Heterologous expression and biochemical characterization of α-glucosidase from aspergillus niger by pichia pastroris

Article abstract of DOI:10.1021/jf1000502

The aglu of Aspergillus niger encodes the pro-protein of α-glucosidase, and the mature form of wild-type enzyme is a heterosubunit protein. In the present study, the cDNA of α-glucosidase was cloned and expressed in Pichia pastoris strain KM71. The activity of recombinant enzyme in a 3 L fermentor reached 2.07 U/mL after 96 h of induction. The recombinant α-glucosidase was able to produce oligoisomaltose. The molecular weight of the recombinant enzyme was estimated to be about 145 kDa by SDS-PAGE, and it reduced to 106 kDa after deglycosylation. The enzymatic activity of recombinant α-glucosidase was not significantly affected by a range of metal ions. The optimum temperature of the enzyme was 60 °C, and it was stable below 50 °C. The enzyme was active over the range of pH 3.0-7.0 with maximal activity at pH 4.5. Using pNPG as substrate, the K_m and V_max values were 0.446 mM and 43.48 U/mg, respectively. These studies provided the basis for the application of recombinant α-glucosidase in the industry of functional oligosaccharides.

Full text of DOI:10.1021/jf1000502

J. Agric. Food Chem. 2010, 58, 4819–4824 4819
DOI:10.1021/jf1000502
Heterologous Expression and Biochemical Characterization of
r-Glucosidase from Aspergillus niger by Pichia pastroris
†,‡
DONG-L
I
C
HEN
,
†,‡ XING
HU-GUANG
T
ONG
,
†,‡ SHANG-WEI
C
HEN
,*,†,‡ AND
,
†,‡ SHENG
IAN HEN
C
HEN
,
,†,‡
†,‡ DAN
WU,
S
F
ANG,§ JING
W
U
J
C
*
†State Key Laboratory of Food Science and Technology, Jiangnan University, 1800 Lihu Avenve,
Wuxi 214122, People’s Republic of China, ‡School of Biotechnology, Jiangnan University,
1800 Lihu Avenue, Wuxi 214122, People’s Republic of China, and §Leipu Biotechnology Limited
Company, 720-1-216 Chailun Road, Shanghai 201203, People’s Republic of China
The aglu of Aspergillus niger encodes the pro-protein of R-glucosidase, and the mature form of wild-type
enzyme is a heterosubunit protein. In the present study, the cDNA of R-glucosidase was cloned and
expressed in Pichia pastoris strain KM71. The activity of recombinant enzyme in a 3 L fermentor reached
2.07 U/mL after 96 h of induction. The recombinant R-glucosidase was able to produce oligoisomaltose.
The molecular weight of the recombinant enzyme was estimated to be about 145 kDa by SDS-PAGE,
and it reduced to 106 kDa after deglycosylation. The enzymatic activity of recombinant R-glucosidase
was not significantly affected by a range of metal ions. The optimum temperature of the enzyme was
60 °C, and it was stable below 50 °C. The enzyme was active over the range of pH 3.0-7.0 with
maximal activity at pH 4.5. Using pNPG as substrate, the Km and Vmax values were 0.446 mM and 43.48
U/mg, respectively. These studies provided the basis for the application of recombinant R-glucosidase in
the industry of functional oligosaccharides.
KEYWORDS: R-Glucosidase; Aspergillus niger; Picha pastoris; expression; characterization
INTRODUCTION
pro-protein (11). It was suggested that the pro-protein was subjected
to limited proteolysis after secretion from the A. niger cells and 14
residues inside the polypeptide were cleaved, which resulted in a
heterosubunit protein of the mature form of R-glucosidase (11).
Probably due to this special phenomena, expression of aglu has been
attempted only in fungal species, such as Aspergillus nidulans (11)and
Emericella nidulans (12). Increasing copy number of aglu by chro-
mosomal integration could also improve the yield of R-glucosidase in
A. niger (13). However, the yield obtained by these efforts was still
low and could not reach the requirement of industrial applications.
The yeast Pichia pastoris expression system, as a eukaryotic
expression system, has been a favorite system for expressing
heterologous proteins due to its many advantages, such as high
production and high secretion efficiency (14). The Pichia expres-
sion system has been extensively used in the enzyme industry for
the production of recombinant proteins (15). In our previous work,
the cDNA of A. niger (No. SG136) R-glucosidase was cloned
by overlap-PCR and expressed in P. pastoris (16). However, it
was found that the biological activity of the recombinant enzyme
was low. This study described the cloning of the cDNA of
R-glucosidase from another strain of A. niger (CICIM F0620) by
RT-PCR and its expression in P. pastoris. In addition, the
characterization of the recombinant enzyme from P. pastoris
was also investigated. These studies provide the basis for the
application of recombinant R-glucosidase in the industry of
IMOs production.
R-Glucosidases (EC3.2.1.20) are a group of typical exotype
carbohydrases, which catalyze the liberation of R-glucose from non-
reducing terminals of substrates (1). Various types of R-glucosidases
are widespread in nature, distributed in microorganisms, insects,
plants and mammals (2). Some R-glucosidases, e.g. those from
Aspergillus niger (3), Bacillus stearothermophilus (4), Saccharomyces
cerevisiae (5) etc., not only hydrolyze glycosides but also can catalyze
transglucosidation reaction. For example, A. niger R-glucosidase
can transfer a glucosyl residue to the 6-OH of the accepting glucose
unit and yield isomaltose, panose, isomaltotriose and tetrasacchar-
ides from maltose (6, 7). Isomaltose, panose, isomaltotriose and
tetrasaccharides are defined as isomaltooligosaccharides (IMOs) (8).
Since IMOs are stimulating materials to Bifidobacteria and total
lactic acid bacteria of human intestines (7), they are of special interest
to the food industry. In addition, IMOs are also utilized in animal
feed to increase dry matter and calcium digestibility (9).
It has been reported that, among all the R-glucosidases, A. niger
R-glucosidase gives a notable yield of total transglycosylating pro-
ducts (10), therefore, the preparation of R-glucosidase from A. niger
has been long investigated by many researchers. However, low yield
of R-glucosidase from wild-type A. niger makes it uneconomical for
large-scale industrial application, thus genetic engineering approach
is highly necessary for the expression of this enzyme in a new host of
efficiency. Previously, A. niger R-glucosidase gene aglu was identi-
fied by Kimura (1). Biochemical studies showed that aglu was a
MATERIALS AND METHODS
*Corresponding author. Phone: þ86-510-85327802. Fax: þ86-510-
85327802. E-mail: jingwu@jiangnan.edu.cn (J.W.); jchen@jiangnan.
edu.cn (J.C.).
Strains, Vectors and Materials. The strain of A. niger (No. CICIM
F0620) was from China Center for Type Culture Collection (CCTCC).
© 2010 American Chemical Society
Published on Web 04/06/2010
pubs.acs.org/JAFC

4820 J. Agric. Food Chem., Vol. 58, No. 8, 2010
Chen et al.
P. pastoris KM71 and the plasmid pPIC9K were obtained from Invitro-
gen. The EZ-10Spin Column Plasmid Mini-Preps kit, agarose gel DNA
purification kit, restriction enzymes, and T4 DNA ligase were obtained
ethanol and collected by centrifugation (10000g, 20 min). The precipitate
was dissolved in 50 mL of buffer A (20 mM sodium acetate buffer, pH 5.5),
and dialyzed against two liters of buffer A at 4 °C overnight. Solid
(NH4)2SO4 was added to the dialyzed sample to a final concentration of
20% (w/v). The sample was filtered (0.22 μm) and loaded onto a Phenyl
HP Sepharose FF column pre-equilibrated with 20% (NH4)2SO4 in buffer
A. A reverse gradient from 20% to 0% (NH4)2SO4 in buffer A was applied
at a flow rate of 1.0 mL/mim over 60 min. The fractions containing pNPG
hydrolase activity were pooled and dialyzed against 1 L of buffer A
overnight. The purified enzyme was stored at -80 °C.
Molecular Weight Determinations. The subunit molecular weight of
recombinant R-glucosidase was determined by SDS-PAGE. The native
molecular weight of recombinant R-glucosidase was determined by gel
filtration utilizing a Superdex 200 10/300GL column. The elution volume
was determined in triplicate for all samples and standards.
Deglycosylation of Recombinant r-Glucosidase. Ten micrograms
of recombinant R-glucosidase was denatured with glycoprotein denaturing
buffer at 100 °C for 10 min. After the addition of G5 reaction buffer, Endo
Hf was added and the reaction mixture was incubated for 1 h at 37 °C (19).
HPLC Analysis of Purified Recombinant Enzyme. The purified
enzyme was analyzed by gel filtration HPLC on an Agilent separation
module (model 1200) equipped with quaternary pump, using a TSK-gel
G3000SWXL column (7.5 ꢀ 300 mm). The mobile phase consisted of
10 mM sodium phosphate buffer (pH 6.8) used at a flow rate of 0.6 mL/
min. In addition, the enzyme was also subjected to a reverse-phase HPLC
with a C18 column (3.9 ꢀ 150 mm) (Delta-Pak). The reverse-phase HPLC
analysis was performed according to the previous report (2).
Temperature Optimum and Thermostability. The optimal tempera-
ture of the recombinant enzyme was measured at temperatures ranging
between 30 and 90 °C at pH 5.5, using pNPG as substrate in 100 mM
acetate buffer. Since the pH of acetate buffer is temperature-dependent,
the pH of the buffers was adjusted to 5.5 at the desired temperatures. At
each temperature, the buffer and pNPG were preincubated for 5 min. The
reaction was initiated by the addition of the enzyme and allowed to
proceed for an additional 15 min. The thermostability was determined by
incubating the enzyme in 100 mM acetate buffer (pH 5.5) at the various
temperatures (50-70 °C). At different intervals, samples were taken and
assayed for residual activity. The experiments were carried out in three
independent experiments.
from TakaRa (Dalian, China). p-Nitrophenyl-R-D-glucopyranoside
(pNPG) was obtained from Seebio Biotech. Inc. (Shanghai, China). Endo
Hf was obtained from New England Biolabs (Beijing, China). Other
chemicals were obtained from Sinopharm Chemical Reagent Co. Ltd.
(Shanghai, China). DNA primers were synthesized by Shanghai Sangon
Biological Engineering Technology & Services Co. Ltd. (Shanghai,
China). DNA sequencing was performed by Shanghai Sangon Biological
Engineering Technology & Services Co. Ltd.(Shanghai, China).
Gene Cloning of A. niger r-Glucosidase. The cDNA of A. niger
R-glucosidase exclude the fragment of its signal peptide was cloned by RT-
PCR. Total RNA of A. niger was extracted and purified as described
previously (17). cDNA was synthesized using SuperScript III First-Strand
Synthesis System for RT-PCR (Invitrogen, USA). The obtained first-
strand cDNA was served as template for PCR. The cloning primer
sequences were designed according to GenBank (GeneID: 4991096) as
follows: ATTAATGCGGCCGCGTCCACCACTGCCCCT TCC (for-
ward primer) and AGCACTAGCGGCCGCCCATTCCAATACC-
CAGT TTTCC (reverse primer). The NotI restriction site (underlined)
was designed into the primers. The amplification was carried out under the
following conditions: the first step was at 95 °C for 4 min, followed by
30 cycles of 94 °C for 45 s, 58 °C for 45 s, and 72 °C for 4 min, and the final
extension was carried out at 72 °C for 10 min. The PCR product was
digested with NotI, gel-purified and then ligated into pPIC9K which was
subjected to a similar treatment. The recombinant plasmid, pPIC9K/aglu,
was identified by restriction analysis and sequencing.
Expression of r-Glucosidase in P. pastoris. The recombinant
plasmid pPIC9K/aglu was linearized with BglII and then electroporated
into P. pastoris KM71. The transformants were selected at 30 °C on the MD
agar plates for 2-4 days. The presence of the R-glucosidase gene in the
transformants was confirmed by PCR using yeast genomic DNA as
template. For expression, the colonies were grown in 10 mL of YPD medium
at 30 °C for 24 h, then inoculated into 50 mL of BMGY medium and shaken
(200 rpm) at 30 °C until OD600 of 5-6 was reached. The cells were collected
by centrifugation at 5000 rpm for 5 min at 4 °C, resuspended in 25 mL of
BMMY. To maintain induction, methanol was supplemented every 24 h to a
final concentration of 1.0% (v/v) throughout the induction phase.
pH Optimum and Stability. pH optimum of the recombinant enzyme
was measured over a pH range of 3.0-7.0 by using acetate buffer
(pH 3.0-5.0), sodium phosphate buffer (pH 5.0-6.0) and Tris-HCl buffer
(pH 6.0-7.0), respectively. To determine the pH stability, the enzyme was
preincubated in the various buffers described above at 4 °C for 24 h, and
then assayed for residual activity at pH 5.5. The experiments were carried
out in three independent experiments.
Determination of Kinetic Parameters. Enzyme assays were per-
formed in acetate buffer (pH 5.5) at 50 °C using pNPG as substrate. Sub-
strate concentrations were in the range of 0.1-2.0 mM. The Michaelis-
Menten parameters, Vmax and Km, were calculated from double reciprocal
plots of reaction curve (20). The experiments were carried out in three
independent experiments.
The recombinant P. pastoris with the highest R-glucosidase yield was
used to scale up fermentation in a 3 L fermentor (BIOFLO 110, America).
The fermentation began at batch growth phase in 1.5 L BSM at 30 °C and
pH 5.5, and the pH was maintained with ammonium hydroxide. After the
level of dissolved oxygen increased, continuous glycerol feeding was
carried out until the OD600 reached 100. When the dissolved oxygen
increased again, a methanol solution was added to the fermentor. The level
of dissolved oxygen was maintained above 30% throughout the induction
phase. DO-stat methanol feeding strategies were applied.
Hydrolytic Activity of Enzyme. The hydrolytic activity of R-gluco-
sidase was measured as the amount of p-nitrophenol (pNP) released from
pNPG (18). The reaction mixture contained 1 mL of 100 mM sodium
acetate buffer (pH 5.5), 0.05 mL of 10 mM pNPG, and 0.05 mL of
appropriately diluted enzyme. The reaction was incubated at 50 °C for
15 min and terminated by 1 mL of 1 M sodium carbonate solution. One
unit (U) of enzyme activity was defined as the amount of 1 μmol pNP
produced per min under the above conditions.
Transglycosylation Activity of Enzyme. The reaction mixture
(2.5 mL), which consisted of 2 mL of 10% (w/v) maltose solution in
100 mM sodium acetate buffer (pH 5.5) and 500 μL of enzyme (to reach a
final activity of 0.4 U/mL), was incubated at 60 °C. At different intervals,
100 μL reaction mixtures were taken and incubated at 100 °C for 5 min to
inactivate the enzyme. Samples were centrifuged at 12,000 rpm for 5 min
and analyzed by HPLC. The HPLC analysis was performed on an Agilent
separation module (model 1200) equipped with quaternary pump, using a
Hypersil NH2 column (4.6 ꢀ 250 mm). The mobile phase consisted of 75%
acetonitrile and 25% water used at a flow rate of 1 mL/min. A refractive
index detector (Agilent model 1200) was used (5).
Effect of Ions on Enzyme Activity. To determine the effect of metal
ions (Ca2þ, Co2þ, Mg2þ, Mn2þ, Pb2þ, Zn2þ, Fe2þ, Ba2þ, Ni2þ, Cu2þ
,
Al3þ, and Pb2þ) on the recombinant R-glucosidase activity, the enzyme
was preincubated with each metal ion at a 1 mM concentration in 100 mM
acetate buffer (pH 5.5) at 50 °C for 1 h. The residual enzyme activity was
assayed at 50 °C. The experiments were carried out in three independent
experiments.
RESULTS
Cloning and Expression of r-Glucosidase in P. pastoris. The
cDNA of R-glucosidase excluding the fragment of signal peptide
was reverse transcribed from the total RNA of A. niger (CICIM
F0620) and cloned into P. pastoris expression vector pPIC9K.
Nucleotide sequence analysis showed that the gene length was
2883 bp encoding a protein consisting of 960 amino acids. The
cDNA sequence and amino acid sequence were compared with
those of A. niger CBS513.88 R-glucosidase. It was shown that the
cDNA sequence shared 99.8% homology with that of A. niger
Purification of Recombinant r-Glucosidase. The culture super-
natant of engineered P. pastoris was obtained by centrifugation at 10000g
for 20 min and then concentrated by ultrafiltration (30 kDa cutoff
membrane, Amicon). R-Glucosidase was precipitated with 70% (v/v)

Article
J. Agric. Food Chem., Vol. 58, No. 8, 2010 4821
retention time of each peak from HPLC was compared with those
of IMOs standards. As shown in Figure 3, isomaltose, panose,
isomaltotriose were able to be detected in the reaction mixture by
HPLC. The results showed that recombinant R-glucosidase had
transglycosylation activity.
Purification of the Recombinant r-Glucosidase. The recombi-
nant R-glucosidase was purified from culture supernatant by
ultrafiltration, ethanol fraction and hydrophobic interaction
chromatography. The purified enzyme was homogeneous by
SDS-PAGE with a specific activity of 2.52 U/mg.
Physical Properties. The molecular weight of recombinant
enzyme as determined by SDS-PAGE was 145 kDa (Figure 4).
The molecular weight of the native enzyme determined by gel
filtration chromatography was 277 kDa (Figure 5), 1.9 times the
molecular weight determined by SDS-PAGE. Therefore, recom-
binant R-glucosidase is predicted to have a dimeric structure in
solution.
Figure 1. SDS-PAGE analysis of culture supernatant of engineered
P. pastoris. Lane 1 marker; lanes 2-6 culture supernatant of recombinant
P. pastoris after methanol induction from 1 to 5 days at the shaker flask
level; lane 7 control.
In addition, the calculated molecular weight of the mature
R-glucosidase was 106 kDa (http://www.expasy.ch/tools/pi_tool.
html), which is different from that estimated from SDS-PAGE.
This difference is probably caused by glycosylation. Sequence
analysis showed that there were 18 potential N-glycosylation sites
in A. niger R-glucosidase (http://www.cbs.dtu.dk/services/). In
order to confirm whether the recombinant enzyme is glycosy-
lated, the purified enzyme was subjected to be treated by
deglycosylase (Endo Hf). As shown in Figure 4, the molecular
weight of the expressed enzyme was reduced after the treatment.
These results indicated that the recombinant protein was glyco-
sylated in the host of P. pastoris.
Furthermore, the purified enzyme showed one single peak by
HPLC with a TSK-gel column, while it showed two peaks by
HPLC with a reverse phase column (Figure 6).
Figure 2. Time profiles for batch cultivations of recombinant P. pastoris in
3 L fermentor.
Temperature Optimum and Thermostability. The optimum
temperature curve of the purified R-glucosidase showed that the
enzyme activity increased with increasing temperature from 30 to
60 °C and decreased from 60 to 90 °C (Figure 7 A). At the
optimum temperatureof60 °C, the activity was 5-foldhigher than
that at 30 °C.
The thermostable experiment showed that the enzyme retained
50% of activity after 72 h at 50 °C or 3 h at 60 °C, but was rapidly
inactivated above 70 °C (Figure 7 B). Since the stability of the
recombinant R-glucosidase is similar to the wild-type enzyme (2),
which was stated to be stable, the recombinant enzyme from the
yeast expression system in the present study is also considered to
be stable against heat.
pH Optimum and Stability. The optimum pH of recombinant
R-glucosidase was 4.5 (Figure 8 A). The enzyme exhibited the
highest enzymatic activity (>90% of maximum) between pH 3.5
and 5.5. It retained more than 50% of its maximal activity
between pH 3.0 and 8.0 after incubation at 4 °C for 24 h
(Figure 8 B).
Kinetic Studies. The kinetics of the recombinant enzyme was
analyzed using pNPG as substrate. At 50 °C, the Km and Vmax of
the recombinant enzyme were 0.446 mM and 43.48 U/mg,
respectively. The Km value was similar to that of the native
enzyme, which was 0.620 mM (12).
CBS513.88 R-glucosidase(GenBank Accession No. 4991096) and
differed by four nucleotides. The amino acid sequence shared
100% identity with that of A. niger CBS513.88 R-glucosidase
(NCBI Accession No. XP_001402053).
For expression, the recombinants were screened in MD and
YPD/G418 plates, and the insert was identified by PCR. The
P. pastoris KM71 transformed with vector pPIC9K was used as
control. After 120 h of induction on methanol in a shake flask, the
pNPG hydrolase activity in the culture supernatant of recombi-
nant P. pastoris KM71/pPIC9K-aglu reached 1.15 U/mL, which
was 18.2-fold higher than that of native R-glucosidase extracted
from A. niger (CICIM F0620). The protein concentration in the
culture medium was 517 μg/mL. SDS-PAGE analysis showed
that there was one major band of protein, approximately 145
kDa, secreted into the culture medium (Figure 1). No pNPG
hydrolase activity was detected in the culture supernatant of the
control strain under the same culture conditions.
The expression efficiency of the engineered P. pastoris was
further explored in a 3 L fermentor. As shown in Figure 2, after
methanol induction for 5 days, R-glucosidase activity and protein
concentration in the culture supernatant were 2.07 U/mL and
918 μg/mL, which were 1.80-fold and 1.78-fold higher than those
in shake condition, respectively. The yield ofrecombinant enzyme
in the culture media of engineered P. pastoris was 32.8-fold higher
than that of native R-glucosidase extracted from A. niger (No.
CICM F0620).
Metal Requirement. Previously, it was reported that the activity
ofR-glucosidasesfromEscherichiacoli(21),Mucorracemosus(22)
and Thermotoqa maritima (23) was able to be stimulated in the
presence of Al3þ, Ca2þ, Kþ, Mg2þ or Mn2þ (1-10 mM), while
there is no metal requirement information for R-glucosidase of
A. niger. In the present study, the metal requirement of the
recombinant R-glucosidase was analyzed by using 1 mM metal
Transglycosylation Activity of Recombinant r-Glucosidase. To
determine whether the expressed R-glucosidase has transglycosy-
lation activity, the culture supernatant of recombinant P. pastoris
KM71/pPIC9K-aglu was incubated with 10% (w/v) maltose
solution at 60 °C. The progress of the reaction was monitored
byHPLC. Toidentify the components inthe reaction mixture, the
ions (Ca2þ, Co2þ, Mg2þ, Mn2þ, Pb2þ, Zn2þ, Fe2þ, Ba2þ, Ni2þ
,
Cu2þ, Al3þ, and Pb2þ). The enzyme was preincubated with each

4822 J. Agric. Food Chem., Vol. 58, No. 8, 2010
Chen et al.
Figure 3. Analysis of transglucosidation products by HPLC. (A) Standard (commercial IMOs). Peak 1, maltose; peak 2, isomaltose; peak 3, panose; peak 4,
isomaltotriose. (B) Transglucosidation products by recombinant R-glucosidase. Peak 5, glucose.
Figure 4. SDS-PAGE analysis for deglycosylation of recombinant R-
glucosidase. Lane 1, marker; lane 2, recombinant R-glucosidase; lane 3,
deglycosylated recombinant R-glucosidase; lane 4, endoglycosidase Hf
(Endo Hf).
Figure 6. Reverse-phase HPLC of recombinant R-glucosidase.
DISCUSSION
In the industry of functional oligosaccharides, the transglyco-
sylation activity of A. niger R-glucosidase has been applied to
produce IMOs (7). In order to improve the yield of enzyme
production, in the present study, cDNA of A. niger R-glucosidase
was cloned and expressed in P. pastoris KM71. Previously,
A. niger R-glucosidase was expressed in A. nidulans (11) and
E. nidulans (12), and the expression level was reported to be 0.04
U/mg and 0.96 U/mg, respectively. In addition, the yield of
recombinant R-glucosidase obtained from E. nidulans was re-
ported to be 0.65 U/mL (11). In the present study, the enzyme
activity in the culture supernatant of a 3 L fermentor could reach
2.07 U/mL and 2.21 U/mg protein. The high expression level
obtained in the present study probably due to that, compared
with filamentous fungal expression systems, the P. pastoris
expression system has several advantages for expression of
Figure 5. Molecular weight determination of native recombinant R-gluco-
sidase by Superdex 200 10/300 gel filtration chromatography. 1, standard;
2, β-amylase (Mr 200,000); 3, alcohol dehydrogenase (Mr 150,000);
albumin bovine serum (Mr 66,000); carbonic anhydrase (Mr 29,000);
cytochrome C (Mr 12,400); a, recombinant R-glucosidase. Error bars
correspond to the standard deviation of three determinations.
heterologous proteins, including use of the strong and regulated
AOX1 promoter, the effectively selectable markers, secretion
signals and methods for coping with proteases (24).
Previously, cDNA of A. niger (No.SG136) R-glucosidase was
cloned and expressed in P. pastoris in our laboratory; however,
the yield of recombinant R-glucosidase was only 0.08 U/mL. The
low expression level compared to that in the present study of
A. niger (CICIM F0620) might be caused by nonidentical gene
sequences in both cases as well as the low copy number of
the target gene in the host cell. Thus, to the best of our knowledge,
the production of recombinant R-glucosidase obtained in the
present study represents the highest yield reported so far.
metal ion and then assayed for the activity. The results showed
that none of these metals significantly affected the activity of
recombinant enzyme, which suggested that the structure and the
catalysis of the enzyme are not sensitive to the metal ions in the
experimental condition.

Article
J. Agric. Food Chem., Vol. 58, No. 8, 2010 4823
Figure 7. Effects of temperature on activity and stability of recombinant R-glucosidase. (A) Temperature optimum. The activity of recombinant R-glucosidase
at 60 °C was defined as 100%. (B) Thermostability of the enzyme, 50 °C (]), 60 °C (0) and 70 °C (4). The activity of recombinant R-glucosidase without
heat treated was defined as 100%. Error bars correspond to the standard deviation of three independent determinations.
Figure 8. Effects of pH on activity and stability of recombinant R-glucosidase. (A) pH optimum. The activity of recombinant R-glucosidase at pH 4.5 was
defined as 100%. (B) pHstability. The activity of recombinantR-glucosidaseatpH 4.5wasdefinedas100%. Error barscorrespond to thestandard deviation of
three independent detrminations.
Chemical characterization of recombinant A. niger R-glucosi-
dase has been performed previously when the gene of A. niger
R-glucosidase (including introns and extrons) was cloned and
expressed using fungal species as host cell (11-13). Although in
our previous study, the cDNA of A. niger R-glucosidase was
cloned and expressed in yeast, only the condition of transglyco-
sylation reaction of the recombinant enzyme was investi-
gated (16). In order to demonstrate if the R-glucosidase from
the fungal source A. niger has been successfully post-translational
modified in the yeast expression system, in the present study, the
biochemical properties of the recombinant enzyme were char-
acterized in detail.
Comparative biochemical characterization of native R-gluco-
sidase from A. niger and recombinant enzyme from P. pastoris
indicated that they had similar optimal pH and temperature. The
recombinant R-glucosidase remained active at a wide pH range
and was stable against thermal denaturation. These results
showed that the recombinant R-glucosidase was potentially to
be effectively useful in the preparation of IMOs.
of the recombinant enzyme indicated that it was glycosylated in
P. pastoris. Considering the similar catalytic properties between
the wild-type and recombinant enzyme, it seems like the recom-
binant enzyme has the correct glycosylation patterns to ensure its
biological activity.
Previously, it was reported that the gene length of aglu is 3124
bp, containing three introns and four extrons. It encodes 985
amino acids, and the N-terminal sequence from Met-1 to Leu-25
is predicted to be a signal peptide which is similar to the typical
eukaryotic signal sequence (11). In addition, it was found that the
mature wild-type R-glucosidase was actually a heterosubunit
protein, in which the two heterosubunits were composed of
residues 26-252 and 267-985 of aglu respectively. Even though
the mechanism of this mature protein formation process has not
been demonstrated, it was suggested that the pro-protein of aglu
was subjected to a limited proteolysis after secretion from the
cells (11). Interestingly, it was found that the two heterosubunits
had a very tight interaction and could not be separated by
SDS-PAGE, while they were able to be separated by reverse-
phase HPLC (2). In the present study, a similar phenomenon
was also observed. The recombinant enzyme exhibited one
Wild-type R-glucosidase from A. niger is a glycoprotein con-
taining 25.5-27.6% carbohydrate (25). Deglycosylation analysis

4824 J. Agric. Food Chem., Vol. 58, No. 8, 2010
Chen et al.
band on SDS-PAGE, one peak by gel filtration HPLC, and
two peaks by reverse-phase HPLC. Attempting to N-terminal
sequence the recombinant enzyme failed probably due to
glycosylation issues. Considering that the biochemical pro-
perties of recombinant enzyme in the present study are similar
to those of the wild-type, it is assumed that the recombinant
enzyme was also proteolyzed after synthesis and formed a
heterosubunit protein. If this is correct, it may be presumed that
the protease which hydrolyzes the pro-R-glucosidase has no strict
substrate specificity. It not only exists in A. niger but also exists
in P. pastoris. Further information is needed to support this
hypothesis.
In summary, cDNA of A. niger R-glucosidase was cloned,
expressed and characterized in detail. The expression level of 2.07
U/mL and 2.21 U/mg protein obtained in the culture media in the
present study represents the highest yield of A. niger R-glucosi-
dase reported so far. Detailed biochemical characterization
demonstrated that the recombinant enzyme from P. pastoris
was similar to that of native R-glucosidase from A. niger,
suggesting that the recombinant enzyme has been successfully
post-translationally modified in the P. pastoris expression system.
Further enhancement of the yield of the recombinant R-glucosi-
dase by fermentation technology is currently underway in our
laboratory, and these studies will provide the basis for the
application ofrecombinant R-glucosidaseinthe industryofIMOs
production.
(10) Prodanovic, R.; Milosavic, N.; Sladic, D.; Zlatovic, M.; Bozic, B.;
Velickovic, T. C.; Vujcic, Z. Transglucosylation of hydroquinone
catalysed by alpha-glucosidase from baker’s yeast. J. Mol. Catal. B:
Enzym. 2005, 35 (4-6), 142–146.
(11) Nakamura, A.; Nishimura, I.; Yokoyama, A.; Lee, D.-G.; Hidaka,
M.; Masaki, H.; Kimura, A.; Chiba, S.; Uozumi, T. Cloning and
sequencing of an alpha-glucosidase gene from Aspergillus niger and
its expression in A. nidulans. J. Biotechnol. 1997, 53, 75–84.
(12) Ogawa, M.; Nishio, T.; Minoura, K.; Uozumi, T.; Wada, M.;
Hashimoto, N.; Kawachi, R.; Oku, T. Recombinant alpha-glucosi-
dase from Aspergillus niger. Overexpression by Emericella nidulans,
purification and Characterization. J. Appl. Glycosci. 2006, 53, 13–16.
(13) Lee, D. G.; Nishimura-Masuda, I.; Nakamura, A.; Hidaka, M.;
Masaki, H.; Uozumi, T. Overproduction of aphla-glucosidase in
Aspergillus niger transformed with the cloned gene aglA. J. Gen.
Appl. Microbiol. 1998, 44, 177–181.
(14) Ruanglek, V.; Sriprang, R.; Ratanaphan, N.; Tirawongsaroj, P.;
Chantasigh, D.; Tanapongpipat, S.; Pootanakit, K.; Eurwilaichitr,
L. Cloning, expression, characterization and high cell-density pro-
duction of recombinant endo-1,4-β-xylanase from Aspergillus niger
in Pichia pastoris. Enzyme Microb. Technol. 2007, 41 (1-2), 19–25.
(15) Macauley-Patrick, S.; Fazenda, M. L.; McNeil, B.; Harvey, L. M.
Heterologous protein production using the Pichia pastoris expres-
sion system. Yeast 2005, 22 (4), 249–270.
(16) Tong, X.; Tang, Q.; Wu, Y.; Wu, J.; Chen, J. Cloning of the gene
encoding aphla-glucosidase from Aspergillus niger and its expression
in Pichia pastoris. Acta Microbiol. Sin. 2009, 49 (2), 262–268.
(17) Chantasingh, D.; Pootanakit, K.; Champreda, V.; Kanokratana, P.;
Eurwilaichitr, L. Cloning, expression and characterization of a
xylanase 10 from Aspergillus terreus (BCC129) in Pichia pastoris.
Protein Expression Purif. 2006, 46 (1), 143–149.
LITERATURE CITED
(18) Nashiru, O.; Koh, S.; Lee, S.-Y.; Lee, D.-S. Novel R-glucosidase
from extreme thermophile Thermus caldophilus GK24. J. Biochem.
Mol. Biol. 2001, 34 (4), 347–354.
(19) Chen, X.; Cao, Y.; Ding, Y.; Lu, W.; Li, D. Cloning, functional
expression and characterization of Aspergillus sulphureus beta-
mannanase in Pichia pastoris. J. Biotechnol. 2007, 128 (3), 452–461.
(20) Tseng, S. J.; Hsu, J. P. A Comparison of the Parameter Estimating
Procedures for the Michaelis-Menten Model. J. Theor. Biol. 1990,
145 (4), 457–464.
(1) Kimura, A.; Takata, M.; Sakai, O.; Matsui, H.; Takai, N.;
Takayanagi, T.; Nishimura, I.; Uozumi, T.; Chiba, S. Complete
amino acid sequence of crystalline alpha-glucosidase from Aspergil-
lus niger. Biosci., Biotechnol., Biochem. 1992, 56 (8), 1368–1370.
(2) Kita, A.; Matsui, H.; Somoto, A.; Kimura, A.; Takata, M.; Chiba, S.
Substrate specificity and subsite affinities of crystalline alpha-glu-
cosidase from Aspergillus niger. Agric. Biol. Chem. 1991, 55 (9),
2327–2335.
(3) Kato, N.; Suyama, S.; Shirokane, M.; Kato, M.; Kobayashi, T.;
Tsukagoshi, N. Novel alpha-glucosidase from Aspergillus nidulans
with strong transglycosylation activty. Appl. Environ. Microbiol.
2002, 68 (3), 1250–1256.
(21) Olusanya, O.; Olutiola, P. O. Characterisation of maltase from
enteropathogenic Escherichia coli. FEMS Microbiol. Lett. 1986, 36
(2-3), 239–244.
(22) Yamasaki, Y.; Suzuki, Y.; Ozawa, J. Certain properties of alpha-
glucosidase from Mucor racemosus. Agric. Biol. Chem. 1997, 41,
1559–1565.
(23) Raasch, C.; Streit, W.; Schanzer, J.; Bibel, M.; Gosslar, U.; Liebl, W.
Thermotoga maritima Agla, an extremely thermostable NADþ,
Mn2þ, and thiol-dependent alpha-glucosidase. Extremophiles 2000,
4 (4), 189–200.
(24) Cregg, J. M.; Cereghino, J. L.; Shi, J.; Higgins, D. R. Recombinant
protein expression in Pichia pastoris. Mol. Biotechnol. 2000, 16 (1),
23–52.
(4) Mala, S.; Dvorakova, H.; Hrabal, R.; Kralova, B. Towards regio-
selective synthesis of oligosaccharides by use of alpha-glucosidases
with different substrate-specificity. Carbohydr. Res. 1999, 322, 209–
218.
(5) Fernandez-Arrojo, L.; Marin, D.; De Segura, A. G.; Linde, D.;
Alcalde, M.; Gutierrez-Alonso, P.; Ghazi, I.; Plou, F. J.; Fernandez-
Lobato, M.; Ballesteros, A. Transformation of maltose into pre-
biotic isomaltooligosaccharides by a novel alpha-glucosidase from
Xantophyllomyces dendrorhous. Process Biochem. 2007, 42 (11),
1530–1536.
(25) Lee, S. S.; He, S.; Withers, S. G. Identification of the catalytic
nucleophile of the Family 31 alpha-glucosidase from Aspergillus
niger via trapping of a 5-fluoroglycosyl-enzyme intermediate. Bio-
chem. J. 2001, 359, 381–386.
(6) McCleary, V. B.; Gibson, T. S.; Sheehan, H.; Casey, A.; Horgan, L.;
O’Flaherty, J. Purification, properties and industrial significance of
transglucosidase from Aspergillus niger. Carbohydr. Res. 1989, 185
(1), 147–162.
(7) Duan, K. J.; Sheu, D. C.; Lin, M. T.; Hsueh, H. C. Reaction
mechanism of isomaltooligosaccharides synthesis by alpha-glucosi-
dase from Aspergillus carbonarious. Biotechnol. Lett. 1994, 16 (11),
1151–1156.
Received for review January 6, 2010. Revised manuscript received
March 17, 2010. Accepted March 23, 2010. This work was supported
financially by the National Outstanding Youth Foundation of China
(20625619), Research Program of State Key Laboratory of Food
Science and Technology (SKLF-MB-200802, SKLF-TS-200910,
SKLF-KF-200909), Program of Innovation Team of Jiangnan
University (2008CXTD01), Public Topic of Key Laboratory of
Industrial Biotechnology, Ministry of Education, Jiangnan University
(KLIB-KF200904) and the Key Program of National Natural Science
Foundation of China (No. 20836003).
(8) Mori, T.; Nishimoto, T.; Okura, T.; Chaen, H.; Fukuda, S. Purifica-
tion and characterization of cyclic maltosyl-(1f 6)-maltose hydro-
lase and alpha-glucosidase from an Arthrobacter globiformis strain.
Biosci., Biotechnol., Biochem. 2008, 72 (7), 1673–1681.
(9) Li, y.-J.; Zhao, G.-Y.; Du, W.; Zhang, T.-J. Effect of dietary
isomaltooligosaccharides on nutrient digestibility and concentration
of glucose, insulin, cholesterol and triglycerides in serum of growing
pigs. Anim. Feed Sci. Technol. 2009, 151 (3-4), 312–315.