Effect of substrate features and mutagenesis of active site tyrosine residues on the reaction course catalysed by Trypanosoma brucei sterol C-24-methyltransferase

Article abstract of DOI:10.1042/BJ20110865

TbSMT [Trypanosoma brucei 24-SMT (sterol C-24- methyltransferase)] synthesizes an unconventional 24-alkyl sterol product set consisting of Δ²⁴⁽²⁵⁾-, Δ²⁴⁽²⁸⁾- and Δ ²⁵⁽²⁷⁾-olefins. The C-methylation reaction requires Si(β)-face C-24-methyl addition coupled to reversible migration of positive charge from C-24 to C-25. The hydride shifts responsible for charge migration in formation of multiple ergostane olefin isomers catalysed by TbSMT were examined by incubation of a series of sterol acceptors paired with AdoMet (S-adenosyl- L-methionine). Results obtained with zymosterol compared with the corresponding 24-²H and 27-¹³C derivatives revealed isotopic-sensitive branching in the hydride transfer reaction on the path to form a 24-methyl-Δ²⁴⁽²⁵⁾-olefin product (kinetic isotope effect, k_H/k_D =1.20), and stereospecific CH₃→ CH₂ elimination at the C28 branch and C27 cis-terminal methyl to form Δ²⁴⁽²⁸⁾and Δ²⁵⁽²⁷⁾ products respectively. Cholesta-5,7,22,24-tetraenol converted into ergosta-5,7,22,24(28)-tetraenol and 24β-hydroxy ergosta-5,7,23-trienol (new compound), whereas ergosta-5,24-dienol converted into 24-dimethyl ergosta-5,25(27)-dienol and cholesta-5,7,24-trienol converted into ergosta-5,7,25(27)-trienol, ergosta-5,7,24(28)-trienol, ergosta-5,7,24-trienol and 24 dimethyl ergosta-5,7,25(27)-trienol. We made use of our prior research and molecular modelling of 24-SMT to identify contact amino acids that might affect catalysis. Conserved tyrosine residues at positions 66, 177 and 208 in TbSMT were replaced with phenylalanine residues. The substitutions generated variable loss of activity during the course of the first C-1-transfer reaction, which differs from the corresponding Erg6p mutants that afforded a gain in C-2-transfer activity. The results show that differences exist among 24-SMTs in control of C-1- and C-2-transfer activities by interactions of intermediate and aromatic residues in the activated complex and provide an opportunity for rational drug design of a parasite enzyme not synthesized by the human host. The Authors Journal compilation

Full text of DOI:10.1042/BJ20110865

www.biochemj.org
Biochem. J. (2011) 439, 413–422 (Printed in Great Britain) doi:10.1042/BJ20110865
413
Effect of substrate features and mutagenesis of active site tyrosine residues
on the reaction course catalysed by Trypanosoma brucei sterol
C-24-methyltransferase
Jialin LIU*1, Kulothungan GANAPATHY*1, Ewa WYWIAL†, Janusz M. BUJNICKI†‡, Chizaram A. NWOGWUGWU* and
W. David NES*2
*Department of Chemistry and Biochemistry, Texas Tech University, Lubbock, TX 79409, U.S.A., †The Laboratory of Bioinformatics and Protein Engineering, International Institute of
Molecular and Cell Biology in Warsaw, ul. Ks. Trojdena 4, 02-109 Warsaw, Poland, and ‡The Laboratory of Bioinformatics, Institute of Molecular Biology and the Biotechnology, Faculty
of Biology, Adam Mickiewicz University, ul. Umultowska 89, 61-614 Poznan, Poland
TbSMT [Trypanosoma brucei 24-SMT (sterol C-24-
methyltransferase)] synthesizes an unconventional 24-alkyl
sterol product set consisting of ꢀ24(25)-, ꢀ24(28)- and ꢀ25(27)-olefins.
The C-methylation reaction requires Si(β)-face C-24-methyl
addition coupled to reversible migration of positive charge
from C-24 to C-25. The hydride shifts responsible for charge
migration in formation of multiple ergostane olefin isomers
catalysed by TbSMT were examined by incubation of a
series of sterol acceptors paired with AdoMet (S-adenosyl-
L-methionine). Results obtained with zymosterol compared
with the corresponding 24-2H and 27-13C derivatives revealed
isotopic-sensitive branching in the hydride transfer reaction on the
path to form a 24-methyl-ꢀ24(25)-olefin product (kinetic isotope
effect, kH/kD = 1.20), and stereospecific CH3→CH2 elimination
at the C28 branch and C27 cis-terminal methyl to form ꢀ24(28)
and ꢀ25(27) products respectively. Cholesta-5,7,22,24-tetraenol
converted into ergosta-5,7,22,24(28)-tetraenol and 24β–hydroxy
ergosta-5,7,23-trienol (new compound), whereas ergosta-5,24-
dienol converted into 24-dimethyl ergosta-5,25(27)-dienol
and cholesta-5,7,24-trienol converted into ergosta-5,7,25(27)-
trienol, ergosta-5,7,24(28)-trienol, ergosta-5,7,24-trienol and 24
dimethyl ergosta-5,7,25(27)-trienol. We made use of our prior
research and molecular modelling of 24-SMT to identify contact
amino acids that might affect catalysis. Conserved tyrosine
residues at positions 66, 177 and 208 in TbSMT were replaced
with phenylalanine residues. The substitutions generated variable
loss of activity during the course of the first C-1-transfer reaction,
which differs from the corresponding Erg6p mutants that afforded
a gain in C-2-transfer activity. The results show that differences
exist among 24-SMTs in control of C-1- and C-2-transfer
activities by interactions of intermediate and aromatic residues in
the activated complex and provide an opportunity for rational drug
design of a parasite enzyme not synthesized by the human host.
Key words: homology modelling, kinetic isotope effect, muta-
genesis, sterol C-24-methyltransferase (24-SMT), Trypanosoma
brucei, zymosterol.
of fungal and plant 24-SMTs targeted at contact amino acids have
shown that specifically spaced tyrosine residues in the active site
contribute electron-rich aromatic amino acids to catalysis, where
they direct the conformation of the flexible sterol side chain and
stabilize positively charged transition states during the reaction
sequence.
INTRODUCTION
Much of the structural diversity found in the sterol biosynthetic
pathway is introduced by olefin C-methylation reactions of
a few common ꢀ24 substrates catalysed by 24-SMT (sterol
C-24-methyl transferase) to form 24-alkyl sterols [1]. In the
biosynthesis of these ancient biomolecules [2–4], which function
primarily as architectural components of membranes [5–7], the
size and configuration of the 24-alkyl group has phylogenetic
significance; the β-methyl group is typically synthesized in
early divergent organisms represented by protozoa and fungi,
the α-ethyl group synthesized in vascular plants and the C11-
extended side chain in chrysophyte algae and marine invertebrates
(Figure 1) [8–10]. These 24-SMT enzymes of tetrameric
organization utilize different substrate (Supplementary Fig-
ure S1 at http://www.BiochemJ.org/bj/439/bj4390413add.htm)
and product specificities, but in their primary structure share
similar sequence identity across kingdoms (49–77%) and three
conserved regions coinciding with substrate-binding segments for
sterol acceptor molecules [11]. This feature, the cationic nature of
C-methylation-deprotonation reactions, and mutagenesis studies
In spite of
a complete isoprenoid-sterol biosynthetic
pathway including the 24-SMT gene present in all sequenced
Trypanosomatidae genomes [12–14], there is a unique 24-
alkyl sterol composition in Trypanosoma brucei, the causative
agent for African sleeping sickness. According to co-metabolite
and substrate-specificity studies of the TbSMT (24-SMT from
T. brucei) and sterol 14-demethylase enzymes, lanosterol is
converted into 31-norlanosterol then ergosterol, and its structural
isomers ergosta-5,7,25(27)-trienol and ergosta-5,7,24(25)-trienol
[15–17]. This contrasts with the situation in the human host of
T. brucei where the 24-SMT is not synthesized, lanosterol is
converted into 32-norlanosterol and cholesterol is the principle
cellular sterol found. These differences in sterol metabolism
between parasite and host presents opportunities for the design
and testing of anti-infective agents targeted at enzymes that act on
Abbreviations used: AdoMet, S-adenosyl-L-methionine; a.m.u., atomic mass unit; CMA, mycolic acid cyclopropane synthase; EI-MS, electrospray
ionization-MS; FR, fold recognition; KIE, kinetic isotope effects; RFM, Rosmann-fold MTase; RRTc, retention time relative to retention time of cholesterol;
24-SMT, sterol C-24-methyltransferase; TbSMT, 24-SMT from Trypanosoma brucei.
1
These authors contributed equally to this work.
To whom correspondence should be addressed (email wdavid.nes@ttu.edu).
2
ꢀ
c
ꢀ
c
The Authors Journal compilation 2011 Biochemical Society

414
J. Liu and others
Figure 1 Postulated C-24-methylation pathways that proceed from a C8 sterol side chain to a C11 sterol side chain
Each trans-alkylation step corresponding to the addition of a methyl group from AdoMet is shown as C1, C2 or C3. 2H and 13C are indicated with a circle or star respectively. Sitosterol side chain
(24α-ethyl; intermediate 13) synthesized by a reductase-type enzyme from intermediate 6 is shown for reference purpose only. Relevant sterol side chains discussed in the text regarding TbSMT
catalysis are: ꢀ24(25), intermediates 1 and 5; ꢀ25(27), intermediate 4; and ꢀ24(28), intermediate 3.
Table 1 DNA sequence of the synthetic oligonucleotides used for the site-
directed mutagenesis of the TbSMT gene
sterols and efforts to develop such agents are currently underway
in several laboratories [15,18–22].
The present paper describes new details of the substrate
scope for multiple product TbSMT, and through homology
modelling and mutagenesis experiments key tyrosine residues
were identified to be involved in catalytic competence. These
studies were facilitated by assay of 24-2H- and 27-13C-labelled
sterols, performed previously with fungalandplant24-SMTs [23],
which allowed an explanation for timing of the C-methylation
steps and regiospecificity associated with the TbSMT-generated
products. The results support the hypothesis that TbSMT
represents a primitive type of 24-SMT enzyme which evolved
a unique active-site motif from those described previously.
Moreover, the present paper is the first report to show the relevance
of substrate selectivity directing the sequence of enzymatic
activities in ergosterol biosynthesis.
Codons for the changed amino acids are underlined.
Strain
Forward oligonucleotide sequence (5ꢁ–3ꢁ).
Y166F
Y177F
Y208F
gttacagatttcttcgaatacggttgg
ttcgacggagcattcgccatcgaggcg
atcaaacctggtttctactttatgctg
Site-directed mutagenesis of TbSMT
Site-specific mutations at various positions along the pCW-ERG6
template were carried out using the QuikChange® site-directed
mutagenesis kit (Stratagene). The replaced mutant codons are
listed in Table 1. Putative positive clones were picked, the
plasmids isolated using the Promega SV wizard miniprep kit
and the mutation confirmed by sequencing using the appropriate
primer. Vectors carrying the mutated gene for 24-SMT were
transformed into the expression host Escherichia coli BL21 (DE3)
(Novagen) as described previously [25].
EXPERIMENTAL
Substrates
Zymosterol, [24-2H]zymosterol (98% atom enrichment) and
[27-13C]zymosterol (98% atom enrichment) were prepared
as described previously [24]. 24-Methyldesmosterol [ergosta-
5,24(25)-dienol] was prepared by acid-induced isomerization
of 24(28)-methylenecholesterol obtained from corn pollen [25].
Cholesta-5,7,24-tirenol and cholesta-5,7,22,24-tetraenol were
isolated from the yeast mutant Erg6 [26]. [methyl-2H3]AdoMet
(AdoMet is S-adenosyl-L-methionine; 99% atom enrichment)
was from MSD Isotopes, [methyl-3H3]AdoMet (diluted to
10 μCi/μmol) was purchased from New England Nuclear and
AdoMet as the chloride salt was from Sigma. Sterol substrate
purity was approximately >95% by GC analysis. All other
reagents and chemicals were purchased from Sigma or Fisher
unless otherwise noted.
TbSMT assay and product analysis
E. coli (BL21) harbouring recombinant wild-type or mutant
TbSMTs were harvested by centrifugation (13300 g for 10 min
at 4◦C) and the cell pellet lysed by French-press disruption as
described previously [25]. The resulting crude TbSMT in the
soluble fraction (300 μl with 3 mg of total protein) was assayed
in the presence of sterol substrate either at saturation (100 μM)
or varied over the concentration range (5–150 μM) emulsified
with Tween 80 (final concentration 1.2 g/l). Incubations of a
total volume of 600 μl were initiated with AdoMet (100 μl of
100 μM; in kinetic studies AdoMet was diluted with 0.6 μCi of
ꢀ
c
ꢀ
c
The Authors Journal compilation 2011 Biochemical Society

Sterol C-24-methylation reaction
415
Table 2 Observed KIE for deprotonation and products catalysed by TbSMT
Rates are the averages of duplicate assays, using the same lysate preparation for all three substrates, performed under standard incubation conditions for 1 h. Results were fitted non-linearly
− 1
to the Michaelis–Menten equation using the enzyme kinetic module (SPSS); accordingly, the mean standard error of the Vmax determinations was 3 pmol · min mg− 1 and r2 = 0.95. For
+
−
enzyme-generated product analysis identical assay conditions were used except that the assay continued for 16 h. Values in parentheses are the catalytic competence normalized to 100% in reference
to zymosterol or wild-type.
Steady-state kinetic parameters
Vmax
Relative proportion of TbSMT generated products (%)
Ergosta-8, 25
(27)-dienol
Ergosta-8, 24
(28)-dienol
Ergosta-8, 24
(25)-dienol
24-Dimethyl-ergosta-8,
25 (27)-dienol
Substrate
(pmol · min− 1 · mg− 1
)
Km (μM)
Vmax/Km
Zymosterol
258
258
215
55
55
60
4.7 (100)
4.7 (100)
3.6 (69)
50
50
68
13
13
26
32
32
3
5
5
3
[27-13C]zymosterol
[24-2H]zymosterol
[methyl-3H3]AdoMet) and continued aerobically at 35◦C with
gentle shaking for 60 min. During this period the progression
of the reaction was linear. The reaction was stopped by
the addition of 600 μl of 5% (w/v) KOH-methanol. Sterols
were extracted three times with hexane and the combined
extracts concentrated to dryness. For every substrate, the kinetic
parameters of the reaction (Km,app and Vmax,app) determined
under initial velocity conditions (Supplementary Figure S2
at http://www.BiochemJ.org/bj/439/bj4390413add.htm) were
calculated by fitting the liquid scintillation data to the Michaelis–
Menten equation using the enzyme kinetic module from SPSS.
The error in work-up of duplicate samples was generally 5–
10%. Controls, containing radioactive AdoMet and no sterol,
were used to background-subtract methylation activity due to
endogenous AdoMet-dependent enzymes in the lysate; generally
the accumulation of radioactivity in these treatments was low,
500–1000 d.p.m. For use of isotope effects to determine enzyme
mechanisms, the same batch of lysate protein was employed in
incubations of 2H- and 13C-labelled zymosterols and zymosterol.
Sterol compounds, referenced to the retention time of
cholesterol in capillary GC at 13.8 min and HPLC at 22 or
37 min (analytical compared with semi-preparative C18 column),
were quantified by integration of the detector signal from 10–
30 min. Products were routinely identified by their retention times
in GC and electron-impact spectrum with those of reference
specimens. For selected products, unambiguous identification was
established after HPLC (Phenomenex C18 column linked to a
diode array detector which provided UV spectra) fractionation
followed by GC-MS analysis (HP LS 6500 gas chromatograph
interfaced to a 5973 mass spectrometer) and NMR [spectra
measured on deuteriochloroform solutions using a Varian Unity
Inova 500 MHz spectrometer operating at 500 MHz for protons
and 125 MHz for 13C nuclei; chemical shifts were referenced to
CHCl3 at δ 77.00 and reported as δ (p.p.m.)] identification of the
biomethyl sterol as described previously [24–27].
used as a starting point for comparative modelling. We used the
‘FRankenstein’s Monster’ approach which comprises cycles of
local realignments in uncertain regions, building of alternative
models and their evaluation, realignment in poorly scored regions
and merging of the best-scoring fragments [29,30]. Previously, we
used this approach for successful building of models for different
methyltransferases that were later confirmed by crystallographic
analyses [31,32]. Diverged regions of TbSMT, for which the
FR analysis failed to identify consensus alignments, and whose
predicted secondary structure differed significantly from that of
the template, have been remodelled using de novo folding methods
of ROSETTA [33] and REFINER [34]. Mapping of sequence on
to the model was done for the multiple sequence alignment of the
24-SMT family with the ConSurf server [35].
Bioinformatics analysis identified members of the RFM
(Rossmann-fold MTase) superfamily [36] as the best modelling
templates, with the crystal structure of CMA (mycolic
acid cyclopropane synthase), CmaA2 from Mycobacterium
tuberculosis (PDB code 1KPI) [37], reported with the highest
scores by most methods. We have built a preliminary model of
TbSMT using a comparative (homology-based) method, based on
alignments obtained by the GeneSilico Metaserver, docked the
ligands (AdoMet and sterol molecule) based on superimposition
on to the co-substrates present in the template structure, and
optimized the conformation of the variable regions using de
novo folding methods. The final model of TbSMT was evaluated
as a ‘very good model’ using the PROQ method [38] with a
score of 0.413, and MetaMQAP predicted that its root mean
square deviation to the wild-type structure is approximately 3.9 Å
(1 Å = 0.1 nm) [39].
RESULTS
General features of the TbSMT-catalysed reaction
The structures and distribution of the TbSMT-catalysed reaction
of zymosterol have been described for the recombinant sterol
gene introduced into E. coli HMS-174 cells [16]. In brief, GC-MS
analysis of the enzyme-generated products from a soluble TbSMT
showed the presence of four biomethylated sterols identified
as ergosta-8,25(27)-dienol, ergosta-8,24(28)-dienol, ergosta-
8,24(25)-dienol and 24 dimethyl ergosta-8,25(27)-dienol in a ratio
of substrate/product of 7:3; the products distributed in a ratio of
approximately 5:1:2:2 respectively. In the present study, the
TbSMT expressed in E. coli BL21 cells generated a sterol com-
position much like that reported previously (Table 2). However,
using a lysate rather than soluble preparation, the rate of the
reaction for zymosterol catalysis was found to be somewhat lower
than determined before at a Vmax value of 258 pmol · min− 1 mg− 1
Protein sequence analysis and structure prediction
Multiple amino-acid sequences of diverse 24-SMTs were aligned
with ClustalW2 at the European Bioinformatics Institute with
default parameters (http://www.ebi.ac.uk/Tools/msa/clustalw2/).
Protein structure prediction was carried out via the GeneSilico
MetaServer [28], which is a gateway for a variety of bioinform-
atics algorithms for prediction of secondary structure, intrinsic
disorder, per-residue solvent accessibility and protein FR (fold
recognition), i.e. matching the target sequence to known protein
structures (potential templates). The potentially best template
has been identified according to the consensus between diffe-
rent FR methods. Top-scoring pairwise alignments between the
TbSMT sequence and the structure of the best template were
ꢀ
c
ꢀ
c
The Authors Journal compilation 2011 Biochemical Society

416
J. Liu and others
2H3]AdoMet on Erg6p were near unity. In the present study which
tested TbSMT with these substrates, a marked deuterium KIE was
detected in both reaction rate and product distribution (Table 2).
The effect of the deuterium substitution at C-24 on zymosterol
biomethylation was to slow catalysis with no measurable influence
on substrate binding; the observed KIE of [24-2H]zymosterol was
a kH/kD value of 1.2, indicating that a deprotonation step is rate-
limiting for the overall reaction process. GC-MS analysis of the
composition of the TbSMT C-1-transfer products from incubation
of [24-2H]zymosterol showed that ergosta-8,24(28)-dienol and
ergosta-8,25(27)-dienol was increased markedly relative to a
decrease in ergosta-8,24(25)-dienol. The amount of 24-dimethyl
ergsota-8,25(27)-dienol in the sterol mixture remained constant,
indicating that the C-2-transfer activity was unaffected. Notably,
the mass spectra of these sterols were diagnostic; the [M]+
peak at m/z 399 observed on MS analysis of the two early-
eluting compounds showed retention of one deuterium atom in the
side chain at C-24 or C-25, whereas the late-eluting compounds
showed a loss of deuterium incorporation in the side chain by
the molecular ion at M+ 398 and 412 a.m.u. (atomic mass
unit) respectively (Supplementary Figure S2). The results of
these studies, and of earlier work on the TbSMT reaction [16],
indicate that a reversible 1,2-hydride shift (of H-24 to C-25) is
responsible for charge migration in the formation of the three
biomethyl olefin products, and that the hydride shift of H-25 to
C-24 in the formation of the [25-2H]-C-24 cationic intermediate
becomes rate-limiting. The timing of deprotonation of H-24 must
be delayed relative to ꢀ25(27)-olefin formation, indicating that
some degree of side-chain flexing may occur to position the
migratory hydrogen in a region of the active site for elimination
not involved at C-27 (or C-28). These findings are consistent with
the electrophilic nature of the reaction and support the ‘steric-
electric plug’ model for sterol C-24 methylation [23].
Figure 2 Signals in the olefinic region
1H-NMR (A) and enhanced signals in 13C-NMR (B) spectra of [27-13C]ergosta-8,25(27)-dienol
and [27-13C]ergosta-8,24(28)-dienol isolated from HPLC as a TbSMT-generated product
mixture.
compared with a Vmax value of 901 pmol · min− 1 · mg, whereas
binding in the Michaelis complex was similar to that established
+
previously with a Km value of 55 5 μM compared with
−
+
47 5 μM (Table 2).
The previous H-NMR evaluation of the TbSMT-generated
−
1
ergosta-8,25(27)-dienol revealed the 24-methyl group to be
β-oriented [16]. In the present study, we evaluated the
deprotonation steps in the C-24-methylation mechanism directly,
by a comparison of methyl→methylene elimination in formation
of the ꢀ24(28)- and ꢀ25(27)-olefins by TbSMT using [27-
13C]zymosterol and zymosterol. As expected, the rates of catalysis
for both substrates and product distributions were similar; the
molecular ion cluster of peaks in the mass spectra of the four
13C-labelled products showed a one mass unit increase relative
to the unlabelled products (Supplementary Figure S3 at
http://www.BiochemJ.org/bj/439/bj4390413add.htm). Preparat-
ive incubation of [27-13C]zymosterol with TbSMT afforded,
after HPLC, a mixture of biomethyl sterols. The 1H-NMR
spectrum showed four methyl groups at C-18, C-19, C-21 and
C-26 consistent with the structures of the previously characterized
ergosta-8,24(28)-dienol and ergosta-8,25(27)-dienol. Of the two
olefinic protons in the product set, one resonated at 4.55
(J 6 Hz), the other at 4.66 (J 154 Hz), signals corresponding with
C-28 in ergosta-8,24(28)-dienol and C-27 in ergosta-8,25(27)-
dienol respectively. The 13C-NMR spectrum of the sterol mixture
displayed two enhanced singlets at 22.4 and 109.3 p.p.m.,
confirming the C-28 in ergosta-8,(28)-dienol and C-27 in ergosta-
8,25(27)-dienol respectively [40,41] (Figure 2). The signal at
22.4 in the [27-13C]ergosta-8,24(28)-dienol product defines the
stereochemistry at C-25, that therefore is R-oriented [40].
Substrate utilization of TbSMT
To further assess the scope of the first and second C-1-
transfer reactions catalysed by TbSMT, three substrates with
ꢀ5-bonds were tested with the recombinant enzyme, ergosta-
5,24(25)-dienol (24-methyl desmosterol), cholesta-5,7,24-trienol
and cholesta-5,7,22,24-tetraenol. The sterols were individually
bound by the 24-SMT such that each one of them converted
into a biomethyl product of similar binding constants of a
+
Km value if 25 3 μM, but they differed in their rates of
−
conversion with zymosterol (Vmax = 258 pmol/min) catalysed
faster than ergosta-5,7,22-trienol (Vmax = 155 pmol/min) or
cholesta-5,7,22,24-tetraenol (Vmax = 33 pmol/min) and ergosta-
5,24-dienol (Vmax = 74 pmol/min). GC-MS analysis of the
reaction products showed that: (i) ergosta-5,24-dienol converted
into a single product at a RRTc (retention time relative to retention
time of cholesterol) value of 1.27 of M+ 412 a.m.u. consistent with
the structure 24-dimethyl ergosta-5,25(27)-dienol; (ii) cholesta-
5,7-24-trienol converted into three products at RRTc values of
1.18, 1.19 and 1.27 and a fourth compound eluting at a RRTc value
of 1.36 possessing a M+ value of 410 a.m.u. chromatographic and
spectral data consistent for ergosta-5,7,25(27)-trienol, ergosta-
5,7,24(28)-trienol, ergosta-5,7,24-trienol, and 24-dimethyl
ergosta-5,7,25(27)-trienol were in agreement with previous stud-
ies (Supplementary Figure S4 at http://www.BiochemJ.org/bj/
439/bj4390413add.htm) [15]; and (iii) cholesta-5,7-22,24-
tetraenol (RRTc value of 1.14, a M+ value of 380 a.m.u. and
λmax at 232 and 282 nm) converted into two products (Figure 3),
a minor compound identified previously from yeast as ergosta-
5,7,22,24(28)-tetraenol [RRTc value of 1.15 and a M+ value
of 394 a.m.u. and other diagnostic ions at 380 a.m.u. (100),
To evaluate the reversible hydride shift of H-24 to C-25
in formation of the uncommon assemblage of olefins shown in
Figure 1, we took advantage of isotopically sensitive branching
experiments resulting from reaction with [24-2H]zymosterol
relative to zymosterol as referenced in Table 2. In non-competitive
assays, the primary deuterium KIEs (kinetic isotope effects) for
sterol C-24 methylation using [27-13C]zymosterol or [methyl-
ꢀ
c
ꢀ
c
The Authors Journal compilation 2011 Biochemical Society

Sterol C-24-methylation reaction
417
Information from homology modelling
The three-dimensional structure of any orthologue of TbSMT is at
present unknown, yet over 100 structures of AdoMet-dependent
methyl transferase have been reported that can be used as reference
material in homology modelling of a 24-SMT that binds sterol
along with AdoMet. To ascertain mechanistic inferences on the
involvement of a cationic intermediate in catalysis by mutants
prepared in the present study, we undertook modelling and
docking experiments of the TbSMT to show putative interaction
between protein and co-substrates sterol and AdoMet in the active
site. The current modelling studies take into consideration our
investigations that involved photoaffinity and chemical labelling
and site-directed mutagenesis experiments in the Erg6p [27,43–
45]. The combination of these efforts reveal four substrate-binding
segments for AdoMet and sterol referred to as Regions I–IV [45],
and that tyrosine residues at positions 81, 192 and 223 (equivalent
to Tyr66, Tyr177 and Tyr208 in TbSMT) represent contact amino acids
for sterol-binding sites (Figure 6 and Supplementary Figure S6 at
http://www.BiochemJ.org/bj/439/bj4390413add.htm).
Using a refined and updated set of sequence and structure
information, allowed us to construct a pseudo-atomic model of a
24-SMT which is in general agreement with prior mutagenesis of
Erg6p that revealed four substrate-binding segments associated
with the active site (Figure 7). The new bioinformatics analysis
predicts that a protomer of TbSMT forms a relatively compact
structure, formed by the highly conserved RFM domain
[36,46] surrounded by variable elements. In the ligand-bound
conformation based on the related CMA structure, the enzyme
is in the closed conformation, with the AdoMet-binding pocket
covered by the N- extension and the sterol-binding pocket cov-
ered by insertions in the catalytic domain. The key residues
involved in binding of AdoMet to TbSMT (in parentheses are
the Erg6p residues) appear at His75 (His90) and Asp110 (Asp125),
corresponding to substrate domains for Regions I and II, which
co-ordinate the methionine moiety, and Asp162 (Asp177) which co-
ordinates the adenine moiety. Prediction of sterol-binding residues
is more difficult, as they are specific to the 24-SMT family and
absent in other members of the RFM superfamily. Furthermore,
the conformation of the sterol side chain to ligand binding is
enigmatic. With these considerations in mind, mapping of residues
that are evolutionarily conserved just in the 24-SMT family on
to the structure of our model reveals a putative substrate-binding
pocket.
Figure 3 GC-MS (total ion current chromatogram) for incubation of
cholesta-5,7,22,24-tetraenol with TbSMT
1, cholesta-5,7,22,24-tetraenol; 2, ergosta-5,7,22,24-tetraenol; 3, ergosta-5,7,23-3,22-diol.
361 a.m.u. (15), 347 a.m.u. (100), 269 a.m.u. (35), 251 a.m.u.
(35), 157 a.m.u. (38) and 143 a.m.u. (40)] [41] and into a second
compound eluting in GC significantly after ergosta-5,7,22,24(28)-
tetraenol with a RRTc value of 1.48 and a M+ value of 412 a.m.u.
However, it was not possible to identify the apparent biomethyl
product, as it did not match any authentic standard available to us.
In order to investigate the identity of the anomalous product,
the co-substrate AdoMet was replaced with [methyl-2H3]AdoMet
in the incubation mixture and the assay incubated overnight with
cholesta-5,7,22,24-tetraenol in the usual manner. The resulting
sterol fraction was examined by GC-MS and peaks appeared in
the chromatogram in the same substrate/product ratio as before,
except the compound at a RRTc value of 1.48 possessed a 3 a.m.u.
increase over the same compound biosynthesized from AdoMet,
which is consistent with the addition of one methyl group to
the substrate side chain (Figure 4). At this point, it was clear to
us that we had an unusual biomethyl product which prompted
us to pursue its identity further. From a preparative incubation
with cholesta-5,7,22,24-tetraenol, the total sterols were extracted
and fractionated by HPLC. The material eluting at a αc value
0.57 of λmax = 282 nm was recovered from the column. By GC-
MS analysis the sample was 100% pure with a RRTc value of
It is worth mentioning that our model refers to a structure of
an isolated SMT protomer, although it is known based on gel-
permeation chromatography that the functionally active form of
the protein is a tetramer [16,40]. Without experimental structural
information (such as the protein shape or sites of contact between
different SMT protomers in the tetramer) it is currently impossible
to reliably predict the quaternary structure. It is probable that some
protein segments, especially the regions outside the conserved
RFM core, may assume a different conformation in the tetramer
than in our model. However, we believe that tetramerization is
unlikely to affect the protein core that harbours the active site,
and hence we are relatively confident in our prediction of key
functional residues.
1
1.48 and a M+ value of 412 a.m.u.; H-NMR of the sample
revealed δ H-3 (bearing OH), 3.64 (m), H-6, 5.67 (dd), H7.
5.39 (m), H3-18, 0.64 (s), H3-19, 0.95 (s), H3-21, 1.06 (d), H-22
(bearing OH), 5.46 (d), H-23, 5.45 (m), H3-26, 0.99 (d), H3-27,
0.88 (d) and H3-28, 1.55 (s) p.p.m. (Supplementary Figure S5 at
http://www.BiochemJ.org/bj/439/bj4390413add.htm). The shift
of side-chain methyl doublets related ꢀ23 formation suggested
an E rather a Z-configuration of the double bond [41,42]. The
combination of chromatographic and spectral data of the late-
eluting material in GC coupled with the biosynthetic information
showing the addition of a methyl group from AdoMet to
the structure indicates that the biomethyl product is a new
natural product 24-methyl ergosta-5,7,23-dien-3β-24β-diol. A
reasonable mechanism for the formation of the two biomethyl
products from incubation of cholesta-5,7,22,24-tetraenol with
TbSMT is shown in Figure 5; path a represents the typical reaction
process to a natural biomethyl sterol and path b shows progress
to a new outcome.
Effect of tyrosine to phenylalanine mutations on TbSMT activity
Based on the interactions observed in the model and earlier
studies targeted at Erg6p tyrosine residues at positions 81, 192
and 223, which upon mutation to phenylalanine recognizes
ꢀ24(28) substrates and converts them into multiple 24-ethyl(idene)
products [45], the TbSMT residues at Tyr66, Tyr177 and Tyr223 were
ꢀ
c
ꢀ
c
The Authors Journal compilation 2011 Biochemical Society

418
J. Liu and others
Figure 4 EI-MS (electrospray ionization-MS) spectra of TbSMT products
Products are from the incubation of cholesta-5,7,22,24-tetraenol paired with AdoMet (A) or [methyl-2H3]AdoMet (B). MS peak 3 is shown in Figure 3.
Figure 5 Postulated C-24-methylation pathways in the conversion of cholesta-5,7,22,24-tetraenol into ꢀ22(28)-olefin (path 1 to 1A to 2) and 22-hydroxylꢀ23(24)
olefin (path 1 to 1A to 3) sterol side-chain constructions by TbSMT.
-
replaced with phenylalanine. These amino acid replacements, to
conserve size and shape but eliminate the potentially reactive
function, did not act like the corresponding Erg6 mutant
proteins. The TbSMT mutant proteins catalysed zymosterol much
less efficiently than the wild-type enzyme, with a Vmax/Km
ratio 23–40% that of the parent strain (Table 3), yet there
was no change in C-2-transfer activity. However, the sterol
composition of the Y66F catalysis was different, appearing to
derive from a change in the mono-alkylated sterol content;
the sterol mixture possessed a significant decrease in ergosta-
8,24(25)-dienol compensated by an increase in ergosta-8,25(27)-
dienol and ergosta-8,24(28)-dienol (Supplementary Figure S6
at http://www.BiochemJ.org/bj/439/bj4390413add.htm). GC-MS
analysis of the Y66F mutant did not show biosynthesis
ꢀ
c
ꢀ
c
The Authors Journal compilation 2011 Biochemical Society

Sterol C-24-methylation reaction
419
Table 3 Comparison of kinetic constants and percentage distribution of ergostenols produced from zymosterol by wild-type and tyrosine to phenylalanine
residue TbSMT mutant proteins
Rates are the averages of duplicate assays, using the same lysate preparation for all three substrates, performed under standard incubation conditions for 1 h. Results were fitted non-linearly
− 1
to the Michaelis–Menten equation using the enzyme kinetic module (SPSS); accordingly, the mean standard error of the Vmax determinations was 3 pmol/min · mg and r2 = 0.95. For
+
−
enzyme-generated product analysis identical assay conditions were used except that the assay continued for 16 h. Values in parentheses are the catalytic competence normalized to 100% in reference
to zymosterol or wild-type.
Steady-state kinetic parameters (%)
Relative proportion of TbSMT-generated products (%)
Substrates Vmax (pmol · min− 1 · mg− 1
)
Km (μM) Vmax/Km
Ergosta-8, 25 (27)-dienol Ergosta-8, 24 (28)-dienol Ergosta-8, 24 (25)-dienol 24-Dimethyl-ergost–8, 25 (27)-dienol
Wild-type 67
22
6
10
36
3.04 (100) 50
13
26
30
19
32
3
10
24
5
3
trace
trace
Y66F
19
34
26
3.1 (102) 68
3.4 (112) 60
0.72 (24) 57
Y177F
Y208F
Figure 6 Alignment of 24-SMT amino acid sequences of cloned 24-SMTs
®
®
1. S. cerevisiae (ScSMT, GenBank accession number NP_0131706); 2. Paracoccidioides brasiliensis (PbSMT, GenBank accession number XM_002796521.1); 3. Pneumocystis carinii (PcSMT,
®
®
®
GenBank accession number Q96WX43); 4. Glycine max (GmSMT1, GenBank accession number AAB04057); 5. Glycine max (GmSMT2, GenBank accession number FJ483974); 6. Arabidopsis
®
®
®
thaliana (AtSMT1, GenBank accession number NP_001078579); 7. A. thaliana (AtSMT2, GenBank accession number NP_173458); and 8. T. brucei (TbSMT, GenBank accession number
AAZ40214). Regions identified as the sterol-binding segments are shown as reported in [45] for the Erg6p (S. cerevisiae 24-SMT). Light shaded colour represents conserved amino acid residues
among 24-SMTs. Tyrosine residues considered to be part of the 24-SMT active site are dark shaded. 24-SMTs have different substrate specificities and, except for ScSMT1 and PbSMT1 which
catalyse only the first C-1-transfer reaction, all other 24-SMTs in the Table are bifunctionally capable of catalysing either the first [ꢀ24(25)-substrate] or second [ꢀ24(28)-substrate] C-1-transfer
reaction. The optimal substrate for each catalyst is reported: zymosterol (ZY), lanosterol (LA), cycloartenol (CA) and 24(28)-methylene lophenol (ML) and their structures are shown in Supplementary
Figure S1 at http://www.BiochemJ.org/bj/439/bj4390413add.htm.
with the mutant enzymes was shown to exhibit similar product
profiles and catalytic competence to the wild-type enzyme
(Supplementary Figures S7 and S8 at http://www.BiochemJ.org/
bj/439/bj4390413add.htm), whereas ergosta-8,24(28)-dienol
(fecosterol) was not a substrate for any mutant TbSMT
proteins.
DISCUSSION
The major product of TbSMT catalysis is a 24β-methyl
sterol [ergosta-8,25(27)-dienol] which, according to sterol
chemotaxonomy, is a primitive compound. In the reaction
mechanism leading to ꢀ25(27)-olefins, a hydride ion migrates from
C-24 to C-25 in a reversible manner which suggests that in
both single- and double-transmethylations some stabilization is
received by the consequent formation of a carbocation at C-25,
implying that its C-24 carbocation precursor is significantly
long-lived and that the usual coupled methylation-deprotonation
reaction is not concerted as it is for Erg6p [39,40,49,50]. The
proton transfer catalysed by TbSMT occurs in such a way that
the Z-methyl group of the zymosterol substrate is transformed
specifically into the Si-methyl group of the product. This cis-
selectivity in methyl to methylene elimination at C-25(27),
previously noted in algal sterol biosynthesis [50], was confirmed
by the 13C-labelling studies of the TbSMT product. In particular,
methyl insertion and hydride migration are occurring on opposite
faces of the original double bond as evidenced by the detection
of the pro-R methyl group at C-25 in the formation of the minor
TbSMT product, [27-13C]ergosta-8,24(28)-dienol.
Figure 7 Ribbon representation of the active site of TbSMT
The AdoMet- (SAM; magenta) and sterol- (STE; orange) binding pockets are shown. Tyrosine
residues that were substituted are labelled in blue. Relevant contact amino acids identified
in the homology modelling are shown in stick representation. The image was using PyMol
with coordinates obtained by homology modelling against CMA coordinates as described in
Materials and methods section.
of 24-ethyl(idene) sterols nor was there any evidence that
the second C-1-transfer activity involving ergosta-8,24(25)-
dienol conversion into 24 dimethyl ergsota-8,25(27)-dienol was
affected (Supplementary Figure S7 at http://www.BiochemJ.org/
bj/439/bj4390413add.htm). Notably, ergosta-5,24-dienol tested
ꢀ
c
ꢀ
c
The Authors Journal compilation 2011 Biochemical Society

420
J. Liu and others
The formation of ergosta-8,24(28)-dienol in the product set
appears to be a more advanced trait since it is utilized in the
biosynthesis of 24-ethyl(idene) sterols on the path to 24α-ethyl
sterols (sitosterol). However, the second alkylation of the ꢀ24(28)
substrate was not carried out, rather ergosta-8,24(25)-dienol was
the alternative ꢀ24 substrate for the second C-1-transfer reaction
yielding a 24-dimethyl sterol. The remarkable promiscuity in
olefin product formation by TbSMT, compared with the other
24-SMTs studied to date, may reflect the inherent positional
selectivity of the normal deprotonation step of the reaction [i.e.
regiospecificity for deprotonation from the C-27 methyl (to vinyl)
is favoured over C-28 methyl (to methylene) deprotonation]. As
noted in studies of the deuterium isotope effects on TbSMT, a
primary isotope effect on C-25 deprotonation was observed in
ergosta-8,24(25)-dienol formation, suggesting this deprotonation
step is rate-limiting in the formation of 24-dimethyl sterols. By
contrast, C-2-transfer activities catalysed by plant 24-SMTs and
the Erg6p mutant proteins (Tyr81) are sensitive to proton loss from
C-28, making this step rate limiting in ꢀ24(28) sterol formation
[47,48,51–53].
some cases cyclopropane structures are formed along the lateral
side chain [8,55]. The crystal structures of three CMAs from
the bacterium M. tuberculosis have emerged to shed light on
the location of the cofactor AdoMet in the active site of the
protein [35,55,56]. We were intrigued by these findings, since the
closest homologue of 24-SMT is CMA (16% identity and 28%
similarity). As seen in the putative interactions between cofactor
and active-site residues of CMA, several aromatic side chains
were shown to align the active-site contour required to stabilize the
carbocationic intermediate through cation π interactions, which
is in agreement with our hypothesis for the topology of the 24-
SMT active site. Homology modelling of TbSMT shows that
zymosterol (the natural substrate) docked adjacent to AdoMet
aligns near Trp210 (Trp225), Leu236 (Leu251) and His223 (His238
)
which correspond with sterol-recognition sites for Regions III and
IV (Figure 7). These residues are likely to form a hydrophobic
interaction with the acceptor from the α-face of the sterol and
possibly hydrogen bond to the C-3 OH group. At the other end of
the sterol, a set of residues form a core structure around the ꢀ24
double bond with Glu180 (Glu195), His184 (His199) and Tyr177 (Tyr192),
corresponding with Region III, on top of the side chain and Tyr59
(Tyr74) and Tyr66 (Tyr81), corresponding with Region I, positioned
below and towards the opposite face of the substrate double
bond. From leucine residue screening mutagenesis experiments
of Erg6p, His77 and Glu125 were shown to be essential to C-1-
transfer activity, whereas replacement of Tyr192 and Tyr223 with
leucine had no significant effect on zymosterol conversion into
fecosterol; neither Tyr59 or Asp162 were studied since they are not
absolutely conserved in this class of catalyst [25,27,45].
Consequently, when considering similarity of substrate
interactions in the Michaelis complex of fungal, plant and
protozoan 24-SMTs in which a common ꢀ24(28)-olefin is produced,
we independently reasoned that the central region of these
enzymes is lined with aromatic and acidic amino acid residues
whose positions and orientation appear to be responsible for
producing the specific geometry that determines the product
specificity that occurs with each 24-SMT [42,43,45]. For the
TbSMT, when the OH group of the aromatic residues located
some distance away from the reactive carbocation intermediate
at Tyr177 and Try208 are replaced with H (phenylalanine) catalytic
activity decreases without a corresponding affect on the sterol
composition in the mutant proteins. On the other hand, when
Tyr66 located close to the substrate double bond is replaced with a
phenylalanine residue the resulting activity in the mutant protein is
markedly slowed accompanied by a modified C-1-transfer product
profile, consistent with the proposed role and positioning of this
residue in the activated complex.
The results of the present study and our earlier investigations
have established that the active-site geometry of 24-SMTs
is sufficiently versatile to direct the formation of different
product sets, leading to suggestions of evolutionary relevance
[16,45,48,50]. Perhaps most strikingly, deprotonations that
form ergosta-8,25(27)-dienol and ergosta-8,24(28)-dienol involve
protons chemically and geometrically distinct from that lost
in the generation of ergosta-8,24(25)-dienol, indicating that
multiple amino acid residues could be acting as adventitious
active-site bases on either side of the intermediate in the
activated complex. These substrate novelties and single-residue
modifications, strongly encourages crystallographic effort with
24-SMTs to more satisfactorily define contact amino acids that
determine sterol compositions. The study of sterol methylating
catalysts is a wide-open area that needs to be understood in more
detail [57]. Indeed, the future of the enzymatic and biological
research into 24-SMT will provide new insights into development
of parasite-specific sterol biosynthesis inhibitors.
Of the substrates tested in the present study, the only one that
converted into an unexpected product was cholesta-5,7,22,24-
tetraenol, the other ꢀ24 sterols converted into typical side-
chain products formed by TbSMT. The tetraenol converted into
two C-24 methyl sterols with the minor biomethyl product
possessing the ‘native’ ꢀ22,24(28)-diene structure and the major
product possessing the previously uncharacterized ꢀ23(24)-C-22-
hydroxy group construction. In sterol structure–function tests of
plant and fungal 24-SMTs, cholesta-5,7,22,24-tetraenol failed
to bind productively. These results indicate that the conjugated
ꢀ22,24(25)-diene structure, which originates in the ERG6 mutant of
defective 24-SMT, is not an acceptable substrate in the C-24-
methylation reaction. Yet, ꢀ22,24(28) side chains occur naturally, as
a result they are often considered to be intermediates on the path
to 24β-alkyl sterols, such as ergosterol. It would appear that the
order of enzymatic reactions to form the ꢀ22-24β-methyl sterol
side chain proceeds first by C-24 methylation to form the ꢀ24(28)
-
olefin, then ꢀ22 desaturation followed by ꢀ24(28) reduction to form
the 24β methyl group. A possible explanation for ordering of the
C-24 methylation before ꢀ22 destaturation in the late stages of
ergosterol biosynthesis may be due to the potential harmful effect
of the intermediate C-22 cation species on 24-SMT activity.
It is tempting to speculate that the ꢀ22,24-diene sterol could
represent a substrate analogue, which upon C-24 methylation
affords a ‘charged’ intermediate in a region of the protein that
does not normally encounter reactive electrophilic centres and
that therefore would be susceptible to alkylation. Indeed, we have
shown the inactivation of 24-SMT synthases by sterol analogues
containing conjugated systems with a ꢀ24 bond due to attack
of the resulting intermediate cations on sensitive nucleophilic
groups of the enzyme which are in range of the rotationally
flexible side chain; upon saponification of the enzyme preparation
these intermediates sequester into the organic extracts as ‘diol’
structures possessing one hydroxy group at C-3 and the other
hydroxy group at C-24 or C-26 [23,44] (Supplementary Figure
S9 at http://www.BiochemJ.org/bj/439/bj4390413add.htm).
The multiple products generated by the protozoan TbSMT
are different from those synthesized by plant 24-SMT1 or 24-
SMT2, or the single product Erg6p, suggesting phyla-specific
differences in the primary structural elements that determine
product specificities. In AdoMet-dependent enzymes where the
methyl transfer reactions proceed through electrophilic catalysis
of an Sn2 mechanism, the methyl cation is transferred to the
double bond, forming a carbocation intermediate. The reaction
course can proceed differently among 24-SMTs such that in
ꢀ
c
ꢀ
c
The Authors Journal compilation 2011 Biochemical Society

Sterol C-24-methylation reaction
421
21 Croft, S. L., Barrett, M. P. and Urbina, J. A. (2005) Chemotherapy of trypanosomiases and
leishmaniasis. Trends Parasitol. 21, 508–512
22 de Souza, W. and Rodrigues, J. C. F. (2009) Sterol biosynthesis pathway as target for
anti-trypanosomatid drugs. Interdiscipl. Perspect. Infect. Dis. 2009, 642502
23 Nes, W. D. (2003) Enzyme mechanisms for sterol C-methylations. Phytochemistry 64,
75–95
AUTHOR CONTRIBUTION
Jialin Liu performed sterol analysis, synthesis and purification of substrates/products.
Kulothungan Ganapathy and Chizaram Nwogwugwu performed the kinetic studies with
the cloned TbSMT. Ewa Wywial and Janusz Bujnicki developed the homology model of
the TbSMT. W. David Nes conceived the work and wrote the paper.
24 Zhou, W., Guo, D. and Nes, W. D. (1996) Stereochemistry of hydrogen migration from
C-24 to C-25 during biomethylation in ergosterol biosynthesis. Tetrahedron Lett. 37,
1339–1342
FUNDING
25 Guo, D., Jia, Z. and Nes, W. D. (1996) Phytosterol biosynthesis: isotope effects associated
with biomethylation formation to 24-alkene sterol isomers. Tetrahedron Lett. 37,
6823–6826
26 Xu, S. and Nes, W. D. (1988) Biosynthesis of cholesterol in the yeast mutant erg6.
Biochem. Biophys. Res. Commun. 155, 509–517
ThisworkwassupportedbytheNationalScienceFoundation[grantnumberMCB-0929212
(to W.D.N.)] and the Polish Ministry of Science and Higher Education [grant numbers
POIG.02.03.00-00-003/09 and 188/N-DFG/2008/0 (to J.M.B.)].
27 Nes, W. D., Jayasimha, P., Zhou, W., Ragu, K., Jin, C., Jaradat, T. T., Shaw, R. W. and
Bujinicki, J. M. (2004) Sterol methyltransferase: functional analysis of highly conserved
residues by site-directed mutagenesis. Biochemistry 43, 569–576
28 Kurowski, M. A. and Bujnicki, J. M. (2003) GeneSilico protein structure prediction
meta-server. Nucleic Acids Res. 31, 3305–3307
29 Kosinski, J., Cymerman, I. A., Feder, M., Kurowski, M. A., Sasin, J. M. and Bujnicki,
J. M. A. (2003) ‘FRankenstein’s monster’ approach to comparative modeling: merging the
finest fragments of Fold-Recognition models and iterative model refinement aided by 3D
structure evaluation. Proteins 53, 369–379
30 Kosinski, J., Gakda, M. J., Cymerman, I. A., Kurowski, M. A., Pawlowski, M., Boniecki,
M., Obarska, A., Papaj, G., Srocznska-Obuchowicz, P., Tkacuk, K. L. et al. (2005)
FRankenstein becomes a cyborg: the automatic recombination and realignment of fold
recognition models in CASP6. Proteins 61, 106–113
31 Purta, E., van Vliet, F., Tricot, C., De Bie, L. G., Feder, M., Skowronek, K., Droogmans, L.
and Bujnicki, J. M. (2005) Sequence–structure–function relationships of a tRNA (m7G46)
methyltransferase studied by homology modeling and site-directed mutagenesis. Proteins
59, 482–488
32 Tkaczuk, K. L., Obarska, A. and Bujnicki, J. M. (2006) Molecular phylogenetics and
comparative modeling of HEN1, a methyltransferase involved in plant microRNA
biogenesis. BMC Evol. Biol. 6, 1
33 Simmons, K. T., Kooperberg, C., Huang, E. and Baker, D. (1997) Assembly of protein
tertiary structures from fragments with similar local sequences using simulated annealing
and Bayesian scoring functions. J. Mol. Biol. 268, 209–225
34 Boniecki, M., Rotkiewicz, P., Skolnick, J. and Kolinski, A. (2003) Protein fragment
reconstruction using various modeling techniques. J. Comput. Aided Mol. Des. 17,
725–738
REFERENCES
1
Zhou, W., Nguyen, H. T. and Nes, W. D. (2008) Plant sterol methyltransferase:
phytosterolomic analysis, enzymology and bioengineering Strategies. In Advances in
Plant Biochemistry and Molecular Biology (Lewis, N. G., ed.), pp. 242–281, Elsevier
Science, Oxford
2
3
Pearson, A., Bundin, M. and Brocks, J. J. (2003) Phylogenetic and biochemical evidence
for sterol synthesis in the bacterium Gemmata obscuriglobus. Proc. Natl. Acad. Sci.
U.S.A. 100, 15353–15357
Love, G. D., Grosjean, E., Stalvies, C., Fike, D. A., Grotzinger, J. P., Bradley, A. S., Kelly,
A. E., Bhatia, M., Meredith, W., Snape, C. E. et al. (2009) Fossil steroids record the
appearance of Demosponges during the Cryogenian period. Nature 457, 718–721
Nes, W. D., Norton, R. A., Crumley, F. G., Madigan, S. J. and Katz, E. R. (1990) Sterol
phylogenesis and algal evolution. Proc. Natl. Acad. Sci. U.S.A. 87, 7565–7569
Barenholz, Y. (2002) Cholesterol and other membrane active sterols: from membrane
evolution to ‘rafts’. Prog. Lipid Res. 41, 1–5
Bloch, K. E. (1983) Sterol structure and membrane function. Crit. Rev. Biochem. 14,
47–92
Bacia, K., Schwille, P. and Kurzchalia, T. (2005) Sterol structure determines the separation
of phases and the curvature of the liquid-ordered phase in model membranes. Proc. Natl.
Acad. Sci. U.S.A. 102, 3272–3277
4
5
6
7
8
9
Kerr, R. G. and Baker, B. J. (1991) Marine sterols. Nat. Prod. Rep. 8, 465–497
Djerassi, C. and Silva, C. J. (1991) Sponge sterols: origin and biosynthesis. Acc. Chem.
Res. 24, 371–378
10 Patterson, G. W. (1994) Phylogenetic distribution of sterols. Am. Chem. Soc. Symp. Ser.
562, 90–108
11 Neelakandan, A. K., Zong, Z., Wang, J., Richards, M. H., Wu, X., Valliyodan, B., Nguyen,
H. T. and Nes, W. D. (2009) Cloning, functional expression and phylogenetic analysis of
plant sterol 24C-methyltransferases involved in sitosterol biosynthesis. Phytochemistry
70, 1982–1998
12 El-Sayed, N. M., Myler, P. J., Blandin,, G., Berriman, M., Crabtree, J., Aggarwal, G., Caler,
E., Renauld, H., Worthey, E. A., Hertz-Fowler, C. et al. (2005) Comparative genomics of
trypanosomatid parasitic protozoa. Science 309, 409–415
35 Landau, M., Mayrose, I., Rosenberg, Y., Glaser, F., Martz, E., Pupko, T. and Ben-Tal, N.
(2005) ConSurf 2005 the projection of evolutionary conservation scores of residues on
protein structures. Nucleic Acids Res. 33, W299–W302
36 Bujnicki, J. M. (1999) Comparison of protein structures reveals monophyletic origin of
the AdoMet-dependent methyltransferase family and mechanistic convergence rather than
recent differentiation of N4-cytosine and N6-adenine DNA methylation. In Silico Biol. 1,
175–182
13 Berriman, M. E., Ghedin, C., Hertz-Fowler, C., Blandin, G., Renauld, H., Bartholomeu,
D. C., Lennard, N. J., Caler, E., Hamlin, N. E. and Haas, B. (2005) The genome of the
African trypanosome Trypanosoma brucei. Science 309, 416–422
37 Huang, C. C., Smith, C. V., Glickman, M. S., Jacobs, Jr, W. R. and Sacchettini, J. C.
(2002) Crystal structures of mycolic acid cyclopropane synthases from Mycobacterium
tuberculosis. J. Biol. Chem. 277, 11559–11569
14 Ivens, A. C., Peacock, C. S., Worthey, E. A., Murphy, L., Aggarwal, G., Berriman, M., Sisk,
E., Rajandream, M. A., Adlem, E., Aert, R. et al. (2005) The genome of the kinetoplastid
parasite, Leishmania major. Science 309, 436–442
15 Zhou, W., Cross, G. A.M. and Nes, W. D. (2007) Cholesterol import fails to prevent
catalyst-based inhibition of ergosterol synthesis and cell proliferation of Trypanosoma
brucei. J. Lipid Res. 48, 665–673
16 Zhou, W., Lepesheva, G. I., Waterman, M. R. and Nes, W. D. (2006) Mechanistic analysis
of a multiple product sterol methyltransferase implicated in ergosterol biosynthesis in
Trypanosoma brucei. J. Biol. Chem. 281, 6290–6296
17 Lepesheva, G. I., Nes, W. D., Zhou, W., Hill, G. C. and Waterman, M. R. (2004) CYP51
from Trypanosoma brucei is obtusifoliol-specific. Biochemistry 43, 10789–10799
18 Lepesheva, G. I., Ott, R. D., Hargove, T. Y., Kleshchenko, Y. Y., Schuster, L., Nes, W. D.,
Hill, G. C., Villalta, F. and Waterman, M. R. (2007) Sterol 14α-demethylase as a potential
target for antitrypanosomal therapy: enzyme inhibition and parasite cell growth. Chem.
Biol. 14, 1283–1293
19 Buckner, F., Yokoyama, K., Lockman, J., Aikenhead, K., Ohkanda, J., Sadliek, M., Sebti,
S., Van Voohis, W., Hamilton, A. and Gelb, M. H. (2003) A class of sterol 14-demethylase
inhibitors as anti-Trypanosoma cruzi agents. Proc. Natl. Acad. Sci. U.S.A. 100,
15149–15153
20 Roberts, C. W., McLeod, R., Rice, D. W., Ginger, M., Chance, M. L. and Goad, L. J. (2003)
Fatty acid and sterol metabolism: potential antimicrobial targets in apicomplexan and
trypanosatid parastic protozoa. Mol. Biochem. Parasitol. 126, 129–142
38 Wallner, B., Fang, H. and Elofsson, A. (2003) Automatic consensus-based fold
recognition using Pcons, ProQ, and Pmodeller. Proteins 53, 534–541
39 Pawlowski, M., Gajda, M. J., Matlak, R. and Bujnicki, J. M. (2008) MetaMQAP: a
meta-server for the quality assessment of protein models. (2008) BMC Bioinformatics 9,
403
40 Nes, W. D., McCourt, B. S., Zhou, W., Ma, J., Marhsall, J. A., Peek, L-A. and Brennan, M.
(1998) Overexpression, purification, and stereochemical studies of the recombinant
(S)-adenosyl-L-methionine: δ 24(25)- to δ 24(28)-sterol methyl transferase enzyme from
Saccharomyces cerevisiae. Arch. Biochem. Biophys. 353, 297–311
41 Goad, L. J. and Akihisa, T. (1997) Analysis of Sterols. Blackie Academic, London
42 Kokke, W. C.M. C., Shoolery, J. N., Fenical, W. and Djerassi, C. (1984) Mechanism of
side chain alkylation in E-24-propylidenecholesterol by a chrysophyte alga. J. Org. Chem.
49, 3742–3752
43 Jayasimha, P. and Nes, W. D. (2008) Photoaffinity labeling and mutational analysis of
24-C-sterol methyltransferase defines the AdoMet binding site. Lipids 43, 681–693
44 Nes, W. D., Marshall, J. A., Jia, Z., Jaradat, T. T., Song, Z. and Jayasimha, P. (2002)
Biosynthesis of phytosterols: kinetic mechanism for the enzymatic -methylation of sterols.
J. Biol. Chem. 277, 42459–42556
45 Ganapathy, K., Jones, C. W., Stephens, C. M., Vatsyayan, R., Marshall, J. A. and Nes,
W. D. (2008) Molecular probing of the Saccharomyces cerevisiae sterol 24-C
methyltransferase reveals multiple amino acid residues involved with C2-transfer activity.
Biochim. Biophys. Acta 1781, 344–351
ꢀ
c
ꢀ
c
The Authors Journal compilation 2011 Biochemical Society

422
J. Liu and others
46 Kozbial, P. Z. and Mushegian, A. R. (2005) Natural history of S-adenosylmethionine-
binding proteins. BMC Struct. Biol. 5, 19–25
52 Nes, W. D., Song, Z., Dennis, A. L., Zhou, W., Nam, J. and Miller, M. (2003) Biosynthesis
of phytosterols. Kinetic mechanism for the enzymatic C-methylation of sterols. J. Biol.
Chem. 278, 34505–34516
53 Goad, L. J., Knapp, F. F., Lenton, J. R. and Goodwin, T. W. (1972) Observations on the
sterol side-chain alkylation mechanism in a Trebouxia species. Biochem. J. 129,
219–222
54 Zimmerman, M. P. and Djerassi, C. (1991) Biosynthetic studies of marine lipids. 34.
Stereochemical features of the enzymatic C-methylation on the path to isofucosterol and
fucosterol. J. Am. Chem. Soc. 113, 3530–3533
47 Nes, W. D., Jayasimha, P. and Song, Z. (2008) Yeast sterol C24-methyltransferase: role of
highly conserved tyrosine-81 in catalytic competence studied by site-directed
mutagenesis and thermodynamic analysis. Arch. Biochem. Biophys. 477, 313–323
48 Nes, W. D., McCourt, B. S., Marshall, J. A., Ma, J., Dennis, A. L., Lopez, M., Li, H. and
He, L. (1999) Site-directed mutagenesis of the sterol methyl transferase active site from
Saccharomyces cerevisiae results in formation of novel 24-ethyl sterols. J. Org. Chem.
64, 1535–1542
49 Arigoni, D. (1978) Stereochemical studies of enzymic C-methylations. Ciba Found.
Symp. 60, 243–261
50 Mangla, A. T. and Nes, W. D. (2000) Sterol C-methyl transferase from Prototheca
wickerhamii mechanism, sterol specificity and inhibition. Bioorg. Med. Chem. 8,
925–936
55 Shimizu, S., Kawashima, H., Wada, M. and Yamada, H. (1992) Occurrence of a novel
sterol, 24,25-methylenecholest-5-en-3β-ol in Mortierella alpina 1S-4. Lipids 27,
481–483
56 Vaubourgeix, J., Bardou, F., Boissier, F., Julien, S., Constant, P., Ploux, O., Daffe, M.,
Quemard, A. and Mourey, L. (2009) S-Adenosyl-N-decyl-aminoethyl, a potent bisubstrate
inhibitor of Mycobacterium tuberculosis mycolic acid methyltransferases. J. Biol. Chem.
284, 19321–19330
51 Venkatramesh, M., Guo, D., Jia, Z. and Nes, W. D. (1996) Mechanism and structural
requirements for transformations of substrates by the
S-adenosyl-L-methionine:ꢀ24(25)-sterol methyl transferase enzyme from Saccharomyces
cerevisiae. Biochim. Biophys. Acta 1299, 313–324
57 Smith, T. K. and Butikofer, P. (2010) Lipid metabolism in Trypanosoma brucei. Mol.
Biochem. Parasitol. 172, 66–79
Received 13 May 2011/30 June 2011; accepted 8 July 2011
Published as BJ Immediate Publication 8 July 2011, doi:10.1042/BJ20110865
ꢀ
c
ꢀ
c
The Authors Journal compilation 2011 Biochemical Society

Biochem. J. (2011) 439, 413–422 (Printed in Great Britain) doi:10.1042/BJ20110865
SUPPLEMENTARY ONLINE DATA
Effect of substrate features and mutagenesis of active site tyrosine residues
on the reaction course catalysed by Trypanosoma brucei sterol
C-24-methyltransferase
Jialin LIU*1, Kulothungan GANAPATHY*1, Ewa WYWIAL†, Janusz M. BUJNICKI†‡, Chizaram A. NWOGWUGWU* and
W. David NES*2
*Department of Chemistry and Biochemistry, Texas Tech University, Lubbock, TX 79409, U.S.A., †The Laboratory of Bioinformatics and Protein Engineering, International Institute of
Molecular and Cell Biology in Warsaw, ul. Ks. Trojdena 4, 02-109 Warsaw, Poland, and ‡The Laboratory of Bioinformatics, Institute of Molecular Biology and the Biotechnology, Faculty
of Biology, Adam Mickiewicz University, ul. Umultowska 89, 61-614 Poznan, Poland
Figure S1 Natural sterol acceptors for 24-SMT
Theacceptorsare:zymosterolforfungalandprotozoan24-SMT1;lanosterolforfungal24-SMT1;
cycloartenol for plant 24-SMT1; and 24(28)-methylene lophenol for plant 24-SMT2 [1,2].
Figure S2 Time-course study of TbSMT incubated with saturating amounts
of zymosterol and AdoMet
Zymosterol (100 μM) and AdoMet (100 μM) were diluted with catalytic amounts of
[methyl-3H3]AdoMet in standard assay conditions as discussed in the Materials and methods
section of the main text. When plotting the kinetics of TbSMT catalysis using the radioactivity in
biomethyl product formation, the d.p.m. in product formation continued to increase after 60 min
(by approximately 20% over the product formed at 60 min) and plateaus at 120–240 min
of incubation, yet the specific activity (pmol·min− 1·mg− 1 of total protein) decreases with
increasing time giving rise to the initial velocity conditions reported in the Materials and
methods section of the main text.
1
These authors contributed equally to this work.
To whom correspondence should be addressed (email wdavid.nes@ttu.edu).
2
ꢀ
c
ꢀ
c
The Authors Journal compilation 2011 Biochemical Society

J. Liu and others
Figure S3 EI-MS spectra
Ergosta-8,25(27)-dienol (1), ergosta-8,24(28)-dienol (2), ergosta-8,24(25)-dienol (3) and 24-dimethyl ergosta-8,25(27)-dienol (4) from incubation of TbSMT with zymosterol paired with AdoMet
(A), [27-13C]zymosterol paired with AdoMet (B) or [24-2H]zymosterol paired with AdoMet (C).
ꢀ
c
ꢀ
c
The Authors Journal compilation 2011 Biochemical Society

Sterol C-24-methylation reaction
Figure S4 EI-MS spectra of TbSMT products generated from incubation of cholesta-5,7,24-trienol
(A) Spectrum of the substrate. (B) Mass spectrum for the three mono-alkylated products [ergosta-5,7,25(27)-trienol, ergosta-5,7,24(28)-trienol and ergosta-5,7,24(25)-trienol] which showed similar
fragmentation patterns. (C) Mass spectrum of 24-dimethyl ergosta-5,7,25(27)-trienol.
ꢀ
c
ꢀ
c
The Authors Journal compilation 2011 Biochemical Society

J. Liu and others
Figure S5 500 MHz 1H-NMR spectrum of the TbSMT-generated product
Product was generated from incubation with cholesta-5,7,22,24-tetraenol and corresponds with the late-eluting GC peak at a RRTc value of 1.48 and a M + value of 412 a.m.u.
Figure S6 Sequence alignment comparison of CMA (PDB code IKP1) and T. brucei sterol C24-methyl transferase (TbSMT)
Cylinders represent α-helices, arrows are β-stands. ss, secondary structure; ssp, secondary structure predictions.
Figure S7 GC-MS (total ion chromatogram) of incubations
The incubations shown are with wild-type TbSMT (A), zymosterol with Y66F TbSMT (B) and ergosta-5,24(25)-dienol with Y66F TbSMT (C).
ꢀ
c
ꢀ
c
The Authors Journal compilation 2011 Biochemical Society

Sterol C-24-methylation reaction
Figure S8 EI-MS of incubations of Y66F TbSMT with ergosta-5,24(25)-dienol
Substrate (A) and product (B) from the incubation are shown. The GC profile can be seen in Figure S6(C).
ꢀ
c
ꢀ
c
The Authors Journal compilation 2011 Biochemical Society

J. Liu and others
Figure S9 Postulated C-24-methylation mechanisms involved in the formation of C-24 and C-26-hydroxylated side chains from sterol analogues proven to
be suicide substrates
Reported in [3,4].
REFERENCES
1
Neelakandan, A.K., Song, Z., Wang, J., Richards, M.H., Wu, X., Valliyodan, B., Nguyen, H.
T. and Nes, W.D. (2009) Cloning, functional expression, and phylogenetic analysis of plant
24C-methyltransferases involved in sitosterol biosynthesis. Phytochemistry 70,
1982–1998
2
Pereira, M., Song, Z., Santos-Silva, L.K., Richards, M.R., Nguyen, T.T., Liu, J., Ganapathy,
K. and Nes, W.D. (2010) Cloning, mechanistic and functional analysis of a fungal sterol
24-C methyltransferase implicated in brassicaterol biosynthesis. Biochim. Biophys. Acta
1801, 1163–1174
3
4
Nes, W.D., Marshall, J.A., Jia, Z., Jaradat, T.T., Song, Z. and Jayasimha, P. (2002) Active
site mapping and substrate channeling in the sterol methyl transferase pathway. J. Biol.
Chem. 277, 42459–42556
Song, Z. and Nes, W.D. (2007) Inactivation of soybean sterol 24-C-methyltransferase by
elongated sterol side chains at C26. Bioorg. Med. Chem. Lett. 17, 5902–5906
Received 13 May 2011/30 June 2011; accepted 8 July 2011
Published as BJ Immediate Publication 8 July 2011, doi:10.1042/BJ20110865
ꢀ
c
ꢀ
c
The Authors Journal compilation 2011 Biochemical Society