oxo-4-(3-((E)-2-(pyr
idin-3-yl)vinyl)-1H-indol-1-yl)butanoyl)oxy)ethyl)-1H-1,2,3-triazol-1-yl)methyl)benzo
ate (HT4).
Similar to the synthesis of HT1, HT4 was prepared by using 10 to treat with 23
1
and obtained as a pale yellow solid (109 mg, 80.1%). H NMR (600 MHz, CDCl3) δ
8.76 (s, 1H), 8.51 (d, J = 4.1 Hz, 1H), 8.45 (d, J = 7.9 Hz, 1H), 8.12 (dt, J = 7.1, 1.7
Hz, 1H), 8.06 (s, 1H), 7.92 – 7.85 (m, 2H), 7.68 (s, 1H), 7.49 – 7.44 (m, 2H), 7.43 (s,
1H), 7.43 – 7.37 (m, 2H), 7.37 – 7.33 (m, 1H), 7.29 (s, 1H), 7.20 (d, J = 16.5 Hz, 1H),
7.16 (dd, J = 8.5, 2.1 Hz, 1H), 7.08 (d, J = 2.1 Hz, 1H), 6.88 (d, J = 8.5 Hz, 1H), 6.51
(s, 2H), 6.49 – 6.42 (m, 2H), 5.50 (s, 2H), 4.43 (t, J = 6.5 Hz, 2H), 3.81 (s, 3H), 3.77
(s, 3H), 3.71 (s, 6H), 3.28 – 3.22 (m, 2H), 3.10 (t, J = 6.4 Hz, 2H), 2.83 – 2.78 (m,
2H). 13C NMR (150 MHz, CDCl3) δ 172.08, 169.69, 163.93, 152.99, 150.32, 148.14,

147.88, 144.76, 139.42, 137.16, 136.51, 135.50, 133.34, 132.85, 132.77, 132.43,
130.49, 130.19, 130.11, 129.65, 129.56, 129.45, 128.51, 128.37, 127.97, 125.93,
125.82, 124.28, 123.76, 123.19, 123.04, 121.92, 121.87, 120.43, 119.94, 116.84,
112.12, 105.87, 63.58, 60.90, 55.97, 55.96, 53.50, 30.73, 28.53, 25.53. HR-MS (m/z)
(ESI): calcd for C49H45N5O9 [M+H]+: 848.32901; found: 848.33160. Elemental
analysis calcd (%) for C49H45N5O9: C, 69.41; H, 5.35; N, 8.26; found: C, 69.21; H,
5.40; N, 8.10.
4.1.8.(E)-2-methoxy-5-(3-oxo-3-(3,4,5-trimethoxyphenyl)prop-1-en-1-yl)phenyl3-((4,9
-dioxo-4,9-dihydro-1H-naphtho[2,3-d][1,2,3]triazol-1-yl)methyl)benzoate (HT5).
According to the synthetic process of HT1, reaction of 14 with 19 yielded HT5
as a tawny solid (88 mg, 59.9%). 1H NMR (600 MHz, CDCl3) δ 8.39 – 8.32 (m, 2H),
8.24 (d, J = 7.6 Hz, 1H), 8.20 (d, J = 7.8 Hz, 1H), 7.88 – 7.85 (m, 1H), 7.85 – 7.72 (m,
4H), 7.56 – 7.50 (m, 3H), 7.35 (d, J = 15.5 Hz, 1H), 7.27 (s, 1H), 7.04 (d, J = 8.3 Hz,
1H), 6.13 (s, 2H), 3.94 (d, J = 6.1 Hz, 9H), 3.85 (s, 3H). 13C NMR (150 MHz, CDCl3)
δ 189.08, 176.66, 175.46, 163.93, 153.28, 153.14, 145.68, 143.70, 142.42, 140.15,
135.39, 134.55, 134.39, 133.78, 133.61, 133.43, 133.21, 132.76, 130.97, 130.41,
130.05, 129.51, 128.97, 128.10, 127.95, 127.45, 121.90, 120.41, 112.49, 106.04,
60.99, 56.43, 56.10, 53.31, 50.84. HR-MS (m/z) (ESI): calcd for C37H29N3O9 [M+H]+:
660.19766; found: 660.20275. Elemental analysis calcd (%) for C37H29N3O9: C, 67.37;
H, 4.43; N, 6.37; found: C, 67.27; H, 4.47; N, 6.25.
4.1.9.(E)-2-(1-(3-((2-methoxy-5-(3-oxo-3-(3,4,5-trimethoxyphenyl)prop-1-en-1-yl)phe
noxy)carbonyl)benzyl)-1H-1,2,3-triazol-4-yl)ethyl3-((4,9-dioxo-4,9-dihydro-1H-napht
ho[2,3-d][1,2,3]triazol-1-yl)methyl)benzoate (HT6).
Based on the synthetic method of HT1, treatment of 16 with 19 to produce HT6
as a buff solid (97 mg, 81.2%). 1H NMR (600 MHz, CDCl3) δ 8.28 (dd, J = 7.5, 1.3
Hz, 1H), 8.20 – 8.15 (m, 3H), 8.11 (s, 1H), 7.96 (d, J = 7.8 Hz, 1H), 7.83 – 7.78 (m,
2H), 7.75 (d, J = 15.5 Hz, 1H), 7.70 (d, J = 7.8 Hz, 1H), 7.62 – 7.58 (m, 2H), 7.49 (dd,
J = 9.5, 5.6 Hz, 3H), 7.46 (d, J = 2.0 Hz, 1H), 7.43 (t, J = 7.7 Hz, 1H), 7.36 (d, J =
15.5 Hz, 1H), 7.28 (s, 2H), 7.01 (d, J = 8.5 Hz, 1H), 6.02 (s, 2H), 5.75 (s, 2H), 4.58 (t,
J = 6.2 Hz, 2H), 3.95 (s, 6H), 3.93 (s, 3H), 3.84 (s, 3H), 3.23 (t, J = 6.2 Hz, 2H). 13C

NMR (150 MHz, CDCl3) δ 188.96, 176.63, 175.36, 165.41, 163.93, 153.18, 153.14,
145.67, 144.56, 143.58, 142.38, 140.05, 135.74, 135.35, 134.39, 134.12, 133.59,
133.35, 133.29, 133.20, 133.11, 132.67, 130.93, 130.55, 130.32, 129.81, 129.56,
129.51, 129.32, 128.92, 128.11, 127.90, 127.40, 122.27, 121.87, 120.40, 112.45,
105.99, 63.87, 61.00, 56.43, 56.09, 53.70, 53.44, 53.26, 25.56, 14.13, 11.45. HR-MS
(m/z) (ESI): calcd for C49H40N6O11 [M+H]+: 889.28278; found: 889.28507. Elemental
analysis calcd (%) for C49H40N6O11: C, 66.21; H, 4.54; N, 9.45; found: C, 66.12; H,
4.57; N, 9.31.
4.1.10.
2-methoxy-5-((E)-3-oxo-3-(3,4,5-trimethoxyphenyl)prop-1-en-1-yl)phenyl
4-oxo-4-(3-((E)-2-(pyridin-3-yl)vinyl)-1H-indol-1-yl)butanoate (HT7).
HT7 was obtained by a similar way to prepare HT1 via reaction of 14 with 23 as
1
a yellow solid (90 mg, 63.8%). H NMR (600 MHz, CDCl3) δ 8.76 (s, 1H), 8.56 –
8.47 (m, 2H), 7.88 (dd, J = 17.2, 7.7 Hz, 2H), 7.76 – 7.70 (m, 2H), 7.47 (dd, J = 4.2,
2.3 Hz, 2H), 7.43 – 7.37 (m, 2H), 7.34 (dd, J = 13.9, 5.6 Hz, 2H), 7.26 (d, J = 8.4 Hz,
3H), 7.19 (d, J = 16.5 Hz, 1H), 6.99 (d, J = 9.0 Hz, 1H), 3.94 (d, J = 2.4 Hz, 9H), 3.87
(s, 3H), 3.42 (t, J = 6.5 Hz, 2H), 3.20 (t, J = 6.5 Hz, 2H). 13C NMR (150 MHz, CDCl3)
δ 189.06, 170.48, 169.33, 153.15, 153.07, 147.97, 147.69, 143.66, 142.39, 140.02,
136.59, 133.63, 133.40, 132.90, 128.83, 128.36, 128.09, 126.01, 125.81, 124.34,
123.85, 122.95, 121.98, 121.87, 120.54, 120.45, 119.97, 116.89, 112.40, 106.02,
61.01, 56.44, 56.11, 30.82, 28.41. HR-MS (m/z) (ESI): calcd for C38H34N2O8 [M+H]+:
647.23879; found: 647.24119. Elemental analysis calcd (%) for C38H34N2O8: C, 70.58;
H, 5.30; N, 4.33; found: C, 70.38; H, 5.28; N, 4.15.
4.1.11.
2-methoxy-5-((E)-3-oxo-3-(3,4,5-trimethoxyphenyl)prop-1-en-1-yl)phenyl
3-((4-(2-((4-oxo-4-(3-((E)-2-(pyridin-3-yl)vinyl)-1H-indol-1-yl)butanoyl)oxy)ethyl)-1
H-1,2,3-triazol-1-yl)methyl)benzoate (HT8).
Reaction of 16 with 23 by a similar way to synthsize HT1 yielded HT8 as a puce
solid (102 mg, 85.7%). 1H NMR (600 MHz, CDCl3) δ 8.75 (s, 1H), 8.47 (dd, J = 31.9,
5.7 Hz, 2H), 8.22 – 8.16 (m, 1H), 8.13 (s, 1H), 7.91 – 7.84 (m, 2H), 7.74 (d, J = 15.5
Hz, 1H), 7.65 (s, 1H), 7.53 – 7.47 (m, 4H), 7.45 (d, J = 2.0 Hz, 1H), 7.39 (td, J = 7.3,
1.4 Hz, 2H), 7.34 – 7.30 (m, 2H), 7.25 (s, 2H), 7.18 (d, J = 16.5 Hz, 1H), 7.01 (d, J =

8.6 Hz, 1H), 5.54 (s, 2H), 4.43 (t, J = 6.4 Hz, 2H), 3.93 (d, J = 2.1 Hz, 9H), 3.84 (s,
3H), 3.29 – 3.23 (m, 2H), 3.12 (t, J = 6.4 Hz, 2H), 2.85 – 2.78 (m, 2H). 13C NMR (150
MHz, CDCl3) δ 188.94, 172.11, 169.68, 163.99, 153.21, 153.14, 148.12, 147.85,
144.85, 143.58, 142.41, 140.07, 136.50, 135.69, 133.58, 133.11, 132.81, 130.59,
129.92, 129.63, 129.57, 128.89, 128.38, 128.13, 125.95, 125.85, 124.31, 123.78,
122.97, 121.90, 120.49, 120.37, 119.98, 116.81, 112.46, 106.00, 63.57, 61.01, 56.44,
56.10, 53.51, 30.73, 28.51, 25.54. HR-MS (m/z) (ESI): calcd for C50H45N5O10
[M+H]+: 876.32392; found: 876.32688. Elemental analysis calcd (%) for C50H45N5O10:
C, 68.56; H, 5.18; N, 8.00; found: C, 68.34; H, 5.24; N, 7.85.
4.1.12. HPLC analysis of hydrolysis behavior of HT2.
The standard samples were prepared in PBS (pH=5.0) or a solvent containing
60.0% acetonitrile and 40.0% water, and detected by HPLC at different time,
respectively. Reversed phase HPLC was implemented on a 250×4.5 mm ODS column
and the HPLC profiles were recorded on UV detection at 245 nm. Mobile phase
consisted of acetonitrile/water (60:40, v/v), and flow rate was 1.0 mL/min. The
samples were taken for HPLC analysis after filtration by 0.45 mm filter.
4.2. Biology
4.2.1. In vitro cytotoxicity
Materials. All human cancer cell lines and non-tumoral cell line were purchased
from Jiangsu KeyGen Biotech Co. Ltd. (Nanjing, China). The β-Acitn, Bax, Bcl-2,
caspase-3, PARP and TDO antibodies were obtained from Cell Signaling Technology
(Danvers, MA, USA). FITC-conjugated rabbit anti-tubulin antibody was purchased
from Jackson Immuno Research Laboratories (USA). Peripheral blood mononuclear
cells (PBMCs) from unrelated healthy donators and anti-CD3/4/8 antibody (Abcam)
were also purchased for flow cytometry analysis. Culture medium Dulbecco's
modified Eagle medium (DMEM), phosphate buffered saline (PBS), fetal bovine
serum (FBS) and Antibiotic-Antimycotic were obtained from Jiangsu KeyGen
Biotech Co. Ltd. (Nanjing, China).
Cell culture. HepG2 (human hepatoma cancer cell line), U87 (human primary
glioblastoma cell line), HCT-116 (human colorectal cell line) and A549 (human lung

cancer cell line) cells as well as human non-tumoral liver cell LO2 were grown at
37 °C in a 5% CO2 atmosphere and maintained in monolayer culture in DMEM
medium containing 100 mg/mL of penicillin, 100 mg/mL of streptomycin and 10%
fetal bovine serum (FBS).
MTT assay. The in vitro antiproliferative activity of the synthesized compounds
was determined by the standard MTT assay. Briefly, approximately 5×105 cells,
suspended in DMEM medium including 10% fetal bovine serum (FBS), were seeded
into each well of a 96-well plate and incubated at 37 °C in 5% CO2 atmosphere for 24
h. The solutions of the different compounds were prepared at different indicated
concentrations by dissolving in DMSO and added to the culture medium, and the cell
cultures were then continued at 37 °C in a 5% CO2 atmosphere. After 72 h, fresh MTT
was added to each well at a concentration of 0.5 mg/mL and incubated for an
additional 4 h. The medium was removed and 100 µL of DMSO was added. The UV
absorption intensity was detected with the ELISA reader at 490 nm. The IC50 values
were calculated by the Bliss method and repeated in three times.
4.2.2. Immunofluorescent staining.
HepG2 cells were grown in six-well of plates and co-incubated with the
indicated compounds for 24 h. After 24 h, the cells were collected and fixed in 4%
paraformaldehyde at 37 °C, and subsequently washed three times with ice-PBS. After
permeabilized with 0.5% Triton X-100 and blocked by using 10% goat serum at room
temperature, cells were incubated with primary antibody (tubulin) for 2 h, and then
washed with ice-PBS. The cells were then stained with fluorescence conjugated
secondary antibody for 1 h and cells nuclei marker of 4,6-diamidino-2-phenylindole
(DAPI) at room temperature. Finally, Cells were observed on a laser scanning
confocal microscope.
4.2.3. Cell apoptosis assay by flow cytometry.
Apoptosis was determined by flow cytometry analysis of cells via double stained
with annexin V/FITC and PI. HepG2 cells at the density of 2×106/well were seeded
into 6-well plates in 10% FBS-DMEM and cultured overnight, and then incubation
with the indicated compounds for 24 h. After that, the cells were harvested and

washed twice with cold PBS, and subsequently were resuspend in Binding Buffer (0.1
M Hepes/NaOH, 1.4 M NaCl, 25 mM CaCl2) at a concentration of 1×106 cells/mL.
The cells were transfered to culture tube, and add 5 mL of FITC Annexin V (BD,
Pharmingen) and 5 mL propidium iodide (PI) to stain using annexin-V FITC
apoptosis kit followed. Gently vortex the cells and incubated at room temperature in
the dark for 30 min. The apoptosis data were analyzed with the system software (Cell
Quest; BD Biosciences).
4.2.4. Analysis of cell cycle.
HepG2 cells in 6-well plates were incubated with indicated concentrations of
compounds for 24 h in 5% CO2 at 37 °C. After incubated period, cells were harvested,
fixed and permeabilized with ice-cold ethanol (70%) at 4 °C overnight. The cells were
washed with ice-cold PBS after ethanol was removed by centrifugation, then
incubation with 100 mg/ml RNase A at 37 °C for 30 min, and finally stained with 1
mg/ml propidium iodide (PI) at 4 °C for 30 min. Samples were analyzed with the
system software (Cell Quest; BD Biosciences).
4.2.5. Acridine orange/ethidium bromide (AO/EB) fluorescence staining assay.
The AO/EB dual staining assay was carried out to observe the morphological
evidence of apoptotic cells. In brief, HepG2 cells (2×106/ml per well) were seeded
into 6-well plates with 10% FBS-DMEM to the final volume of 2 mL. Then removed
the medium and rejoined fresh medium including 10% fetal bovine serum, the cells
were exposed to the tested compounds and cultured in 5% CO2 at 37 °C for 24 h. The
cells were harvested by centrifugation and suspended in phosphate buffered saline
solution (PBS), then stained with 20 µL of dye mixture AO/EB stain (100 mg/mL)
and incubated at room temperature in the dark for 20 min. Fluorescence was detected
on an Nikon ECLIPSETE2000-S fluorescence microscope (OLYMPUS Co., Japan).
4.2.6. Mitochondrial membrane potential monitored by JC-1 staining.
HepG2 cells (2 × 106 cells) were grew into 6 well plates in the DMEM medium
with 10% FBS to the final volume of 2 mL and incubated overnight. The cells were
incubated with the tested compounds for 24 h. After 24 h incubation, the cells were
rinsed with PBS and added fresh medium, subsequently the molecular probe of JC-1

was added to each well and incubated for 30 min at room temperature. Cells were
collected by centrifugation, washed with PBS for two times, and mitochondrial
membrane potential was analyzed by flow cytometry and fluorescence microscope.
4.2.7. Measurement of intracellular ROS generation.
The production of intracellular ROS after incubated with the tested compounds
was detected using the fluorescent probe DCFH-DA (Beyotime, Haimen, China) by
flow cytometry. In brief, HepG2 cells were seeded into 6-well plates with the DMEM
medium containing 10% FBS and incubated with the tested compounds. After
incubation for 24 h, cells were harvested by centrifugaion and washed with ice-cold
PBS, and then resuspended in 1 mL of free medium containing 10 mM DCFH-DA for
30 min at 37 °C. After washed twice with PBS, the cellular fluorescence was detected
by flow cytometry at an excitation wavelength of 485 nm and an emission wavelength
of 538 nm.
4.2.8. Western bloting analysis.
After the incubation of HepG2 cells with the indicated compounds for 24 h at
37 °C, the cells were collected by centrifugation and washed twice with ice-cold
phosphate buffered saline (PBS). The cells were then resuspended in lysis buffer and
lysed on ice for 30 min, subsequently lysates were centrifuged at 4 °C for 10 min. The
protein concentration was determined using the BCA protein assay reagents. Equal
amounts of protein were separated on sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS-PAGE) and transferred to PVDF Hybond-P membrane (GE
Healthcare). Membranes were blocked with 5 mL of 5% skim dry milk in
Tris-buffered saline (TBS) containing Tween 20 (TBST) buffer for 1 h, the
membranes being gently rotated overnight at 4 °C. Membranes were then incubated
with primary antibodies at 4 °C for overnight, following incubation of peroxidase
labeled secondary antibodies for 2 h at room temperature. The protein blots were
detected by chemiluminescence reagent (Thermo Fischer Scientifics Ltd.).
Anti-β-actin antibody was used as loading control.
4.2.9. Cell migration assay.
The wound healing assay was carried out to evaluate the migration effect of HT2

on HepG2 cells. The HepG2 cells were plated in 6-well plates and cultured in DMEM
medium containing 10% FBS for 24 h. The HepG2 cells were scratched using a 10 ml
pipette tip to draw a straight line in the middle of each well. The medium in each well
was removed and washed twice with ice-PBS, the cells were then incubated with or
without HT2 and CA-4 for 24 h. The extent of wound heal was observed (0 h and 24
h) by imaging with fluorescence microscope.
4.2.10. Quantitative (q)RT-PCR.
The mRNA expression levels of TDO and AHR were detected as the method
described previously [28,29]. The total RNA was isolated from HepG2 cells and
collected for further analysis after incubation with the tested compounds. Total RNA
was isolated with the Qiagen RNAeasy kitand cDNA was synthesized with the
Applied Biosystems reverse-transcription-kit (Foster City, CA, USA). (q)RT-PCR was
carried out in a light cycler 480 II thermo cycler with SYBR Green PCR Mastermix
(Roche). All primers were separated by at least one intron on the genomic DNA to
exclude its amplification. PCR reactions were performed by including no-RT controls,
by omission of templates, and by melting curves. Standard curves were generated for
each gene. Relative quantification of gene expression was determined by comparison
of threshold values. All results were normalized to GAPDH.
Primer sequences (designed by Jiangsu KeyGen Biotech Company) were (5’-3’
forward, reverse):
TGTTGCCATCAATGACCCCTT; CTCCACGACGTACTCAGCG (GAPDH)
GGCCGTGTCGATGTATCAGT; GCCTGGCAGTACTGGATTGT (AHR)
CGGTGGTTCCTCAGGCTATC; CTTCGGTATCCAGTGTCGGG (TDO)
4.2.11. The level of kynurenine determined by HPLC.
The level of kynurenine was determined according to literature reports [28].
HepG2 cells (2×105 cells) were incubated in a 6-well plate with 2 mL medium
(containing 10% FBS, 100 U/mL penicillin, and 100 mg/mL streptomycin) and
incubated with indicated compounds at 37 °C for 24 h. The cells was collected by
centrifugation, and mixed with 50 µL of 20% trichloroacetic acid for protein
precipitation. After incubated for 30 min, the sample was centrifuged to remove the

sediments, and the supernatant was analyzed by HPLC. Reversed phase HPLC was
implemented on a 250×4.5 mm ODS column and the HPLC profiles were recorded on
UV detection at 360 nm. All samples were assessed by HPLC analysis after filtration
by 0.45 mm filter. Standard curves were generated with kynurenine in the same
medium.
4.2.12. T cells proliferation assay in vitro.
A mixed leukocyte reaction (MLR) was performed to analyze T cells
proliferation as described previously [28,29]. HepG2 cells (1×105) were seeded in
6-well plates and exposed to the indicated compounds with an control group. The
HepG2 cells were then incubated in the presence of different compounds for 2 days at
37 °C. After PHA-M stimulation, PBMCs (2×105 cells/well) stained with Cell
TraceTM Far Red Cell Proliferation Kit (CFSE) was subsequently inserted into each
well. After co-culture for 6 days at 37 °C, the PBMCs were harvested by
centrifugation for further analysis. The cell pellets were resuspended in PBS and
stained with anti-CD3 and anti-CD4/8 antibody. The T-cell proliferation was
measured by flow cytometry.
4.2.13. In vivo antitumor efficacy of HT2.
The in vivo antitumor activity of HT2 was investigated in mouse liver cancer
xenograft models. The Institute of Cancer Research (ICR) mice were purchased from
Shanghai SLAC Laboratory Animals Co. Ltd. (Shanghai, China). H22 cells (1 × 107
cells) were subcutaneously implanted into the right armpit region of each ICR mouse
to establish tumors model. After incubation for 1 day, all mice were randomly divided
into four groups: the first group was injected with free vehicle (physiological saline
containing 5% Tween 80); the second group was treated with CA-4 at a dose of 30
mg/kg; the third group was treated with HT2 at a dose of 30 mg/kg; the fourth group
received the mixture of CA-4 and compound 19 (CA-4 15.4 mg/kg + 19 14.6 mg/kg).
All groups were intravenously injected via a tail vein one dose per day for a total 21
consecutive days. Body weights and tumor volumes were recorded every 2 days after
drug treatment. All mice were sacrificed and weighed after 21 days of treatment. The
tumor sizes were measured using electronic digital calipers and the tumor volume (V)

was determined by measuring length (A) and width (B) to calculate volume (V =
AB2/2). Statistical analysis was carried out by using Student's t-Test at the end point.
In vivo antitumor efficacy of HT2 was similarly examined in A549 tumor model
as described above. Five-week-old male BALB/c nude mice (18-22 g) were purchased
from Shanghai SLAC Laboratory Animals Co. Ltd. (Shanghai, China). After A549
xenograft BALB/c nude mice model was established and the tumors reached a volume
of 120-150 mm3, all mice were randomly divided into three groups (control, CA-4 of
30 mg/kg, HT2 30 mg/kg for 29 days). The following experimental procedures were
similar to the described above.
At the end of experiment, the mouse major organs from one of each group
(including heart, liver, spleen, lung and kidneys) were collected for histopathological
analysis using Hematoxylin and Eosin (H&E) staining. Briefly, the specimens were
fixed in 4% paraformaldehyde and embedded in paraffin to prepare sections. Then the
sections were cut and stained in Harris hematoxylin solution and eosin-phloxine
solution. Finally, the histological analysis of the tissues was performed under
fluorescence microscopy using an Eclipse E800 Nikon (Nikon, Tokyo, Japan).
4.2.14. Immunohistochemical and flow cytometry analysis of immune T cells in mouse
tumors and spleen tissues.
After treated with indicated compounds for 21 days, all mice (ICR) were
sacrificed, and tumors and spleen were harvested for further observation. The tumors
tissue sections were prepared and incubated with primary antibodies in antibody
dilution buffer at room temperature for 45 min, then stained with biotinylated
secondary antibody for 30 min. Images were obtained by fluorescence microscopy
using an Eclipse E800 Nikon (Nikon, Tokyo, Japan). The immune T cells in spleen
were evaluated according to the reported method [41]. The spleen tissue was cut into
smaller pieces with scissors, digested and filtered to obtain T cells, and then the
single-cell suspensions were washed with PBS for twice and resuspended in buffer
and stain with anti-CD3/4/8 antibody. The resulting mixtures were analyzed by flow
cytometry.
Notes

The authors declare no competing financial interest.
Acknowledgments
We are grateful to the National Natural Science Foundation of China (Grant Nos.
21571033 and 81503099) for financial aids to this work. The research was also
supported by the Zhishan Youth Scholar Program of SEU (2242019R40045). The
authors would also like to thank the Fundamental Research Funds for the Central
Universities (Project 2242017K41024) for supplying basic facilities to our key
laboratory.
References
[1] M. Kavallaris, Microtubules and resistance to tubulin-binding agents, Nat. Rev.
Cancer 10 (2010) 194-204.
[2] F. Pellegrini, D.R. Budman, Review: tubulin function, action of antitubulin drugs,
and new drug development, Cancer Invest. 23 (2005) 264-273.
[3] (a) L.A. Amos, What tubulin drugs tell us about microtubule structure and
dynamics, Semin. Cell Dev. Biol. 22 (2011) 916-926. (b) L.A. Amos, Microtubule
structure and its stabilisation, Org. Biomol. Chem. 2 (2004) 2153-2160.
[4] P.F. Zhou, Y. Liu, L. Zhou, K.K. Zhu, K.C. Feng, H. Zhang, Y.R. Liang, H.L. Jiang,
C. Luo, M.M. Liu, Y. Wang, Potent antitumor activities and structure basis of the
chiral β-Lactam bridged analogue of combretastatin A-4 binding to tubulin, J.
Med. Chem. 59 (2016) 10329-10334.
[5] E.A. Perez, Microtubule inhibitors: differentiating tubulininhibiting agents based
on mechanisms of action, clinical activity, and resistance, Mol. Cancer Ther. 8
(2009) 2086-2095.
[6] R.K.V. Devambatla, O.A. Namjoshi, S. Choudhary, E. Hamel, C.V. Shaffer, C.C.
Rohena, S.L. Mooberry, A. Gangjee, Design, synthesis, and preclinical evaluation
of 4-Substituted-5- methyl-furo[2,3-d]pyrimidines as microtubule targeting agents
that are effective against multidrug resistant cancer cells, J. Med. Chem. 59 (2016)
5752-5765.

[7] A. Jordan, J.A. Hadfield, N.J. Lawrence, A.T. McGown, Tubulin as a target for
anticancer drugs: agents which interact with the mitotic spindle, Med. Res. Rev.
18 (1998) 259-296.
[8] G.R. Pettit, S.B. Singh, E. Hamel, C.M. Lin, D.S. Alberts, D. Garcia-Kendal,
Isolation and structure of the strong cell growth and tubulin inhibitor
combretastatin A-4, Experientia. 45 (1989) 209-211.
[9] R. Mikstacka, T. Stefanski, J. Rozanski, Tubulin-interactive stilbene derivatives as
anticancer agents, Cell. Mol. Biol. Lett. 18 (2013) 368-397.
[10] D.M. Patterson, G.J.S. Rustin, Vascular damaging agents, Clin.Oncol. 19 (2007)
443-456.
[11] G. Nagaiah, S.C. Remick, CA-4 phosphate: a novel vascular disrupting agent,
Future Oncol. 6 (2010) 1219-1228.
[12] (a) A. Dowlati, K. Robertson, M. Cooney, W.P. Petros, M. Stratford, J. Jesberger,
N. Rafie, B. Overmoyer, V. Makkar, B. Stambler, A. Taylor, J. Waas, J.S. Lewin,
K.R. McCrae, S.C. Remick, A phase I pharmacokinetic and translational study of
the novel vascular targeting agent combretastatin A-4 phosphate on a single-dose
intravenous schedule in patients with advanced cancer, Cancer Res. 62 (2002)
3408-3416. (b) G.J. Rustin, S.M. Galbraith, H. Anderson, M. Stratford, L.K.
Folkes, L. Sena, L. Gumbrell, P.M. Price, Phase I clinical trial of weekly CA-4
phosphate: clinical and pharmacokinetic results, J. Clin. Oncol. 21 (2003)
2815-2822.
[13] K. Hori, S. Saito, Microvascular mechanisms by which the combretastatin A-4
derivative AC7700 (AVE8062) induces tumour blood flow stasis, Br. J. Cancer 89
(2003) 1334-1344.
[14] S. Ducki, R. Forrest, J.A. Hadfield, A. Kendall, N.J. Lawrence, A.T. McGown, D.
Rennison, Potent antimitotic and cell growth inhibitory properties of substituted
chalcones, Bioorg. Med. Chem. Lett. 8 (1998) 1051-1056.
[15] N.S. Vasudev, A.R. Reynolds, Anti-angiogenic therapy for cancer: current
progress, unresolved questions and future directions, Angiogenesis 17 (2014)
471-494.