Synthesis of moracin C and its derivatives with a 2-arylbenzofuran motif and evaluation of their PCSK9 inhibitory effects in HepG2 cells

Article abstract of DOI:10.3390/molecules26051327

Proprotein convertase subtilisin/kexin type 9 (PCSK9) is a key factor in several cardiovascular diseases, as it is responsible for the elevation of circulating low-density lipoprotein cholesterol (LDL-C) levels in blood plasma by direct interaction with t

Full text of DOI:10.3390/molecules26051327

molecules
Article
Synthesis of Moracin C and Its Derivatives with a
2-arylbenzofuran Motif and Evaluation of Their PCSK9
Inhibitory Effects in HepG2 Cells
Jagadeesh Nagarajappa Masagalli † , Melanayakanakatte Kuberappa BasavanaGowda †, Hee-Sung Chae
and Won Jun Choi *
College of Pharmacy and Integrated Research Institute for Drug Development, Dongguk University,
Seoul 04620, Korea; mnjagadeesh123@gmail.com (J.N.M.); basavanagowdru@gmail.com (M.K.B.);
chaeheesung83@gmail.com (H.-S.C.)
* Correspondence: mp89@dongguk.edu; Tel.: +82-31-961-5219
† These authors contributed equally to this work.
Abstract: Proprotein convertase subtilisin/kexin type 9 (PCSK9) is a key factor in several cardiovas-
cular diseases, as it is responsible for the elevation of circulating low-density lipoprotein cholesterol
(LDL-C) levels in blood plasma by direct interaction with the LDL receptor. The development of
orally available drugs to inhibit this PCSK9-LDLR interaction is a highly desirable objective. Here,
we report the synthesis of naturally occurring moracin compounds and their derivatives with a
2-arylbenzofuran motif to inhibit PCSK9 expression. In addition, we discuss a short approach involv-
ing the three-step synthesis of moracin C and a divergent method to obtain various analogs from
one starting material. Among the tested derivatives, compound 7 (97.1%) was identified as a more
ꢀꢁꢂꢀꢃꢄꢅꢆꢇ
ꢀꢁꢂꢃꢄꢅꢆ
potent inhibitor of PCSK9 expression in HepG2 cells than berberine (60.9%). These results provide a
better understanding of the structure–activity relationships of moracin derivatives for the inhibition
of PCSK9 expression in human hepatocytes.
Citation: Masagalli, J.N.;
BasavanaGowda, M.K.; Chae, H.-S.;
Choi, W.J. Synthesis of Moracin
C and Its Derivatives with a
Keywords: proprotein convertase subtilisin/kexin type 9; low-density lipoprotein cholesterol;
2-arylbenzofuran Motif and
Evaluation of Their PCSK9 Inhibitory
Effects in HepG2 Cells. Molecules
2021, 26, 1327. https://doi.org/
10.3390/molecules26051327
cardiovascular diseases; moracin compounds; structure activity relationships; HepG2 cell lines
1. Introduction
Academic Editor: Luisella Verotta
Cardiovascular diseases (CVDs) are one of the leading causes of death worldwide [
1]
and are caused by various cardiovascular factors [ ], including the elevation of circulating
low-density lipoprotein cholesterol (LDL-C) levels. Proprotein convertase subtilisin/kexin
type 9 (PCSK9) plays an important role in regulating the circulating levels of LDL-C due
2
Received: 19 January 2021
Accepted: 25 February 2021
Published: 2 March 2021
to its ability to inhibit LDL receptor recycling in the liver [3]. The loss-of-function of
PCSK9 in humans significantly lowers LDL-C levels and CVD-related morbidity, which
indicates that PCSK9 could be a promising therapeutic target for the treatment of CVDs by
Publisher’s Note: MDPI stays neutral
with regard to jurisdictional claims in
published maps and institutional affil-
iations.
lowering LDL-C levels [
4]. Thus, PCSK9 inhibition has become the focus for the treatment
of hypercholesterolemia.
Owing to the promise of their therapeutic potential, multiple PCSK9 monoclonal
antibodies (mAbs) have been evaluated in clinical trials. Among these antibodies, two
PCSK9 mAbs (alirocumab and evolocumab) have been approved by the United States Food
and Drug Administration for the treatment of coronary heart disease. In addition, a small
interfering RNA medication, inclisiran, which inhibits the synthesis of PCSK9, lowered
Copyright:
© 2021 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
LDL-C levels in patients with CVD and is in the process of being approved [5]. However,
these drugs are costly and administered by injection only, which may restrict their clinical
use. Therefore, an orally available small molecule targeting PCSK9 would be a highly
desirable alternative therapeutic agent, based on its ease of administration and lower cost.
Small molecules targeting PCSK9—PF-06446846 analogs—identified by Pfizer have
been found to lower the secretion of PCSK9 [
6]. Natural products, such as berberine, ery-
Molecules 2021, 26, 1327. https://doi.org/10.3390/molecules26051327
https://www.mdpi.com/journal/molecules

Molecules 2021, 26, 1327
2 of 11
braedin D, sauchinone, and 3,7,20-trihydroxy-5-methoxy-flavanone, also exhibited potent
inhibitory effects on PCSK9 levels in HepG2 cells [7–9] (Figure 1). Recently, moracin C
(Figure 2), the bioactive ingredient of dried, immature Morus alba fruits, was reported to
downregulate PCSK9 expression in HepG2 cells [10].
Figure 1. Small molecule inhibitors of proprotein convertase subtilisin/kexin type 9 (PCSK9) expression.
Figure 2. Structure of moracin C.
Herein, we describe the preparation of a new series of 2-arylbenzofuran derivatives
with PCSK9 inhibitory activity by chemical modifications of moracin C and the screening
of a library of our synthesized small molecules using PCSK9 expression in HepG2 cells as
the readout.
2. Results and Discussion
2.1. Design and Synthesis of Moracin Derivatives
The retrosynthetic approach for moracin C is outlined in Figure 3. We envisaged
that the aliphatic chain in moracin C (
n-BuLi and prenyl halide, and the construction of the benzofuran skeleton (
M) [11 12] could be achieved by the Sonogashira coupling of halobenzene-diol (
ethynylbenzene-diol (4).
1
) could be easily introduced by prenylation using
, moracin
) with
2
,
3
Figure 3. Retrosynthetic analysis of moracin C.
The formation of the 2-arylbenzofuran nucleus was easily accessible through the Sono-
gashira coupling reaction of 2-iodo-5-methoxyphenol with 1-ethynyl-3,5-dimethoxybenzene
in the presence of PdCl2 (PPh3)2 and CuI in dimethylformamide (DMF). The yield of the
Sonogashira product was higher (62%) than that reported previously [13]. Prenylation of
the 2-arylbenzofuran nucleus was carried out using n-BuLi to afford a mixture of three
components: a 40-prenylated compound
(25%), an isomeric 7-prenylated derivative
(12%), and a di-prenylated compound 10 (15%) (Scheme 1).
5
6
7
8
9

Molecules 2021, 26, 1327
3 of 11
Scheme 1. Reagents and Conditions: (
3,3-dimethylallyl bromide, cyclohexane, 0 C to reflux, 2 h.
a
) PdCl2 (PPh3)2, CuI, TEA, DMF, 100 ◦C, 15 h and (
b) 2.5-M n-BuLi in hexanes,
◦
Several attempts were made for the demethylation of the methyl ether groups in
compound to give moracin C ( ) by employing various conditions (such as BBr3, BCl3,
8
1
AlCl3, and pyridinium p-toluenesulfonate (PPTS)) (Scheme 2) [14]. However, most attempts
failed, resulting in the cyclized/chromane product 11 as the major product (Table 1).
Scheme 2. Demethylation of phenolic ether.
Table 1. Reaction conditions for demethylation *.
Yields (%)
◦
Temp ( C)
Time (h)
Entries
Conditions
Additives
Solvents
1
11
1
2
3
4
5
6
7
8
BBr3
BCl3
AlCl3
-
-
CH2Cl2
CH2Cl2
CH2Cl2
THF
DMF
DMF
−78 to rt
3
4
4
36
5
15 min
3
-
-
-
10
-
-
60
42
-
-
-
35
40
-
−78
Thiourea
Diphenyl phosphine
50
n-BuLi
Sodium mercaptan
PPTS
−78 to reflux
-
-
-
60
120
200
130
Pyridine·HCl
DMF
NMP
-
30
NaOH
1-Dodecane thiol
24
* THF: tetrahydrofuran; NMP: N-methylpyrrolidone; Bold aims to highlight the good result.
The use of acidic reagents leads to a ring-fused/chromane formation due to the
stability of the tertiary carbocation species. Interestingly, the cyclized/chromane compound
11 was found to be Wittifuran D, a natural compound present in the stem bark of Morus
wittiorum (Moraceae) [15]. As a member of the library of moracin derivatives, Wittifuran D
(
11) was easily prepared by demethylation using a conventional reagent, BBr3, and this
method also yielded moracin M (2) from 7.
Among the conditions presented in Table 1, a basic demethylation condition [16
]
using 1-dodecanethiol and NaOH in NMP met our objective in spite of the low yield and a
product mixture consisting of (30%), 12 (14%), and 13 (10%). Compound 12 was found
to be a natural compound, Artoindonesianin O [17] (Scheme 3). The methyl group in
1

Molecules 2021, 26, 1327
4 of 11
the partially demethylated compound, Artoindonesianin O (12), is present at the ortho
position to the prenyl group, which was confirmed by a two-dimensional nuclear magnetic
resonance (NMR) analysis.
◦
Scheme 3. Reagents and conditions: (
NMP, NaOH, 130 C, 24 h.
a) 1.0-M BBr3, CH2Cl2,
−
78 C to room temperature (rt), 3 h and (
b) 1-dodecanethiol,
◦
A similar method was applied to the intermediate compounds 9 and 10, resulting in
fully deprotected final products 14 (moracin S) [18] and 16 (morusalfuran D) [19] and two
new partially deprotected moracin derivatives, 15 and 17 (Scheme 3).
2.2. Inhibitory Activity against PCSK9 mRNA Expression
The inhibitory effects of a series of synthesized Moracin C and its derivatives on
PCSK9 mRNA was measured by quantitative RT-PCR using human hepatoma HepG2 cells
(Figure 4A).

Molecules 2021, 26, 1327
5 of 11
Figure 4. Identification of compound
quantitative RT-PCR. The expression of PCSK9 mRNA was measured in HepG2 cells after the treatment of compounds
(20 M) and berberine HCl (BER; 20 M) for 24 h. Mean values of three independent experiments are shown, and the
) Western blot analysis indicates that compound inhibited the expression of PCSK9 in
7 as a strong inhibitor of PCSK9. (A) Evaluation of the PCSK9 mRNA level by
µ
·
µ
asterisk (*) indicates p < 0.05. (
B
7
HepG2 cells.
Among them, 1, 7, 9, 11, and 14 were found to significantly inhibit the expression
of PCSK9 mRNA, whose percent inhibitory activities were 44.9%, 97.1%, 96.7%, 88.5%,
and 96.3% (berberine 60.9%), respectively. However, other compounds failed to exhibit
suppressive effects. In particular, compound
a prenyl group, exhibited the strongest inhibitory effect. To confirm whether compound
can downregulate the expression of PCSK9, we exposed compound to HepG2 cells,
suppressed the expression
7, the protected Moracin C precursor without
7
7
conducted a Western blot analysis, and found that compound
of PCSK9 protein (Figure 4B).
7
In conclusion, the present approach to synthesize moracin C in three steps was found
to be more efficient than those reported previously in terms of both yield and time [20 21].
,
The exclusive scale-up synthesis of the other natural products presented herein will be
reported in the near future. Various prenylated 2-arylbenzofuran derivatives could exert
more persistent and enhanced biological effects than moracin C.
The results of the present study provide a better understanding of the structure–
activity relationships of moracin derivatives for the inhibition of PCSK9 expression in
human hepatocytes. This information would be useful for the rational design of new drugs
for hypercholesterolemia.
3. Materials and Methods
3.1. Figures, Tables, and Schemes
Except where noted, all the materials were purchased from commercial suppliers
(Sigma Aldrich, Darmstadt, Germany; Tokyo Chemical Industy Co., ltd. Tokyo, Japan;
Alfa, Ward Hill, MA, USA; Combi-blocks, San Diego, CA, USA) and were used without
further purification. All reactions were routinely carried out under an inert atmosphere
1
of dried nitrogen. H-NMR spectra (CDCl3, CD3OD, and (CD3)2CO) were recorded on
a Varian (400 MHz) spectrometer (Varian Medical Systems, Inc., Palo Alto, CA, USA).
The 1H-NMR data are reported as peak multiplicities: s for singlet, d for doublet, dd for
doublet of doublets, t for triplet, q for quartet, bs for broad singlet, and m for multiplet.
13C-NMR spectra (CDCl3, CD3OD, and (CD3)2CO) were recorded on a Varian (100 MHz)
spectrometer (Palo Alto, CA, USA). The chemical shifts are reported as parts per million (δ)
relative to the solvent peak, with the coupling constants in hertz (Hz). Infrared spectra were
recorded on Fourier-transform infrared spectroscopy (FTIR, NICOLET-iS5, Waltham, MA,

Molecules 2021, 26, 1327
6 of 11
USA). Reactions were monitored with Thin-layer chromatography (TLC, Merck precoated
60 F254 plates, Darmstadt, Germany). Spots were detected by viewing under a UV light
and colorizing with charring after dipping in KMnO4 solution. Column chromatography
was performed on silica gel 60 (230–400 mesh Kieselgel 60). Purity of the final compound
was determined using reversed-phase high-pressure liquid chromatography (RP-HPLC)
performed on a Waters◦Corp. HPLC system equipped with an ultraviolet (UV) detector at
254 nm operating at 25 C. The HPLC employed a YMC hydrosphere C18 (HS-302) column
(5-µm particle size and 12-nm pore size) with a diameter of 4.6 mm and length of 150 mm at
a flow rate of 1.0 mL/min. Mobile phase: (A) H2O containing 0.05% trifluoroacetic acid and
(B) CH3CN. Method I: a gradient of 25% B to 100% B in 30 min and Method II: a gradient
of 50% B to 100% B in 30 min. (The purity data are provided in Supplementary Materials.)
The purity of all tested compounds was > 95% purity using Method I and Method II. The
mass spectra were recorded using LRMS (electron ionization Mass spectrometry (MS))
obtained on a Shimadzu-2020 or using HRMS (electrospray ionization MS) obtained on a
G2 Quadrupole time-of-flight (QTOF) mass spectrometer.
3.2. Cell Culture, Drugs and Chemicals
HepG2 human hepatocellular cells were obtained from the Korea Research Institute of
Bioscience and Biotechnology (KRIBB, Daejeon, Korea) and grown in Eagle’s Minimum Essen-
tial Media (EMEM) containing 10% fetal bovine serum and 100-U/mL penicillin/streptomycin
◦
(Pen/Strep). Cells were cultured in a humidified incubator with 5% CO2 at 37 C. EMEM and
Pen/Strep were purchased from Hyclone (Logan, UT, USA). Bovine serum albumin (BSA)
was purchased from Sigma-Aldrich (St. Louis, MO, USA). Antibodies against PCSK9 and
β-actin were purchased from Abcam (Cambridge, MA, USA).
3.3. Quantitative Real-Time RT-PCR
Total RNA was isolated using a Trizol RNA extraction kit (Thermo Fisher Korea,
Seoul, Korea) according to the manufacturer’s instructions. Briefly, total RNA (1 µg) was
converted to Complementary DNA (cDNA) by reverse transcriptase (200 unit) and oligo-
deoxythymidine triphosphate (dT) primer (500 ng) in 50-mM Tris-HCl (pH 8.3), 75-mM
KCl, 3-mM MgCl2, 10-mM dithiothreitol (DTT), and 1-mM deoxyribose Nucleoside Triphos-
◦
phates (dNTPs) at 42 C for 1 h. The reaction was terminated by incubating the solution at
70 ◦C for 15 min; after which, 1-
reaction was performed using 1-
µ
l cDNA mixture was mixed for PCR amplification. PCR
L cDNA and 9- L master mix containing iQ SYBR Green
µ
µ
Supermix (Bio-Rad, Hercules, CA, USA), forward primer (5 pmol), and reverse primer
(5 pmol) in a CFX384 Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). PCR
reaction was as follow: 3 min at 95 ◦C, followed by 40 cycles of 95 ◦C for 10 sec, 55 ◦C for
30 sec, and 72 ◦C for 2 min. The fluorescence signal generated by SYBR Green I DNA dye
was measured. PCR primers were obtained from Bioneer (Daejeon, Korea), and the speci-
ficity of the primers was confirmed using the melting curve analysis. Data were collected
and managed by CFX Manager Software (Bio-Rad, Hercules, CA, USA). The sequences
of the PCR primer sets were as follows: human PCSK9 (Forward: GGTACTGACCCC-
CAACCTG and Reverse: CCGAGTGTGCTGACCATACA) and human Glyceraldehyde
3-phosphate dehydrogenase (GAPDH) (Forward: GAAGGTGAAGGTCGGAGTCA and
Reverse: AATGAAGGGGTCATTGATGG).
3.4. Statistical Analysis
The data from the experiments were expressed as the mean
±
S.E.M. The level of
statistical significance was determined by analysis of variance (ANOVA), followed by
0
Dunnett s t-test for multiple comparisons. P-values less than 0.05 were regarded as statisti-
cally significant.

Molecules 2021, 26, 1327
7 of 11
3.5. Western Blot Analysis
Sample were ground by pestle and incubated with 200-
µL RIPA buffer (50-mM Tris-
HCl at pH 8.0, 150-mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, and protease inhibitors
cocktail) for 1 h on ice. Lysates were collected by centrifugation, and protein concentration
was measured by the BCA Protein Assay Kit (Thermo Fisher, Pittsburgh, PA, USA). Equal
amounts of lysates were resolved by SDS-PAGE and transferred to the Polyvinylidene
fluoride (PVDF) membrane. The membrane was incubated in blocking buffer (5% skim
milk in 1x PBS-0.1% Tween-20; PBST) for 1 h and hybridized with the appropriate primary
antibody in 1x PBS containing 3% bovine serum albumin (BSA) overnight at 4 ◦C. After
washing three times with 1x PBST for 30 min, the membrane was hybridized with the
appropriate Horseradish peroxidase (HRP)-conjugated secondary antibody (Cell Signaling
Technology, Danvers, MA, USA) for 1 h at room temperature and washed three times
with 1x PBST solution for 30 min. The membrane was visualized using an enhanced
chemiluminescence (ECL) detection system.
3.6. Synthetic Methods
2-(3,5-Dimethoxyphenyl)-6-methoxybenzofuran (
-methoxyphenol (1 g, 4.2 mmol) in dry DMF (8 mL) under N2 atmosphere were added
successively PdCl2(PPh3)2 (148 mg, 0.21 mmol), CuI (27 mg, 0.25 mmol), and Et3N (1.8 mL,
7): To a stirred solution of 2-iodo-5
5
12.6 mmol). After 5 min, 1-ethynyl-3,5-dimethoxybenzene
6 (1 g, 6.3 mmol) was added,
and the mixture was stirred at 80 ◦C for 15 h. The reaction mixture was cooled to room
temperature and acidified with dilute HCl and extracted with ethyl acetate. The organic
layer was washed with water, then dried over MgSO4, filtered, and evaporated. The
residue was purified by silica gel column chromatography (Hex:EtOAc = 9:1, v/v) to afford
1
compound
7
(750 mg, 62% yield) as a pale yellow solid: H-NMR (400 MHz, CDCl3)
δ
7.40
(d, J = 8.8 Hz, 1H), 7.05 (d, J = 2.4 Hz, 1H), 6.95 (d, J = 2.4 Hz, 2H), 6.91 (d, J = 0.8 Hz, 1H),
6.85 (dd, J = 2.0 and 8.4 Hz, 1H), 6.43 (t, J = 2.0 Hz, 1H), 3.84 (s, 3H), 3.83 (s, 6H); 13C-NMR
(100 MHz, CDCl3)
δ 161.07, 158.15, 155.82, 154.90, 132.43, 122.42, 121.06, 112.03, 102.50,
101.71, 100.54, 95.80, 55.69, 55.67, 55.44, 55.42; IR (neat) 2935, 2829, 1598, 1444, 1204, 1137,
810 cm−1; LCMS Electrospray ionization (ESI) m/z calcd for C17H17O4 [M + H]+: 285.1127,
found: 285.1139; Purity 96.21% (determined by RP-HPLC, method I, tR = 21.64 min).
3.6.1. Procedure for Prenylation
n-Butyllithium (1.6 M solution in hexane, 1.64 mL, 2.63 mmol) was added dropwise to
a stirred solution of
7
(500 mg, 1.75 mmol) in absolute cyclohexane (15 mL) at 0 ◦C under
◦
N2 atmosphere. The reaction mixture was heated at 60 C for 30 min. After cooling to
room temperature, 3,3-dimethylallylbromide (0.3 mL, 2.63 mmol) was added dropwise,
and the resulting mixture was stirred at 60 C for 2 h [22]. The reaction mixture was cooled
◦
and poured into a saturated solution of sodium bicarbonate, extracted with ethyl acetate,
washed with water, dried over MgSO4, filtered, and evaporated. The crude residue was
purified by column chromatography (Hex:EtOAc = 9.5:0.5, v/v) to get the products
and 10.
8, 9,
6-Methoxy-2-(3,5-dimethoxy-4-(3-methylbut-2-enyl)phenyl)benzofuran (
8
): 154 mg (25% yield)
1
as a white solid: H-NMR (400 MHz, CDCl3)
δ
7.42 (d, J = 8.4 Hz, 1H), 7.08 (bs, 1H), 6.98
(s, 2H), 6.91 (s, 1H), 6.86 (dd, J = 1.6 and 8.8 Hz, 1H), 5.20 (t, J = 7.2 Hz, 1H), 3.90 (s, 6H),
3.87 (s, 3H), 3.36 (d, J = 6.8 Hz, 2H), 1.78 (s, 3H), 1.67 (s, 3H); 13C-NMR (100 MHz, CDCl3)
δ
158.22, 157.92, 155.69, 155.53, 131.42, 129.24, 122.58, 122.50, 120.83, 118.73, 111.85, 100.74,
100.30, 95.84, 55.87, 55.73, 25.87, 22.32, 17.75; IR (neat) 2840, 1567, 1489, 1405, 1170, 1106,
818 cm−1; LCMS (ESI) m/z calcd for C22H25O4 [M + H]+: 353.1753, found: 353.1768; Purity
98.30% (determined by RP-HPLC, method II, tR = 23.73 min).
6-Methoxy-2-(3,5-dimethoxyphenyl)-7-(3-methylbut-2-enyl)benzofuran (
a pale yellow solid: 1H-NMR (400 MHz, CDCl3)
7.33 (d, J = 8.8 Hz, 1H), 6.99 (d, J = 2.4 Hz
2H), 6.93 (s, 1H), 6.86 (d, J = 8.8 Hz, 1H), 6.44 (t, J = 2.4 Hz, 1H), 5.40 (t, J = 1.6 Hz, 1H), 3.91
9): 74 mg (12% yield) as
δ
,

Molecules 2021, 26, 1327
8 of 11
(s, 3H), 3.87 (s, 6H), 3.65 (d, J = 7.6 Hz, 2H), 1.91 (s, 3H), 1.69 (s, 3H); 13C-NMR (100 MHz,
CDCl3)
δ 161.03, 155.11, 154.94, 154.24, 132.65, 131.72, 122.80, 122.09, 117.89, 113.70, 108.05,
102.64, 101.88, 101.86, 100.42, 56.72, 56.69, 55.44, 55.42, 25.82, 22.93, 17.84; IR (neat) 2999,
2934, 2831, 1601, 148, 1283, 1200, 1147, 1026, 815 cm−1; LCMS (ESI) m/z calcd for C22H25O4
[M + H]+: 353.1753, found: 353.1770; Purity 97.66% (determined by RP-HPLC, method I,
tR = 26.89 min).
6-Methoxy-2-(3,5-dimethoxy-4-(3-methylbut-2-enyl)phenyl)-7-(3-methylbut-2-enyl)benzofuran (10):
1
110 mg (15% yield) as a colourless gummy liquid: H-NMR (400 MHz, CDCl3)
δ
7.30 (d,
J = 8.8 Hz, 1H), 7.01 (s, 2H), 6.90 (s, 1H), 6.85 (d, J = 8.4 Hz, 1H), 5.41 (quint, J = 1.6 and
8.0 Hz, 1H), 5.20 (quint, J = 1.6 and 6.8 Hz, 1H), 3.90 (s, 9H), 3.66 (d, J = 7.6 Hz, 2H), 3.37
(d, J = 7.2 Hz, 2H), 1.93 (s, 3H), 1.78 (s, 3H), 1.69 (s, 3H), 1.67 (s, 3H); 13C-NMR (100 MHz,
CDCl3)
δ 158.19, 155.58, 154.92, 154.12, 131.58, 131.38, 129.48, 122.99, 122.56, 122.14, 118.72,
117.67, 113.58, 107.90, 100.88, 100.40, 56.70, 55.79, 25.86, 25.84, 22.98, 22.33, 17.80, 17.76; IR
(neat) 2997, 2899, 2832, 1570, 1494, 1408, 1237, 1162, 1112, 1078, 802, 743 cm−1; LCMS (ESI)
m/z calcd for C27H33O4 [M + H]+: 421.2379, found: 421.2372; Purity 98.41% (determined
by RP-HPLC, method II, tR = 30.66 min).
7-(6-Hydroxybenzofuran-2-yl)-2,2-dimethylchroman-5-ol, Wittifuran D (11): To a stirred solu-
◦
tion of
8
(100 mg, 0.28 mmol) in dry DCM (4 mL) at
−
78 C under nitrogen conditions was
added dropwise 1-M BBr3 solution in CH2Cl2 (1.4 mL, 1.42 mmol) and stirred at the same
temperature for 2 h, then room temperature for 1 h. After completion of the reaction, the
excess BBr3 was quenched by adding ice water at 0 ◦C. The reaction mixture was warmed
to room temperature and extracted with ethyl acetate 2 times. The combined organic layer
was dried over MgSO4, filtered, and evaporated. The residue was purified by silica gel
column chromatography (Hex:EtOAc = 7:3, v/v) to afford compound 11 (50 mg, 60% yield)
1
as a white solid: H-NMR (400 MHz, CDCl3)
δ
7.36 (d, J = 8.4 Hz, 1H), 6.97 (br, 1H), 6.89
(s, 1H), 6.81 (s, 2H), 6.75 (d, J = 8.8 Hz, 1H), 4.96 (s, 2H), 2.69 (t, J = 6.8 Hz, 2H), 1.84 (t,
J = 6.4 Hz, 2H), 1.36 (s, 6H); 13C-NMR (100 MHz, CDCl3)
δ
155.54, 155.24, 155.04, 154.13,
153.42, 129.72, 122.90, 121.08, 111.94, 108.85, 106.17, 102.42, 100.91, 98.23, 74.32, 32.04, 26.65,
17.00; IR (neat) 3391, 2969, 1634, 1561, 1492, 1422, 1207, 1120, 972 cm−1; LCMS (ESI) m/z
calcd for C19H19O4 [M + H]+: 311.1283, found: 311.1284; Purity 96.20% (determined by
RP-HPLC, method I, tR = 15.93 min).
5-(6-Hydroxybenzofuran-2-yl)benzene-1,3-diol, Moracin M (2): 45 mg (70% yield from 7) as a
1
white solid: H-NMR (400 MHz, CD3OD)
δ 7.33 (d, J = 8.8 Hz, 1H), 6.89 (s, 1H), 6.88 (d,
J = 2.0 Hz, 1H), 6.74 (d, J = 2.4 Hz, 2H), 6.71 (dd, J = 2.0 and 8.4 Hz, 1H), 6.23 (t, J = 2.4 Hz,
1H); 13C-NMR (100 MHz, CD3OD)
δ
158.52, 155.80, 155.41, 154.67, 132.37, 121.60, 120.58,
111.80, 102.46, 102.05, 100.78, 97.01; IR (neat) 3522, 3248, 1609, 1424, 1357, 1279, 1131, 997,
955, 802 cm−1; LCMS (ESI) m/z calcd for C14H11O4 [M + H]+: 243.0651, found: 243.0649;
Purity 96.42% (determined by RP-HPLC, method I, tR = 7.46 min).
3.6.2. General Procedure for Demethylation
Powdered NaOH (254 mg, 6.3 mmol) was added to a resealable tube containing aryl
methyl ethers (8, 9, and 10) (0.7 mmol). The tube was evacuated with vacuum and filled
back with N2 gas. Anhydrous NMP (2 mL) was added to the mixture, followed by an
addition of 1-dodecanethiol (1 mL, 5.0 mmol). The reaction mixture was stirred at 130 ◦C
until the aryl methyl ether was consumed, as monitored by TLC. After reaction completion,
the mixture was allowed to cool to room temperature, then acidified with 1-N HCl and
diluted with (Ethyl Acetate) EtOAc. The aqueous phase was extracted with EtOAc, and the
combined organic layers were washed with water and brine, dried over MgSO4, filtered,
and evaporated. The residue was purified by column chromatography (Hex:EtOAc = 6:4,
v/v) to afford compounds 1 and 12–17.
5-(6-Hydroxy benzofuran-2-yl)-2-(3-methylbut-2-enyl) benzene-1,3-diol, Moracin C (
1
): 70 mg
1
(30% yield) as a white solid: H-NMR (400 MHz, CD3OD)
δ
7.33 (d, J = 8.8 Hz, 1H), 6.88
(br, 1H), 6.83 (s, 1H), 6.78 (s, 2H), 6.72 (dd, J = 2.0 and 8.4 Hz, 1H), 5.26 (t, J = 6.4 Hz, 1H),

Molecules 2021, 26, 1327
9 of 11
3.32 (d, J = 6.4 Hz, 2H), 1.78 (s, 3H), 1.67 (s, 3H); 13C-NMR (100 MHz, CD3OD)
δ
156.08,
155.68, 155.15, 155.05, 129.89, 128.79, 122.92, 121.75, 120.35, 115.40, 111.64, 102.33, 99.83,
96.97, 24.58, 21.89, 16.51; 1H-NMR (400 MHz, (CD3)2CO)
δ
7.36 (d, J = 8.4 Hz, 1H), 6.94
(d, J = 2.0 Hz, 1H), 6.89 (s, 2H), 6.88 (d, J = 0.4 Hz, 1H), 6.78 (dd, J = 2.0 and 8.4 Hz, 1H),
5.32-5.28 (m, 1H), 3.37 (d, J = 6.8 Hz, 2H), 1.76 (s, 3H), 1.63 (s, 3H); 13C-NMR (100 MHz,
(CD3)2CO)
δ 156.24, 155.74, 155.54, 154.86, 130.08, 128.96, 123.06, 121.75, 120.90, 115.34,
112.14, 102.90, 100.52, 97.42, 24.99, 21.18, 17.00; IR (neat) 3332, 2916, 1612, 1489, 1436, 1039,
980, 830 cm−1; LCMS (ESI) m/z calcd for C19H19O4 [M + H]+: 311.1283, found: 311.1288;
Purity 98.17% (determined by RP-HPLC, method I, tR = 14.32 min).
2-(3-Hydroxy-5-methoxy-4-(3-methylbut-2-enyl)phenyl)benzofuran-6-ol, Artoindonesianin O
1
(
12): 33 mg (14% yield) as a white solid: H-NMR (400 MHz, CD3OD)
δ
7.33 (d, J = 8.4 Hz,
1H), 6.92 (s, 1H), 6.92 (s, 3H), 6.73 (dd, J = 1.6 and 8.4 Hz, 1H), 5.20 (t, J = 6.8 Hz, 1H), 3.86
(s, 3H), 3.31 (d, J = 6.0 Hz, 2H), 1.76 (s, 3H), 1.65 (s, 3H); 13C-NMR (100 MHz, CD3OD)
δ
160.14, 157.23, 157.16, 156.75, 156.43, 131.45, 130.55, 124.25, 123.23, 121.91, 118.13, 113.20,
105.33, 101.66, 99.65, 98.50, 56.18, 26.02, 23.25, 17.93; IR (neat) 3282, 2921, 1614, 1504, 1437,
1413, 1359, 1299, 1282, 1164, 1141, 1083, 970, 941, 838, 774 cm−1; LCMS (ESI) m/z calcd for
C20H21O4 [M + H]+: 325.1440, found: 325.1445; Purity 99.58% (determined by RP-HPLC,
method I, tR = 18.95 min).
2-(3,5-Dimethoxy-4-(3-methylbut-2-enyl)phenyl)benzofuran-6-ol (13): 24 mg (10% yield) as a
1
half white solid: H-NMR (400 MHz, CD3OD)
δ 7.38 (d, J = 8.4 Hz, 1H), 7.02 (bs, 1H),
6.98 (s, 2H), 6.90 (s, 1H), 6.77 (dd, J = 2.0 and 8.2 Hz, 1H), 5.20 (t, J = 7.2 Hz, 1H), 4.91 (s,
1H), 5.91 (s, 6H), 3.37 (d, J = 6.8 Hz, 2H), 1.78 (s, 1H), 1.67 (s, 3H); 13C-NMR (100 MHz,
CD3OD) δ 158.26, 155.74, 155.60, 153.49, 131.45, 129.18, 122.97, 122.52, 120.98, 118.89, 111.96,
100.74, 100.43, 98.27, 55.91, 25.86, 22.35, 17.76; IR (neat) 3095, 2921, 2848, 1747, 1569, 1409,
1221, 1104, 962, 827 cm−1; LCMS (ESI) m/z calcd for C21H23O4 [M + H]+: 339.1596, found:
339.1599; Purity 99.15% (determined by RP-HPLC, method I, tR = 23.80 min).
5-(6-Hyroxy-7-(3-methylbut-2-enyl)benzofuran-2-yl)benzene-1,3-diol, Moracin S (14): 35 mg
1
(15% yield) as a white solid: H-NMR (400 MHz, CD3OD)
δ 7.15 (d, J = 8.4 Hz, 1H), 6.87 (s,
1H), 6.76 (d, J = 1.6 H, 2H), 6.70 (d, J = 8.0 Hz, 1H), 6.21 (t, J = 2.0 Hz, 1H), 5.40 (t, J = 7.6 Hz,
1H), 3.58 (d, J = 7.2 Hz, 2H), 1.88 (s, 3H), 1.68 (s, 3H); 13C-NMR (100 MHz, CD3OD)
158.50,
154.44, 154.36, 152.37, 132.59, 130.89, 122.05, 121.43, 117.46, 111.61, 111.17, 102.39, 101.88,
δ
101.06, 24.54, 22.20, 16.68; IR (neat) 3338, 3192, 1645, 1480, 1422, 1134, 1036, 807 cm−1
;
LCMS (ESI) m/z calcd for C19H19O4 [M + H]+: 311.1283, found: 311.1284; Purity 98.86%
(determined by RP-HPLC, method I, tR = 12.77 min).
5-(6-Methoxy-7-(3-methylbut-2-enyl)benzofuran-2-yl)benzene-1,3-diol (15): 33 mg (14% yield)
1
as a white solid: H-NMR (400 MHz, CD3OD)
δ 7.35 (d, J = 8.8 Hz, 1H), 6.88 (bs, 1H), 6.74
(dd, J = 2.0 and 9.0 Hz, 1H), 6.70-6.69 (m, 2H), 6.46 (d, J = 2.0 Hz, 1H), 5.09 (t, J = 5.2 Hz
,
1H), 3.43 (d, J = 6.4 Hz, 2H), 2.96 (s, 3H), 1.65 (s, 6H); 13C-NMR (100 MHz, CD3OD)
δ
158.94, 155.90, 155.64, 155.26, 154.43, 131.44, 130.10, 124.04, 121.49, 120.52, 119.29, 111.67,
106.59, 104.41, 98.83, 96.95, 54.65, 25.13, 24.45, 16.60; IR (neat) 2921, 2850, 1605, 1424, 1141,
1115, 1042, 979, 817 cm−1; LCMS (ESI) m/z calcd for C20H21O4 [M + H]+: 325.1440, found:
325.1444; Purity 95.38% (determined by RP-HPLC, method I, tR = 17.18 min).
5-(6-Hyroxy-7-(3-methylbut-2-enyl)benzofuran-2-yl)-2-(3-methylbut-2-enyl)benzene-1,3-diol,
Morusalfuran D (16): 35 mg (15% yield) as a white solid: 1H-NMR (400 MHz, CD3OD)
δ
7.13 (d, J = 8.0 Hz, 1H), 6.80 (s, 2H), 6.79 (s, 1H), 6.69 (d, J = 8.4 Hz, 1H), 5.40 (t, J = 7.2 Hz,
1H), 5.25 (t, J = 7.2 Hz, 1H), 3.58 (d, J = 7.6 Hz, 2H), 3.30 (d, J = 7.2 Hz, 2H), 1.86 (s, 3H),
1.76 (s, 3H), 1.67 (s, 3H), 1.65 (s, 3H); 13C-NMR (100 MHz, CD3OD)
156.06, 154.83, 154.25,
152.13, 130.95, 129.89, 129.06, 122.97, 122.12, 121.61, 117.26, 115.29, 111.54, 111.23, 102.37,
δ
100.20, 24.61, 24.54, 22.22, 21.92, 16.73, 16.55; IR (neat) 3377, 2930, 1617, 1413, 1022, cm−1
;
LCMS (ESI) m/z calcd for C24H27O4 [M + H]+: 379.1909, found: 379.1916; Purity 97.69%
(determined by RP-HPLC, method I, tR = 18.93 min).

Molecules 2021, 26, 1327
10 of 11
5-(6-Methoxy-7-(3-methylbut-2-enyl)benzofuran-2-yl)-2-(3-methylbut-2-enyl)benzene-1,3-diol (17):
1
33 mg (14% yield) as a white solid: H-NMR (400 MHz, CDCl3)
δ
7.24 (d, J = 7.6 Hz, 1H),
6.94 (s, 1H), 6.92 (s, 1H), 6.87 (s, 1H), 6.76 (d, J = 8.4 Hz, 1H), 5.42 (t, J = 7.6 Hz, 1H), 5.37
(s, 1H), 5.29 (s, 1H), 5.25 (t, J = 7.2 Hz, 1H), 3.89 (s, 3H), 3.71 (d, J = 7.2 Hz, 2H), 3.43 (d,
J = 7.2 Hz, 2H), 1.09 (s, 3H), 1.82 (s, 3H), 1.77 (s, 3H), 1.75 (s, 3H); 13C-NMR (100 MHz,
CD3OD) δ 158.62, 155.69, 154.70, 154.32, 152.23, 130.77, 129.97, 129.31, 122.82, 122.14, 121.63,
117.36, 116.53, 111.61, 111.18, 103.86, 100.51, 98.13, 54.69, 24.55, 24.54, 22.25, 21.79, 16.68,
16.47; IR (neat) 3273, 2913, 1620, 1492, 1416, 1223, 1165, 1092, 807 cm−1; LCMS (ESI) m/z
calcd for C25H29O4 [M + H]+: 393.2066, found: 393.2063; Purity 99.73% (determined by
RP-HPLC, method I, tR = 23.94 min).
Supplementary Materials: The supplementary materials are available online.
Author Contributions: W.J.C. designed and wrote the manuscript; J.N.M. and M.K.B. synthesized
the compounds; and H.-S.C. performed the pharmacological experiments. All authors have read and
agreed to the published version of the manuscript.
Funding: This research was funded by Dongguk University and the National Research Foundation
of Korea (NRF).
Institutional Review Board Statement: Not applicable.
Informed Consent Statement: Not applicable.
Data Availability Statement: The data presented in this study are available on request from the
corresponding author.
Acknowledgments: This study was supported by the research program of Dongguk University, 2018
and the Basic Science Research Program through the National Research Foundation of Korea (NRF)
funded by the Ministry of Education (NRF-2017R1D1A1B03036116).
Conflicts of Interest: The authors declare no conflict of interest.
Sample Availability: Samples of the compounds are available from the corresponding author.
References
1.
2.
3.
4.
Yusuf, S.; Reddy, S.; Ounpuu, S.; Anand, S. Global burden of cardiovascular diseases: Part II: Variations in cardiovascular disease
by specific ethnic groups and geographic regions and prevention strategies. Circulation 2001, 104, 2855–2864. [CrossRef]
Sung, K.C.; Kim, B.J.; Ryu, S. An association of a variety of cardiovascular risk factors with low grade albuminuria in Korean men.
Atherosclerosis 2008, 196, 320–326. [CrossRef] [PubMed]
Lagace, T.A. PCSK9 and LDLR degradation: Regulatory mechanisms in circulation and in cells. Curr. Opin. Lipidol. 2014, 25,
387–393. [CrossRef] [PubMed]
Raal, F.; Scott, R.; Somaratne, R.; Bridges, I.; Li, G.; Wasserman, S.M.; Stein, E.A. Low-density lipoprotein cholesterol-lowering
effects of AMG 145, a monoclonal antibody to proprotein convertase subtilisin/kexin type 9 serine protease in patients with
heterozygous familial hypercholesterolemia: The reduction of LDL-C with PCSK9 inhibition in heterozygous familial hyperc-
holesterolemia disorder (RUTHERFORD) randomized trial. Circulation 2012, 126, 2408–2417.
5.
6.
7.
Catapano, A.L.; Pirillo, A.; Norata, G.D. New pharmacological approaches to target PCSK9. Curr. Atheroscler. Rep. 2020, 22, 24.
[CrossRef]
Lintner, N.G.; McClure, K.F.; Petersen, D.; Londregan, A.T.; Piotrowski, D.W.; Wei, L.; Cate, J.H. Selective stalling of human
translation through small-molecule engagement of the ribosome nascent chain. PLoS Biol. 2017, 15, e2001882. [CrossRef]
Nhoek, P.; Chae, H.S.; Masagalli, J.N.; Mailar, K.; Pel, P.; Kim, Y.-M.; Choi, W.J.; Chin, Y.-W. Discovery of flavonoids from
Scutellaria baicalensis with inhibitory activity against PCSK 9 expression: Isolation, synthesis and their biological evaluation.
Molecules 2018, 23, 504. [CrossRef]
8.
9.
Chae, H.S.; You, B.H.; Kim, D.Y.; Lee, H.; Ko, H.W.; Ko, H.-J.; Choi, Y.H.; Choi, S.S.; Chin, Y.-W. Sauchinone controls hepatic
cholesterol homeostasis by the negative regulation of PCSK9 transcriptional network. Sci. Rep. 2018, 8, 6737. [CrossRef]
Ahn, J.; Kim, Y.M.; Chae, H.S.; Choi, Y.H.; Ahn, H.-C.; Yoo, H.; Kang, M.; Kim, J.; Chin, Y.-W. Prenylated flavonoids from the roots
and rhizomes of Sophora tonkinensis and their effects on the expression of inflammatory mediators and proprotein convertase
subtilisin/kexin type 9. J. Nat. Prod. 2019, 82, 309–317. [CrossRef] [PubMed]
10. Pel, P.; Chae, H.S.; Nhoek, P.; Kim, Y.M.; Chin, Y.-W. Chemical constituents with proprotein convertase subtilisin/kexin
type 9 mRNA expression inhibitory activity from dried immature Morus alba fruits. J. Agric. Food Chem. 2017, 65, 5316–5321.
[CrossRef]

Molecules 2021, 26, 1327
11 of 11
11. Arias, L.; Vara, Y.; Cossío, F.P. Regioselective preparation of benzo[b]furans from phenols and
2012, 77, 266–275. [CrossRef] [PubMed]
α
-bromoketones. J. Org. Chem.
12. Wu, K.; Wu, L.-L.; Zhou, C.-Y.; Che, C.-M. Transition-metal-free C(sp2)-C(sp2) cross-coupling of diazo quinones with catechol
boronic esters. Angew. Chem. Int. Ed. 2020, 59, 16202–16208. [CrossRef] [PubMed]
13. Kitamura, T.; Otsubo, K. Palladium-catalyzed intramolecular hydroarylation of 6-benzofuranyl alkynoates. Heterocycles 2012, 86,
759–766. [CrossRef]
14. Weissman, S.A.; Zewge, D. Recent advances in ether dealkylation. Tetrahedron 2005, 61, 7833–7863. [CrossRef]
15. Tan, Y.-X.; Liu, C.; Chen, R.-Y. 2-arylbenzofuran derivatives from Morus wittiorum. Acta Pharm. Sin. 2008, 43, 1119–1122.
16. Chae, J. Practical demethylation of aryl methyl ethers using an odorless thiol reagent. Arch. Pharm. Res. 2008, 31, 305–309.
[CrossRef]
17. Hakim, E.H.; Ulinnuha, U.Z.; Syah, Y.M.; Ghisalberti, E.L. Artoindonesianins N and O, new prenylated stilbene and prenylated
arylbenzofuran derivatives from Artocarpus gomezianus. Fitoterapia 2002, 73, 597–603. [CrossRef]
18. Su, B.-N.; Cuendet, M.; Hawthorne, M.E.; Kardono, L.B.S.; Riswan, S.; Fong, H.H.S.; Mehta, R.G.; Pezzuto, J.M.; Kinghorn, A.D.
Constituents of the bark and twigs of Artocarpus dadah with cyclooxygenase inhibitory activity. J. Nat. Prod. 2002, 65, 163–169.
[CrossRef] [PubMed]
19. Ha, M.T.; Tran, M.H.; Ah, K.J.; Jo, K.-J.; Kim, J.; Kim, W.D.; Cheon, W.J.; Woo, M.H.; Ryu, S.H.; Min, B.S. Potential pancreatic
lipase inhibitory activity of phenolic constituents from the root bark of Morus alba L. Bioorg. Med. Chem. Lett. 2016, 26, 2788–2794.
[CrossRef] [PubMed]
20. McAllister, G.D.; Hartley, R.C.; Dawson, M.J.; Knaggs, A.R. Total synthesis of moracin C. J. Chem. Soc. Perkin Trans. 1998, 1,
3453–3457. [CrossRef]
21. Matsuyama, S.; Kuwahara, Y.; Nakamura, S.; Suzuki, T. Oviposition stimulants for the lesser mulberry pyralid, Glyphodes
pyloalis (Walker), in mulberry leaves; Rediscovery of phytoalexin components as insect kairomones. Agric. Biol. Chem. 1991, 55,
1333–1341.
22. Wu, D.; Mei, H.; Tan, P.; Lu, W.; Zhu, J.; Wang, W.; Huang, J.; Li, J. Total synthesis of the 2-arylbenzo[b]furan-containing natural
products from Artocarpus. Tetrahedron Lett. 2015, 56, 4383–4387. [CrossRef]