A glycosynthase derived from an inverting GH19 chitinase from the moss Bryum coronatum

Article abstract of DOI:10.1042/BJ20120036

BcChi-A, a GH19 chitinase from the moss Bryum coronatum, is an endo-acting enzyme that hydrolyses the glycosidic bonds of chitin, (GlcNAc)_n [a β-1,4-linked polysaccharide of GlcNAc (N-acetylglucosamine) with a polymerization degree of n], through an inverting mechanism. When the wild-type enzyme was incubated with α-(GlcNAc)₂-F [α-(GlcNAc) ₂ fluoride] in the absence or presence of (GlcNAc)₂, (GlcNAc)₂ and hydrogen fluoride were found to be produced through the Hehre resynthesis-hydrolysis mechanism. To convert BcChi-A into a glycosynthase, we employed the strategy reported by Honda et al. [(2006) J. Biol. Chem. 281, 1426-1431; (2008) Glycobiology 18, 325-330] of mutating Ser¹⁰², which holds a nucleophilic water molecule, and Glu ⁷⁰, which acts as a catalytic base, producing S102A, S102C, S102D, S102G, S102H, S102T, E70G and E70Q. In all of the mutated enzymes, except S102T, hydrolytic activity towards (GlcNAc)₆ was not detected under the conditions we used. Among the inactive BcChi-A mutants, S102A, S102C, S102G and E70G were found to successfully synthesize (GlcNAc)₄ as amajor product from α-(GlcNAc)₂-F in the presence of (GlcNAc) ₂. The S102A mutant showed the greatest glycosynthase activity owing to its enhanced F^- releasing activity and its suppressed hydrolytic activity. This is the first report on a glycosynthase that employs amino sugar fluoride as a donor substrate. The Authors Journal compilation

Full text of DOI:10.1042/BJ20120036

www.biochemj.org
Biochem. J. (2012) 444, 437–443 (Printed in Great Britain) doi:10.1042/BJ20120036
437
A glycosynthase derived from an inverting GH19 chitinase from the moss
Bryum coronatum
Takayuki OHNUMA*, Tatsuya FUKUDA*, Satoshi DOZEN*, Yuji HONDA†, Motomitsu KITAOKA‡ and Tamo FUKAMIZO*1
*Department of Advanced Bioscience, Kinki University, 3327-204 Nakamachi, Nara 631-8505, Japan, †Department of Food Science, Ishikawa Prefectural University, 1-308 Suematsu,
Nonoichi, Ishikawa 921-8836, Japan, and ‡National Food Research Institute, National Agriculture and Food Research Organization, 2-1-12, Kannondai, Tsukuba, Ibaraki 305-8642,
Japan
BcChi-A, a GH19 chitinase from the moss Bryum coronatum, is
an endo-acting enzyme that hydrolyses the glycosidic bonds of
chitin, (GlcNAc)n [a β-1,4-linked polysaccharide of GlcNAc (N-
acetylglucosamine) with a polymerization degree of n], through an
inverting mechanism. When the wild-type enzyme was incubated
with α-(GlcNAc)2-F [α-(GlcNAc)2 fluoride] in the absence or
presence of (GlcNAc)2, (GlcNAc)2 and hydrogen fluoride were
found to be produced through the Hehre resynthesis–hydrolysis
mechanism. To convert BcChi-A into a glycosynthase, we
employed the strategy reported by Honda et al. [(2006) J. Biol.
Chem. 281, 1426–1431; (2008) Glycobiology 18, 325–330] of
mutating Ser102, which holds a nucleophilic water molecule,
and Glu70, which acts as a catalytic base, producing S102A,
S102C, S102D, S102G, S102H, S102T, E70G and E70Q. In
all of the mutated enzymes, except S102T, hydrolytic activity
towards (GlcNAc)6 was not detected under the conditions we used.
Among the inactive BcChi-A mutants, S102A, S102C, S102G and
E70G were found to successfully synthesize (GlcNAc)4 as a major
product from α-(GlcNAc)2-F in the presence of (GlcNAc)2. The
S102A mutant showed the greatest glycosynthase activity owing
to its enhanced F− releasing activity and its suppressed hydrolytic
activity. This is the first report on a glycosynthase that employs
amino sugar fluoride as a donor substrate.
Key words: chitin oligosaccharide, chitobiose phosphorylase, gly-
cosynthase, α-N,Nꢀ-diacetylchitobiosylfluoride [α-(GlcNAc)2-F],
site-directed mutagenesis.
in the reaction by GH19 chitinases. Several GH18 chitinases
exhibit significant transglycosylation activity [13,14], that can be
utilized for synthesizing a new glycosidic bond [15]. However,
yields are usually poor, because of the subsequent break
down of the transglycosylation products. Thus mutations of the
enzyme proteins have been performed with the aim of increasing
the yields. Mutation of aspartic acids of the catalytic triad
(DXDXE) in GH18 chitinases was found to successfully
enhance the transglycosylation reaction [16,17]. In recent years,
glycosynthase-catalysed synthesis has become one of the most
attractive strategies for synthesizing the glycosides. The first
glycosynthase was reported by Mackenzie et al. [18], who
converted a retaining β-glucosidase from Agrobacterium sp.
into a glycosynthase by introducing a mutation in its catalytic
nucleophile (Glu358). Thereafter, a number of retaining GHs
were converted into glycosynthases by introducing a mutation
in their catalytic nucleophiles [19]. The glycosynthase technique
was developed by mimicking the Hehre resynthesis–hydrolysis
mechanism [20], in which an inverting GH acts towards the
glycosyl fluoride possessing a ‘wrong’ anomer resulting in a net
release of fluorine atom through the two steps: (i) synthesis of a
new glycoside with an acceptor molecule in a ‘correct’ anomer
and (ii) hydrolysis of the glycoside formed in the first step.
Nevertheless, most of the glycosynthases reported until recently
were derived from retaining GHs. In 2006, Honda and Kitaoka
[21] reported the conversion of an inverting glycoside hydrolase,
Rex (reducing-end xylose-releasing exo-oligoxylanase) from
Bacillus halodurans C-125, into a glyosynthase. Two mutants,
in which the general base Asp263 was substituted with cysteine
INTRODUCTION
Chitin oligosaccharides (GlcNAc)n [a β-1,4-linked polysacchar-
ide of GlcNAc (N-acetylglucosamine) with a polymerization de-
gree of n] have been drawing attention because of their presumed
biological functions, such as inhibition of tumour angiogenesis
[1], control of cell growth, differentiation and development in
vertebrates [2,3], their anti-oxidative effect [4], and the eliciting
of defensive actions in plants [5,6]. However, in spite of these
attractive properties, the molecular mechanisms underlying their
biological activities remain to be clarified. In this context, it is
highly desirable to obtain well-defined chitin oligosaccharides in
large quantities. Chitin oligosaccharides have been prepared by
enzymatic degradation [7] or acid hydrolysis of chitin followed
by purification with an appropriate separation system [8,9]. In
both cases, the glycosidic bonds in the chitin chain are cleaved
randomly, producing a mixture of chitin oligosaccharides with a
wide variety of chain lengths. This leads to a laborious purification
procedure. Procedures for synthesizing chitin oligosaccharides
are also laborious, because multiple protection, coupling and
deprotection reactions are required to controlthe regio- and stereo-
selectivity in glycosidic bond formation [10].
Chitinases (EC 3.2.1.14) that catalyse the hydrolysis of chitin
are widely distributed in living organisms. The enzymes have
been classified into two families, GH (glycoside hydrolase)
family 18 (GH18) and 19 (GH19), on the basis of the amino
acid sequence of their catalytic modules (http://www.cazy.org/)
[11,12]. Anomeric forms of the enzymatic products are retained
in the reaction catalysed by GH18 chitinases, but inverted
Abbreviations used: ChBP, chitobiose phosphorylase; 2,5-DHB, 2,5-dihydroxy benzoic acid; GH, glycoside hydrolase; GlcNAc, N-acetylglucosamine;
(GlcNAc)n, a β-1,4-linked polysaccharide of GlcNAc with a polymerization degree of n; α-GlcNAc-F, α-GlcNAc fluoride; α-(GlcNAc)2-F, α-(GlcNAc)2
fluoride; La3 + -ALC, lanthanum/alizarin complexon; MALDI–TOF-MS, matrix-assisted laser-desorption ionization–time-of-flight MS; Rex, reducing-end
xylose-releasing exo-oligoxylanase.
1
To whom correspondence should be addressed (email fukamizo@nara.kindai.ac.jp).
ꢁ
c
ꢁ
c
The Authors Journal compilation 2012 Biochemical Society

438
T. Ohnuma and others
and asparagine, were found to accumulate significant amounts
of xylotriose from α-xylobiosyl fluoride and xylose. This was
the first report of a glycosynthase derived from an inverting GH,
suggesting the availability of inverting GHs for synthesis. Tyr198
holding the nucleophilic water molecule at the catalytic site was
also found to be a mutation target for creating a glycosynthase
from Rex [22].
Taira et al. [23] isolated and characterized BcChi-A, a GH19
chitinase from the moss Bryum coronatum. Because of its high
thermal stability (Tm, up to 70◦C), small molecular size (22 kDa)
and relatively high yield of recombinant protein in Escherichia
coli (100 mg/l of culture), BcChi-A appears to be an appropriate
enzyme for basic and applied research, including the creation
of a first glycosynthase from the GH19 scaffold. Although
various retaining and inverting GHs have been converted into
glycosynthases, there have been no reports on glycosynthases
derived from enzymes employing the amino sugar fluoride
as a donor substrate. We report in the present study the
successful conversion of a GH19 chitinase into a glycosynthase by
introducing mutations into a serine residue holding a nucleophilic
water molecule.
MATERIALS AND METHODS
Chemicals
Figure 1 Reaction scheme of the enzymatic reactions used
(A) Direct synthesis of α-(GlcNAc)2-F from α-GlcNAc-F by means of ChBP. (B) Hehre
resynthesis–hydrolysis reaction catalysed by BcChi-A.
(GlcNAc)n (n = 1–6) were purchased from Seikagaku Biobusi-
ness. All other reagents were of analytical grade available
commercially.
O-deacetylation using sodium methoxide in methanol according
to a standard procedure [29,30]. To synthesize α-(GlcNAc)2-F, we
employed the synthetic reaction catalysed by ChBP (chitobiose
phosphorylase) from Vibrio proteolyticus [31]. Since α-GlcNAc-
F can act as both donor and acceptor substrates for ChBP [32],
the direct synthesis of α-(GlcNAc)2-F from α-GlcNAc-F was
conducted using ChBP as a catalyst, as shown in Figure 1(A).
The enzyme was added to a solution of α-GlcNAc-F in 1 ml of
0.1 M Mes buffer (pH 7.0). After 4 days at 4◦C, the products
were concentrated and separated using silica gel chromatography
with 4:1 acetonitrile/methanol as the eluent to obtain pure α-
(GlcNAc)2-F. NMR spectra were determined using a JEOL ECX-
400P spectrometer operating at 298 K at a 13C frequency of 100.53
MHz and a 19F frequency of 376.17 MHz. The NMR data for
synthesized α-(GlcNAc)2-F were: 13C-NMR ([2H4]methanol); δ
174.07 (C = O), 107.22 (d, JC1,F 222.3 Hz), 103.08 (C1ꢀ), 80.25,
78.02, 75.59, 74.35, 71.81, 70.32, 65.88, 62.42, 60.96, 57.21,
54.66, 53.75, 23.06 (acetamide), 22.48 (acetamide) and 19F-NMR
([2H4]methanol); δ − 147.89 (dd, JF,H2 27.6 Hz, JF,H1 55.1 Hz).
SDS/PAGE and protein measurement
SDS/PAGE was carried out using the method of Laemmli [24]
using a 15% acrylamide gel. Proteins on the gel were stained
with Coomassie Brilliant Blue R250. Protein concentrations were
determined by reading absorbance at 280 nm, using a molar
absorption coefficient of BcChi-A obtained from the equation
proposed by Pace et al. [25].
Homology modelling
SWISS-MODEL, a knowledge-based protein modelling tool [26],
was employed to construct the tertiary structure of BcChi-A using
the known X-ray structure of chitinase G from Streptomyces
coelicolor A3(2) (PDB code 2CJL) [27] as a template. The
modelled structure of BcChi-A was used to select mutation targets
for converting the enzyme into a glycosynthase.
Protein expression and purification
Reaction of the BcChi-A enzymes towards α-GlcNAc-F and
α-(GlcNAc)2-F
Site-directed mutagenesis was performed according to Wang and
Malcolm [28] using the QuikChange® site-directed mutagenesis
kit (Stratagene). The BcChi-A mutants and the corresponding
oligonucleotide primers used in the present study are listed in
Supplementary Table S1 (at http://www.BiochemJ.org/bj/444/
bj4440437add.htm). The wild-type and mutated BcChi-A were
successfully produced and purified by methods described
previously [23].
The reaction mixture (10 μl), consisting of 4 μM wild-type
BcChi-A and 25 mM donor substrate [α-GlcNAc-F or α-
(GlcNAc)2-F], was incubated in the absence or presence of
25 mM acceptor substrate [GlcNAc or (GlcNAc)2] in 0.1 M
Mops buffer (pH 7.0) at 37◦C for 3 h. The reaction products
were analysed by TLC using a silica gel 60 aluminium sheet
(Merck). The plate was developed in a solvent system of butan-
1-ol/methanol/28.8% ammonium hydroxide (5:4:2, by vol.),
and the carbohydrates were visualized by heating the plate
after dipping it in vanillin/H2SO4 reagent. The glycosynthase
activity of the BcChi-A mutants was examined by incubating the
reaction mixture (10 μl) containing 4 μM enzyme and 25 mM
α-(GlcNAc)2-F (donor) in the absence or presence of (GlcNAc)2
Chemoenzymatic synthesis of α-GlcNAc-F (α-GlcNAc fluoride) and
α-(GlcNAc)2-F [α-(GlcNAc)2 fluoride]
α-GlcNAc-F was synthesized by the reaction of tetra-O-acetyl
GlcNAc with pyrydinium poly(hydrogen fluoride), followed by
ꢁ
c
ꢁ
c
The Authors Journal compilation 2012 Biochemical Society

A glycosynthase derived from an inverting GH19 chitinase
439
(acceptor) in 0.1 M Mops buffer (pH 7.0) for 3 h at 37◦C. The
reaction products were analysed by TLC as described above. To
analyse the reaction products with HPLC, the donor and acceptor
concentrations were increased to 0.1 M respectively. After 30, 60,
90, 120 and 180 min, the enzymatic reaction was terminated by
adding an equal volume of 0.1 M NaOH solution, and the mixture
was applied to a gel-filtration column of TSK-GEL G2000PW
(Tosoh). Elution was carried out with distilled water at a flow
rate of 0.3 ml/min. Oligosaccharides were detected by ultraviolet
absorption at 220 nm.
ammonium gas in methanol [20,21,32,34,35]. We first tried to
synthesize α-(GlcNAc)2-F by this standard procedure. However,
the yield of α-(GlcNAc)2-F was very low. On the other hand, ChBP
catalyses reversible phosphorolysis of (GlcNAc)2, producing
GlcNAc 1-phosphate and GlcNAc. For the synthetic (reverse)
reaction, ChBP employs not only GlcNAc 1-phosphate, but
also α-GlcNAc-F as a donor substrate. In addition, α-GlcNAc-
F was found to act as both a donor and an acceptor substrate
in ChBP-catalysed synthesis [32]. Thus, in the present study,
a chemoenzymatic method without protection of the hydroxy
group was employed to obtain α-(GlcNAc)2-F directly from
α-GlcNAc-F using the synthetic reaction catalysed by ChBP
[31] (Figure 1A). After incubation of α-GlcNAc-F (33 mg,
0.15 mmol) with ChBP (23 nmol), the products were separated by
silica gel chromatography to obtain pure α-(GlcNAc)2-F (13 mg,
0.03 mmol). Chemical shifts and coupling constants obtained
from the NMR spectra of the product were consistent with the
structure of α-(GlcNAc)2-F. The yield of α-(GlcNAc)2-F was
20%.
F− -releasing activity
The F− -releasing activity was assayed colorimetrically using a
La3 + -ALC (lanthanum/alizarin complexon) solution using the
method of Shoda et al. [33]. The enzymatic F− release reaction
was performed in a reaction mixture consisting of 4 μM enzyme
(wild-type, S102A, S102C or S102G), 25 mM α-(GlcNAc)2-F
and 25 mM (GlcNAc)2 in 0.1 M Mops buffer (pH 7.0) at 37◦C, as
shown in Figure 1(B). After incubation for 180 min, 2 ml of 0.5%
La3 + -ALC solution containing 50% (v/v) acetone was added
to the mixture (10 μl) and incubated for 90 min at 25◦C. The
amount of F− liberated from α-(GlcNAc)2-F (the first reaction
step in Figure 1B) was quantified by measuring the absorbance at
620 nm using the standard curve obtained with authentic sodium
fluoride solutions.
Reactivity of the wild-type BcChi-A towards α-GlcNAc-F and
α-(GlcNAc)2-F
Prior to converting BcChi-A into a glycosynthase, we examined
whether the enzyme catalyses the Hehre resynthesis–hydrolysis
reaction. The results are shown in Figure 2(A). The wild-type
BcChi-A was incubated with α-GlcNAc-F (lane 3), α-GlcNAc-F
and GlcNAc (lane 4), or α-GlcNAc-F and (GlcNAc)2 (lane 5).
The enzyme was also incubated with α-(GlcNAc)2-F (lane 6),
α-(GlcNAc)2-F and GlcNAc (lane 7), or α-(GlcNAc)2-F and
(GlcNAc)2 (lane 8). No matter whether the acceptor substrate
[GlcNAc or (GlcNAc)2] was present or not in the reaction mixture,
α-GlcNAc-F was not consumed even after 3 h of incubation, as
was observed from the intensity of the corresponding TLC spots
(lanes 3, 4 and 5). In contrast, α-(GlcNAc)2-F was consumed
by the enzyme in all cases (lanes 6, 7 and 8). The spots
corresponding to α-(GlcNAc)2-F disappeared and (GlcNAc)2
became visible (lanes 6 and 7). In lane 8, the spots of α-
(GlcNAc)2-F disappeared, and the TLC spot corresponding to
(GlcNAc)2 became more intensive than the spots in lanes 6
and 7. This could be explained by the reaction scheme shown
in Figure 1(B); that is, the acceptor (GlcNAc)2 was linked
to the donor α-(GlcNAc)2-F, producing hydrogen fluoride and
(GlcNAc)4, which was hydrolysed again into (GlcNAc)2. It
was assumed that the amount of (GlcNAc)2 in the reaction
mixture was doubled by the formation of (GlcNAc)2 from α-
(GlcNAc)2-F. It appears that the wild-type BcChi-A catalyses the
Hehre resynthesis–hydrolysis reaction. However, at this point,
the simple hydrolysis of α-(GlcNAc)2-F by the wild-type BcChi-
A could not be ruled out.
Hydrolytic activity of BcChi-A and its mutants towards (GlcNAc)6
The specific activity of wild-type BcChi-A and its mutants
was determined using the (GlcNAc)6 substrate. The enzymatic
reaction was performed in 50 mM sodium acetate buffer (pH 5.0)
at 40◦C. The enzyme and substrate concentrations were 0.2 μM
and 4.75 mM respectively. At a given reaction time, the enzymatic
reaction was terminated by adding an equal volume of 0.1 M
NaOH solution, and the mixture was applied to a gel-filtration
column of TSK-GEL G2000PW (Tosoh) as described above.
(GlcNAc)n was detected by ultraviolet absorption at 220 nm. The
peak area obtained for (GlcNAc)6 was converted into a molar
concentration, which was then plotted against the reaction time.
Specific activity was determined from the initial velocity of the
(GlcNAc)6 degradation.
MALDI–TOF-MS (matrix-assisted laser-desorption
ionization–time-of-flight MS) of the glycosynthase reaction
products
Products obtained from the glycosynthase reaction were identified
by MALDI–TOF-MS. The reaction mixture, consisting of 4 μM
BcChi-A S102A, 25 mM α-(GlcNAc)2-F and (GlcNAc)2 in
0.1 M Mops buffer (pH 7.0) was incubated for 3 h at 37◦C. A
portion (1 μl) of the reaction mixture was mixed with an equal
volume of 2,5-DHB (2,5-dihydroxy benzoic acid) [20 mg/ml in
acetonitrile/water, 80:20 (v:v)]. After the addition of 0.1 μl of
0.1% trifluoroacetic acid, the mixture was placed on to a plate in
a MALDI micro MX (Waters), and then dried. Mass spectra were
obtained in positive-ion reflection mode. (GlcNAc)n (n = 1–6)
were used as standard m/z.
Production and hydrolytic activity of the BcChi-A mutants
To convert BcChi-A into a glycosynthase, we tried to find the
mutation targets by closely examining the modelled structure of
BcChi-A obtained from the crystal structure of a GH19 chitinase
G from S. coelicolor A3(2) (PDB code 2CJL) as a template [27].
In Figure 3, the modelled structure of BcChi-A (light green)
was superimposed on to the crystal structure of chitinase G
(cyan) by the aid of the Pair Fitting wizard of the molecular
visualization program PyMOL (http://www.pymol.org). From the
close-up view of the catalytic cleft, we found that the side chains
of Glu68 (catalytic acid) and Glu77 (catalytic base) in chitinase
G fully correspond to those of Glu61 and Glu70 in BcChi-A. A
RESULTS
Synthesis of α-(GlcNAc)2-F
Various glycosyl fluorides have been generally synthesized
from O-acetate sugars with pyrydinium poly(hydrogen fluoride),
followed by O-deacetylation using sodium methoxide or
ꢁ
c
ꢁ
c
The Authors Journal compilation 2012 Biochemical Society

440
T. Ohnuma and others
Figure 2 Action of BcChi-A towards α-GlcNAc-F and α-(GlcNAc)2-F in the absence or presence of (GlcNAc)n (n = 1 or 2)
(A) Wild-type BcChi-A. The reaction was conducted by incubating a reaction mixture (10 μl) consisting of 4 μM wild-type BcChi-A and 25 mM donor substrate [α-GlcNAc-F or α-(GlcNAc)2-F] in
◦
the absence or presence of 25 mM acceptor substrate [GlcNAc or (GlcNAc)2] in 0.1 M Mops buffer (pH 7.0) at 37 C for 3 h. The reaction products were analysed by TLC. Lanes 1 and 2, α-GlcNAc-F
and α-(GlcNAc)2-F respectively, incubated without the enzyme; and lanes 3, 4 and 5, α-GlcNAc-F, α-GlcNAc-F and GlcNAc, and α-GlcNAc-F and (GlcNAc)2 respectively, incubated with the enzyme;
lanes 6, 7 and 8, α-(GlcNAc)2-F, α-(GlcNAc)2-F and GlcNAc, and α-(GlcNAc)2-F and (GlcNAc)2 respectively incubated with the enzyme. M is the standard for (GlcNAc)n (n = 1–6). Roman numerals
in the profile indicate the degrees of polymerization of (GlcNAc)n. (B) Mutant BcChi-A. The reaction was conducted by incubating the reaction mixture (10 μl) containing 4 μM enzyme and 25 mM
◦
α-(GlcNAc)2-F (donor) in the absence or presence of (GlcNAc)2 (acceptor) in 0.1 M Mops buffer (pH 7.0) for 3 h at 37 C. Lane 1, without enzyme; lane 2, wild-type BcChi-A; lane 3, S102A; lane 4,
S102C; lane 5, S102D; lane 6, S102G; lane 7, S102H; lane 8, S102T; lane 9, E70G; and lane 10, E70Q. Roman numerals in the profile indicate the degrees of polymerization of (GlcNAc)n.
Figure 3 Superimposition of the modelled structure of BcChi-A and the template structure chitinase G from S. coelicolor A3(2) (PDB code 2CJL)
The side chains of Glu68, Glu77 and Ser111 of chitinase G and the corresponding residues of Glu61, Glu70 and Ser102 of BcChi-A are shown in stick representation. The water molecule that is
co-ordinated with Glu77 and Ser111 by hydrogen bonding (broken lines) is represented as a red sphere. Glu70 and Ser102 were the mutation targets for creating a glycosynthase.
water molecule represented by a red sphere is co-ordinated with
Glu77 and Ser111 in chitinase G by hydrogen bonding (broken
line), and Ser111 of chitinase G corresponds to Ser102 of BcChi-A.
Thus in BcChi-A Glu70 and Ser102 probably act as the catalytic
base and hold a nucleophilic water molecule in the catalytic cleft
respectively, and appear to correspond to Asp263 and Tyr198
respectively of Rex. Therefore we mutated Glu70 and Ser102 to
obtain eight mutated enzymes (Supplementary Table S1). All
mutants, E70G, E70Q, S102A, S102C, S102D, S102G, S102H
and S102T, were expressed in amounts equivalent to that of the
wild-type and purified to homogeneity (Supplementary Figure S1
at http://www.BiochemJ.org/bj/444/bj4440437add.htm). In all of
the mutated enzymes, except S102T, hydrolytic activity towards
(GlcNAc)6 was not detected under the conditions we employed.
A very low residual activity might have been undetected in this
assay condition. Only S102T exhibited a significant enzymatic
activity, 43% of that of the wild-type BcChi-A, indicating an
importance of the hydroxy group at the 102nd position probably
in forming a hydrogen bond with a nucleophilic water molecule.
Glu70 and Ser102 were found to be critically important for the
hydrolytic activity, and the mutations of these residues might be
an appropriate strategy to suppress the hydrolytic activity, leading
to accumulation of the synthetic product shown in the middle of
Figure 1(B).
Glycosynthase activity of the BcChi-A mutants
Since α-GlcNAc-F was not consumed by the wild-type BcChi-A
(Figure 2A), the synthetic ability of the BcChi-A mutants was
tested with only α-(GlcNAc)2-F as the donor substrate in the
presence of (GlcNAc)2 as the acceptor substrate. As seen in
the TLC profile in Figure 2(B), the spot corresponding to
α-(GlcNAc)2-F disappeared, and the spot corresponding
to (GlcNAc)4 appeared in lanes 3, 4, 6 and 9. This indicates
that the S102A, S102C, S102G and E70G mutants exhibited
glycosynthase activity and that the (GlcNAc)2 production from
α-(GlcNAc)2-F observed in Figure 2(A) is resulting from the
Hehre resynthesis–hydrolysis reaction catalysed by the wild-type
BcChi-A. In lane 2, only the spot of α-(GlcNAc)2-F became
faint, indicating consumption of the substrate by the wild-type.
ꢁ
c
ꢁ
c
The Authors Journal compilation 2012 Biochemical Society

A glycosynthase derived from an inverting GH19 chitinase
441
Figure 5 F− -releasing activity of the wild-type BcChi-A and the Ser102
mutants
The reaction was conducted in a mixture consisting of 4 μM enzyme (wild-type, S102A, S102C
or S102G), 25 mM α-(GlcNAc)2-F and 25 mM (GlcNAc)2 in 0.1 M Mops buffer (pH 7.0) at
◦
37 C. After 180 min of incubation, the amount of F− liberated from α-(GlcNAc)2-F was
quantified by the method described in the Materials and methods section.
F− -releasing activity of BcChi-A and the mutants possessing
glycosynthase activity
The amounts of F− released from α-(GlcNAc)2-F by the wild-
type BcChi-A, S102A, S102C and S102G, were determined using
La3 + -ALC. As shown in Figure 5, the amount of F− released by
the S102A and S102C mutants was approximately 1.5-fold larger
than that released by the wild-type, indicating that the first reaction
step, shown in Figure 1(B), was enhanced by these mutations. In
contrast, the F− -releasing activity was considerably suppressed
in the S102G mutant.
Figure 4 Time-dependent HPLC profiles showing the glycosynthase
reaction catalysed by the BcChi-A Ser102 mutants
The reaction was conducted by incubating the reaction mixture, containing 4 μM enzyme and
0.1 M α-(GlcNAc)2-F (donor) in the presence of 0.1 M (GlcNAc)2 (acceptor) in 0.1 M Mops
◦
buffer (pH 7.0) at 37 C. Aliquots (12 μl) of the reaction mixture were withdrawn at given
MALDI–TOF-MS of the glycosynthase reaction products
sampling times and analysed by HPLC using a column of G2000PW (Tosoh). Elution was
conducted with distilled water at a flow rate of 0.3 ml/min. S102A (A); S102C (B); and S102G
(C). Individual peaks were identified using the authentic solutions of (GlcNAc)n (n = 1–6) and
α-(GlcNAc)2-F as the standards.
MALDI–TOF-MS was used to analyse the products obtained
by the glycosynthase reaction of the S102A mutant, using α-
(GlcNAc)2-F as a donor substrate and (GlcNAc)2 as an acceptor
substrate. After a 3-h reaction with the S102A mutant, the mass
spectra of the products showed three distinct mass signals at m/z
values of 446.8, 853.4 and 1259.7, corresponding to the values
of sodium adduct ions of (GlcNAc)2, (GlcNAc)4 and (GlcNAc)6
respectively (Figure 6B).
In other lanes (5, 7, 8 and 10), the spots of α-(GlcNAc)2-F
remained intact and no products were detected, indicating no
glycosynthase activity for S102D, S102H, S102T and E70Q. The
spot of (GlcNAc)4 in lane 3 was the most intensive, indicating
that S102A possesses the highest glycosynthase activity among
the mutants tested. Further analysis was not conducted for E70G,
because Honda et al. [22] proposed that the mutation of a residue
holding a nucleophilic water molecule is more practical than that
of a catalytic base for creating a glycosynthase from inverting
GHs. Only the Ser102 mutants were examined in further detail.
DISCUSSION
For synthesizing β-glycosides by the glycosynthase reaction, α-
glycosyl fluorides possessing a fluoride in the opposite anomeric
configuration to that of the normal substrates have been used
as the donor substrate [18,20,21]. Therefore as the first step
of the present study we synthesized α-GlcNAc-F using a
standard chemical procedure and then synthesized α-(GlcNAc)2-
F enzymatically from the chemically synthesized α-GlcNAc-F
using ChBP (Figure 1A). This chemoenzymatic method was
successful and appears to be a versatile tool in the synthesis of
various derivatives of glycosides of (GlcNAc)2.
Prior to the glycosynthase reaction of the mutated BcChi-A
enzymes, we examined the reactivity of the wild-type enzyme
towards α-GlcNAc-F and α-(GlcNAc)2-F in the absence or
presence of the acceptor substrate, GlcNAc or (GlcNAc)2, by
TLC (Figure 2A). α-GlcNAc-F was not consumed by the
enzyme at all, regardless of the presence of the acceptor
substrate (Figure 2A, lanes 3, 4 and 5). Previously, BcChi-A was
shown to hydrolyse chitin oligosaccharides having a degree of
polymerization larger than 3 [23,36]. Therefore α-GlcNAc-F was
assumed to be too short to be consumed by the enzyme. The Hehre
resynthesis–hydrolysis reaction shown in Figure 1(A) only took
place when α-(GlcNAc)2-F was employed as a donor substrate.
α-(GlcNAc)2-F was consumed by the enzyme in all cases
Time course of the glycosynthase reaction monitored by HPLC
The time course of the glycosynthase reaction catalysed by the
S102A, S102C and S102G mutants was monitored by HPLC
(Figure 4). In an early stage of the reaction, a single major
fraction of (GlcNAc)2 combined with a minor fraction of α-
(GlcNAc)2-F appeared at the elution time of 108–109 min. The
profile of the S102A mutant shows that with the progress of
the enzymatic reaction α-(GlcNAc)2-F gradually decreased, but
(GlcNAc)4 was accumulated (Figure 4A). The S102C mutant
synthesized (GlcNAc)4, like the S102A mutant, up to 90 min,
but thereafter the peak area for (GlcNAc)4 gradually decreased
(Figure 4B), suggesting that the S102C mutant still retained
a low residual hydrolytic activity and the synthetic product
(GlcNAc)4 was cleaved into (GlcNAc)2 eventually. The S102G
mutant yielded a much smaller amount of (GlcNAc)4 than the
S102A mutant, indicating the lowest glycosynthase activity of
this mutant (Figure 4C).
ꢁ
c
ꢁ
c
The Authors Journal compilation 2012 Biochemical Society

442
T. Ohnuma and others
(Figure 2B, lane 6), although the F− -releasing activity was
suppressed as compared with the wild-type enzyme. This might be
due to a complete inactivity of S102G for chitin oligosaccharide
hydrolysis. Considering both the enhanced F− -releasing activity
and the residual hydrolytic activity, S102A was regarded as
the best glycosynthase among the mutants we tested. X-ray
crystallography of BcChi-A and its mutants is now in progress
to specify the structural factors controlling the glycosynthase
activity.
MALDI–TOF-MS of the products formed by the S102A
mutant showed three mass signals corresponding to the values
of sodium adduct ions of (GlcNAc)2, (GlcNAc)4 and (GlcNAc)6
(Figure 6). This result also revealed that BcChi-A was successfully
converted into a glycosynthase, forming (GlcNAc)4 from α-
(GlcNAc)2-F and (GlcNAc)2. It should be noted that a mass
signal for (GlcNAc)6 was also detected in the reaction products.
This might be interpreted by the glycosynthetic cycles; that
is, (GlcNAc)4 formed by ‘the first cycle’ was consumed as
the acceptor together with α-(GlcNAc)2-F as the donor in ‘the
second cycle’, producing a small but significant amount of
(GlcNAc)6.
Enzymatic synthesis of novel sugar compounds was conducted
by means of transglycosylation of retaining GH18 chitinases
[37,38]. Enhancement of the transglycosylation activity was also
conducted by site-directed mutagenesis [16,17] and by controlling
the effective water concentration [39]. Chemoenzymatic synthesis
of chitin oligosaccharides by the combined use of an activated
donor substrate, sugar oxazoline and a deactivated GH18 chitinase
from Bacillus circulans WL-12 was also reported by Kohri
et al. [40]. Our first glycosynthase derived from a GH19 chitinase
expands the methodology for the enzymatic synthesis of chitin
oligosaccharides and could be useful for synthesizing new sugar
derivatives containing a GlcNAc moiety.
Figure 6 MALDI–TOF-MS of the glycosynthase reaction products
(A) Standard (GlcNAc)2–6 in 0.1 M Mops buffer (pH 7.0). (B) Reaction products. The reaction
mixture, consisting of 4 μM BcChi-A S102A, 25 mM α-(GlcNAc)2-F and (GlcNAc)2 in 0.1 M
◦
Mops buffer (pH 7.0), was incubated for 3 h at 37 C. The standard and the reaction mixture
were mixed with 2,5-DHB on target, and then dried. The numerals 2–6 indicate (GlcNAc)2–6
.
(Figure 2A, lanes 6, 7 and 8), indicating that α-(GlcNAc)2-F
can be both a donor and an acceptor substrate in the enzymatic
reaction.
AUTHOR CONTRIBUTION
Takayuki Ohnuma, Yuji Honda and Tamo Fukamizo designed the study; Takayuki Ohnuma,
Tatsuya Fukuda and Satoshi Dozen performed the experiments; Takayuki Ohnuma, Yuji
Honda, Motomitsu Kitaoka and Tamo Fukamizo analysed the data; and Takayuki Ohnuma,
Yuji Honda and Tamo Fukamizo wrote the paper.
Referring to the strategy proposed by Honda et al. [21,22],
we mutated Glu70 and Ser102 of BcChi-A corresponding to Asp263
and Tyr198 of Rex respectively. As shown in Figure 2(B), a TLC
spot corresponding to (GlcNAc)4 was observed in lanes 3, 4, 6
and 9, indicating that S102A, S102C, S102G and E70G exhibited
glycosynthase activity, producing (GlcNAc)4 from α-(GlcNAc)2-
F and (GlcNAc)2. This is the first report on a glycosynthase
that employs amino sugar fluoride as a donor substrate. Judging
from the intensity of the spots corresponding to the product
(GlcNAc)4, the glycosynthase activities of the Ser102 mutants
decreased in the following order: S102A>S102C>S102G. Honda
and Kitaoka [21] proposed two mechanistic requirements for
creating a glycosynthase from inverting GHs: one is to enhance
F− -releasing activity (the first step in Figure 1B), and the other is
to suppress hydrolytic activity (the second step in Figure 1B).
The F− -releasing activity was enhanced by the S102A and
S102C mutations, whereas the activity was suppressed in S102G
(Figure 5). Thus the glycosynthase activity of the S102 mutants
might be mainly controlled by the F− -releasing activity. However,
the glycosynthase activity of S102A was significantly higher
than that of S102C, although the F− -releasing activities are
almost the same between these two mutants. The difference
in glycosynthase activity between S102A and S102C might
be derived from the difference in residual hydrolytic activity,
which could not be evaluated under the conditions for activity
determination. In fact, the synthesized (GlcNAc)4 was hydrolysed
again by S102C, but not by S102A, as shown in Figure 4.
In S102G, a small amount of (GlcNAc)4 was accumulated
FUNDING
This work was supported by MEXT (Ministry of Education, Culture, Sports, Science and
Technology)[grantnumberS1101035] and, inpart, byagrant-in-aidforscientificresearch
from MEXT [grant number 23780349 (to T.O.)].
REFERENCES
1
Wang, Z., Zheng, L., Yang, S., Niu, R., Chu, E. and Lin, X. (2007) N-acetylchito-
oligosaccharide is a potent angiogenic inhibitor both in vivo and in vitro. Biochem.
Biophys. Res. Commun. 357, 26–31
2
Snaar-Jagalska, B. E., Krens, S. F., Robina, I., Wang, L. X. and Spaink, H. P. (2003)
Specific activation of ERK pathways by chitin oligosaccharides in embryonic zebrafish cell
lines. Glycobiology 13, 725–732
3
4
5
Semino, C. E. and Allende, M. L. (2000) Chitin oligosaccharides as candidate patterning
agents in zebrafish embryogenesis. Int. J. Dev. Biol. 44, 183–193
Ngoa, D. N., Kimb, M. M. and Kim, S. K. (2008) Chitin oligosaccharides inhibit oxidative
stress in live cells. Carbohydr. Polym. 74, 228–234
Kaku, H., Nishizawa, Y., Ishii-Minami, N., Akimoto-Tomiyama, C., Dohmae, N., Takio, K.,
Minami, E. and Shibuya, N. (2006) Plant cells recognize chitin fragments for defense
signaling through a plasma membrane receptor. Proc. Natl. Acad. Sci. U.S.A. 103,
11086–1191
6
Miya, A., Albert, P., Shinya, T., Desaki, Y., Ichimura, K., Shirasu, K., Narusaka, Y.,
Kawakami, N., Kaku, H. and Shibuya, N. (2007) CERK1, a LysM receptor kinase, is
essential for chitin elicitor signaling in Arabidopsis. Proc. Natl. Acad. Sci. U.S.A. 104,
19613–19618
ꢁ
c
ꢁ
c
The Authors Journal compilation 2012 Biochemical Society

A glycosynthase derived from an inverting GH19 chitinase
443
7
8
Woo, C. J. and Park, H. D. (2003) An extracellular Bacillus sp. chitinase for the
production of chitotriose as a major chitinolytic product. Biotechnol. Lett 25, 409–412
Rupley, J. A. (1964) The hydrolysis of chitin by concentrated hydrochloric acid, and the
preparation of low-molecular-weight substrates for lysozyme. Biochim. Biophys. Acta 83,
245–255
Berkeley, R. C., Brewer, S. J. and Ortiz, J. M. (1972) Preparation of 2-acetamido-
2-deoxy-β-D-glucose oligosaccharides from acid hydrolyzates of chitin by electrolytic
desalting and exclusion chromatography. Anal. Biochem. 46, 687–690
24 Laemmli, U. K. (1970) Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature 227, 680–685
25 Pace, C. N., Vajdos, F., Fee, L., Grimsley, G. and Gray, T. (1995) How to measure and
predict the molar absorption coefficient of a protein. Protein Sci. 4, 2411–2423
26 Peitsch, M. (1995) Protein modeling by e-mail. Biotechnology 13, 658–660
27 Hoell, I. A., Dalhus, B., Heggset, E. B., Aspmo, S. I. and Eijsink, V. G. (2006) Crystal
structure and enzymatic properties of a bacterial family 19 chitinase reveal differences
from plant enzymes. FEBS J. 273, 4889–4900
9
10 Barroca-Aubry, N., Pernet-Poil-Chevrier, A., Domard, A. and Trombotto, S. (2010)
Towards a modular synthesis of well-defined chitooligosaccharides: synthesis of the four
chitodisaccharides. Carbohydr. Res. 345, 1685–1697
28 Wang, W. and Malcolm, B. A. (1999) Two-stage PCR protocol allowing introduction of
multiple mutations, deletions and insertions using QuikChange Site-Directed
Mutagenesis. Biotechniques 26, 680–682
11 Henrissat, B. and Davies, G. (1997) Structural and sequence-based classification of
glycoside hydrolases. Curr. Opin. Struct. Biol. 7, 637–644
29 Hayashi, M., Hashimoto, M. and Noyori, R. (1984) Simple synthesis of glycosyl fluorides.
Chem. Lett. 13, 1747–1750
12 Fukamizo, T. (2000) Chitinolytic enzymes: catalysis, substrate binding, and their
application. Curr. Protein Pept. Sci. 1, 105–124
30 Yokoyama, M. (2000) Methods of synthesis of glycosyl fluorides. Carbohydr. Res. 327,
5–14
13 Taira, T., Hayashi, H., Tajiri, Y., Onaga, S., Uechi, G., Iwasaki, H., Ohnuma, T. and
Fukamizo, T. (2009) A plant class V chitinase from a cycad (Cycas revoluta): biochemical
characterization, cDNA isolation, and posttranslational modification. Glycobiology 19,
1452–1461
14 Fukamizo, T., Sasaki, C., Schelp, E., Bortone, K. and Robertus, J. D. (2001) Kinetic
properties of chitinase-1 from the fungal pathogen Coccidioides immitis. Biochemistry
40, 2448–2454
15 Cote, G. L. and Tao, B. Y. (1990) Oligosaccharide synthesis by enzymatic
transglycosylation. Glycoconjugate J. 7, 145–162
16 Martinez, E. A., Boer, H., Koivula, A., Samain, E., Driguez, H., Armand, S. and Cottaz, S.
(2012) Engineering chitinases for the synthesis of chitin oligosaccharides: catalytic amino
acid mutations convert the GH-18 family glycoside hydrolases into transglycosylases J.
Mol. Catal. B: Enzym. 74, 89–96
17 Zakariassen, H., Hansen, M. C., Jøranli, M., Eijsink, V. G. and Sørlie, M. (2011)
Mutational effects on transglycosylating activity of family 18 chitinases and construction
of a hypertransglycosylating mutant. Biochemistry 50, 5693–5703
18 Mackenzie, L. F., Wang, Q., Warren, R. A. J. and Withers, S. G. (1998) Glycosynthases:
mutant glycosidases for oligosaccharide synthesis. J. Am. Chem. Soc. 120, 5583–5584
19 Shaikh, F. A. and Withers, S. G. (2008) Teaching old enzymes new tricks: engineering and
evolution of glycosidases and glycosyl transferases for improved glycoside synthesis.
Biochem. Cell Biol. 86, 169–177
20 Williams, S. J. and Withers, S. G. (2000) Glycosyl fluorides in enzymatic reactions.
Carbohydr. Res. 327, 27–46
21 Honda, Y. and Kitaoka, M. (2006) The first glycosynthase derived from an inverting
glycoside hydrolase. J. Biol. Chem. 281, 1426–1431
31 Honda, Y., Kitaoka, M. and Hayashi, K. (2004) Reaction mechanism of chitobiose
phosphorylase from Vibrio proteolyticus: identification of family 36 glycosyltransferase in
Vibrio. Biochem. J. 377, 225–232
32 Honda, Y., Kitaoka, M. and Hayashi, K. (2004) Kinetic evidence related to substrate-
assisted catalysis of family 18 chitinases. FEBS Lett. 567, 307–310
33 Shoda, S., Shintate, K., Ishihara, M., Noguchi, M. and Kobayashi, A. (2007) Colorimetric
assay for evaluating glycosyl fluoride-hydrolyzing activity of glycosidase by using alizarin
complexon reagent. Chem. Lett. 36, 16–17
34 Kim, Y. W., Fox, D. T., Hekmatm, O., Kantner, T., McIntosh, L. P., Warren, R. A. and
Withers, S. G. (2006) Glycosynthase-based synthesis of xylo-oligosaccharides using an
engineered retaining xylanase from Cellulomonas fimi. Org. Biomol. Chem. 4,
2025–2032
35 Wada, J., Honda, Y., Nagae, M., Kato, R., Wakatsuki, S., Katayama, T., Taniguchi, H.,
Kumagai, H., Kitaoka, M. and Yamamoto, K. (2008) 1,2-α-l-Fucosynthase: a
glycosynthase derived from an inverting α-glycosidase with an unusual reaction
mechanism. FEBS Lett. 582, 3739–3743
36 Ohnuma, T., Sørlie, M., Fukuda, T., Kawamoto, N., Taira, T. and Fukamizo, T. (2011) Chitin
oligosaccharide binding to a family GH19 chitinase from the moss Bryum coronatum.
FEBS J. 278, 3991–4001
37 Fujimoto, H., Takayanagi, T. and Ajisaka, K. (1994) Synthesis of N-acetyl-glucosamine
modified ara-C and its effect on ovarian cancer cells. J. Med. Chem. 37, 3668–3670
38 Li, C., Huang, W. and Wang, L. X. (2008) Chemoenzymatic synthesis of N-linked
neoglycoproteins through a chitinase-catalyzed transglycosylation. Bioorg. Med. Chem.
16, 8366–8372
39 Usui, T., Matsui, H. and Isobe, K. (1990) Enzymic synthesis of useful chitooligo-
saccharides utilizing transglycosylation by chitinolytic enzymes in a buffer containing
ammonium sulfate. Carbohydr. Res. 203, 65–77
40 Kohri, M., Kobayashi, A., Noguchi, M., Kawaida, S., Watanabe, T. and Shoda, S. (2006)
Stepwise synthesis of chitooligosaccharides through a transition-state analogue substrate
catalyzed by mutants of chitinase A1 from Bacillus circulans WL-12. Holzforschung 60,
485–491
22 Honda, Y., Fushinobu, S., Hidaka, M., Wakagi, T., Shoun, H., Taniguchi, H. and Kitaoka,
M. (2008) Alternative strategy for converting an inverting glycoside hydrolase into a
glycosynthase. Glycobiology 18, 325–330
23 Taira, T., Mahoe, Y., Kawamoto, N., Onaga, S., Iwasaki, H., Ohnuma, T. and Fukamizo, T.
(2011) Cloning and characterization of a small family 19 chitinase from moss (Bryum
coronatum). Glycobiology 21, 644–654
Received 9 January 2012/5 March 2012; accepted 21 March 2012
Published as BJ Immediate Publication 21 March 2012, doi:10.1042/BJ20120036
ꢁ
c
ꢁ
c
The Authors Journal compilation 2012 Biochemical Society

Biochem. J. (2012) 444, 437–443 (Printed in Great Britain) doi:10.1042/BJ20120036
SUPPLEMENTARY ONLINE DATA
A glycosynthase derived from an inverting GH19 chitinase from the moss
Bryum coronatum
Takayuki OHNUMA*, Tatsuya FUKUDA*, Satoshi DOZEN*, Yuji HONDA†, Motomitsu KITAOKA‡ and Tamo FUKAMIZO*1
*Department of Advanced Bioscience, Kinki University, 3327-204 Nakamachi, Nara 631-8505, Japan, †Department of Food Science, Ishikawa Prefectural University, 1-308 Suematsu,
Nonoichi, Ishikawa 921-8836, Japan, and ‡National Food Research Institute, National Agriculture and Food Research Organization, 2-1-12, Kannondai, Tsukuba, Ibaraki 305-8642,
Japan
Figure S1 SDS/PAGE of BcChi-A and its mutants
The samples were subjected to SDS/PAGE and protein bands were stained with Coomassie
Brilliant Blue R-250. M, Marker; lane 1, BcChi-A; lane 2, S102A; lane 3, S102C; lane 4, S102D;
lane 5, S102G; lane 6, S102H; lane 7, S102T; lane 8, E70G; and lane 9, E70Q. Molecular mass
is given in kDa on the left-hand side.
Table S1 BcChi-A mutants and the sequences of their oligonucleotide
primers
The mutation sites are underlined.
Mutant
Oligonucleotide primer (5ꢀ→3ꢀ)
S102A
S102C
S102D
S102G
S102H
S102T
E70G
CGTGGTCCAATCCAACTCGCATGGAACTACAACTATGGCG
CGTGGTCCAATCCAACTCTGCTGGAACTACAACTATGGCG
CGTGGTCCAATCCAACTCGACTGGAACTACAACTATGGCG
CGTGGTCCAATCCAACTCGGCTGGAACTACAACTATGGCG
CGTGGTCCAATCCAACTCCACTGGAACTACAACTATGGCG
CGTGGTCCAATCCAACTCACATGGAACTACAACTATGGCG
GGGTTGCAGTTTATCCAAGGGCAAAACCCACAGAGTGATT
GGGTTGCAGTTTATCCAACAGCAAAACCCACAGAGTGATT
E70Q
Received 9 January 2012/5 March 2012; accepted 21 March 2012
Published as BJ Immediate Publication 21 March 2012, doi:10.1042/BJ20120036
1
To whom correspondence should be addressed. (email fukamizo@nara.kindai.ac.jp).
ꢁ
c
ꢁ
c
The Authors Journal compilation 2012 Biochemical Society