Double cyclization of bis(α-hetarylmethyl)amino esters to optically active bridged N-heterocycles of HIV-inhibiting activity

Article abstract of DOI:10.1002/ejoc.200400136

Anellated 1-azabicyclo[3.3.1]nonanes 6 were synthesized by several routes starting from natural α-amino esters 2 and ohaloaryl- or o-bromohetarylmethyl bromides 1. N-Alkylation of the starting amino esters to 5 and 3 was followed by halogen/lithium exchange and double cyclization. The cyclization products 6 exhibit interesting inhibition of RNase H and DNA-polymerase activity of reverse transcriptase (RT) of HIV-1 at concentrations where human cellular DNA polymerases are not affected. Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, Germany, 2004.

Full text of DOI:10.1002/ejoc.200400136

FULL PAPER
Double Cyclization of Bis(α-hetarylmethyl)amino Esters to Optically Active
Bridged N-Heterocycles of HIV-Inhibiting Activity
Heike Faltz,[a] Christoph Bender,[a] Birgitta M. Wöhrl,*[b][‡] Karin Vogel-Bachmayr,[b][‡]
Ullrich Hübscher,[c] Kristijan Ramadan,[c] and Jürgen Liebscher*[a]
Dedicated to Prof. Dr. Johann Mulzer on the occasion of his 60th birthday
Keywords: Nitrogen heterocycles / Cyclization / Lithiation / Antiviral agents / Inhibitors
Anellated 1-azabicyclo[3.3.1]nonanes 6 were synthesized by
several routes starting from natural α-amino esters 2 and o-
haloaryl- or o-bromohetarylmethyl bromides 1. N-Alkylation
of the starting amino esters to 5 and 3 was followed by hal-
ogen/lithium exchange and double cyclization. The cycliza-
DNA-polymerase activity of reverse transcriptase (RT) of
HIV-1 at concentrations where human cellular DNA poly-
merases are not affected.
( Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim,
tion products 6 exhibit interesting inhibition of RNase H and Germany, 2004)
Introduction
occurs under very mild conditions (Ϫ100 °C) to afford chi-
ral polycyclic hydroxytetrahydropyridines 6 via intermedi-
ate monocyclization products 8. Here, we disclose the scope
and limitations of this synthesis, the extension of this
method to bis(o-iodobenzyl)amino esters, as well as full ex-
perimental details. We further report the highly interesting
activity of bridged polycyclic hydroxytetrahydropyridines 6
as inhibitors of RNase H and DNA-polymerase activity of
reverse transcriptase (CT) of HIV 1.
Achiral 1-azadibenzo[c,f]bicyclo[3.3.1]nonanes have at-
tracted interest as antihistaminic compounds
[1]
and as
starting materials in the synthesis of Amaryllidaceae alka-
loids.[2,3] Such compounds as well as thieno analogues were
synthesized by acid-catalyzed double cyclization of α-(di-
benzylamino)aldehydes, acetals,[1,2,4,5] ketones
or N,N-
[6,7]
dibenzyl-2-propynylamines.[8] Alternatively, suitably func-
tionalized isoquinolines can undergo electrophilic cycliza-
tion to 1-azadibenzo[c,f]bicyclo[3.3.1]nonanes.[3,9Ϫ12] 1-Az-
adibenzo[c,f]bicyclo[3.3.1]nonanes were also obtained by
treatment of 4-aryltetrahydroisoquinolines with formal-
dehyde.[13] So far, optically active members of this class of
compounds could only be obtained by optical resolution.[2]
We recently found a novel stereoselective chiral pool syn-
thesis of heterocyclic analogues 6 of 1-azadibenzo[c,f]bicy-
clo[3.3.1]nonanes (most of the analogues were β-carboline
derivatives).[14] Our synthesis starts with amino esters 2,
which are dialkylated by o-bromobenzyl halides or their
heterocyclic analogues 1 to afford 5. After the exchange of
bromide by lithium with butyllithium, double cyclization
Results and Discussion
Synthesis
A variety of brominated and iodinated N,N-bis(hetaryl-
methyl)-2-amino esters 5 were obtained by reaction of the
corresponding α-amino ester 2 with 2 equiv. of the corre-
sponding benzyl halide or its heterocyclic analogue 1
(Scheme 1, Table 1). Asymmetrically substituted dialky-
lation products 5kϪm with different aryl rings (Ar1 ϶ Ar2)
were synthesized in a two-step mode, i.e. by the isolation of
monoalkylation products 3. Higher yields of the 3-bromo-
indol-2-yl-substituted products 5 (Ar1 ϭ indole, Ar2 ϶ Ar1)
were obtained when the 3-bromoindol-2-ylmethyl substitu-
ent was introduced first (formation of corresponding 3a
with Ar1 ϭ indole) followed by N-alkylation with the other
o-bromobenzyl halide or heterocyclic analogue 1, rather
than with the reversed sequence. To prevent competing for-
mation of the dialkylation product 5 with identical aryl
rings (Ar1 ϭ Ar2) in the monoalkylation to 3a, an excess of
[‡]
Present address: Universität Bayreuth, Lehrstuhl für Struktur
und Chemie der Biopolymere, Universitätsstrasse 30,
95447 Bayreuth, Germany
[a]
Institut für Chemie, Humboldt-Universität Berlin,
Brook-Taylor-Strasse 1Ϫ2, 12489 Berlin, Germany
[b]
Max-Planck-Institut für molekulare Physiologie,
Otto-Hahn-Strasse 11, 44227 Dortmund, Germany
[c]
Institut für Veterinärbiochemie und Molekulare Biologie,
Universität Zürich-Irchel,
Winterthurerstrasse 190, 8057 Zürich, Switzerland
3484
 2004 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
DOI: 10.1002/ejoc.200400136
Eur. J. Org. Chem. 2004, 3484Ϫ3496

Double Cyclization of Bis(α-hetarylmethyl)amino Esters
FULL PAPER
amino ester 2 was used. X-ray crystal analysis of the N,N-
diskatylvaline derivative 5f exhibits a sterically crowded ar-
rangement around the indole rings, which is somewhat re-
lieved by arranging these two rings in an edge to face man-
ner (Figure 1).
Table 1 (continued)
Table 1. (S)-N,N-Bis(hetarylmethyl)-2-amino esters 5
Scheme 1
The cyclization of the N,N-dialkylated products 5 to 1-
azadibenzo[c,f]bicyclo[3.3.1]nonanes and their heterocyclic
analogues 6 (see Table 2) was generally achieved by im-
plementing the halo/lithium exchange with nBuLi at Ϫ100
°C (Route A). In this context it is worth mentioning that
reaction of just 1 equiv. of nBuLi with the dialkylation
product 5m gave a monocyclization product 8e rather than
low yields of the corresponding double cyclization product
6f (Route B). Further treatment of 8e with nBuLi (Route C)
implemented the second cyclization to 6f. This result also
demonstrates the higher reactivity of the bromoindole ring
in bromo/lithium exchange reactions relative to that of the
bromothiophene substituents.
Eur. J. Org. Chem. 2004, 3484Ϫ3496
www.eurjoc.org
 2004 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
3485

J. Liebscher et al.
FULL PAPER
O-butyl ether (formula 8 with R2 ϭ BuOCH2), obviously
derived from alkylation by butyl bromide formed in the
bromo/lithium exchange. Therefore, 5i was protected by
TBDMSCl to afford 5j, which was further treated with 2
equiv. of nBuLi. Again, only monocyclization occurred, and
the debrominated β-carboline 12 (Ar1 ϭ Ar2 ϭ indole;
R2 ϭ CH2OTBS) was obtained.
Figure 1. X-ray crystal analysis of N,N-diskatylvaline ester 5f
The N,N-bis(o-bromobenzyl)valine ester 5b afforded the
monocyclization product 8a when treated with 2 equiv. of
butyllithium (Route B), i.e. it resisted a second bromo/lith-
ium exchange and cyclization. Similar monocyclization
products 7 were obtained before, when mono(o-bromo-
benzyl)amino esters or heterocyclic analogues 3 were
treated with butyllithium at low temperatures.[15,16] Only
unchanged starting material 5b and the monocyclization
product 8a were found in the reaction mixture when the
bis(o-bromobenzyl)amino ester 5b was treated with 2 equiv.
of tBuLi. Obviously, the o-bromobenzyl moieties are not as
reactive as the bromo-substituted heterocyclic rings. This
was also observed in the treatment of N,N-bis(o-bromo-
benzyl)alanine ester 5a with nBuLi, which afforded a mix-
Scheme 2
The structures of the cyclization products 6 and 8 were
ture of bromobenzylated products 9, 10 and 11 and in elucidated by spectroscopic methods, in particular by NMR
which BuLi had attacked the carbonyl group while the spectroscopy. An NOE was observed between the hydroxy
bromo substituents survived (Scheme 2). Remarkably, a proton and the iPr group in 6g, thus proving the proximity
double cyclization to the envisaged 6a could be achieved of both groups. The stereochemical mode of attack in the
starting from the more reactive N,N-(o-iodobenzyl)valine second cyclization step is likely to be anti with respect to
ester 5c through route A, although in low yields. Treatment the substituent R2, as found in intermolecular 1,2-additions
of the tetramethoxy-substituted N,N-bis(o-bromobenzyl)- of Grignard reagents or hydride to the carbonyl group of
alanine ester 5d with nBuLi resulted in the re-isolation of condensed dihydropyridones 7.[16,17] However, this mode
the starting material. We suppose that the bromo/Li ex- only has consequences toward the final configuration if
change is hampered by the high electron density in the aryl products 6 are formed in which Ar1 and Ar2 are different
ring, or that the chelating properties of the dimethylcatechyl from each other, i.e. 6f. Since the latter compound could
moiety caused complexation of the Li ion thus preventing also be synthesized starting form 8e, the syn attack would
bromo/Li exchange. In some of the successful double cycli- lead to the given structure 6f (see Scheme 1 and Table 2).
zations of bis(o-bromohetarylmethyl)amino esters 5 to 6, HPLC and NMR spectroscopy of the crude double cycliza-
halogen-lacking monocyclization products 12 were ob- tion products 6 did not show any sign of racemization or
served as by-products in low yield. These by-products could epimerization. Thus, a peak for the (Ϫ) enantiomer of 6c
be formed from monocyclization product 8 by further was totally absent in the chromatogram (HPLC at CHIR-
bromo/lithium exchange. But the second cyclization to 6 ALCEL OD phase) of compound 6c. This result corre-
failed, and thus a proton was introduced upon quenching sponds to an ee Ͼ 99%, i.e. the configuration of the chiral
with water. The second cyclization was also unsuccessful, center in the starting amino esters 2 was not affected
when the serine ester 5i was used as starting material. Treat- throughout the transformations into the final product. The
ment of this compound with 3 equiv. of nBuLi gave a mix- diindolo product 6b could be methylated with methyl iodide
ture of monocyclization product 8c and the corresponding to afford the quaternary ammonium salt 13 in high yield,
3486
 2004 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.eurjoc.org
Eur. J. Org. Chem. 2004, 3484Ϫ3496

Double Cyclization of Bis(α-hetarylmethyl)amino Esters
FULL PAPER
Table 2. 5-Hydroxy-1-azabicyclo[3.3.1]nonanes 6 and monocyclization products 8
[a]
[b]
[c]
[d]
ϩ17% 8e. tBuLi. ϩ 48% 6f. 30% 8c ϩ 19% 8d ϩ 18% 5i.
Eur. J. Org. Chem. 2004, 3484Ϫ3496
www.eurjoc.org
 2004 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
3487

J. Liebscher et al.
FULL PAPER
ficient to severely impair the polymerization activity; 74%,
85% and 88% of inhibition can be achieved at this concen-
tration. The main difference between the polymerization
products in the absence or presence of the inhibitors ap-
pears to be the quantity of the products but not their
length. This indicates that the inhibitor reduces the poly-
merization activity of the enzyme but does not reduce its
processivity, i.e. the number of nucleotides incorporated be-
fore the enzyme dissociates from the substrate.
Table 3. Quantification of polymerization products in the presence
of inhibitor
Inhibitor µ
6b[a]
6d[a]
6e[a]
100
32
8
87
75
0
89
85
46
0
88
88
33
0
2
0
0.8
0
0
0
[a]
Values represent percentage of inhibition.
Figure 2. PM3 geometry-optimized structure of 6b (UniChem. 4.0)
which might be useful as in asymmetric phase-transfer ca-
talysis. The double cyclization products 6 are butterfly-
shaped (for a PM3 geometry-optimized structure see Fig-
ure 2). Since other butterfly-shaped molecules were re-
ported as anti-HIV agents,[18] we tested some products 6 for
possible antiviral properties.
Antiviral Testing
RT Inhibition
The enzyme reverse transcriptase (RT) is a pivotal en-
zyme in the life cycle of human immunodeficiency virus 1
(HIV-1), the causative agent of AIDS. It catalyzes the con-
version of the single-stranded RNA genome into double-
stranded DNA, which is then incorporated into the genome
of the host cell. Antiviral substances that have been devel-
oped to inhibit this enzyme lead to the development of a
resistant virus. Thus, the design of new antivirals to fight
the virus is essential.
In order to determine the inhibitory effect of 6b, 6d, and
6e on the DNA polymerization activity of HIV-1 RT, we
performed RT activity assays with a heteropolymeric DNA
template. This substrate mimics the synthesis of the second
DNA strand during reverse transcription. A 5Ј[32P] radioac-
tively labeled primer hybridized onto single-stranded M13
DNA was elongated in the presence of HIV-1 RT and
dNTPs. The length of the polymerization products was vis-
Figure 3. Analysis of polymerization products in the presence of
inhibitors; HIV-1 RT (10 n) was preincubated with dNTPs (250
µ) in the absence of inhibitor (lane ϩRT) or in the presence of
6b, 6d or 6e at the following concentrations: 100 µ (lanes 1), 32
µ (lanes 2), 8 µ (lanes 3), 2.0 µ (lanes 4), 0.8 µ (lanes 5);
lane ϪRT ϭ substrate without HIV-1 RT; approximate sizes (in
nucleotides) of the elongation products are indicated on the right;
reactions were started by the addition of a radioactively labeled
M13/primer substrate; after incubation at 37 °C for 20 min, reac-
tions were stopped and the samples were applied on a 10% denatur-
ing urea/polyacrylamide gel; the polymerization products were vis-
ualized by phosphorimaging
Inhibition of RNase H Activity
The RNase H domain of the dimeric HIV RT is located
ualized on a denaturing polyacrylamide gel by phosphorim- at the C-terminus of the larger 66 kDa subunit of the en-
aging (Figure 3). Quantification of the elongation products zyme and hydrolyzes the RNA strand in the RNA/DNA
in the presence of inhibitor (Table 3) shows that with all hybrid that is created during the first step of reverse tran-
three inhibitors, concentrations of around 32 µ are suf- scription of the viral RNA genome. This activity is also
3488
 2004 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.eurjoc.org
Eur. J. Org. Chem. 2004, 3484Ϫ3496

Double Cyclization of Bis(α-hetarylmethyl)amino Esters
FULL PAPER
Figure 4. Inhibition of RNase H activity; 20 n of HIV-1 RT was incubated with 6b, 6d or 6e at the following concentrations: 200 µ
(lanes 1), 100 µ (lanes 2), 32 µ (lanes 3), 8 µ (lanes 4) or 2 µ (lanes 5); RNase H cleavage reactions were started by the addition of
a fluorescent-labeled RNA/DNA hybrid; a schematic representation of the hybrid is shown on top; the asterisk on the 5Ј end of the
RNA indicates the Cy5 fluorescent label; potential cleavage sites in the RNA are indicated by arrows; cleavage products were separated
on 10% denaturing urea/polyacrylamide gels; the fluorescent bands were visualized using a fluorimaging device
essential in the life cycle of the virus. Since no RNase H Toxicity
inhibitors are in clinical use yet, RNase H is an interesting
target for HIV inhibition.
We also determined if these substances had a toxic effect
on human cells. This was tested on the human HeLa cell
line with increasing amounts of inhibitors. Our results indi-
cate that 6d was least toxic. Even at the highest concen-
tration of 300 µ of 6d, only about 30% of the cells died,
whereas with 6b and 6e about 40Ϫ50% of the cells died at
a concentration of 100 µ.
To mimic the RNA/DNA substrate in vitro we used an
RNA that contained a fluorescent label at the 5Ј end, and
hybridized it to an oligodeoxynucleotide. Upon cleavage of
the RNA by the RNase H activity of RT, the labeled 5Ј
RNA reaction products can be analyzed on a denaturing
polyacrylamide gel.
Figure 4 shows the cleavage products by HIV-1 RT in the
presence of inhibitors. Clearly, with all three inhibitors (6b,
6d and 6e) a strong inhibition of more than 50% of the
RNase H activity is already visible at inhibitor concen-
trations of 8 µ (Table 4). These concentrations are even
lower than those necessary for inhibition of the polymerase
activity (Figure 3). Since our results indicate that both the
polymerase as well as the RNase H activity of RT are re-
duced in the presence of inhibitor, inhibition by these sub-
stances may be even more effective in vivo. Furthermore,
inhibition of the two enzyme activities implies confor-
mational changes of the enzyme upon inhibitor binding,
which influence its two active sites.
Effect on Cellular DNA Polymerases
To determine whether the inhibitors are specific for HIV
RT but do not impair human cellular polymerases the two
inhibitors of HIV-RT-polymerase 6b and 6d, dissolved in
DMSO, were tested for a main replicative DNA poly-
merase, exemplified as pol δ, and for an essential repair
DNA polymerase, exemplified as pol β (Figure 5). For both
tested inhibitors 6b and 6d with concentrations of 16 µ,
pol δ is inhibited by about 10%, and with a concentration
of 32 µ by about 40%. When pol β was tested with these
two inhibitors, it is even less sensitive (with a concentration
of 32 µ for the inhibitors, only 10% inhibition with 6b or
20% with 6d) than pol δ. The influence of both substances
on pol λ, another repair pol, was similar to that on pol β
(data not shown). The final concentration of DMSO as the
solvent for the chemical substances in the reactions was 5%,
and was taken as the zero control to measure the effect of
DMSO alone.
Table 4. Quantification of the RNase H cleavage products in the
presence of inhibitor
Inhibitor µ
6b[a]
6d[a]
6e[a]
200
100
32
8
83
83
87
57
48
81
81
81
72
56
80
80
80
74
44
Conclusion
A highly stereoselective synthesis of chiral polycyclic
hydroxytetrahydropyridines
through a double cyclization of bis(haloheteroarylmethyl)a-
mino esters by bromo or iodo/lithium exchange with BuLi.
6 has been accomplished
2
[a]
Values represent percentage of inhibition.
Eur. J. Org. Chem. 2004, 3484Ϫ3496
www.eurjoc.org
 2004 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
3489

J. Liebscher et al.
FULL PAPER
are new and were obtained by adopting known procedures for the
synthesis of analogues.[18Ϫ21] TLC analysis was performed on
Merck silica gel 60F254 plates and visualized with UV illumination
and charring with phosphomolybdic acid in EtOH (5%, v/v) or
0.3% ninhydrin in EtOH. Column chromatography was conducted
with Merck silica gel 60 (400Ϫ639 mesh). 1H NMR and 13C NMR
spectra were recorded at 300 and 75.5 MHz, respectively, with a
Bruker AC-300 in CDCl3 with TMS as internal standard. Mass
spectra were measured at 70 eV. Optical rotations were determined
with a PerkinϪElmer polarimeter 241 (d ϭ 2 mm). Enantiomeric
purity was proved by analytical HPLC on cellulose carbamate
(Chiral PAK AD).
Starting Materials 1
N-Boc-3-bromo-2-(bromomethyl)indole (1a): NBS (4.45 g, 0.025
mol) and a catalytic amount of AIBN were added to a solution
of N-Boc-3-bromo-2-methylindole (7.75 g, 0.025 mol) in dry CCl4
(150 mL). The mixture was slowly heated to 80 °C and kept at this
temperature for 2 h. After cooling to room temperature, the re-
sulting succinimide was filtered off, and the filtrate was concen-
trated under vacuum. The remainder was purified by column chro-
matography (hexane/EtOAc, 9:1; Rf ϭ 0.56) to afford the colorless
1
product in 98% yield. H NMR (CDCl3): δ ϭ 1.98 (s, 9 H), 5.31
(s, 2 H), 7.13Ϫ7.35 (m, 3 H), 8.01 (d, J ϭ 8.4 Hz, 1 H) ppm. 13C
NMR (CDCl3): δ ϭ 25.4 (CH2), 28.4 (CH3), 85.9 (C), 104.1 (C),
116.3 (CH), 120.2 (CH), 124.1 (CH), 127.0 (CH), 128.2 (C), 133.1
(C), 136.5 (C), 149.5 (CO) ppm. C14H15Br2NO2 (389.08): calcd. C
43.22, H 3.89, N 3.60; found C 43.61, H 3.72, N 3.41.
3-Bromo-2-(bromomethyl)thiophene (1b): 3-Bromo-2-methylthio-
phene (2.60 g, 0.0147 mol) was brominated with NBS (2.62 g,
0.0147 mol) in CCl4 in the same manner (vide supra) to afford the
product as yellow oil (Rf ϭ 0.43; hexane/EtOAc, 9:1) in 86% yield.
1H NMR (CDCl3): δ ϭ 4.56 (s, 2 H), 6.82 (d, J ϭ 5.4 Hz, 1 H),
7.19 (d, J ϭ 5.4 Hz, 1 H) ppm. 13C NMR: (CDCl3): δ ϭ 25.2
(CH2), 112.7 (C), 126.7 (CH), 130.5 (CH), 134.6 (C) ppm.
Figure 5. Effect of the two different inhibitors 6b (corresponds to
number 1316) and 6d (corresponds to number 1317) on DNA poly-
merases δ (A) and DNA polymerase β (B); the DNA polymerase
assays were carried out as outlined in Materials and Methods (Exp.
Sect.); the results represent the mean of triplicate experiments
The synthesis can conveniently be implemented as a one- tert-Butyl 3-Bromo-2-({[(1S)-1-(methoxycarbonyl)-2-methylpropyl]-
amino}methyl)-1H-indol-1-carboxylate (3a): A solution of 1-Boc-3-
bromo-2-(bromomethyl)indole (5.84 g, 0.015 mol), methyl valinate
(3.93 g, 0.03 mol), and K2CO3 (2.07 g, 0.015 mol) in MeCN
(200 mL) was refluxed for 3 h. The resulting suspension was fil-
tered, and the filtrate was concentrated under vacuum. The remain-
der was purified by column chromatography. Yellow oil, 62% yield,
Rf (hexane/ethyl acetate, 98:2) ϭ 0.22, [α]2D0 ϭ ϩ2.3 (c ϭ 1,
CH2Cl2). H NMR (CDCl3): δ ϭ 0.81 (d, J ϭ 6.8 Hz, 3 H, CH3),
0.86 (d, J ϭ 6.3 Hz, 3 H, CH3), 1.66 [s, 9 H, (CH3)3Cq], 1.71Ϫ1.80
[m, 1 H, CH(CH3)2], 2.09 (s, 1 H, NH), 2.98 (d, J ϭ 5.6 Hz, 1 H,
pot procedure but is also possible in two steps. The two
heterocyclic rings anellated to the final hydroxytetrahydro-
pyridine can be identical or different. Bromobenzyl sub-
stituents are not as suitable for BuLi-mediated double cycli-
zation as heterocyclic analogues. N-Alkylation of the prod-
ucts 6 produces quaternary ammonium salts. The double
cyclization products 6 possess butterfly-shaped structures.
They exhibit remarkable, inhibitory effects on the poly-
merase as well as on the RNase H activity of HIV-1 RT.
1
On the other hand, these products appear to exert low tox- CHN), 3.19 (s, 3 H, CH3O), 4.11 (d, J ϭ 14.7 Hz, 1 H, CH2N),
4.24 (d, J ϭ 14.7 Hz, 1 H, CH2N), 7.19Ϫ7.28 (m, 2 H, CHar), 7.42
(d, J ϭ 7.2 Hz, 1 H, CHar), 8.02 (d, J ϭ 7.9 Hz, 1 H, CHar) ppm.
13C NMR (CDCl3): δ ϭ 18.4 (CH3), 19.1 (CH3), 28.4 (C), 31.9
(CH), 44.7 (CH2ϪN), 51.2 (CH3), 65.5 (CH), 84.8 (C), 102.3 (C),
115.7 (CH), 118.3 (CH), 119.9 (CH), 123.3 (CH), 127.9 (C), 135.5
(C), 135.7 (C), 149.8 (CO), 175.3 (CO) ppm. C20H27BrN2O4
(439.34): calcd. C 54.68, H 6.19, Br 18.19, N 6.38; found C 54.73,
H 6.08, Br 18.57, N 6.46.
icity and affect human DNA-polymerases to a lower extent
than HIV-1 RT. The repair DNA polymerase β is even less
affected. Thus, these compounds might represent a promis-
ing lead for the development of new drugs in the HIV ther-
apy.
Experimental Section
tert-Butyl (3S)-3-Isopropyl-4-oxo-1,2,3,4-tetrahydro-9H-β-carbolin-
9-carboxylate (7a): A solution of 3a (0.658 g, 1.5 mmol) in dry
THF (80 mL) under argon was cooled to Ϫ100 °C. 1.7  tBuLi in
pentane (3.15 mmol) was added dropwise while the temperature
was kept below Ϫ98 °C. After complete addition, the mixture was
stirred at Ϫ100 °C for 4 h and was quenched with satd. aqueous
NH4Cl. The mixture was stirred at room temperature until all pre-
a) Synthesis
General Remarks: All reactions were carried out under argon in
oven-dried glassware. Solvents were dried and deoxygenated by
standard procedures. Starting materials were purchased from Ald-
rich and Merck. (Bromomethyl)arenes and heteroarenes 1 and 4
3490
 2004 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.eurjoc.org
Eur. J. Org. Chem. 2004, 3484Ϫ3496

Double Cyclization of Bis(α-hetarylmethyl)amino Esters
cipitate had dissolved. The mixture was extracted with CH2Cl2 Ϫ41.7. (c ϭ 1.2, CHCl3). 1H NMR (CDCl3): δ ϭ 0.87 (d, J ϭ
FULL PAPER
three times, and the combined organic layers were dried (Na2SO4).
After removal of the solvent under vacuum, the remainder was
purified by column chromatography. Colorless solid, 61% yield. M.
5.3 Hz, 3 H, CH3), 0.89 (d, J ϭ 5.3 Hz, 3 H, CH3), 1.19 (t, J ϭ
7.1 Hz, 3 H, CH3), 1.87 (m, 1 H, CH), 2.92 (d, J ϭ 8.2 Hz, 1 H,
CH), 3.55 (d, J ϭ 13.9 Hz, 2 H, CH2), 3.76 (d, J ϭ 13.9 Hz, 2 H,
CH2), 4.08 (q, J ϭ 7.1 Hz, 2 H, CH2), 6.84 (m, 2 H, CH), 7.23 (m,
p. 168 °C, Rf (CH2Cl2/acetone, 8:2) ϭ 0.36, [α]2D0 ϭ Ϫ11.4 (c ϭ 1,
1
CH2Cl2). H NMR (CDCl3): δ ϭ 0.95 (d, J ϭ 6.8 Hz, 3 H, CH3), 4 H, CH), 7.71 (m, 2 H, CH) ppm. 13C NMR (CDCl3): δ ϭ 14.5
1.01 (d, J ϭ 6.9 Hz, 3 H, CH3), 1.63 [s, 9 H, (CH3)3Cq], 2.06 (s, 1
(CH3), 18.7 (CH3), 19.4 (CH3), 31.8 (CH), 56.9 (CH2), 60.4 (CH2),
H, NH), 2.36Ϫ2.49 [m, 1 H, CH(CH3)2], 3.10 (d, J ϭ 5.5 Hz, 1 H, 66.7 (CH), 99.9 (2 C), 128.1 (2 CH), 128.7 (2 CH), 129.6 (2 CH),
CHN), 4.29 (d, J ϭ 19.0 Hz, 1 H, CH2N), 4.54 (d, J ϭ 19.0 Hz, 1 2 ϫ 139.3 (CH), 142.1 (2 C), 174.9 (CO) ppm.
H, CH2N), 7.25 Ϫ7.28 (m, 2 H, CHar), 8.06Ϫ8.13 (m, 1 H, CHar),
Methyl (2S)-2-[Bis(2-bromo-4,5-dimethoxybenzyl)amino]propanoate
(5d): Colorless oil, 73% yield. Rf (hexane/ethyl acetate, 7:3) ϭ 0.25.
8.17Ϫ8.21 (m, 1 H, CHar) ppm. 13C NMR (CDCl3): δ ϭ 18.5
(CH3), 20.3 (CH3), 27.1 (CH), 28.6 (CH3), 44.2 (CH2), 67.6 (CH),
86.1 (C), 115.6 (CH), 116.1 (C), 121.9 (CH), 124.9 (CH), 125.5
(CH), 126.1 (C), 136.0 (C), 149.9 (CO), 151.3 (C), 196.2 (CO) ppm.
C19H24N2O3 (328.406): calcd. C 69.49, H 7.37, N 8.53; found C
69.27, H 7.07, N 8.55.
[α]2D0 ϭ Ϫ49.9 (c ϭ 2.5, CH2Cl2). H NMR (CDCl3): δ ϭ 1.51 (d,
1
J ϭ 7.1 Hz, 3 H), 3.72 (q, J ϭ 7.1 Hz, 1 H), 3.89 (s, 3 H,) 3.92 (s,
12 H), 3.94 (s, 4 H, 2 CH2), 7.02 (s, 2 H, CH), 7.17 (s, 2 H, CH)
ppm. 13C NMR (CDCl3): δ ϭ 14.4 (CH3), 51.5 (CH3), 54.6 (2
CH2), 55.9 (2 CH3), 56.1 (2 CH3), 58.6 (CH), 113.2 (2 CH), 113.8
(2 C), 115.2 (2 CH), 130.6 (2 C), 148.2 (2 C), 174.1 (C) ppm. MS:
m/z ϭ 502 (11), 231 (89), 230 (11), 229 (100), 151 (17), 107 (34),
105 (11), 92 (10), 91 (11), 89 (15), 79 (15), 77 (26), 63 (11), 56 (11).
C22H27Br2NO6 (561.26): calcd. C 47.08, H 4.85, Br 28.47, N 2.50;
found C 47.15, H 4.29, Br 27.43, N 2.38.
General Procedure for the Synthesis of Symmetric Dialkylation
Products 5: The amino ester 2 (6.43 mmol) and K2CO3 (4.15 g,
30 mmol) were added to a solution of the arylmethyl bromide or
hetarylmethyl bromide 1 (13 mmol) in MeCN (250 mL). The mix-
ture was refluxed for 2Ϫ5 h. After complete reaction, the suspen-
sion was allowed to cool down, and the solid was filtered off. The
filtrate was concentrated under vacuum and the remainder purified
by column chromatography.
Methyl (2S)-2-{Bis[(1-Boc-3-bromo-1H-indol-2-yl)methyl]amino}-
propanoate (5e): Colorless solid, 74% yield. Rf (hexane/ethyl acet-
ate, 9:1) ϭ 0.25. [α]2D0 ϭ Ϫ47.4 (c ϭ 1, CH2Cl2). 1H NMR (CDCl3):
δ ϭ 1.32 (d, J ϭ 7.3 Hz, 3 H, CH3CH), 1.52 [s, 18 H, 2 (CH3)3C],
3.61 (q, J ϭ 7.3 Hz, 1 H, CH), 3.63 (s, 3 H, CH3), 4.38 (s, 4 H, 2
CH2), 7.09Ϫ7.25 (m, 6 H, CH), 7.72 (d, J ϭ 7.6 Hz, 2 H, CH)
ppm. 13C NMR (CDCl3): δ ϭ 16.3 (C), 28.6 (2 (CH3)3], 47.2 (2
CH2), 51.7 (CH3), 59.5 (CH), 84.3 (2 C), 103.5 (2 C), 115.6 (2 CH),
119.5 (2 CH), 123.1 (2 CH), 125.2 (2 CH), 128.6 (2 C), 135.9 (4C),
149.7 (2 C), 174.9 (C) ppm. MS: m/z ϭ 355 (13), 353 (15), 254 (10),
252 (11), 210 (78), 209 (12), 208 (79), 130 (43), 129 (41), 128 (38),
102 (22), 101 (16), 77 (10), 57 (89), 56 (34), 55 (16), 50 (11).
C32H37Br2N3O6 (719.46): calcd. C 53.42, H 5.18, N 5.84; found C
53.05, H 5.24, N 6.00.
General Procedure for the Synthesis of Asymmetric Dialkylation
Products 5kϪ5m: The arylmethyl bromide or hetarylmethyl bro-
mide 1 (5.5 mmol) and K2CO3 (0.69 g, 5 mmol) were added to a
solution of the [(o-bromoindolyl)methyl]amino ester 3 (Ar1 ϭ in-
dole)[15] (5 mmol) in MeCN (150 mL). After 6 h of reflux, the cold
reaction mixture was filtered. The filtrate was concentrated under
vacuum and the remainder was purified by column chromatogra-
phy.
Methyl (2S)-2-[Bis(2-bromobenzyl)amino]propanoate (5a): Colorless
oil, 77% yield. Rf (hexane/ethyl acetate, 9:1) ϭ 0.48. [α]2D0 ϭ Ϫ48.35
(c ϭ 1.15, CH2Cl2). 1H NMR (CDCl3): δ ϭ 1.28 (d, J ϭ 7.2 Hz, 3
H), 3.47 (q, J ϭ 7.2 Hz, 1 H), 3.63 (s, 3 H,) 3.78 (d, J ϭ 15.1 Hz,
2 H), 3.85 (d, J ϭ 15.1 Hz, 2 H), 6.89Ϫ6.95 (m, 2 H, CH),
7.08Ϫ7.11 (m, 2 H, CH), 7.35 (dd, J1 ϭ 7.9, J2 ϭ 1.2 Hz, 2 H),
7.44 (dd, J1 ϭ 7.7, J2 ϭ 1.5 Hz, 2 H) ppm.13C NMR (CDCl3): δ ϭ
15.3 (CH3), 51.9 (CH3), 55.1 (2 CH2), 58.3 (CH), 124.6 (2 C), 127.6
(2 CH), 128.7 (2 CH), 130.8 (2 CH), 132.9 (2 CH), 138.9 (2 C),
174.5 C ppm. MS: m/z ϭ 441 (1) [Mϩ], 384 (12), 382 (23), 380 (12),
212 (16), 210 (13), 185 (19), 183 (17), 171 (100), 170 (10), 169 (95),
104 (14), 102 (11), 91 (27), 90 (54), 89 (46), 82 (12), 80 (11), 77 (15),
63 (17), 59 (10), 56 (15), 55 (12). C18H19Br2NO2 (441.16): calcd. C
49.01, H 4.34, Br 36.22, N 3.18; found C 48.72, H 4.29, Br 36.53,
N 3.47.
Ethyl (2S)-2-{Bis[(1-Boc-3-bromo-1H-indol-2-yl)methyl]amino}-3-
methylbutanoate (5f): Colorless solid, 64% yield. Rf (hexane/ethyl
acetate, 9:1) ϭ 0.2. [α]2D0 ϭ Ϫ110.5 (c ϭ 1, CH2Cl2). 1H NMR
(CDCl3): δ ϭ 0.59 [d, J ϭ 6.4 Hz, 3 H, (CH3)2], 0.67 [d, J ϭ 6.5 Hz,
3 H, (CH3)2], 1.34 (t, J ϭ 7.1 Hz, 3 H, CH3), 1.46 [s, 18 H, (2
CH3)3], 2.18Ϫ2.23 (m, 1 H, CH), 2.63 (d, J ϭ 10.8 Hz, 1 H, CH),
4.06 (d, J ϭ 13.6 Hz, 2 H, 2 CH2), 4.20Ϫ4.29 (m, 2 H, CH2), 4.58
(d, J ϭ 13.6 Hz, 2 H, 2 CH2), 7.15Ϫ7.19 (m, 4 H, CH), 7.38Ϫ7.40
(m, 2 H, CH), 7.81 (d, J ϭ 7.3 Hz, 2 H, CH) ppm. 13C NMR
(CDCl3): δ ϭ 15.1 (C), 20.2 (C), 20.9 (C), 27.5 (C), 28.6 (2 C), 47.2
(2 CH2), 60.2 (CH2), 69.9 (CH), 84.3 (2 C), 104.5 (2 C), 115.7 (2
CH), 119.7 (2 CH), 123.1 (2 CH), 125.3 (2 CH), 128.7 (2 C), 135.7
(2 C), 136.2 (2 C), 149.5 (2 C), 172.4 (C) ppm. C35H43Br2N3O6
(761.54): calcd. C 55.20, H 5.69, N 5.52; found C 54.84, H 5.68, N
5.23. rac-5f was obtained by starting from racemic valine ester.
Ethyl (2S)-2-[Bis(2-bromobenzyl)amino]-3-methylbutanoate (5b):
1
Colorless oil, 62% yield. Rf (hexane/ethyl acetate, 9:1) ϭ 0.44. H
NMR (CDCl3): δ ϭ 0.88 (d, J ϭ 6.5 Hz, 3 H, CH3), 1.11 (d, J ϭ
6.6 Hz, 3 H), 1.38 (t, J ϭ 7.1 Hz, 3 H,), 2.19Ϫ2.27 (m, 1 H), 2.99
(d, J ϭ 10.6 Hz, 1 H), 3.93 (s, 4 H), 4.30 (q, J ϭ 7.1 Hz, 2 H,),
7.07Ϫ7.12 (m, 2 H), 7.25Ϫ7.32 (m, 2 H, CH), 7.52 (d, J ϭ 7.9 Hz,
2 H, 2 H), 7.64 (d, J ϭ 7.7 Hz, 2 H) ppm. 13C NMR (CDCl3): δ ϭ
15.0 (CH3ϪCH2), 20.4 (CH3), 20.5 (CH3), 28.3 (CH), 55.2 (2 CH2),
60.5 (CH2), 69.8 (CH), 124.7 (2 C), 127.6 (2 CH), 128.6 (2 CH),
130.4 (2 CH), 133.1 (2 CH), 138.6 (2 C), 172.5 (C) ppm.
C21H25Br2NO2 (483.24): calcd. C 52.19, H 5.21, Br 33.07, N 2.90;
found C 51.93, H 5.27, Br 33.20, N 2.85.
X-ray Crystal Analysis of 5f:[22] Empirical formula:
C35H43Br2N3O6, formula mass: 761.54, temperature: 295 (2) K,
˚
wavelength: 0.71073 A, crystal system: orthorhombic, space group:
P212121, unit cell dimensions: a ϭ 14.501(18), b ϭ 15.941(3), c ϭ
3
˚
˚
16.072(3) A, volume: 3715.4(10) A , Z ϭ 4, density (calcd.): 1.361
Mg/m3, absorption coefficient: 2.227 mmϪ1, F (000) ϭ 1568, crystal
size: 0.98 ϫ 0.96 ϫ 0.80 mm, θ range for data collection:
1.80Ϫ25.05°, limiting indices: Ϫ4 Յ h Յ 17, 0 Յ k Յ 18, 0 Յ l
Յ 19; reflections collected: 5485, unique: 4544 [R (int) ϭ 0.0446],
completeness to θ ϭ 25.05°, absorption correction: empirical
(ψ-scan), max. and min. transmission: 0.9994 and 0.8232, refine-
Ethyl (2S)-2-[Bis(2-iodobenzyl)amino]-3-methylbutanoate (5c): Col-
orless solid, 77% yield. Rf (hexane/ethyl acetate, 7:3) ϭ 0.37. [α]2D0
ϭ
Eur. J. Org. Chem. 2004, 3484Ϫ3496
www.eurjoc.org
 2004 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
3491

J. Liebscher et al.
FULL PAPER
ment method: full-matrix least squares on F2, data/restraints/ CH3), 2.02 [s, 9 H, (CH3)3], 4.01 (q, J ϭ 7.3 Hz, 1 H, CH), 4.04 (s,
parameters: 3351/1/376, goodness-of-fit on F2: 1.156, final Rint
3 H, CH3), 4.17 (d, 1 H, CH2), 4.26 (d, 1 H, CH2), 4.71 (d, J ϭ
[I Ͼ 2σ(I)]: R1 ϭ 0.0536, wR2 ϭ 0.1039; Rint (all data): R1 ϭ 13.5 Hz, 1 H, CH2), 4.86 (d, J ϭ 13.5 Hz, 1 H, CH2), 7.03Ϫ7.27
0.1175, wR2 ϭ 0.1400, absolute structure parameter: Ϫ0.030(18),
(m, 2 H, CH), 7.45Ϫ7.69 (m, 5 H, CH), 8.13 (d, J ϭ 8.1 Hz, 1 H,
CH) ppm. 13C NMR (CDCl3): δ ϭ 16.6 (CH3), 28.3 (C), 48.6
(CH2), 51.4 (CH3), 54.1 (CH2), 59.9 (CH), 84.2 (C), 103.1 (C),
115.0 (CH), 119.4 (CH), 122.8 (CH), 123.3 (C), 125.1 (CH), 126.4
(CH), 127.5 (CH), 127.8 (C), 129.8 (CH), 132.1 (CH), 134.7 (C),
135.4 (C), 139.1 (C), 149.4 (C), 174.2 (C) ppm. C25H28Br2N2O4
(580.31): calcd. C 51.74, H 4.86, Br 27.54, N 4.83; found C 51.54,
H 4.41, Br 27.24, N 4.80.
extinction coefficient: 0.0017(4), largest diff. peak and hole: 0.417
and Ϫ0.485 e AϪ3
.
Methyl
(2S,3S)-2-{Bis[(1-Boc-3-bromo-1H-indol-2-yl)methyl]-
amino}-3-methylpentanoate (5g): Colorless solid, 76% yield. Rf
(hexane/ethyl acetate, 9:1) ϭ 0.28. [α]2D0 ϭ Ϫ55.8 (c ϭ 1, CH2Cl2).
1H NMR (CDCl3): δ ϭ 0.46 (t, J ϭ 7.3 Hz, 3 H, CH3), 0.63 (d,
J ϭ 6.6 Hz, 3 H, CH3), 1.48 (s, 18 H, 2 (CH3)3], 1.49Ϫ1.74 (m, 2
H, CH2), 1.91Ϫ2.12 (m, 1 H, CH3), 2.87 (d, J ϭ 10.6 Hz, 1 H,
CH), 3.71 (s, 3 H, CH3), 4.13 (d, J ϭ 13.7 Hz, 2 H, CH2), 4.51 (d,
J ϭ 13.7 Hz, 2 H, CH2), 7.14 Ϫ7.19 (m, 4 H, CH), 7.36Ϫ7.39 (m,
2 H, CH), 7.81 (d, J ϭ 7.5 Hz, 2 H, CH) ppm. 13C NMR (CDCl3):
δ ϭ 10.6 (C), 16.0 (C), 25.8 (C), 28.6 (2 C), 33.2 (C), 47.3 (2 CH2),
51.0 (CH3), 68.4 (CH), 84.3 (2 C), 104.3 (2 C), 115.8 (2 CH), 119.7
(2 CH), 123.2 (2 CH), 125.4 (2 CH), 128.7 (2 C), 135.7 (2 C), 136.2
(2 C), 149.6 (2 C), 172.8 (C) ppm. C35H43Br2N3O6 (761.54): calcd.
C 55.20, H 5.69, N 5.52; found C 54.96, H 5.51, N 5.43.
tert-Butyl
3-Bromo-2-({(2-bromo-4,5-dimethoxybenzyl)[(1S)-2-
methoxy-1-methyl-2-oxo-ethyl]amino}methyl)-1H-indole-1-carb-
oxylate (5l): Colorless solid, 79% yield. Rf (hexane/ethyl acetate,
7:3) ϭ 0.32. 1H NMR (CDCl3): δ ϭ 1.62 (d, J ϭ 7.2 Hz, 3 H,
CH3), 1.98 [s, 9 H, (CH3)3], 3.89 (s, 3 H, CH3), 3.99 (s, 3 H, CH3),
4.03 (s, 3 H, CH3), 4.08 (d, 1 H, CH2), 4.16 (d, 1 H, CH2), 4.43 (q,
J ϭ 7.2 Hz, 1 H, CH), 4.73 (d, 1 H,CH2), 4.80 (d, 1 H, CH2), 7.02
(s, 1 H, CH), 7.05 (s, 1 H, CH), 7.48Ϫ7.63 (m, 2 H, CH), 7.69Ϫ7.78
(m, 1 H, CH), 8.18 (d, J ϭ 7.7 Hz, 1 H, CH) ppm. 13C NMR
(CDCl3): δ ϭ 14.2 (CH3), 28.3 (C), 49.1 (CH2), 51.4 (CH3), 54.0
(CH2), 55.7 (CH3), 56.0 (CH3), 60.2 (CH), 84.5 (C), 102.9 (C),
112.7 (CH), 112.9 (C), 114.9 (CH), 115.09 (CH), 119.4 (CH), 123.1
(CH), 125.5 (CH), 128.0 (C), 131.4 (C), 135.4 (C), 135.5 (C), 147.9
(C), 148.0 (C), 149.5 (C), 174.2 (C) ppm. C27H32Br2N2O6 (640.36):
calcd. C 50.64, H 5.04, N 4.37; found C 50.54, H 4.92, N 4.56.
Methyl (2S)-2-{Bis[(1-Boc-3-bromo-1H-indol-2-yl)methyl]amino}-4-
methylpentanoate (5h): Colorless solid, 61% yield. Rf (hexane/ethyl
acetate, 9:1) ϭ 0.26. [α]2D0 ϭ Ϫ81.5 (c ϭ 1, CH2Cl2). 1H NMR
(CDCl3): δ ϭ 0.32 (d, J ϭ 6.4 Hz, 3 H, CH), 0.70 (d, J ϭ 6.5 Hz,
3 H, CH), 1.38Ϫ1.46 (m, 1 H, CH), 1.51 (s, 18 H, 2 CH), 1.72Ϫ1.84
(m, 2 H, CH2), 3.31Ϫ3.40 (m, 1 H, CH), 3.64 (s, 3 H, CH3), 4.38
(d, J ϭ 13.8 Hz, 2 H, CH2), 4.44 (d, J ϭ 13.8 Hz, 2 H, CH2),
7.09Ϫ7.19 (m, 4 H, CH), 7.32Ϫ7.35 (m, 2 H, CH), 7.77Ϫ7.80 (m,
2 H, CH) ppm. MS: m/z ϭ 397 (15), 395 (15), 254 (11), 252 (12),
210 (30), 208 (31), 130 (11), 129 (12), 128 (13), 57 (100), 44 (12)
ppm. 13C NMR (CDCl3): δ ϭ 21.7 (C) 23.6 (C), 24.9 (C), 28.7
2(C), 38.5 (C), 47.1 (2 CH2), 51.5 (CH3), 61.1 (CH), 84.4 (2 C),
103.9 (2 C), 115.8 (2 CH), 119.6 (2 CH), 123.2 (2 CH), 125.4 (2
CH), 128.6 (2 C), 135.8 (2 C), 136.0 (2 C), 149.7 (2 C), 174.5 (C)
ppm. C35H43Br2N3O6 (761.54): calcd. C 55.20, H 5.69, Br 20.98, N
5.52; found C 55.14, H 5.72, Br 21.08, N 5.73.
tert-Butyl 3-Bromo-2-({[(3-bromo-2-thienyl)methyl][(1S)-1-(ethoxy-
carbonyl)-2-methylpropyl]amino}methyl)-1H-indole-1-carboxylate
(5m): Yellowish oil, 84% yield. Rf (hexane/ethyl acetate, 9:1) ϭ 0.43.
1H NMR (CDCl3): δ ϭ 0.90 (d, J ϭ 6.6 Hz, 3 H, CH), 1.03 (d,
J ϭ 6.5 Hz, 3 H, CH), 1.39 (t, J ϭ 7.1 Hz, 3 H, CH), 1.73 (s, 9 H,
C), 2.16Ϫ2.21 (m, 1 H, CH), 3.13 (d, J ϭ 10.5 Hz, 1 H, CH), 3.96
(d, J ϭ 15.9 Hz, 1 H, CH2), 4.12 (d, J ϭ 15.9 Hz, 1 H, CH2), 4.29
(q, J ϭ 7.1 Hz, 2 H, CH), 4.42 (d, J ϭ 13.5 Hz, 1 H, CH2), 4.49
(d, J ϭ 13.5 Hz, 1 H, CH2), 6.66 (d, J ϭ 5.3 Hz, 1 H, CH), 6.93
(d, J ϭ 5.3 Hz, 1 H, CH), 7.23Ϫ7.34 (m, 2 H, CH), 7.46Ϫ7.48 (m,
1 H, CH), 7.93Ϫ7.96 (m, 1 H, CH) ppm. 13C NMR (CDCl3): δ ϭ
15.0 (C), 20.4 (C), 21.0 (C), 28.4 (C), 28.8 (C), 49.3 (CH2), 49.8
(CH2), 60.4 (CH2), 72.4 (CH), 84.7 (C), 104.3 (C), 108.1 (C), 115.8
(CH), 119.9 (CH), 123.3 (CH), 124.5 (CH), 125.7 (CH), 128.4 (C),
129.5 (CH), 134.9 (C), 135.9 (C), 140.0 (C), 149.8 (C), 172.5 (C)
ppm. C26H32Br2N2O4S (628.42): calcd. C 49.69, H 5.13, N 4.46, S
5.10; found C 49.75, H 5.26, N 4.64, S 5.01.
Methyl (2S)-2-{Bis[(1-Boc-3-bromo-1H-indol-2-yl)methyl]amino}-3-
hydroxypropanoate (5i): Colorless solid, 75% yield. Rf (hexane/ethyl
acetate, 9:1) ϭ 0.16. 1H NMR (CDCl3): δ ϭ 1.59 [s, 18 H, 2
(CH3)3], 3.30Ϫ3.33 (m, 1 H, CH), 3.72Ϫ3.81 (m, 2 H, CH2), 3.85
(s, 3 H, CH3), 4.53 (d, J ϭ 14.7 Hz, 1 H, CH2), 4.55 (d, J ϭ
14.7 Hz, 1 H, CH), 7.19Ϫ7.30 (m, 4 H, CH), 7.39Ϫ7.46 (m, 2 H,
CH), 7.81 (d, J ϭ 8.0 Hz, 2 H, CH) ppm. 13C NMR (CDCl3): δ ϭ
28.6 (2 C), 46.8 (2 CH2), 51.7 (CH3), 59.4 (CH2), 64.9 (CH), 84.9
(2 C), 105.0 (2 C), 116.1 (2 CH), 119.8 (2 CH), 123.4 (2 CH), 125.6
(2 CH), 128.6 (2), 134.9 (2 C), 135.9 (2 C), 150.1 (2 ϫ C), 172.1
(C) ppm. C32H37Br2N3O7 (735.46): calcd. C 52.26, H 5.07, N 5.71;
found C 52.04, H 5.22, N 5.83.
Methyl
(2S)-2-{Bis[(3-bromo-2-thienyl)methyl]amino}propanoate
(5n): Yellowish oil, 44% yield. Rf (hexane/ethyl acetate, 9:1) ϭ 0.35.
1H NMR (CDCl3): δ ϭ 1.31 (d, J ϭ 7.2 Hz, 3 H, CH), 3.53 (q,
J ϭ 7.2 Hz, 1 H, CH), 3.68 (s, 3 H, CH3), 3.83 (d, J ϭ 15.2 Hz, 2
H, CH2), 4.03 (d, J ϭ 15.2 Hz, 2 H, CH2), 6.8 (d, J ϭ 5.3 Hz, 2
H, CH), 7.15 (d, J ϭ 5.3 Hz, 2 H, CH) ppm. 13C NMR (CDCl3):
δ ϭ 15.8 (C), 49.5 (2 CH2), 51.9 (CH3), 57.0 (CH), 109.3 (2 C),
125.6 (2 CH), 130.1 (2 CH), 139.1 (2 C) 174.1 (C) ppm.
C14H15Br2NO2S2 (453.21): calcd. C 37.10, H 3.34, Br 35.26, N 3.09,
S 14.15; found C 37.13, H 3.44, Br 35.55, N 3.28, S 14.17.
Methyl (2S)-2-{Bis[(1-Boc-3-bromo-1H-indol-2-yl)methyl]amino}-3-
(tert-butyldimethylsilyloxy)propanoate (5j): Colorless solid, 91%
yield. Rf (hexane/ethyl acetate, 9:1) ϭ 0.69 ppm. 13C NMR
(CDCl3): δ ϭ Ϫ5.4 (CH3), Ϫ5.1 (CH3), 18.6 (C), 26.2 (C), 28.6 (2
C), 48.2 (2 CH2), 51.4 (CH3), 64.0 (CH2), 66.2 (CH), 84.3 (2 C),
103.6 (2 C), 115.7 (2 CH), 119.5 (2 CH), 123.1 (2 CH), 125.3 (2
CH), 128.6 (2 C), 135.8 (2 C), 135.9 (2 C), 149.6 (2 C), 172.5 (C)
ppm. C38H51Br2N3O7Si (849.72): calcd. C 53.71, H 6.05, Br 18.81,
N 4.95; found C 54.04, H 5.87, Br 19.22, N 4.79.
Ethyl
(2S)-2-{Bis[(3-bromo-2-thienyl)methyl]amino}-3-methylbut-
anoate (5o): Light yellow oil, 19% yield. Rf (hexane/ether, 9:1) ϭ
1
0.43. H NMR (CDCl3): δ ϭ 0.80 (d, J ϭ 6.4 Hz, 3 H, CH), 1.05
(d, J ϭ 6.6 Hz, 3 H, CH), 1.28 (t, J ϭ 7.1 Hz, 3 H, CH), 2.06Ϫ2.24
(m, 1 H, CH), 2.93 (d, J ϭ 10.6 Hz, 1 H, CH), 3.87 (s, 4 H, 2 CH2),
tert-Butyl 3-Bromo-2-({(2-bromobenzyl)[(1S)-2-methoxy-1-methyl-
2-oxoethyl]amino}methyl)-1H-indole-1-carboxylate (5k): Colorless 4.19 (q, J ϭ 7.1 Hz, 2 H, CH), 6.82 (d, J ϭ 5.3 Hz, 2 H, CH), 7.16
oil, 74% yield. Rf (hexane/ethyl acetate, 9:1) ϭ 0.29. [α]2D0 ϭ Ϫ3.0 (d, J ϭ 5.3 Hz, 2 H, CH) ppm. 13C NMR (CDCl3): δ ϭ 15.0 (C),
(c ϭ 1, CH2Cl2).1H NMR (CDCl3): δ ϭ 1.66 (d, J ϭ 7.3 Hz, 3 H, 20.2 (CH3), 20.4 (CH3), 28.3 (C), 49.7 (2 CH2), 60.7 (CH2), 68.8
3492
 2004 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.eurjoc.org
Eur. J. Org. Chem. 2004, 3484Ϫ3496

Double Cyclization of Bis(α-hetarylmethyl)amino Esters
(CH), 109.6 (2 C), 125.5 (2 CH), 130.1 (2 CH), 138.6 (2 C), 172.4 H, CH2), 4.17 (d, J ϭ 18.7 Hz, 1 H, CH2), 4.50 (d, J ϭ 19.8 Hz, 1
FULL PAPER
(C) ppm. C17H21Br2NO2S2 (495.29): calcd. C 41.22, H 4.27, N 2.83;
found 41.45, H 4.40, N 3.11.
H, CH2), 4.61 (d, J ϭ 18.7 Hz, 1 H, CH2), 7.07Ϫ7.21 (m, 4 H,
CH), 7.92Ϫ8.25 (m, 4 H, CH) ppm. 13C NMR (CDCl3): δ ϭ 22.4
(C), 22.5 (C), 28.2 (C), 28.6 (2 C), 28.7 (C), 51.8 (CH2), 58.6 (CH2),
70.4 (CH), 73.8 (C), 84.3 (2 C), 115.7 (CH), 115.8 (CH), 121.0
(CH), 121.3 (CH), 122.0 (C), 123.2 (CH), 123.3 (CH), 123.6 (CH),
123.9 (CH), 127.0 (C), 127.4 (C), 127.9 (C), 133.9 (C), 134.3 (C),
136.0 (C), 136.3 (C), 150.7 (C), 150.8 (C) ppm. C33H39N3O5
(557.68): calcd. C 71.07, H 7.05, N 7.53; found C 70.84, H 6.84,
N 7.32. HPLC determination of the enantiomeric excess: Column:
CHIRALCEL OD, eluent: hexane/iPrOH (98:2), flow rate: 0.5 mL/
min, detection: UV 254 nm, temperature 20 °C. Racemic mixture
rac-6c, obtained starting from rac-5f, revealed for the (Ϫ) enanti-
omer Rt ϭ 13 min and for the (ϩ) enantiomer Rt ϭ 14.5 min. Com-
pound 6c showed just one peak at 14.5 min, i.e. ee Ͼ 99%.
General Procedure for the Synthesis [c,f]-Difused 1-Azabicyclo[3-3-
1]nonanes 6 and Monocyclization Products 8
Route A/B: A solution of the dialkylamino ester 5 (2 mmol) in dry
THF (130 mL) was cooled to Ϫ100 °C under argon. 1.6  nBuLi
in hexane or 1.7  tBuLi in pentane (4.2 mmol) was added drop-
wise while the temperature was kept below Ϫ98 °C. After complete
addition, the solution was stirred at Ϫ100 °C for 6 h and was
quenched with saturated aqueous NH4Cl. The mixture was allowed
to warm up to room temperature whilst stirring. After all precipi-
tate had dissolved, the mixture was extracted with CH2Cl2 (4 ϫ
50 mL). The combined organic layers were dried with Na2SO4 and
concentrated under vacuum. The remainder was purified by col-
umn chromatography.
Di-tert-butyl (23S)-1-Hydroxy-23-[(1R)-1-methylpropyl]-9,12,15-
triazahexacyclo[10.10.1.02,10.03,8.014,22.016,21]tricosa-2(10),3,5,7,
14(22),16,18,20-octaene-9,15-dicarboxylate (6d): Light yellow solid,
73% yield. M.p. 134 °C, Rf (hexane/ethyl acetate, 9:1) ϭ 0.09.
Route
D/C:
3-Bromo-2-(bromomethyl)thiophene
(0.304 g,
1.18 mmol) and K2CO3 (0.163 g, 1.18 mmol) were added to a solu-
tion of the corresponding monocyclized β-carbolinone 7a (Ar1 ϭ
indole) in MeCN (30 mL). The mixture was refluxed for 4 h. The
cold suspension was filtered, and the filtrate was concentrated un-
der vacuum. The remaining material was purified by column chro-
matography (hexane/EtOAc, 9:1) providing pure N-alkyl-β-carboli-
none 8e (0.435 g, 95% yield). This product was submitted to Route
A with only 1.1 equiv. of nBuLi to afford 56% of the final product
6f after column chromatography (hexane/ethyl acetate, 9:1).
1
[α]2D0 ϭ ϩ128.2 (c ϭ 1, CH2Cl2). H NMR (CDCl3): δ ϭ 0.85 (t,
J ϭ 7.4 Hz, 3 H, CH), 1.05 (d, J ϭ 6.6 Hz, 3 H, CH), 1.28Ϫ1.49
(m, 2 H, CH), 1.56 [s, 9 H, (CH3)3], 1.57 [s, 9 H, (CH3)3], 1.62Ϫ1.80
(m, 1 H, CH), 2.24 (s, 1 H, OH), 2.90 (d, J ϭ 9.8 Hz, 1 H, CH),
3.95 (d, J ϭ 19.9 Hz, 1 H, CH2), 4.17 (d, J ϭ 18.9 Hz, 1 H, CH2),
4.49 (d, J ϭ 19.9 Hz, 1 H, CH2), 4.59 (d, J ϭ 18.9 Hz, 1 H, CH2),
7.05 Ϫ7.25 (m, 4 H, CH), 7.92Ϫ8.26 (m, 4 H, CH) ppm. 13C NMR
(CDCl3): δ ϭ 11.0 (C), 18.0 (C), 27.8 (C), 28.7 (2 C), 33.8 (C), 51.9
(CH2), 58.4 (CH2), 68.0 (CH), 73.7 (C), 84.3 (2 C), 115.7 (CH),
115.8 (CH), 121.1 (CH), 121.3 (CH), 121.9 (C), 123.2 (CH), 123.3
(CH), 123.6 (CH), 123.9 (CH), 127.0 (C), 127.6 (C), 127.9 (C),
133.9 (C), 134.3 (C), 136.0 (C), 136.3 (C), 150.7 (C), 150.8 (C) ppm.
C34H41N3O5 (571.71): calcd. C 71.43, H 7.23, N 7.35; found C
71.28, H 7.46, N 7.20.
(17S)-17-Isopropyl-9-azatetracyclo[7.7.1.02,7.011,16]heptadeca-
2,4,6,11,13,15-hexaen-1-ol (6a): Yellow-brownish oil, 10% yield. Rf
(hexane/ethyl acetate, 7:3) ϭ 0.31. [α]2D0 ϭ Ϫ37.75. (c ϭ 1, CHCl3).
1H NMR (CDCl3): δ ϭ 0.98 (d, J ϭ 6.4 Hz, 3 H, CH3), 1.00 (d,
J ϭ 6.4 Hz, 3 H, CH3), 2.04 (m, 1 H, CH), 2.51 (s, 1 H, OH), 3.03
(d, J ϭ 7.5 Hz, 1 H, CH), 4.17 (m, 4 H, 2 CH2), 6.93 (m, 4 H,
CH), 7.04 (m, 2 H, CH), 7.25 (m, 2 H, CH) ppm. 13C NMR
(CDCl3): δ ϭ 19.9 (CH3), 20.3 (CH3), 27.1 (CH), 59.7 (2 CH2),
69.9 (C), 76.7 (CH), 126.9 (2 CH), 128.1 (2 CH), 128.5 (4CH),
139.5 (2 C), 141.9 (2 C).) ppm. C31H35N3O5 (529.63): calcd. C
70.30, H 6.66, N 7.93; found C 69.98, H 6.41, N 7.62.
Di-tert-butyl
(23S)-1-Hydroxy-23-isobutyl-9,12,15-triazahexacy-
clo[10.10.1.02,10.03,8. 014,22.016,21]tricosa-2(10),3,5,7,14(22),16,18,20-
octaene-9,15-dicarboxylate (6e): Light yellow solid, 72% yield. Rf
(hexane/ethyl acetate, 7:3) ϭ 0.43. [α]2D0 ϭ ϩ41.6 (c ϭ 1, CH2Cl2).
1H NMR (CDCl3): δ ϭ 1.05 (d, J ϭ 6.6 Hz, 6 H, 2 CH3), 1.49 (m,
1 H, CH), 1.67 (s, 18 H, 2(CH3)3], 2.05 (m, 2 H, CH2), 2.21 (s, 1
H, OH), 3.42 (m, 1 H, CH), 4.15 (d, J ϭ 19.6 Hz, 1 H, CH2), 4.32
(d, J ϭ 18.9 Hz, 1 H, CH2), 4.62 (d, J ϭ 19.6 Hz, 1 H, CH2), 4.77
(d, J ϭ 18.9 Hz, 1 H, CH2), 7.24 (m, 4 H, CH), 8.11 (m, 2 H, CH),
8.26 (m, 2 H, CH) ppm. 13C NMR (CDCl3): δ ϭ 22.4 (CH3), 24.4
(CH3), 25.8 (C), 28.7 (C), 34.7 (CH2), 51.4 (CH2), 58.1 (CH2), 62.8
(CH), 71.4 (C), 84.5 (C), 115.8 (2 CH), 120.9 (CH), 121.0 (CH),
122.1 (C), 123.3 (C), 128.8 (CH), 123.9 (CH), 126.6 (CH), 126.9
(CH), 127.0 (C), 127.6 (C), 127.8 (C), 133. (C), 134.3 (C), 135.9
(C), 136.1 (C), 150.7 (C), 150.8 (C) ppm. C34H41N3O5 (571.71):
calcd. C 71.43, H 7.23, N 7.35; found C 71.14, H 7.13, N 6.96.
Di-tert-butyl
(23S)-1-Hydroxy-23-methyl-9,12,15-triazahexacy-
clo[10.10.1.02,10.03,8.014,22. 016,21]tricosa-2(10),3,5,7,14(22),16,18,20-
octaene-9,15-dicarboxylate (6b): Colorless solid, 59% yield.
M.p.161Ϫ163 °C, Rf (CH2Cl2/acetone, 95:5) ϭ 0.14. [α]2D0 ϭ ϩ55.2
(c ϭ 1, CH2Cl2). 1H NMR (CDCl3): δ ϭ 1.21 (d, J ϭ 6.8 Hz, 3 H,
CH), 1.56 [s, 9 H, (CH3)3], 1.57 [s, 9 H, (CH3)3], 2.39 (s, 1 H, OH),
3.38 (q, J ϭ 6.8 Hz, 1 H, CH), 4.06 (d, J ϭ 19.6 Hz, 1 H, CH2),
4.18 (d, J ϭ 18.8 Hz, 1 H, CH2), 4.63 (d, J ϭ 19.6 Hz, 1 H, CH2),
4.71 (d, J ϭ 18.6 Hz, 1 H, CH2), 7.06Ϫ7.20 (m, 4 H, CH),
7.92Ϫ7.99 (m, 2 H, CH), 8.09Ϫ8.21 (m, 2 H, CH) ppm. 13C NMR
(CDCl3): δ ϭ 12.7 (C), 28.7 [2(CH3)3], 51.5 (CH2), 57.8 (CH2), 60.0
(CH), 71.5 (C), 84.4 (C), 84.5 (C), 115.9 (2 CH), 120.9 (CH), 121.0
(CH), 121.6 (C), 123.3 (2 CH), 123.8 (CH), 123.9 (CH), 126.3 (C),
126.9 (C), 127.8 (C), 132.9 (C), 134.0 (C), 136.1 (2 C), 150.7 (C),
150.8 (C) ppm. C31H35N3O5 (529.63): calcd. C 70.03, H 6.66, N
7.93; found C 69.84, H 6.38, N 7.72.
tert-Butyl (19S)-1-Hydroxy-19-isopropyl-15-thia-9,12-diazapentacy-
clo[10.6.1.02,10.03,8. 014,18]nonadeca-2(10),3,5,7,14(18),16-hexaene-9-
carboxylate (6f): Yellow oil, 48% yield (Route A), 56% yield (Route
1
C). Rf (hexane/ethyl acetate, 9:1) ϭ 0.23. H NMR (CDCl3): δ ϭ
1.05 (d, J ϭ 6.7 Hz, 3 H, CH3), 1.09 (d, J ϭ 6.5 Hz, 3 H, CH3),
1.57 (s, 9 H, C), 2.17 (s, 1 H, OH), 2.78 (d, J ϭ 9.5 Hz, 1 H, CH),
3.88Ϫ3.97 (m, 2 H, 2 CH2), 4.53 (d, J ϭ 19.1 Hz, 1 H, CH2), 6.92
(d, J ϭ 5.1 Hz, 1 H, CH), 7.12Ϫ7.18 (m, 3 H, CH), 6.94Ϫ8.03 (m,
2 H, CH) ppm. 13C NMR (CDCl3): δ ϭ 22.1 (CH3), 22.2 (CH3),
27.7 (C), 28.3 (C), 51.11 (CH2), 57.2 (CH2), 69.4 (CH), 73.5 (C),
Di-tert-butyl (23S)-1-Hydroxy-23-isopropyl-9,12,15-triazahexacy-
clo[10.10.1.02,10.03,8. 014,22.016,21]tricosa-2(10),3,5,7,14(22),16,18,20-
octaene-9,15-dicarboxylate (6c): Colorless solid, 75% yield. Rf (hex-
ane/ethyl acetate, 8:2) ϭ 0.34. [α]2D0 ϭ ϩ117.1 (c ϭ 1, CH2Cl2). H
1
NMR (CDCl3): δ ϭ 1.05Ϫ1.19 (m, 6 H, CH), 1.56 [s, 9 H,
(CH3)3C], 1.57 [s, 9 H, (CH3)3C], 1.68Ϫ1.81 (m, 1 H, CH), 2.21 (s, 83.9 (C), 115.4 (CH), 120.5 (CH), 121.4 (C), 122.8 (CH), 123.4
1 H, OH), 2.79 (d, J ϭ 9.5 Hz, 1 H, CH), 3.95 (d, J ϭ 19.8 Hz, 1 (CH), 123.5 (2 CH), 127.1 (C), 133.6 (C), 134.1 (C), 135.9 (C),
Eur. J. Org. Chem. 2004, 3484Ϫ3496
www.eurjoc.org
 2004 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
3493

J. Liebscher et al.
FULL PAPER
147.3 (C), 150.4 (C) ppm. C24H28N2O3S (424.56): calcd. C 67.90,
H 6.65, N 6.60, S 7.55; found C 67.52, H 6.45, N 6.49, S 7.78.
C31H34BrN3O6 (624.52): calcd. C 59.62, H 5.49, N 6.73; found C
59.34, H 5.38, N 6.64.
(15S)-15-Isopropyl-5,11-dithia-8-azatetracyclo[6.6.1.02,6.01°,14]-
pentadeca-2(6),3,10(14),12-tetraen-1-ol (6g): Yellow oil, 53% yield.
Rf (hexane/ethyl acetate, 9:1) ϭ 0.12. H NMR (CDCl3): δ ϭ 0.99
tert-Butyl (3S)-2-{[1-(tert-Butoxycarbonyl)-1H-indol-2-yl]methyl}-3-
(butoxymethyl)-4-oxo-1,2,3,4-tetrahydro-9H-β-carbolin-9-carb-
oxylate (8d): Colorless solid, 19% yield. Rf (hexane/ethyl acetate,
7:3) ϭ 0.12. 13C NMR (CDCl3): δ ϭ 14.6 (CH3), 24.3 (CH2), 28.4
(CH3), 28.6 (CH3), 29.5 (CH2), 46.0 (CH2), 53.2 (CH2), 59.9 (CH2),
68.1 (CH2), 70.7 (CH), 84.9 (C), 86.5 (C), 111.1 (CH), 115.7 (CH),
115.8 (CH), 116.1 (C), 120.8 (CH), 121.9 (CH), 123.3 (CH), 124.7
(CH), 125.2 (CH), 125.5 (C), 125.8 (CH), 128.9 (C), 136.4 (C),
137.2 (C), 138.0 (C), 148.0 (C), 149.6 (C), 150.8 (C), 193.8 (C) ppm.
1
(d, J ϭ 6.6 Hz, 3 H, CH3), 1.05 (d, J ϭ 6.6 Hz, 3 H, CH3),
1.62Ϫ1.69 (m, 1 H, CH), 2.11 (s, 1 H, OH), 2.72 (d, J ϭ 9.3 Hz, 1
H, CH), 3.69 (d, J ϭ 18.3 Hz, 1 H, CH2); 3.89 (d, J ϭ 17.4 Hz, 1
H, CH2), 4.41 (d, J ϭ 18.3 Hz, 1 H, CH2), 4.47 (d, J ϭ 17.4 Hz, 1
H, CH2), 6.94Ϫ7.18 (m, 4 H, CH) ppm. 13C NMR (CDCl3): δ ϭ
22.3 (CH3), 22.5 (CH3), 28.2 (CH), 50.8 (CH2), 57.8 (CH2), 69.7
(CH), 73.9 (C), 123.3 (CH), 123.5 (CH), 123.7 (CH), 124.2 (CH),
134.3 (C), 134.6 (C), 142.2 (C), 146.8 (C) ppm. C15H17NOS2
(291.43): calcd. C 61.82, H 5.88, N 4.81, S 22.01; found C 61.49,
H 5.73, N 4.85, S 21.91.
tert-Butyl
(3S)-2-[(3-Bromo-2-thienyl)methyl]-3-isopropyl-4-oxo-
1,2,3,4-tetrahydro-9H-β-carbolin-9-carboxylate (8e): Colorless
solid, 95% yield. M. p. 147 °C. Rf (hexane/ethyl acetate, 9:1) ϭ
1
0.24. [α]2D0 ϭ Ϫ20.37 (c ϭ 0.54, CH2Cl2). H NMR (CDCl3): δ ϭ
Corresponding By-Product 5-Isopropyl-6-(2-thienylmethyl)-6,7-di-
hydrothieno[2,3-c]pyridin-4(5H)-one (12): Yellow oil, 26% yield. Rf
(hexane/ethyl acetate, 9:1) ϭ 0.21. [α]2D0 ϭ ϩ2.0 (c ϭ 1.55, CH2Cl2).
1H NMR (CDCl3): δ ϭ 0.86 (d, J ϭ 6.6 Hz, 3 H, CH3), 1.12 (d,
J ϭ 6.5 Hz, 3 H, CH3), 1.86Ϫ1.96 (m, 1 H, CH), 2.78 (d, J ϭ
10.5 Hz, 1 H, CH); 3.73Ϫ3.99 (m, 3 H, 2 ϫ CH2), 4.34 (d, J ϭ
18.2 Hz, 1 H, CH2), 6.76Ϫ7.36 (m, 5 H, CHar) ppm. 13C NMR
(CDCl3): δ ϭ 20.0 (CH3), 21.8 (CH3), 27.8 (CH), 45.6 (CH2), 54.3
(CH2), 74.5 (CH), 124.5 (CH), 125.0 (CH), 125.7 (CH), 125.8 (CH),
126.1 (CH), 135.5 (C), 143.4 (C), 150.5 (C), 194.7 (CO) ppm.
0.89 (d, J ϭ 6.6 Hz, 3 H, CH3), 1.15 (d, J ϭ 6.6 Hz, 3 H, CH3),
1.57 (s, 9 H, C), 1.81Ϫ1.98 (m, 1 H, CH), 2.79 (d, J ϭ 10.5 Hz, 1
H, CH), 3.79 (d, J ϭ 14.7 Hz, 1 H, CH), 4.02 (d, J ϭ 14.7 Hz, 1
H, CH2), 4.24 (d, J ϭ 19.7 Hz, 1 H, CH2), 4.39 (d, J ϭ 19.7 Hz, 1
H, CH2), 6.83 (d, J ϭ 5.3 Hz, 1 H, CH), 7.17 (d, J ϭ 5.3 Hz, 1 H,
CH), 7.27Ϫ7.30 (m, 2 H, CH), 8.03Ϫ8.21 (m, 2 H, CH) ppm. 13C
NMR (CDCl3): δ ϭ 19.6 (CH3), 21.6 (CH3), 28.1 (C), 45.7 (CH2),
53.6 (CH2), 75.2 (CH), 85.8 (C), 109.3 (C), 114.4 (C), 115.3 (CH),
121.6 (CH), 124.6 (CH), 125.0 (CH), 125.4 (CH), 125.6 (CH), 129.8
(CH), 135.9 (C), 138. (C), 146.3 (C), 149.5 (C), 196.3 (CO) ppm.
C24H27BrN2O3S (503.45): calcd. C 57.26, H 5.41, Br 15.87, N 5.56,
S 6.37; found C 56.95, H 5.67, Br 16.01, N 5.46, S 6.50.
(3S)-2-(2-Bromobenzyl)-3-isopropyl-2,3-dihydro-4(1H)-isoquinol-
inone (8a): Colorless solid, 48% yield. Rf (hexane/ethyl acetate,
9:13) ϭ 0.34. 1H NMR (CDCl3): δ ϭ 0.83 (d, J ϭ 6.6 Hz, 3 H,
CH3), 1.11 (d, J ϭ 6.6 Hz, 3 H, CH3), 1.94Ϫ2.02 (m, 1 H, CH),
2.85 (d, J ϭ 10.5 Hz, 1 H, CH), 3.66 (d, J ϭ 17.9 Hz, 1 H, CH2),
3.75 (d, J ϭ 14.4 Hz, 1 H, CH2), 3.86 (d, J ϭ 14.3 Hz, 1 H, CH2),
4.32 (d, J ϭ 17.9 Hz, 1 H, CH2), 7.05Ϫ7.56 (m, 7 H, CH), 7.94
(dd, J1 ϭ 7.8, J2 ϭ 1.0 Hz, 1 H, CH) ppm. 13C NMR (CDCl3):
δ ϭ 20.0 (CH3), 21.6 (CH3), 27.4 (C), 47.7 (CH2), 58.7 (CH2), 125.1
(C), 126.8 (CH), 127.6 (CH), 127.7 (CH), 129.1 (CH), 130.4 (CH),
131.0 (CH), 133.3 (CH), 134.3 (CH), 138.4 (C), 138.6 (C), 140.1
(C), 199.4 (CO). ppm. C19H20BrNO (358.27): calcd. C 63.70, H
5.63, N 3.91; found C 63.44, H 5.41, N 3.74.
(2S)-2-[Bis(2-Bromobenzyl)amino]-3-heptanone (9): Colorless oil,
18% yield. Rf (hexane/ethyl acetate, 9:1) ϭ 0.50. 13C NMR
(CDCl3): δ ϭ 8.1 (C), 14.2 (C), 23.7 (C), 25.9 (CH2), 40.2 (C), 56.0
(2 CH2), 63.2 (CH), 125.5 (2 C), 127.7 (2 CH), 128.9 (2 CH), 131.2
(2 CH), 133.1 (2 CH), 138.8 (2 C), 212.6 (CO) ppm. C21H25Br2NO
(467.24): calcd. C 53.98, H 5.39, N 3.00; found C 54.00, H 5.32,
N 3.09.
(3S,4S)-2-(2-Bromobenzyl)-4-butyl-3-methyl-1,2,3,4-tetrahydro-4-
isoquinolinol (10): Colorless solid, 41% yield. Diastereomeric ratio
78:22 (major stereoisomer separable), Rf (hexane/ethyl acetate, 9:1;
1
major stereoisomer) ϭ 0.25. H NMR (CDCl3): δ ϭ 0.73 (t, J ϭ
tert-Butyl
(3S)-2-(2-Bromobenzyl)-3-methyl-4-oxo-1,2,3,4-tetra-
7.3 Hz, 3 H, CH3), 0.95 (d, J ϭ 6.6 Hz, 3 H, CH3), 1.06Ϫ1.18 (m,
2 H, CH2), 1.66Ϫ1.79 (m, 2 H, CH2), 1.96Ϫ2.06 (m, 2 H, CH2),
3.02 (q, J ϭ 6.6 Hz, 1 H, CH), 3.58Ϫ3.81 (m, 4 H, 2 CH2), 6.89
(d, J ϭ 7.4 Hz, 1 H, CH), 7.02Ϫ7.21 (m, 4 H, CH), 7.34 (dd, J1 ϭ
7.6, J2 ϭ 1.6 Hz, 1 H, CH), 7.45Ϫ7.49 (m, 2 H, CH) ppm. 13C
NMR (CDCl3): δ ϭ 6.3 (CH3), 14.5 (CH3), 23.5 (CH2), 26.0 (CH2),
42.3 (CH2), 50.9 (CH2), 57.7 (CH) 58.8 (CH2), 75.7 (C), 125.5 (C),
125.9 (CH), 126.5 (CH), 126.9 (CH), 127.5 (CH), 129.0 (CH), 131.7
(CH), 133.2 (CH), 133.3 (CH), 134.1 (C), 138.4 (C), 141.4 (C) ppm.
C21H26BrNO (388.34): calcd. C 64.95, H 6.75, N 3.61, Br 20.58;
found C 65.09, H 6.66, N 3.68, Br 20.71.
hydro-9H-β-carbolin-9-carboxylate (8b): Colorless solid,56% yield.
Rf (hexane/ethyl acetate, 7:3) ϭ 0.27. [α]2D0 ϭ Ϫ11.9 (c ϭ 1,
1
CH3CN). H NMR (CDCl3): δ ϭ 1.32 (d, J ϭ 7.1 Hz, 3 H, CH),
1.54 [s, 9 H, (CH3)3,] 3.49 (q, J ϭ 7.1 Hz, 1 H, CH), 3.82 (d, J ϭ
14.7 Hz, 1 H, CH2), 3.91 (d, J ϭ 14.7 Hz, 1 H, CH2), 4.26 (s, 2 H,
CH2), 7.04Ϫ7.30 (m, 4 H, CH), 7.37 (d, J ϭ 7.2 Hz, 1 H, CH),
7.43 (d, J ϭ 7.4 Hz, 1 H, CH), 8.02Ϫ8.09 (m, 1 H, CH), 8.15Ϫ8.20
(m, 1 H, CH) ppm. 13C NMR (CDCl3): δ ϭ 12.7 (CH3), 28.1 (C),
46.3 (CH2), 57.3 (CH2), 63.5 (CH), 85.7 (C), 114.2 (C), 115.3 (CH),
121.5 (CH), 124.6 (CH), 124.7 (C), 125.1 (CH), 125.6 (C), 127.5
(CH), 128.9 (CH), 130.8 (CH), 132.9 (CH), 136.0 (C), 137.5 (C),
147.9 (C), 149.4 (C), 196.4 (CO) ppm. C24H25BrN2O3 (469.37):
calcd. C 61.41, H 5.37, N 5.97; found C 61.24, H 5.28, N 5.84.
5-{(1S)-1-[Bis(2-bromobenzyl)amino]ethyl}-5-nonanol (11): Color-
less oil, 16% yield. Rf (hexane/ethyl acetate, 9:1) ϭ 0.47. 13C NMR
(CDCl3): δ ϭ 9.5 (C), 14.5 (2 C), 22.8 (C), 24.0 (C), 25.4 (CH2),
26.3 (CH2), 36.2 (C), 36.8 (C), 54.9 (2 CH2), 58.3 (CH), 75.9 (C),
124.9 (2 C), 127.8 (2 CH), 129.0 (2 CH), 132.0 (2 CH), 133.2 (2
CH), 138.6 (2 C) ppm. C25H35Br2NO (525.36): calcd. C 57.15, H
6.72, N 2.67 found C 57.22, H 6.66, N 2.72.
tert-Butyl
(3S)-2-{[3-Bromo-1-(tert-butoxycarbonyl)-1H-indol-2-
yl]methyl}-3-(hydroxymethyl)-4-oxo-1,2,3,4-tetrahydro-9H-β-
carbolin-9-carboxylate (8c): Colorless solid, 18% yield. Rf (hexane/
ethyl acetate, 7:3) ϭ 0.19. [α]2D0 ϭ Ϫ12.4 (c ϭ 1, CH2Cl2) ppm. 13C
NMR (CDCl3): δ ϭ 26.3 (C), 26.5 (C), 42.2 (CH2), 45.5 (CH2),
57.3 (CH2), 68.7 (CH), 83.7 (C), 84.2 (C), 104.7 (C), 113.3 (C),
(23S)-9,15-Bis(tert-butoxycarbonyl)-1-hydroxy-12,23-dimethyl-9,15-
113.6 (CH), 114.1 (CH), 117.8 (CH), 119.8 (CH), 121.8 (CH), 122.2 diaza-12-azonia-hexacyclo[10.10.1.02,10.03,8.014,22.016,21]tricosa-
(C), 123.0 (CH), 123.5 (CH), 124.2 (CH), 125.9 (C), 131.5 (C),
2(10),3,5,7,14(22),16,18,20-octaene Iodide (13): MeI (0.36 mL,
133.8 (C), 139.3 (C), 146.1 (C), 147.8 (C), 148.5 (C), 193.2 (C) ppm. 5.66 mmol) was added to a solution of 6b (1.15 mmol) in CH2Cl2
3494
 2004 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.eurjoc.org
Eur. J. Org. Chem. 2004, 3484Ϫ3496

Double Cyclization of Bis(α-hetarylmethyl)amino Esters
(30 mL). After 30 min of refluxing, the volatile components were well plate and incubated overnight in DMEM medium with 10%
FULL PAPER
evaporated under vacuum to afford the product as a yellow solid
fetal calf serum at 37 °C. Then the medium was exchanged and
in 98% yield. Rf (CHCl3/MeOH, 9:1) ϭ 0.18. [α]2D0 ϭ ϩ80.5 (c ϭ inhibitors were added at different concentrations. After 2 d, the
1, CHCl3). 1H NMR (CDCl3): δ ϭ 1.58Ϫ1.61 (m, 21 H, CH3), 3.82 medium was removed and fresh medium containing the same in-
(s, 3 H, CH3) 4.98 (d, 1 H, CH2), 5.06 (d, 1 H, CH2), 5.24Ϫ5.45
hibitor concentrations was added. After incubation for another 3 d,
(m, 2 H, CH2), 5.71 (d, 1 H, CH2), 7.08Ϫ7.29 (m, 4 H, CH, the cells were trypsinated, washed with PBS buffer (137 m NaCl,
7.78Ϫ7.86 (m, 2 H, CH), 8.04Ϫ8.27 (m, 2 H, CH) ppm. 13C NMR 2.68 m KCl, 10 m Na2HPO4, 2 m KH2PO4, pH ϭ 7.4) and
(CDCl3): δ ϭ 9.7 (C), 28.20 (CH3)3, 28.23 (CH3)3, 56.9 (CH3), 63.4 resuspended in 100 µL of PBS. 20 µL of the cell suspension was
(CH2), 68.6 (CH2), 69.8 (CH), 70.1 (C), 86.1 (C), 86.2 (C), 115.2 mixed with 20 µL of Trypan Blue to detect dead cells. Cells were
(CH), 115.4 (CH), 121.1 (CH), 121.2 (C), 122.0 (CH), 122.4 (C), counted in a Neubauer chamber.
123.6 (2 C), 123.7 (CH), 123.8 (CH), 124.8 (C), 125.4 (2 CH), 126.0
(C), 135.4 (C), 135.5 (C), 150.7 (C), 150.8 (C) ppm. C32H38IN3O5
Materials and Methods for DNA Polymerase Assay
Chemicals: [3H]dTTP (40 Ci/mmol) was from Amersham Biosci-
(671.57): calcd. C 57.23, H 5.70, N 6.26; found C 57.05, H 5.87,
N 6.52.
ences; unlabeled dNTPs, poly(dA), and oligo(dT)12-18 were from
Roche Molecular Biochemicals. Whatman was the supplier of the
GF/C filters. All other reagents were of analytical grade and were
purchased from Merck or Fluka.
b) Biological Testing
Methods
DNA Polymerase Assay: DNA polymerase (pol) β activity on po-
ly(dA)/oligo(dT) 10:1 (0.5 µg) was assayed in a final volume of 25
µL containing 50 m Tris-HCl (pH ϭ 7.6), 0.25 mg/mL bovine
serum albumin, 1 m DTT, 0.5 m MnCl2, and 25 µM [3H]dTTP
(5 Ci/mmol). All reaction mixtures were incubated at 37 °C for
15 min, and the DNA was precipitated with 10% trichloroacetic
acid. Insoluble radioactive material was determined by scintillation
counting as described;[28] pol δ was assayed as described for pol β
with the exception that instead of 0.5 m MnCl2, 6 m MgCl2 was
used in the reaction, in addition to 40 n of proliferating cell nu-
clear antigen (PCNA).
Purification of Recombinant HIV-1 RT: The enzyme purification
was described previously.[23Ϫ25]
Inhibitors: The inhibitors 6b, 6c and 6e were dissolved and diluted
in 100% DMSO. The inhibitor solution (2 µL, different concen-
trations) was added to the assay solution to reach a final DMSO
concentration of 2%.
RNase H Assay: The RNase H activity was examined with a 45/
36mer RNA/DNA hybrid. The 45mer RNA was synthesized
chemically and possessed a fluorescent Cy5 label attached to its 5Ј
end (IBA GmbH, Göttingen, Germany). The sequence of the tem-
plate RNA was 5Ј Cy5-CUAAUUCCCCUUUCCCCCUCUC-
CUGGUGAUCCUUUCCAUCCCUGU 3Ј. The sequence of the
DNA primer was complementary to the last 36 nucleotides of the
3Ј end of the RNA. Hybridization was performed as described pre-
viously.[26] The RNase H cleavage was examined in RT buffer
(50 m Tris-HCl pH ϭ 8, 80 m KCl, 5 m DTT, 6 m MgCl2).
20 n HIV-1 RT was pre-incubated with different concentrations
of inhibitor for 2 min at 37 °C. Reactions were started by the ad-
dition of 80 n primer/template and stopped by the addition of
formamide buffer [80% (v/v) formamide in 90 m Tris-HCl pH ϭ
8.3, 90 m boric acid, 3 m EDTA]. Reaction products were sepa-
rated in the dark on denaturing 20% polyacrylamide gels, contain-
ing 7  urea. The fluorescent bands were visualized at an excitation
wavelength of 635 nm with the use of a fluorimaging device (Fuji
FLA 5000). Emission was measured with a cut-off filter (665 nm).
Enzymes: pol δ and pol β were purified as described.[29,30] PCNA
was purified as previously described.[31]
Quantification of the Polymerization Products: This was performed
by phosphorimaging (Figure 3). The amount of extended primer in
the absence of inhibitor (65%) was set as 100%. The amount of
products in the presence of inhibitor was quantified as a ratio ther-
eof.
Quantification of the RNase H Cleavage Products: This was per-
formed by phosphorimaging (Figure 4). The amount of cleaved 5Ј
RNA fragments in the absence of inhibitor (54%) was set as 100%.
The amount of products in the presence of inhibitor was quantified
as a ratio thereof.
Acknowledgments
Analysis of Polymerization Products in the Presence of Inhibitors:
DNA-dependent polymerization on a single-stranded bacterio-
phage M 13 DNA template was determined as described pre-
viously[27] with the following modifications: Briefly, an18mer oligo-
deoxynucleotide labeled radioactively at the 5Ј end with 32P was
hybridized to single-stranded M13 DNA in RT buffer described
above. 8 n of HIV-1 RT was pre-incubated in RT buffer with dif-
ferent amounts of inhibitor and 250 µ dNTPs at 37 °C for 5 min
in a final assay volume of 50 µL. 1 µL of the inhibitor solution
was added to the assay solution. The final DMSO concentration
was 2%. Reactions were started by the addition of the primer/tem-
plate substrate to a final concentration of 10 n. Reactions were
stopped after 20 min by the addition of 25 µL of formamide buffer.
15-µL aliquots were loaded on 10% denaturing polyacrylamide gels
containing 7  urea. The bands were visualized using a phos-
phorimaging device.
We gratefully acknowledge financial support by Fonds der Chem-
ischen Industrie and Deutsche Forschungsgemeinschaft. We thank
Dr. Burkhard Ziemer for providing X-ray crystal analysis and Dr.
Hans-Jürgen Hamann for chiral HPLC analysis.
[1]
H. Takayama, M. Takamoto, T. Okamoto, Tetrahedron Lett.
1978, 1307Ϫ1308.
T. Nomoto, N. Nasui, H. Takayama, J. Chem. Soc., Chem.
[2]
Commun. 1984, 1646Ϫ1647.
T. Nomoto, H. Takayama, J. Chem. Soc., Chem. Commun.
[3]
1984, 1644Ϫ1646.
[4]
J. M. Bobbitt, S. Shibuya, J. Org. Chem. 1970, 35, 1181Ϫ1183.
[5]
T. Suzuki, M. Takamoto, T. Okamoto, H. Takayama, Chem.
Pharm. Bull. 1986, 34, 1888Ϫ1900.
H. Takayama, T. Suzuki, M. Takamoto, T. Okamoto, Hetero-
[6]
cycles 1978, 9, 1429Ϫ1432.
[7]
N. Coskun, L. Büyükuysal, Heterocycles 1998, 48, 53Ϫ59.
[8]
Toxicity on Human Cells: The toxicity of the inhibitors was tested
with the human HeLa cell line. HeLa cells were seeded on a 24-
H. Takayama, T. Suzuki, T. Nomoto, Chem. Lett. 1978,
865Ϫ866.
Eur. J. Org. Chem. 2004, 3484Ϫ3496
www.eurjoc.org
 2004 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
3495

J. Liebscher et al.
FULL PAPER
[9]
H. Hara, O. Hoshino, B. Umezawa, Heterocycles 1981, 15,
Cambridge Crystallographic Data Centre, 12 Union Road,
Cambridge CB2 1EZ, UK; Fax: (internat.) ϩ 44-1223-336-033;
E-mail: deposit@ccdc.cam.ac.uk].
907Ϫ910.
[10]
M. Kihara, M. Kashimoto, Y. Kobayashi, Y. Nagao, Hetero-
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30]
B. Müller, T. Restle, S. Weiss, M. Gautel, G. Sczakiel, R. S:
Goody, J. Biol. Chem. 1989, 264, 13975Ϫ13978.
B. Müller, T. Restle, J. Reinstein, R. S. Goody, Biochemistry
1991, 30, 3709Ϫ3715.
R. Krebs, U. Immendörfer, S. Thrall, B. M. Wöhrl, R. S.
Goody, Biochemistry 1997, 36, 10292Ϫ10300.
B. M. Wöhrl, R. Krebs, R. S. Goody, T. Restle, J. Mol. Biol.
1999, 292, 333Ϫ344.
S. Werner, B. M. Wöhrl, J. Biol. Chem. 1999, 274,
26329Ϫ26336.
U. Hübscher, A. Kornberg, Proc. Natl. Acad. Sci. U. S. A.
1979, 76, 6284Ϫ6288.
I. V. Shevelev, K. Ramadan, U. Hübscher, TheScientificWorld-
JOURNAL 2002, 2, 275Ϫ281.
S. Hasan, N. El-Andaloussi, U. Hardeland, P. O. Hassa, C.
Burki, R. Imhof, P. Schar, M. O. Hottiger, Mol. Cell. 2002,
10, 1213Ϫ1222.
cycles 1992, 34, 747Ϫ756.
J.-P. Mafrand, F. Aloy, Heterocycles 1980, 14, 321Ϫ324.
H. Hara, O. Hoshino, B. Umezawa, Chem. Pharm. Bull. 1985,
33, 2705Ϫ2711.
Y. Inubishi, H. M. Fales, E. W. Warnhoff, W. C. Wildman, J.
Org. Chem. 1960, 25, 2153Ϫ2164.
H. Faltz, J. Liebscher, Synlett 1998, 1355Ϫ1356.
H. Faltz, A. Radspieler, J. Liebscher, Synlett 1997, 1071Ϫ1072.
S. Swaleh, J. Liebscher, J. Org. Chem. 2002, 67, 3184Ϫ2193.
H. Faltz, J. Liebscher, unpublished results.
E. DeClerque, Rev. Med. Virol. 1996, 6, 97.
D. Nagarathnam, Synthesis 1992, 743Ϫ745.
D. W. H. MacDowell, J. M. Purpura, J. Org. Chem. 1986, 51,
183Ϫ188.
R. Baronnet, O. Foussard-Blanpin, Eur. J. Med. Chem. 1974,
9, 182Ϫ187.
[11]
[12]
[13]
[14]
[15]
[16]
[17]
[18]
[19]
[20]
[21]
[22]
[31]
CCDC-231863 contains the supplementary crystallographic
data for this paper. These data can be obtained free of charge
at www.ccdc.cam.ac.uk/conts/retrieving.html [or from the
Z. O. Jonsson, R. Hindges, U. Hübscher, EMBO J. 1998, 17,
2412Ϫ2425.
Received February 28, 2004
3496
 2004 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.eurjoc.org
Eur. J. Org. Chem. 2004, 3484Ϫ3496