Exploring novel capping framework: high substituent pyridine-hydroxamic acid derivatives as potential antiproliferative agents

DARU Journal of Pharmaceutical Sciences

https://doi.org/10.1007/s40199-021-00406-8

RESEARCH ARTICLE

Exploring novel capping framework: high substituent

pyridine‑hydroxamic acid derivatives as potential antiproliferative

agents

Fernando Hernández‑Borja¹· Itzel Mercado‑Sánchez¹· Yolanda Alcaraz²· Marco A. García‑Revilla¹·

Clarisa Villegas Gómez¹· David Ordaz‑Rosado³· Nancy Santos‑Martínez³· Rocío García‑Becerra⁴·

Miguel A. Vazquez¹

Received: 13 January 2021 / Accepted: 26 June 2021

Abstract

Purpose Histone deacetylases (HDACs) play a vital role in the epigenetic regulation of gene expression due to their over-

expression in several cancer forms. Therefore, these enzymes are considered as a potential anticancer drug target. Diferent

synthetic and natural structures have been studied as HDACs inhibitors; based on available structural design information,

the capping group is important for the biological activity due to the diferent interactions in the active site entrance. The

present study aimed to analyze high substituted pyridine as a capping group, which included carrying out the synthesis,

antiproliferative activity analysis, and docking studies of these novel compounds.

Methods To achieve the synthesis of these derivatives, four reaction steps were performed, generating desired products

15a-k. Their efects on cell proliferation and gene expression of p21, cyclin D1, and p53 were determined using the sul-

phorhodamine B (SRB) method and quantitative real-time polymerase chain reaction. The HDAC1, HDAC6, and HDAC8

isoforms were used for performing docking experiments with our 15a-k products.

Result The products 15a-k were obtained in overall yields of 40–71%. Compounds 15j and 15k showed the highest antipro-

liferative activity in the breast (BT-474 and MDA-MB-231) and prostate (PC3) cancer cell lines at a concentration of 10 µM.

These compounds increased p21 mRNA levels and decreased cyclin D1 and p53 gene expression. The docking study showed

an increment in the strength, and in the number of interactions performed by the capping moiety of the tested molecules

compared with SAHA; interactions displayed are mainly van der Waals, π-stacking, and hydrogen bond.

Conclusion The synthesized compounds 2-thiophene (15j) and 2-furan (15k) pyridine displayed cell growth inhibition,

regulation of genes related to cell cycle progression in highly metastatic cancer cell lines. The molecular coupling analysis

performed with HDAC1, HDAC6 and HDAC8 showed an increment in the number of interactions performed by the capping

moiety and consequently in the strength of the capping group interaction.

Keywords Capping framework · High substituent pyridine · HDACs · Antiproliferative compounds · Docking · Gene

expression

3

* Miguel A. Vazquez

Departamento de Biología de la Reproducción Dr. Carlos

Gual Castro, Instituto Nacional de Ciencias Médicas y

Nutrición Salvador Zubirán, Ciudad de México 14080,

México

mvazquez@ugto.mx

1

Departamento de Química, Universidad de Guanajuato,

Guanajuato, Gto 36050, México

4

Departamento de Biología Molecular y Biotecnología,

Instituto de Investigaciones Biomédicas, Universidad

Nacional Autónoma de México, Ciudad de México 04510,

México

2

Departamento de Farmacia, Universidad de Guanajuato,

Guanajuato, Gto 36050, México

Vol.:(0123456789)

1 3

DARU Journal of Pharmaceutical Sciences

in advanced preclinical phases, such as moce tinostat (4)

[14], entinostat (5) [15], and chidamide (6) [16, 17], which

draws the attention of these molecules is the benzamides

as chelator and pyridine nuclei from nicotinic acid as cap-

ping group. This heterocycle is the subject of the present

research, the principal diference with the molecules pre-

viously mentioned is the substitution in the position C2,

which was considered as a potential metal coordination

moiety, focusing on the two nitrogen atoms. Most of these

inhibitors present a highly known pharmacophoric model

consisting of three fragments: the capping fr ame work,

linker, and zinc-binding group (ZBG) (Fig. 1) [18, 19].

Several studies have shown the pharmacophor ic models

use to generate new compounds displaying HDAC inhibitory

activity, some of which present inter esting structural modi-

fcations in the capping group [20–24]. Some of such strate-

gies are the increase of the hydrophobic region by including

polycycles, or adding several substituents on the aromatic

ring in diferent positions [23 , 25], in addition to the inclu-

sion of several heterocycles [26 ] as coumarin [27] and pyr-

role [28] have been used. These nuclei have hydrophobic

characteristics which can confer specifc recognition of the

HDAC at the edge of the active site cavity. These changes

have generated compounds with similar or higher efcacy to

SAHA. By considering all this research in the literature, it

was planned to extend the knowledge of the relevant interac-

tions between the biological target and the anticancer drugs,

trying to develop new antiproliferative compounds. Here, we

present the synthesis of novel compounds where the capping

group shows a pyridine core highly substituted, which has

not been investigated until now. The antiproliferative activ-

ity and their efects on genes implicated in the cell cycle

were investigated in breast and prostate cancer cell lines.

Besides, docking experiments were performed with HDAC1,

HDAC6, and HDAC8 as biological targets.

Introduction

Histone deacetylases (HDACs) are enzymes responsible

for the regulation of gene expression [1, 2], by deacety-

lation of residues of lysine and arginine in histones and

other proteins [3, 4]. Several studies showed an abnormal

overexpression of HDACs, and such behavior is related to

diferent types of cancer [5] and its diferent stages (initia-

tion and progression) [6 ]. This allows us to visualize them

as a therapeutic objective for treating diferent diseases,

including cancer. The insight gained in diverse analyses

reveal that abnormal expression of tumor suppressor genes

(TSG) is modifed in a cancer cell; nevertheless, it can be

silenced using epigenetic drugs. The use of epigenetic

modulators has been shown a change in the gene expression

in cancer cells, resulting in apoptosis, cell diferentiation,

and recognition of cancer cells by the immune system [7,

8]. For example, those promoting the DNA hypermethyla-

tion catalyzed by DNA methyltransferases (DNMTs) and

those allowing the expansion of chromatin, permitting the

genetic transcription to take place catalyzed by HDACs [9].

The HDACs family has eleven zinc-dependent enzymes

[10], the development of molecules to improve the biologi-

cal activity of HDACs inhibitors has been widely studied.

Among the strategies of such improvement are an efcient

block of the metal and the strength of the displayed interac-

tions of the capping group on the enzyme surface.

Synthetic HDACs inhibitors such as vorinostat (1)

(SAHA), belinostat (2) (PXD 101), and panobinostat (3)

(LDH589) have shown a broad spectrum of epigenetic

activities, all these molecules characterized by containing a

hydroxamic group as the chelating moiety. These drugs have

been approved by the FDA for the treat diferent types of

cancer [11–13]. Nowadays, there are interesting compounds

Fig. 1 Compounds approved by the FDA and clinical candidates with inhibitor activity of HDACs

1 3

DARU Journal of Pharmaceutical Sciences

Methods

in high yield. Subsequently, the compounds 8a-k were trans-

formed to tetrahidropyridin-2-one (9a-k) employing acid

conditions. The latter compounds w er e oxidized to produce

the 10a-k derivatives (Scheme 1) [29, 30].

Chemistry

Reagents and solvents were purchased from Sigma-Aldrich

(St. Louis, MO) and used without prior purifcation. Melting

points were determined on an Electrothermal digital 90,100

melting point apparatus and were uncorrected. The progress

of reactions was monitored by thin-layer chromatography

(TLC) using silica gel 60-F₂₅₄coated aluminum sheets in

hexane/ethyl acetate (7:3) and visualized by a 254 nm UV

lamp. The compounds were purifed by column chromatog-

raphy packed with silica gel of 230–400 mesh of Machery-

Nagel Company using the system hexane/ethyl acetate.

General procedure for the synthesis ethyl

4‑(aryl)‑6‑chloro‑5‑cyano‑2‑methylnicotinate

(11a‑k)

A mixture of 2-pyridone derivative 10a-k (1 mmol),

phosphorus oxychloride (42 mmol), and N,N-dimethyl-

aniline (1.9 mmol) was heated under reflux for 6–7 days.

After the reaction was finished monitored by TLC, the

suspension was cooled down to room temperature, and

the solution was quenched in a mixture of water/ice to

remove the excess of POCl₃; after quenching, the solu-

tion was kept under stirring, observing the precipitation

of the product which was collected by vacuum filtration.

The solid was dried at room temperature to afford a pure

compound 11a-k.

1

Pure compounds were characterized, H NMR and ¹³C

NMR were recorded for solutions in CDCl₃with Me₄Si as

internal standard on Bruker UltraShield (500 MHz) instru-

ment. High-resolution mass spectra were performed using a

spectrometer Bruker ESI-QTOFMS maXis impact, and the

samples were analyzed in combination with methyl stearate

as an internal standard. CEM discovery SP microwave reac-

tor was used for reactions. Chemical shifts are given in ppm

(δ); multiplicities are indicated by s (singlet), d (doublet), dd

(double doublet), t (triplet), q (quartet), m (multiplet), or bs

(broad singlet). X-ray data were collected on Oxford Difrac-

tion Gemini “A” difractometer with a CCD area detector.

Ethyl 6‑chloro‑5‑cyano‑2‑methyl‑4‑phenylnicotinate (11a)

White solid; yield: 92%; mp:108–109 °C; ¹H NMR (500 MHz,

CDCl₃) δ 7.75 – 7.42 (m, 3H), 7.44 – 7.21 (m, 2H), 4.05 (q,

J=7.1 Hz, 2H), 2.67 (s, 3H), 0.92 (t, J=7.1 Hz, 3H); ¹³C

NMR (125 MHz, CDCl₃) δ 166.0, 160.2, 154.4, 153.0, 134.1,

130.3, 128.9, 128.9, 128.2, 114.0, 108.4, 62.3, 23.3, 13.6;

HRMS (ESI+, [M+H]⁺) calculated for [C₁₆H₁₄ClN₂O₂]⁺:

301.0738, found 301.0741.

General procedure for the synthesis ethyl

5‑cyano‑2‑methyl‑6‑oxo‑4‑(aryl)‑1,6‑dihydropyri‑

dine‑3‑carboxylate (10a‑k)

Ethyl 6‑chloro‑5‑cyano‑2‑methyl‑4‑(4‑nitrophenyl)nicoti‑

nate (11b)

To obtain the compounds 10a-k, it was followed previously

reported methodology, which does not deserve an in-depth

analysis. The 4H-pyrans (8a-k) were obtained using difer-

ent aldehydes (7a-k), ethyl acetoacetate, and malononitrile

White solid; yield: 96%; mp: 149–150 °C; ¹H NMR

(500 MHz, CDCl₃) δ 8.38 (d, J = 8.4 Hz, 2H), 7.58 (d,

Scheme 1 Reagent and reaction conditions for 15a-k. i) POCl₃, DMA, 106 °C, 7 d, 90–98%. ii) TEA, EtOH, MW, 120 °C, 3–4 h, 78–90%. iii)

LiOH, THF/H₂O, rt, 12 h, 78–97%. iv) NH₂OH·HCl, DMAP, CDI, DCM, rt, 12 h, 75–84%

1 3

DARU Journal of Pharmaceutical Sciences

J=8.4 Hz, 2H), 4.10 (q, J=7.1 Hz, 2H), 2.71 (s, 3H), 1.01

(t, J=7.1 Hz, 3H); ¹³C NMR (125 MHz, CDCl₃) δ 165.2,

160.9, 153.2, 151.8, 148.9, 140.0, 129.5, 128.2, 124.0, 113.3,

108.0, 62.5, 23.5, 13.7; HRMS (ESI+, [M+H]⁺) calculated

for [C₁₆H₁₃ClN₃O₄]⁺: 346.0589, found 346.0589.

Ethyl 6‑chloro‑5‑cyano‑4‑(4‑methoxyphenyl)‑2‑methylnic‑

otinate (11g)

Pale yellow; yield: 92%; mp: 83–84 °C; ¹H NMR (500 MHz,

CDCl₃) δ 7.33 (d, J=8.7 Hz, 2H), 7.00 (d, J=8.7 Hz, 2H),

4.11 (q, J = 7.1 Hz, 2H), 3.86 (s, 3H), 2.64 (s, 3H), 1.02

(t, J=7.1 Hz, 3H); ¹³C NMR (125 MHz, CDCl₃) δ 166.2,

161.2, 159.8, 154.0, 152.9, 129.8, 128.9, 126.0, 114.4, 114.2,

108.3, 62.1, 55.4, 23.2, 13.7; HRMS (ESI+, [M+H]⁺) cal-

culated for [C₁₇H₁₆ClN₂O₃]⁺: 331.0844, found 331.0843.

Ethyl 6‑chloro‑5‑cyano‑2‑methyl‑4‑(3‑nitrophenyl)nicoti‑

nate (11c)

Gray solid; yield: 90%; mp: 129–130 °C; ¹H NMR (500 MHz,

CDCl₃) δ 8.43–8.38 (m, 1H), 8.28 (s, 1H), 7.75 (d, J=5.1 Hz,

2H), 4.13 (q, J=7.1 Hz, 2H), 2.71 (s, 3H), 1.04 (t, J=7.1 Hz,

3H); ¹³C NMR (125 MHz, CDCl₃) δ 165.2, 160.9, 153.2,

151.4, 148.2, 135.3, 134.2, 130.2, 128.5, 125.0, 123.4, 113.4,

108.3, 62.6, 23.5, 13.7; HRMS (ESI+, [M+H]⁺) calculated

for [C₁₆H₁₃ClN₃O₄]⁺: 346.0589, found 346.0591.

Ethyl 6‑chloro‑4‑(3‑chlorophenyl)‑5‑cyano‑2‑methylnicoti‑

nate (11h)

Gray solid; yield: 94%; mp: 145–146 °C; ¹H NMR

(500 MHz, CDCl₃) δ 7.50 (dt, J = 8.1, 1.8, 1H), 7.45 (t,

J = 7.8 Hz, 1H), 7.36 (t, J= 1.7 Hz, 1H), 7.28 (dt, J= 4.9,

3.5 Hz, 1H), 4.12 (q, J = 7.1 Hz, 2H), 2.67 (s, 3H), 1.01

(t, J=7.1 Hz, 3H); ¹³C NMR (125 MHz, CDCl₃) δ 165.5,

160.4, 153.0, 152.6, 135.5, 135.0, 130.4, 130.2, 128.6,

128.9, 126.5, 113.6, 108.2, 77.3, 77.0, 76.8, 62.3, 23.3, 13.6;

HRMS (ESI+, [M+H]⁺) calculated for [C₁₆H₁₃Cl₂N₂O₂]⁺:

335.0349, found 335.0350.

Ethyl 6‑chloro‑5‑cyano‑4‑(4‑fuorophenyl)‑2‑methylnicoti‑

nate (11d)

Gray solid; yield: 93%; mp: 98–99 °C; ¹H NMR (500 MHz,

CDCl₃) δ 7.48 – 7.30 (m, 2H), 7.20 (t, J=8.5 Hz, 2H), 4.10

(q, J = 7.1 Hz, 2H), 2.66 (s, 3H), 1.00 (t, J = 7.1 Hz, 3H);

¹³C NMR (125 MHz, CDCl₃) δ 165.8, 164.8, 162.8, 160.2,

153.2 (d, J = 23.6 Hz), 139.8, 136.7, 130.3 (d, J= 8.7 Hz),

129.8 (d, J = 3.5 Hz), 128.8, 116.6, 116.2 (d, J= 22.1 Hz),

113.9, 111.8, 108.4, 62.3, 23.3, 13.6; HRMS (ESI + ,

[M + H]⁺) calculated for [C₁₆H₁₃ClFN₂O₂]⁺: 319.0644,

found 319.0645.

Ethyl 6‑chloro‑5‑cyano‑4‑(2,4‑dichlorophenyl)‑2‑methylni‑

cotinate (11i)

Green solid, yield: 81%; mp: 85–86°C; ¹H NMR (500 MHz,

CDCl₃) δ 7.57 (d, J=1.9 Hz, 1H), 7.39 (dd, J=8.3, 1.9 Hz,

1H), 7.16 (d, J = 8.3 Hz, 1H), 4.10 (q, J = 7.1 Hz, 2H),

2.72 (s, 3H), 1.01 (t, J=7.1 Hz, 3H); ¹³C NMR (125 MHz,

CDCl₃) δ 165.0, 161.5, 152.9, 151.3, 137.1, 133.6, 131.8,

130.5, 130.1, 128.4, 127.6, 113.2, 109.4, 62.4, 23.9, 13.7;

HRMS (ESI+, [M+H]⁺) calculated for [C₁₆H₁₃Cl₃N₂O₂]⁺:

368.9959, found 368.9966.

Ethyl 4‑(4‑bromophenyl)‑6‑chloro‑5‑cyano‑2‑methylnicoti‑

nate (11e)

1

Green solid; yield: 87%; mp: 104–105 °C; H NMR

(500 MHz, CDCl₃) δ 7.65 (d, J = 8.4 Hz, 2H), 7.25 (d,

J=8.4 Hz, 2H), 4.10 (q, J=7.1 Hz, 2H), 2.67 (s, 3H), 1.01

(t, J=7.1 Hz, 3H); ¹³C NMR (125 MHz, CDCl₃) δ 165.6,

160.3, 153.0, 153.0, 132.7, 132.2, 129.7, 128.5, 125.0,

113.7, 108.2, 62.3, 23.3, 13.6; HRMS (ESI+, [M+H]⁺) cal-

culated for [C₁₆H₁₃BrClN₂O₂]⁺: 378.9843, found 378.9847.

Ethyl 6‑chloro‑5‑cyano‑2‑methyl‑4‑(thiophen‑2‑yl)nicoti‑

nate (11j)

1

Brown solid; yield: 93%; mp: 119–120 °C; H NMR

(500 MHz, CDCl₃) δ 7.59 (dd, J = 6.3, 5.7 Hz, 1H), 7.36

– 7.34 (m, 1H), 7.18 (dd, J = 4.9, 3.8 Hz, 1H), 4.19 (q,

J = 7.1 Hz, 2H), 2.64 (s, 3H), 1.11 (t, J = 7.1 Hz, 3H);

¹³C NMR (125 MHz, CDCl₃) δ 166.0, 160.1, 153.4,

147.0, 133.1, 130.8, 130.0, 129.2, 128.0, 114.2, 108.5,

62.6, 23.3, 13.8; HRMS (ESI+ , [M + H]⁺) calculated for

[C₁₄H₁₂ClN₂O₂S]⁺: 307.0303, found 307.0304.

Ethyl 6‑chloro‑4‑(4‑chlorophenyl)‑5‑cyano‑2‑methylnicoti‑

nate (11f)

Gray solid; yield: 91%; mp: 91–92°C; ¹H NMR (500 MHz,

CDCl₃) δ 7.49 (d, J=8.3 Hz, 2H), 7.33 (d, J=8.3 Hz, 2H),

4.10 (q, J = 7.1 Hz, 2H), 2.67 (s, 3H), 1.01 (t, J = 7.1 Hz,

3H); ¹³C NMR (125 MHz, CDCl₃) δ 165.7, 160.3, 153.0,

152.9, 136.8, 132.2, 129.6, 129.2, 128.6, 113.8, 108.2,

62.3, 23.3, 13.6; HRMS (ESI+ , [M + H]⁺) calculated for

[C₁₆H₁₃Cl₂N₂O₂]⁺: 335.0349, found 335.0348.

Ethyl 6‑chloro‑5‑cyano‑4‑(furan‑2‑yl)‑2‑methylnicotinate

(11k)

Green solid; yield: 82%; mp: 78–79 °C; ¹H NMR (500 MHz,

CDCl₃) δ 7.62 (d, J=1.4 Hz, 1H), 7.45 (d, J=3.6 Hz, 1H),

1 3

DARU Journal of Pharmaceutical Sciences

6.65 (dd, J=3.7, 1.8 Hz, 1H), 4.38 (q, J=7.2 Hz, 2H), 2.62 (s,

3H), 1.30 (t, J=7.2 Hz, 3H); ¹³C NMR (125 MHz, CDCl₃) δ

166.6, 160.5, 153.9, 145.8, 145.6, 140.2, 125.3, 116.7, 114.9,

113.1, 103.4, 62.5, 23.2, 14.0; HRMS (ESI+, [M+H]⁺) cal-

culated for [C₁₄H₁₂ClN₂O₃]⁺: 291.0531, found 291.0535.

(m, 2H), 5.46 (t, J=5.3 Hz, 1H), 3.98 (q, J=7.1 Hz, 2H),

3.68 (s, 3H), 3.60 (q, J = 7,2 Hz, 2H), 2.57 (s, 3H), 2.35

(t, J = 7.4 Hz, 2H), 1.74 – 1.65 (m, 4H), 1.47 – 1.41 (m,

2H), 0.93 (t, J=7.1 Hz, 3H); ¹³C NMR (125 MHz, CDCl₃)

δ 174.0, 166.8, 161.9, 157.9, 151.3, 148.1, 138.1, 134.0,

129.7, 124.0, 123.2, 117.6, 115.7, 88.8, 61.3, 51.6, 41.2,

33.9, 29.1, 26.3, 24.5, 24.5, 13.6; HRMS (ESI+, [M+H]⁺)

calculated for [C₂₃H₂₇N₄O₆]⁺: 455.1925, found 455.1927.

General procedure for the synthesis Ethyl

4‑(aryl)‑5‑cyano‑6‑((6‑methoxy‑6‑oxohexyl)

amino)‑2‑methylnicotinate (13a‑k)

Ethyl 5‑cyano‑4‑(4‑fuorophenyl)‑6‑((6‑methoxy‑6‑ox‑

In a pressure tube for microwave, the reaction was placed

11a-k (1 mmol), methyl 6-aminohexanoate hydrochloride 12

(1.1 mmol) triethylamine (2.2 mmol), and 3 mL of ethanol

was added. The reaction mixture was microwave irradiated

at 120 °C for 3–4 h. The end of the reaction was confrmed

by TLC using Hex/Ethyl acetate (8:2). Once completed the

reaction, the crude product was purifed by column chro-

matography (Hex/Ethyl acetate 9:1) to obtain compounds

13a-k.

ohexyl)amino)‑2‑methylnicotinate (13d)

Brown solid; yield: 85%; mp: 88–89 °C; ¹H NMR

(500 MHz, CDCl₃) δ 7.32 (dd, J = 7.6, 5.6 Hz, 2H), 7.14

(t, J=8.4 Hz, 2H), 5.42 (bs, 1H), 3.96 (q, J=7.1 Hz, 2H),

3.68 (s, 3H), 3.58 (q, J=6.5 Hz, 2H), 2.53 (s, 3H), 2.35 (t,

J=7.4 Hz, 2H), 1.75 – 1.62 (m, 4H), 1.48 – 1.39 (m, 2H),

0.92 (t, J = 7.1 Hz, 3H); ¹³C NMR (125 MHz, CDCl₃) δ

174.0, 167.5, 163.2 (d, J=249.4 Hz), 160.9, 158.0, 152.7,

132.3 (d, J = 3.5 Hz), 129.9 (d, J = 8.4 Hz), 118.3, 116.3,

115.7 (d, J = 21.9 Hz), 88.9, 61.2, 51.5, 41.2, 33.9, 29.1,

26.3, 24.5, 24.1, 13.6; HRMS (ESI+, [M+H]⁺) calculated

for [C₂₃H₂₇FN₃O₄]⁺: 428.1980, found 428.1986.

Ethyl 5‑cyano‑6‑((6‑methoxy‑6‑oxohexyl)amino)‑2‑me‑

thyl‑4‑phenylnicotinate (13a)

White solid; yield: 90%; mp: 69–70 °C; ¹H NMR (500 MHz,

CDCl₃) δ 7.44 – 7.42 (m, 3H), 7.33 – 7.31 (m, 2H), 5.43 (t,

J=5.4 Hz, 1H), 3.92 (q, J=7.1 Hz, 2H), 3.68 (s, 1H), 3.58

(q, J = 6.9 Hz, 2H), 2.53 (s, 3H), 2.35 (t, J= 7.5 Hz, 2H),

1.75 – 1.62 (m, 4H), 1.46 – 1.40 (m, 2H), 0.83 (t, J=7.1 Hz,

3H); ¹³C NMR (125 MHz, CDCl₃) δ 174.0, 167.7, 160.8,

158.0, 153.8, 136.4, 129.2, 128.5, 127.9, 118.2, 116.4, 88.9,

61.1, 51.5, 41.2, 33.9, 29.1, 26.3, 24.5, 24.0, 13.5; HRMS

(ESI+, [M+H]⁺) calculated for [C₂₃H₂₈N₃O₄]⁺: 410.2074,

found 410.2073.

Ethyl 4‑(4‑bromophenyl)‑5‑cyano‑6‑((6‑methoxy‑6‑ox‑

ohexyl)amino)‑2‑methylnicotinate (13e)

White solid; yield: 88%; mp: 77–78 °C; ¹H NMR (500 MHz,

CDCl₃) δ 7.58 (d, J=8.3 Hz, 2H), 7.20 (d, J=8.3 Hz, 2H),

5.40 (bs, 1H), 3.97 (q, J=7.1 Hz, 2H), 3.68 (s, 3H), 3.58 (q,

J=6.7 Hz, 2H), 2.53 (s, 3H), 2.35 (t, J=7.4 Hz, 2H), 1.76

– 1.62 (m, 4H), 1.48 – 1.39 (m, 2H), 0.92 (t, J=7.1 Hz, 3H);

¹³C NMR (125 MHz, CDCl₃) δ 174.0, 167.4, 161.2, 158.0,

152.6, 135.3, 131.8, 129.5, 123.7, 117.9, 116.2, 88.7, 61.2,

51.5, 41.2, 33.9, 29.1, 26.3, 24.5, 24.1, 13.6; HRMS (ESI+,

[M+H]⁺) calculated for [C₂₃H₂₇BrN₃O₄]⁺: 488.1179, found

488.1183.

Ethyl 5‑cyano‑6‑((6‑methoxy‑6‑oxohexyl)amino)‑2‑me‑

thyl‑4‑(4‑nitrophenyl)nicotinate (13b)

Brown solid; yield: 84%; mp: 90–91 °C; ¹H NMR

(500 MHz, CDCl₃) δ 8.32 (d, J = 8.7 Hz, 2H), 7.51 (d,

J=8.7 Hz, 2H), 5.53 (t, J=5.4 Hz, 1H), 3.96 (q, J=7.1 Hz,

2H), 3.68 (s, 3H), 3.60 (q, J = 6.9 Hz, 2H), 2.58 (s, 3H),

2.35 (t, J=7.5 Hz, 2H), 1.76 – 1.60 (m, 4H), 1.51 – 1.36 (m,

2H), 0.91 (t, J=7.1 Hz, 3H); ¹³C NMR (125 MHz, CDCl₃)

δ 174.0, 166.8, 162.0, 157.8, 151.7, 148.2, 143.1, 129.1,

123.7, 117.2, 115.7, 88.5, 61.3, 51.6, 41.2, 33.9, 29.0, 26.3,

24.5, 24.4, 13.6; HRMS (ESI+ , [M + H]⁺) calculated for

[C₂₃H₂₇N₄O₆]⁺: 455.1925, found 455.1927.

Ethyl 4‑(4‑chlorophenyl)‑5‑cyano‑6‑((6‑methoxy‑6‑ox‑

ohexyl)amino)‑2‑methylnicotinate (13f)

White solid; yield: 87%; mp: 78–79°C; ¹H NMR (500 MHz,

CDCl₃) δ 7.42 (d, J=8.3 Hz, 2H), 7.27 (d, J=8.4 Hz, 2H),

5.47 (bs, 1H), 3.97 (q, J=7.1 Hz, 2H), 3.68 (s, 3H), 3.57 (q,

J=6.7 Hz, 2H), 2.53 (s, 3H), 2.35 (t, J=7.4 Hz, 2H), 1.74

– 1.62 (m, 4H), 1.49 – 1.38 (m, 2H), 0.92 (t, J=7.1 Hz, 3H);

¹³C NMR (125 MHz, CDCl₃) δ 174.0, 167.4, 161.1, 158.0,

152.5, 135.4, 134.8, 129.3, 128.8, 118.0, 116.1, 88.7, 61.2,

51.5, 41.2, 33.9, 29.1, 26.3, 24.5, 24.1, 13.6; HRMS (ESI+,

[M+H]⁺) calculated for [C₂₃H₂₇ClN₃O₄]⁺: 444.1685, found

444.1685.

Ethyl 5‑cyano‑6‑((6‑methoxy‑6‑oxohexyl)amino)‑2‑me‑

thyl‑4‑(3‑nitrophenyl)nicotinate (13c)

White solid; yield: 91%; mp: 81–82 °C; ¹H NMR (500 MHz,

CDCl₃) δ 8.41 – 8.25 (m, 1H), 8.21 (s, 1H), 7.70 – 7.60

1 3

DARU Journal of Pharmaceutical Sciences

Ethyl 5‑cyano‑6‑((6‑methoxy‑6‑oxohexyl)

amino)‑4‑(4‑methoxyphenyl)‑2‑methylnicotinate (13g)

1.48 – 1.39 (m, 2H), 1.03 (t, J = 7.1 Hz, 3H); ¹³C NMR

(125 MHz, CDCl₃) δ 174.0, 167.7, 160.5, 158.1, 145.9,

135.8, 128.9, 128.1, 127.4, 118.9, 116.4, 89.0, 61.4, 51.5,

41.2, 33.9, 29.1, 26.3, 24.5, 23.9, 13.7; HRMS (ESI + ,

[M + H]⁺) calculated for [C₂₁H₂₆N₃O₄S]⁺: 416.1639,

found 416.1642.

Pale yellow; yield: 85%; mp: 96–97 °C; ¹H NMR

(500 MHz, CDCl₃) δ 7.28 (d, J = 8.4 Hz, 2H), 6.95

(d, J = 8.4 Hz, 2H), 5.43 (bs, 1H), 3.98 (q, J = 7.0 Hz,

2H), 3.83 (s, 3H), 3.67 (s,3H), 3.57 (q, J = 6.4 Hz, 2H),

2.51 (s, 3H), 2.34 (t, J = 7.4 Hz, 2H), 1.76 – 1.61 (m,

4H), 1.46 – 1.41 (m, 2H), 0.93 (t, J = 7.1 Hz, 3H); ¹³C

NMR (125 MHz, CDCl₃) δ 174.0, 168.0, 160.4, 160.3,

158.1, 153.4, 129.3, 128.5, 118.5, 116.7, 113.9, 88.9,

61.1, 55.3, 51.5, 41.1, 33.9, 29.1, 26.3, 24.5, 23.9, 13.7;

HRMS (ESI + , [M + H]⁺) calculated for [C₂₄H₃₀N₃O₅]⁺:

440.2180, found 440.2186.

Ethyl 5‑cyano‑4‑(furan‑2‑yl)‑6‑((6‑methoxy‑6‑oxohexyl)

amino)‑2‑methylnicotinate (13k)

1

White solid; yield: 87%; mp: 105–106 °C; H NMR

(500 MHz, CDCl₃) δ 7.54 (s, 1H), 7.11 (d, J=3.4 Hz, 1H),

6.56 (dd, J=3.2, 1.6 Hz, 1H), 5.43 (t, J=5.1 Hz, 1H), 4.24

(q, J=7.1 Hz, 2H), 3.68 (s, 3H), 3.56 (q, J=6.8 Hz, 2H),

2.49 (s, 3H), 2.34 (t, J=7.5 Hz, 2H), 1.74 – 1.61 (m,4H),

1.47 – 1.38 (m, 2H), 1.20 (t, J = 7.1 Hz, 3H); ¹³C NMR

(125 MHz, CDCl₃) δ 174.0, 168.2, 160.6, 158.4, 147.5,

144.2, 139.9, 116.9, 115.8, 113.7, 112.2, 84.8, 61.5, 51.5,

41.2, 33.9, 29.1, 26.3, 24.5, 23.8, 14.0; HRMS (ESI + ,

[M + 1]⁺) calculated for [C₂₁H₂₆N₃O₅]⁺: 400.1867, found

400.1875.

Ethyl 4‑(3‑chlorophenyl)‑5‑cyano‑6‑((6‑methoxy‑6‑ox‑

ohexyl)amino)‑2‑methylnicotinate (13h)

White solid; yield: 91%; mp: 86–87 °C; ¹H NMR

(500 MHz, CDCl₃) δ 7.43 – 7.37 (m, 2H), 7.31 (s, 1H),

7.22 (d, J = 7.4 Hz, 1H), 5.47 (t, J = 5.4 Hz, 1H), 3.98 (q,

J = 7.1 Hz, 2H), 3.68 (s, 3H), 3.58 (q, J = 6.8 Hz, 2H),

2.54 (s, 3H), 2.35 (t, J = 7.5 Hz, 2H), 1.73 – 1.64(m, 4H),

1.47 – 1.39 (m, 2H), 0.91 (t, J = 7.1 Hz, 3H); ¹³C NMR

(125 MHz, CDCl₃) δ 174.0, 167.2, 161.3, 157.9, 152.2,

138.1, 134.5, 129.8, 129.3, 128.0, 126.2, 117.9, 116.0,

88.7, 61.2, 51.5, 41.2, 33.9, 29.1, 26.3, 24.5, 24.2, 13.5;

HRMS (ESI+, [M+H]⁺) calculated for [C₂₃H₂₇ClN₃O₄]⁺:

444.1685, found 444.1683.

General procedure for the synthesis

6‑((4‑(aryl)‑3‑cyano‑5‑(ethoxycarbonyl)‑6‑methyl‑

pyridin‑2‑yl)amino)hexanoic acid (14a‑k)

A mixture of 13a-k derivative (1 mmol), lithium hydrox-

ide (6 mmol), and 3 mL of mixture Water/THF (2:1) was

added. The solution was stirring at room temperature for

12 h. After the reaction was fnished monitored by TLC.

The mixture was acidifed with 2 M HCl, subsequently

diluted with distilled water, and extracted with CH₂Cl₂

(3 × 10 mL). All the organic layers were combined, dried

(anhydrous Na₂SO₄), and the solvent evaporated to give

the product pure 14a-k.

Ethyl 5‑cyano‑4‑(2,4‑dichlorophenyl)‑6‑((6‑methoxy‑6‑ox‑

ohexyl)amino)‑2‑methylnicotinate (13i)

White solid; yield: 78%; mp: 79–80 °C; ¹H NMR (500 MHz,

CDCl₃) δ 7.50 (d, J=1.9 Hz, 1H), 7.32 (dd, J=8.2, 2.0 Hz,

1H), 7.13 (d, J = 8.2 Hz, 1H), 5.43 (t, J = 5.3 Hz, 1H),

4.03 – 3.93 (m, 2H), 3.68 (s, 3H), 3.66 – 3.54 (m, 2H),

2.61 (s, 3H), 2.35 (t, J=7.4 Hz, 2H), 1.76 – 1.62 (m, 4H),

1.49 – 1.38 (m, 2H), 0.93 (t, J = 7.1 Hz, 3H); ¹³C NMR

(125 MHz, CDCl₃) δ 174.0, 166.3, 162.8, 157.7, 151.1,

135.6, 134.5, 133.3, 130.3, 129.6, 127.2, 117.1, 115.4,

89.8, 61.1, 51.6, 41.2, 33.9, 29.1, 26.3, 24.9, 24.5, 13.5;

HRMS (ESI+, [M+H]⁺) calculated for [C₂₃H₂₆Cl₂N₃O₄]⁺:

478.1295, found 478.1292.

6‑((3‑cyano‑5‑(ethoxycarbonyl)‑6‑methyl‑4‑phenylpyri‑

din‑2‑yl)amino)hexanoic acid (14a)

1

White solid; yield: 92%; mp: 128–129 °C; H NMR

(500 MHz, CDCl₃) δ 7.44 – 7.42 (m, 3H), 7.33 – 7.31

(m, 2H), 5.49 (bs, 1H), 3.92 (q, J = 7.1 Hz, 2H), 3.58 (q,

J = 6.5 Hz, 2H), 2.53 (s, 3H), 2.39 (t, J = 7.3 Hz, 2H),

1.77 – 1.63 (m, 4H), 1.51 – 1.41 (m, 2H), 0.88 – 0.83 (t,

J = 7.0 Hz, 3H); ¹³C NMR (125 MHz, CDCl₃) δ 179.3,

167.7, 160.8, 158.0, 153.9, 136.4, 129.2, 128.5, 127.9, 118.2,

116.4, 88.9, 61.1, 41.2, 33.8, 29.1, 26.2, 24.3, 24.0, 13.5;

HRMS (ESI + , [M + H]⁺) calculated for [C₂₂H₂₆N₃O₄]⁺:

396.1918, found 396.1899.

Ethyl 5‑cyano‑6‑((6‑methoxy‑6‑oxohexyl)amino)‑2‑me‑

thyl‑4‑(thiophen‑2‑yl)nicotinate (13j)

White solid; yield: 83%; mp: 73–74 °C; ¹H NMR

(500 MHz, CDCl₃) δ 7.47 (d, J = 4.9 Hz, 1H), 7.22 (d,

J = 3.0 Hz, 1H), 7.12 – 7.09 (m, 1H), 5.44 (bs, 1H), 4.06

(q, J = 7.1 Hz, 2H), 3.68 (s, 3H), 3.57 (q, J = 6.7 Hz, 2H),

2.50 (s, 3H), 2.34 (t, J = 7.5 Hz, 2H), 1.75 – 1.62 (m, 4H),

1 3

DARU Journal of Pharmaceutical Sciences

6‑((3‑cyano‑5‑(ethoxycarbonyl)‑6‑methyl‑4‑(4‑nitrophenyl)

pyridin‑2‑yl)amino)hexanoic acid (14b)

2H), 0.92 (t, J=7.1 Hz, 3H); ¹³C NMR (125 MHz, CDCl₃)

δ 179.3, 167.4, 161.2, 158.0, 152.6, 135.3, 131.8, 129.6,

123.7, 117.9, 116.2, 88.7, 61.3, 41.1, 33.8, 29.1, 26.2,

24.2, 24.1, 13.6; HRMS (ESI+ , [M + H]⁺) calculated for

[C₂₂H₂₅BrN₃O₄]⁺: 474.1023, found 474.0955.

1

Brown solid; yield: 89%; mp: 135–136 °C; H NMR

(500 MHz, CDCl₃) δ 8.32 (d, J = 8.6 Hz, 2H), 7.51 (d,

J=8.6 Hz, 2H), 5.52 (t, J=5.1 Hz, 1H), 3.96 (q, J=7.1 Hz,

2H), 3.61 (q, J=6.7 Hz, 2H), 2.57 (s, 3H), 2.40 (t, J=7.3 Hz,

2H), 2.17 (s, 1H), 1.75 – 1.66 (m, 4H), 1.50 – 1.44 (m,

2H), 0.91 (t, J=7.1 Hz, 3H); ¹³C NMR (125 MHz, CDCl₃)

δ 179.1, 166.8, 162.0, 157.8, 151.7, 148.2, 143.0, 129.2,

123.7, 117.3, 115.7, 88.5, 61.3, 41.2, 33.7, 29.0, 26.2,

24.4, 24.2, 13.6; HRMS (ESI+ , [M + H]⁺) calculated for

[C₂₂H₂₅N₄O₆]⁺: 441.1769, found 441.1700.

6‑((4‑(4‑chlorophenyl)‑3‑cyano‑5‑(ethoxycarbonyl)‑6‑meth‑

ylpyridin‑2‑yl)amino)hexanoic acid (14f)

1

White solid; yield: 88%; mp: 124–125 °C; H NMR

(500 MHz, CDCl₃) δ 7.42 (d, J = 8.2 Hz, 2H), 7.27

(d, J = 8.2 Hz, 2H), 5.49 (t, J = 5.1 Hz, 1H), 3.97 (q,

J=7.1 Hz, 2H), 3.58 (q, J=6.6 Hz, 1H), 2.53 (s, 3H), 2.39

(t, J = 7.4 Hz, 2H), 1.86 – 1.59 (m, 4H), 1.59 – 1.36 (m,

2H), 0.92 (t, J=7.1 Hz, 3H); ¹³C NMR (125 MHz, CDCl₃)

δ 179.4, 167.4, 161.1, 158.0, 152.6, 135.5, 134.8, 129.3,

128.8, 118.0, 116.2, 88.7, 61.2, 41.2, 33.8, 29.1, 26.2,

24.3, 24.1, 13.6; HRMS (ESI+ , [M + H]⁺) calculated for

[C₂₂H₂₅ClN₃O₄]⁺: 430.1528, found 430.1467.

6‑((3‑cyano‑5‑(ethoxycarbonyl)‑6‑methyl‑4‑(3‑nitrophenyl)

pyridin‑2‑yl)amino)hexanoic acid (14c)

Pale yellow solid; yield: 97%; mp: 120–121 °C; ¹H NMR

(500 MHz, CDCl₃) δ 8.33 – 8.31 (m, 1H), 8.21 (s, 1H),

7.70 – 7.63 (m, 2H), 5.55 (t, J = 5.4 Hz, 1H), 3.98 (q,

J = 7.1 Hz, 2H), 3.61 (q, J = 6.7 Hz, 2H), 2.57 (s, 3H),

2.40 (t, J=7.4 Hz, 2H), 2.18 (s, 1H), 1.76 – 1.65 (m, 4H),

1.52 – 1.42 (m, 2H), 0.93 (t, J = 7.1 Hz, 3H); ¹³C NMR

(125 MHz, CDCl₃) δ 179.0, 166.8, 162.0, 157.9, 151.4,

148.1, 138.1, 134.0, 129.7, 124.0, 123.2, 117.6, 115.7, 88.7,

61.3, 41.2, 33.7, 29.0, 26.2, 24.5, 24.2, 13.6; HRMS (ESI+,

[M+H]⁺) calculated for [C₂₂H₂₅N₄O₆]⁺: 441.1769, found

441.1704.

6‑((3‑cyano‑5‑(ethoxycarbonyl)‑4‑(4‑methoxyphenyl)‑6‑

methylpyridin‑2‑yl)amino)hexanoic acid (14g)

1

White solid; yield: 84%; mp: 125–126 °C; H NMR

(500 MHz, CDCl₃) δ 7.28 (d, J = 8.6 Hz, 2H), 6.95 (d,

J = 8.6 Hz, 2H), 5.43 (s, 1H), 3.98 (q, J = 7.1 Hz, 2H),

3.84 (s, 3H), 3.57 (q, J = 6.6 Hz, 2H), 2.51 (s, 3H), 2.39

(t, J = 7.4 Hz, 2H), 1.79 – 1.60 (m, 4H), 1.52 – 1.40 (m,

2H), 0.93 (t, J=7.1 Hz, 3H); ¹³C NMR (125 MHz, CDCl₃)

δ 179.1, 168.0, 160.4, 160.4, 158.1, 153.4, 129.4, 128.5,

118.5, 116.7, 114.0, 88.9, 61.1, 55.3, 41.1, 33.8, 29.1, 26.2,

24.3, 24.0, 13.7; HRMS (ESI+ , [M + H]⁺) calculated for

[C₂₃H₂₈N₃O₅]⁺: 426.2023, found 426.1963.

6‑((3‑cyano‑5‑(ethoxycarbonyl)‑4‑(4‑fuorophenyl)‑6‑meth‑

ylpyridin‑2‑yl)amino)hexanoic acid (14d)

1

Brown solid; yield: 93%; mp: 119–120 °C; H NMR

(500 MHz, CDCl₃) δ 7.37 – 7.28 (m, 2H), 7.14 (t, J=8.5 Hz,

2H), 5.48 (bs, 1H), 3.96 (q, J = 7.1 Hz, 2H), 3.58 (q,

J=6.6 Hz, 2H), 2.53 (s, 3H), 2.39 (t, J=7.4 Hz, 2H), 1.76

– 1.62 (m, 4H), 1.49 – 1.43 (m, 2H), 0.92 (t, J = 7.1 Hz,

3H); ¹³C NMR (125 MHz, CDCl₃) δ 179.1, 167.6, 163.3

(d, J=249.4 Hz), 160.9, 158.0, 152.8, 132.3 (d, J=3.4 Hz),

129.9 (d, J=8.4 Hz), 118.3, 116.3, 115.7 (d, J=21.9 Hz),

88.9, 61.2, 41.2, 33.8, 29.1, 26.2, 24.3, 24.0, 13.6; HRMS

(ESI+, [M+H]⁺) calculated for [C₂₂H₂₅FN₃O₄]⁺: 414.1824,

found 414.1766.

6‑((4‑(3‑chlorophenyl)‑3‑cyano‑5‑(ethoxycarbonyl)‑6‑meth‑

ylpyridin‑2‑yl)amino)hexanoic acid (14h)

1

White solid; yield: 96%; mp: 128–129 °C; H NMR

(500 MHz, CDCl₃) δ 7.44 – 7.35 (m, 2H), 7.31 (s, 1H),

7.22 (d, J = 7.4 Hz, 1H), 5.50 (t, J = 5.4 Hz, 1H), 3.98 (q,

J=7.1 Hz, 2H), 3.59 (q, J=6.7 Hz, 2H), 2.54 (s, 3H), 2.39

(t, J = 7.4 Hz, 2H), 1.77 – 1.62 (m, 4H), 1.52 – 1.40 (m,

2H), 0.91 (t, J=7.1 Hz, 3H); ¹³C NMR (125 MHz, CDCl₃)

δ 179.1, 167.3, 161.3, 157.9, 152.2, 138.1, 134.5, 129.9,

129.3, 128.0, 126.2, 117.9, 116.0, 88.7, 61.2, 41.1, 33.8,

29.1, 26.2, 24.2, 24.2, 13.5; HRMS (ESI+, [M+H]⁺) cal-

culated for [C₂₂H₂₅ClN₃O₄]⁺: 430.1528, found 430.1473.

6‑((4‑(4‑bromophenyl)‑3‑cy‑

ano‑5‑(ethoxycarbonyl)‑6‑methylpyridin‑2‑yl)amino)

hexanoic acid (14e)

1

White solid; yield: 90%; mp: 127–128 °C; H NMR

6‑((3‑cyano‑4‑(2,4‑dichlorophenyl)‑5‑(ethoxycarbonyl)‑6‑

methylpyridin‑2‑yl)amino)hexanoic acid (14i)

(500 MHz, CDCl₃) δ 7.58 (d, J = 8.2 Hz, 2H), 7.20

(d, J = 8.2 Hz, 2H), 5.48 (t, J = 5.4 Hz, 1H), 3.97 (q,

J=7.1 Hz, 2H), 3.58 (q, J=6.6 Hz, 2H), 2.53 (s, 3H), 2.39

(t, J = 7.4 Hz, 2H), 1.75 – 1.63 (m, 4H), 1.51 – 1.41 (m,

1

White solid; yield: 86%; mp: 124–125 °C; H NMR

(500 MHz, CDCl₃) δ 7.50 (d, J = 1.6 Hz, 1H), 7.32 (dd,

1 3

DARU Journal of Pharmaceutical Sciences

J = 8.2, 1.6 Hz, 1H), 7.13 (d, J = 8.2 Hz, 1H), 5.51 (t,

J=5.4 Hz, 1H), 4.03 – 3.95 (m, 2H), 3.72 – 3.48 (m, 2H),

2.61 (s, 3H), 2.40 (t, J=7.4 Hz, 2H), 1.75 – 1.65 (m, 4H),

1.56 – 1.39 (m, 3H), 0.93 (t, J = 7.1 Hz, 3H); ¹³C NMR

(125 MHz, CDCl₃) δ 179.4, 166.3, 162.8, 157.7, 151.1,

135.6, 134.5, 133.3, 130.3, 129.6, 127.2, 117.1, 115.5, 89.8,

61.1, 41.2, 33.8, 29.1, 26.2, 24.9, 24.2, 13.5; HRMS (ESI+,

[M + H]⁺) calculated for [C₂₂H₂₄Cl₂N₃O₄]⁺: 464.1138,

found 464.1072.

Ethyl 5‑cyano‑6‑((6‑(hydroxyamino)‑6‑oxohexyl)

amino)‑2‑methyl‑4‑phenylnicotinate (15a)

1

White solid; yield: 84%; mp: 116–117 °C; H NMR

(500 MHz, CDCl₃) δ 8.81 (bs, 1H), 7.51 – 7.38 (m, 3H),

7.36 – 7.27 (m, 2H), 5.55 (s, 1H), 3.92 (q, J=7.1 Hz, 2H),

3.56 (m, 2H), 2.52 (s, 3H), 2.15 (d, J = 6.1 Hz, 2H), 1.74

– 1.59 (m, 4H), 1.47 – 1.36 (m, 2H), 1.26 (s, 1H), 0.83

(t, J=7.1 Hz, 3H); ¹³C NMR (125 MHz, CDCl₃) δ 171.5,

167.9, 161.0, 158.2, 154.0, 136.5, 129.3, 128.6, 128.0, 118.3,

116.6, 88.9, 61.2, 41.2, 32.8, 29.0, 26.2, 24.9, 24.2, 13.6;

HRMS (ESI+, [M+Na]⁺) calculated for [C₂₂H₂₆N₄O₄Na]⁺:

433.1846, found 433.1852.

6‑((3‑cyano‑5‑(ethoxycarbonyl)‑6‑methyl‑4‑(thiophen‑2‑yl)

pyridin‑2‑yl)amino)hexanoic acid (14j)

1

White solid; yield: 90%; mp: 117–118 °C; H NMR

Ethyl 5‑cyano‑6‑((6‑(hydroxyamino)‑6‑oxohexyl)

amino)‑2‑methyl‑4‑(4‑nitrophenyl)nicotinate (15b)

(500 MHz, CDCl₃) δ 7.47 (d, J = 5.0 Hz, 1H), 7.22 (d,

J=3.5 Hz, 1H), 7.11 (t, J=4.3 Hz, 1H), 5.46 (t, J=5.3 Hz,

1H), 4.07 (q, J = 7.1 Hz, 2H), 3.57 (q, J = 6.7 Hz, 2H),

2.50 (s, 3H), 2.39 (t, J=7.4 Hz, 2H), 1.77 – 1.61 (m, 4H),

1.55 – 1.37 (m, 2H), 1.03 (t, J = 7.1 Hz, 3H); ¹³C NMR

(125 MHz, CDCl₃) δ 179.0, 167.7, 160.5, 158.2, 146.0,

135.7, 128.9, 128.1, 127.4, 118.9, 116.4, 89.0, 61.5, 41.1,

33.7, 29.1, 26.2, 24.3, 23.9, 13.7; HRMS (ESI+, [M+H]⁺)

calculated for [C₂₀H₂₄N₃O₄S]⁺: 402.1482, found 402.1426.

Pale yellow solid; yield: 79%; mp: 134–135 °C; ¹H NMR

(500 MHz, CDCl₃) δ 8.23 (d, J = 8.4 Hz, 2H), 7.43 (d,

J=8.4 Hz, 2H), 5.66 (s, 1H), 3.88 (q, J=7.1 Hz, 2H), 3.49

(m, J=5.4 Hz, 2H), 2.48 (s, 3H), 2.08 (s, 1H), 1.67 – 1.52

(m, 4H), 1.32 (s, 2H), 1.18 (s, 1H), 0.82 (t, J=8.1 Hz, 3H);

¹³C NMR (125 MHz, CDCl₃) δ 171.5, 166.9, 162.2, 158.0,

152.0, 148.3, 143.1, 129.3, 123.8, 117.3, 116.0, 88.4, 61.5,

41.2, 32.7, 28.9, 26.2, 24.9, 24.6, 13.7; HRMS (ESI + ,

[M + Na]⁺) calculated for [C₂₂H₂₅N₅O₆Na]⁺: 478.1697,

found 478.1700.

6‑((3‑cyano‑5‑(ethoxycarbonyl)‑4‑(furan‑2‑yl)‑6‑methyl‑

pyridin‑2‑yl)amino)hexanoic acid (14k)

1

Brown solid; yield: 95%; mp: 111–112 °C; H NMR

Ethyl 5‑cyano‑6‑((6‑(hydroxyamino)‑6‑oxohexyl)

amino)‑2‑methyl‑4‑(3‑nitrophenyl)nicotinate (15c)

(500 MHz, CDCl₃) δ 7.54 (d, J = 1.1 Hz, 1H), 7.11 (d,

J = 3.5 Hz, 1H), 6.56 (dd, J = 3.5, 1.8 Hz, 1H), 5.48 (t,

J=5.5 Hz, 1H), 4.24 (q, J=7.1 Hz, 2H), 3.56 (q, J=6.9 Hz,

2H), 2.49 (s, 3H), 2.39 (t, J=7.4 Hz, 2H), 1.79 – 1.61 (m,

4H), 1.56 – 1.37 (m, 2H), 1.20 (t, J=7.1 Hz, 3H); ¹³C NMR

(125 MHz, CDCl₃) δ 179.0, 168.2, 160.7, 158.5, 147.5,

144.2, 140.0, 117.0, 115.8, 113.7, 112.2, 84.7, 61.5, 41.2,

33.8, 29.1, 26.2, 24.3, 23.8, 14.0; HRMS (ESI+, [M+H]⁺)

calculated for [C₂₀H₂₄N₃O₅]⁺: 386.1710, found 386.1661.

White solid; yield: 83%; mp: 92–93 °C; ¹H NMR (500 MHz,

CDCl₃) δ 8.32 (dd, J=7.0, 2.2 Hz, 1H), 8.21 (s, 1H), 7.70

– 7.63 (m, 2H), 5.57 (s, 1H), 3.98 (q, J=7.1 Hz, 2H), 3.61

(q, J = 6.5 Hz, 2H), 2.57 (s, 3H), 2.20 (t, J= 7.0 Hz, 2H),

1.79 – 1.64 (m, 4H), 1.60 (s, 2H), 1.47 – 1.42 (m, 2H), 0.93

(t, J=7.1 Hz, 3H); ¹³C NMR (125 MHz, CDCl₃) δ 171.7,

167.0, 162.1, 158.0, 151.5, 148.1, 138.1, 134.2, 129.8,

124.1, 123.2, 117.5, 116.0, 88.6, 61.4, 41.2, 32.7, 28.8, 26.2,

24.9, 24.5, 13.7; HRMS (ESI+, [M+Na]⁺) calculated for

[C₂₂H₂₅N₅O₆Na]⁺: 478.1697, found 478.1706.

General procedure for the synthesis Ethyl

4‑(aryl)‑5‑cyano‑6‑((6‑(hydroxyamino)‑6‑oxohexyl)

amino)‑2‑methylnicotinate 15a‑k

Ethyl 5‑cyano‑4‑(4‑fuorophenyl)‑6‑((6‑(hydroxyamino)‑

6‑oxohexyl)amino)‑2‑methylnicotinate (15d)

A mixture of 14a-k derivative (1 mmol), 1.1´-carbonyl-

diimidazole (1.5 mmol), N,N-dimethylpyridin-4-amine

(0.1 mmol), hydroxylamine hydrochloride (1.5 mmol) and

dichloromethane 3 mL was added. The solution was stir-

ring at room temperature for 12 h. After the reaction was

fnished monitored by TLC. The mixture was acidifed with

2 M HCl, diluted with distilled water, and extracted with

CH₂Cl₂(3×10 mL). All the organic layers were combined,

dried (anhydrous Na₂SO₄), and the solvent evaporated to

give the product pure 15a-k.

White solid; yield: 80%; mp: 95–96 °C; ¹H NMR (500 MHz,

CDCl₃) δ 8.77 (bs, 1H), 7.34 – 7.28 (m, 2H), 7.13 (t, J=8.4 Hz,

2H), 5.53 (s, 1H), 3.96 (q, J=7.1 Hz, 2H), 3.56 (s, 2H), 2.52

(s, 3H), 2.16 (s, 2H), 1.70 – 1.65 (m, 4H), 1.41 (s, 2H), 1.26

(s, 1H), 0.91 (t, J=7.1 Hz, 3H); ¹³C NMR (125 MHz, CDCl₃)

δ 171.4, 167.6, 163.3 (d, J=249.4 Hz), 161.0, 158.0, 152.8,

132.3 (d, J=3.5 Hz), 129.9 (d, J=8.4 Hz), 118.3, 116.4,

115.7 (d, J=21.9 Hz), 88.8, 61.2, 41.0, 32.7, 28.9, 26.1,

1 3

DARU Journal of Pharmaceutical Sciences

24.8, 24.1, 13.6; HRMS (ESI+, [M+Na]⁺) calculated for

[C₂₂H₂₅FN₄O₄Na]⁺: 451.1752, found 451.1752.

7.23 (t, J=1.7 Hz, 1H), 7.14 (dt, J=7.3, 1.3 Hz, 1H), 5.54 (t,

J=5.2 Hz, 1H), 3.90 (q, J=7.1 Hz, 3H), 3.48 (q, J=6.5 Hz,

2H), 2.46 (s, 3H), 2.17 – 2.03 (m, 2H), 1.64 – 1.54 (m, 4H),

1.33 (d, J=6.8 Hz, 2H), 0.83 (t, J=7.1 Hz, 3H); ¹³C NMR

(125 MHz, CDCl₃) δ 171.5, 167.4, 161.5, 158.1, 152.4,

138.2, 134.6, 130.0, 129.4, 128.1, 126.3, 117.9, 116.3, 88.7,

61.4, 41.2, 32.8, 31.1, 29.0, 26.2, 25.0, 24.3, 13.7; HRMS

(ESI + , [M + Na]⁺) calculated for [C₂₂H₂₅ClN₄O₄Na]⁺:

467.1457, found 467.1473.

Ethyl 4‑(4‑bromophenyl)‑5‑cy‑

ano‑6‑((6‑(hydroxyamino)‑6‑oxohexyl)amino)‑2‑methylni‑

cotinate (15e)

1

White solid; yield: 81%; mp: 137–138 °C; H NMR

(500 MHz, CDCl₃) δ 8.37 (bs, 2H), 7.58 (d, J = 8.2 Hz,

2H), 7.20 (d, J = 8.2 Hz, 2H), 5.50 (s, 1H), 3.97 (q,

J = 7.1 Hz, 2H), 3.59 – 3.58 (m, 2H), 2.53 (s, 3H), 2.17

(d, J = 6.4 Hz, 2H), 1.84 – 1.52 (m, 5H), 1.44 – 1.41 (m,

2H), 0.92 (t, J=7.1 Hz, 3H); ¹³C NMR (126 MHz, CDCl₃)

δ 170.5, 166.4, 160.2, 157.0, 151.7, 134.2, 130.7, 128.5,

122.7, 116.8, 115.3, 87.5, 60.3, 40.1, 31.6, 27.9, 25.1,

23.8, 23.1, 12.5; HRMS (ESI+, [M+Na]⁺) calculated for

[C₂₂H₂₅BrN₄O₄Na]⁺: 511.0951, found 511.0965.

Ethyl 5‑cyano‑4‑(2,4‑dichlorophenyl)‑6‑((6‑(hydroxyamino)

‑6‑oxohexyl)amino)‑2‑methylnicotinate (15i)

1

White solid, yield: 80%; mp: 109–110 °C; H NMR

(500 MHz, CDCl₃) δ 8.80 (bs, 1H), 7.40 (s, 1H), 7.22 (d,

J=8.2 Hz, 1H), 7.03 (d, J=8.2 Hz, 1H), 5.41 (d, J=4.7 Hz,

1H), 3.90 – 3.86 (m, 2H), 3.52 – 3.46 (m, 2H), 2.58 (s, 3H),

2.30 (t, J=7.3 Hz, 2H), 1.63 – 1.55 (m, 4H), 1.39 1.35 (m,

2H), 0.83 (t, J=7.1 Hz, 3H); ¹³C NMR (125 MHz, CDCl₃)

δ 171.5, 165.3, 161.8, 156.7, 150.1, 134.6, 133.5, 132.3,

129.3, 128.6, 126.8, 116.1, 114.5, 88.8, 60.3, 40.2, 32.6,

28.0, 25.2, 23.9, 23.2, 12.5; HRMS (ESI+, [M+H]⁺) cal-

culated for [C₂₂H₂₅Cl₂N₄O₄]⁺: 479.1247, found 479.1182.

Ethyl 4‑(4‑chlorophenyl)‑5‑cy‑

ano‑6‑((6‑(hydroxyamino)‑6‑oxohexyl)amino)‑2‑methylni‑

cotinate (15f)

1

White solid; yield: 78%; mp: 126–127 °C; H NMR

(500 MHz, CDCl₃) δ 8.31 (bs, 2H), 7.43 (t, J = 8.5 Hz,

2H), 7.29 – 7.26 (m, 2H), 5.50 (s, 1H), 3.97 (q, J=7.2 Hz,

2H), 3.58 (s, 2H), 2.53 (s, 3H), 2.19 (s, 2H), 1.82 – 1.51

Ethyl 5‑cyano‑6‑((6‑(hydroxyamino)‑6‑oxohexyl)

amino)‑2‑methyl‑4‑(thiophen‑2‑yl)nicotinate (15j)

(m, 5H), 1.44 – 1.42 (m, 2H), 0.93 (t, J=7.8 Hz, 3H); ¹³

C

NMR (125 MHz, CDCl₃) δ 171.7, 170.2, 167.6, 163.9,

161.3, 159.8, 158.1, 154.7, 152.8, 135.6, 134.9, 129.4,

128.9, 118.0, 116.4, 88.7, 61.4, 41.2, 32.8, 29.0, 26.2,

25.0, 24.2, 13.7; HRMS (ESI+, [M+Na]⁺) calculated for

[C₂₂H₂₅ClN₄O₄Na]⁺: 467.1457, found 467.1468.

White solid; yield: 79%; mp: 95–96 °C; ¹H NMR (500 MHz,

CDCl₃) δ 8.80 (bs, 1H), 7.47 (d, J= 4.8 Hz, 1H), 7.22 (d,

J = 2.8 Hz, 1H), 7.16 – 7.06 (m, 1H), 5.56 (s, 1H), 4.06

(q, J=7.1 Hz, 2H), 3.55 (d, J=5.5 Hz, 2H), 2.49 (s, 3H),

2.16 (s, 2H), 1.81 – 1.52 (m, 4H), 1.40 (s, 2H), 1.26 (s,

1H), 1.02 (t, J=7.1 Hz, 3H); ¹³C NMR (125 MHz, CDCl₃)

δ 171.4, 167.8, 160.6, 158.2, 146.0, 135.7, 128.9, 128.2,

127.5, 118.8, 116.5, 88.9, 61.5, 41.1, 32.7, 28.9, 26.1,

24.8, 24.0, 13.7; HRMS (ESI+, [M+Na]⁺) calculated for

[C₂₀H₂₄N₄O₄SNa]⁺: 439.1410, found 439.1431.

Ethyl 5‑cyano‑6‑((6‑(hydroxyamino)‑6‑oxohexyl)

amino)‑4‑(4‑methoxyphenyl)‑2‑methylnicotinate (15g)

White solid; yield: 76%; mp: 90–91 °C; ¹H NMR (500 MHz,

CDCl₃) δ 8.69 (bs, 1H), 7.27 (d, J= 7.7 Hz, 2H), 6.95 (d,

J = 7.8 Hz, 2H), 5.48 (s, 1H), 3.98 (q, J = 6.8 Hz, 2H),

3.84 (s, 3H), 3.56 (d, J = 4.2 Hz, 2H), 2.50 (s, 3H), 2.16

(s, 2H), 1.70 – 1.64 (m, 5H), 1.41 (s, 2H), 1.26 (s, 1H),

0.93 (t, J = 6.6 Hz, 3H); ¹³C NMR (125 MHz, CDCl₃) δ

171.4, 168.2, 160.6, 160.6, 158.3, 153.6, 129.5, 128.6,

118.6, 117.0, 114.1, 88.9, 61.3, 55.5, 41.1, 32.8, 29.1, 26.2,

24.9, 24.1, 13.8; HRMS (ESI+, [M+Na]⁺) calculated for

[C₂₃H₂₇N₄O₅Na]⁺: 463.1952, found 463.1966.

Ethyl 5‑cyano‑4‑(furan‑2‑yl)‑6‑((6‑(hydroxyamino)‑6‑ox‑

ohexyl)amino)‑2‑methylnicotinate (15k)

1

Brown solid; yield: 75%; mp: 123–124 °C; H NMR

(500 MHz, CDCl₃) δ 8.52 (bs, 1H), 7.46 (d, J=1.4 Hz, 1H),

7.03 (d, J=3.5 Hz, 1H), 6.49 (dd, J=3.5, 1.8 Hz, 1H), 5.45

(s, 1H), 4.17 (q, J=7.1 Hz, 2H), 3.48 (q, J=6.5 Hz, 2H),

2.41 (s, 3H), 2.10 (s, 1H), 1.72 – 1.51 (m, 5H), 1.35 – 1.33

(m, 2H), 1.19 (s, 1H), 1.13 (t, J = 7.1 Hz, 3H); ¹³C NMR

(125 MHz, CDCl₃) δ 171.4, 168.4, 160.9, 158.6, 147.6,

144.4, 140.1, 117.2, 116.0, 113.9, 112.3, 84.8, 61.7, 41.2,

32.8, 29.1, 26.2, 24.9, 23.9, 14.2; HRMS (ESI+, [M+Na]⁺)

calculated for [C₂₀H₂₄N₄O₅Na]⁺: 423.1639, found 423.1639.

Ethyl 4‑(3‑chlorophenyl)‑5‑cy‑

ano‑6‑((6‑(hydroxyamino)‑6‑oxohexyl)amino)‑2‑methylni‑

cotinate (15h)

1

White solid; yield: 84%; mp: 111–112 °C; H NMR

(500 MHz, CDCl₃) δ 8.37 (bs, 1H), 7.36 – 7.28 (m, 2H),

1 3

DARU Journal of Pharmaceutical Sciences

GTGC; CDKN1A -R, GGCGTTTGGAGTGGTAGAAA;

p53 (TP53)-F, GTCCCAAGCAATGGATGATT; and TP53-

R, TCTGGACCTGGGTCTTCAGT. The gene expression

of the housekeeping gene, glyceraldehyde-3-phosphate

dehydrogenase (GAPDH), was used as an internal control.

It was AGCCACATCGCTGAGACAC for GAPDH-F and

GCCCAATACGACCAAATCC for GAPDH-R.

Cell culture

Breast (BT-474, MDA-MB-231) and prostate (PC3) can-

cer cell lines were obtained from American Type Culture

Collection (ATCC, Manassas, VA, USA). The cells were

cultured and maintained according to the indications of the

supplier. Cell cultures were kept and maintained in a humidi-

fed atmosphere with 5% CO₂at 37 °C.

Statistical analysis

Proliferation studies

Data are expressed as mean standard deviation (S.D.).

Statistical analysis was done using one-way ANOVA, and

all pairwise multiple comparisons were determined by the

Holm-Sidak method on a specialized software package (Sig-

maStat Version 3.5, Jandel Scientifc Systat Software, Inc.,

Richmond, VA, USA).

The diferent compounds ability to inhibit cell prolifera-

tion was studied by the sulphorhodamine (SRB) assay. The

cells were seeded in 96-well culture plates at a density of

3000 cells/well and treated in the present of DMSO, at dif-

ferent concentrations (0.1–10 µM) of compounds 15a–k

or SAHA. The treated cells were incubated for 72–144 h

(depending on the cell line) at 37 °C in a humid environment

with 95% air and 5% CO₂. Cell proliferation was determined

by using the SRB assay [31]. Briefy, the cells were fxed

with 10% trichloroacetic acid at 4 °C for 1 h. The plates

were then washed with tap water and air-dried. The cells

were stained for 1 h with 0.4% SRB dissolved in 1% acetic

acid. To remove the unbound stain, plates were washed four

times with 1% acetic acid and air-dried. The bound protein

stain was solubilized with 10 mM of unbufered tris base

[tris(hydroxymethyl) aminomethane]. Absorbance was

determined at 492 nm in a microplate reader (BioTek, Win-

ooski, VT, USA). All biological assays were performed in

triplicate. The concentrations that caused 50% cell growth

inhibition (IC₅₀) were obtained by non-linear regression

analysis using sigmoidal ftting with a dose–response curve,

with initial and fnal values fxed through a scientifc graph-

ing software (OriginPro 8, OriginLab Corporation, North-

ampton MA).

Computational methodology

The set of ligands (tested molecules: 15a, 15c, 15 g, 15j, and

15 k) were previously built and optimized with the semiem-

pirical PM6 method using Gaussian 09 [32]. The optimized

geometries were exported to pdb format f les to be used with

the docking software. All fexible bonds were set free to

proceed with the fexible computational experiments.

The crystal structures of human HDAC1, 6, and 8 were

obtained from the protein data bank (PDB codes 6Z2J,

5EDU, and 1T69, respectively) [33–35]. The former was

acquired co-crystallized with hexakisphosphate, HDAC6

was obtained in a complex with Trichostatin A (TSA), and

HDAC8 was obtained co-crystallized with suberoylanilide

hydroxamic acid (SAHA). Hexakisphosphate, TSA, and

SAHA were used to validate the parameters of the Docking

experiments. With this regard, molecular docking was per-

formed of each HDACs with the respective co-crystalized

ligands. The root-mean-square deviations (RMSD) found

were: 2.00 Å for inositol hexakisphosphate on HDAC1, 1.16

Å for TSA on HDAC6, and 1.51 Å for SAHA on HDAC8.

Molecular docking was carried out on the AUTODOCK

4.2 software suite. For all calculations, we have used the

Lamarckian Genetic Algorithm search function with 10

runs, 2,500,000 number of evaluations, a maximum number

of generations of 27,000, a maximum population size of 10

individuals, a maximum initial energy for pose generation of

0.010000 kcal/mol, and a neighbor distance factor of 1.00 Å.

Real time RT‑PCR

For gene expression analysis, the cells were incubated in

the absence or presence of 10 µM of 15a, 15c, 15j, 15k,

and SAHA for 24 h. After treatment, the cells were har-

vested, and total RNA was extracted using Trizol® reagent

(Life Technologies). For the cDNA synthesis, a commer-

cial kit was used (Transcriptor First-Strand cDNA Synthe-

sis, Roche). RT-PCR was carried out on a LightCycler 2.0

instrument from Roche (Roche Diagnostics, Mannheim,

Germany) according to the following protocol: activation

of Taq DNA polymerase and DNA denaturing at 95 °C for

10 min, then 45 amplifcation cycles consisting of 10 s at

95 °C, 30 s at 60 °C, and 1 s at 72 °C. The oligonucleo-

tides employed were cyclin D1 (CCND1)-F, GAAGAT

CGTCGCCACCTG; CCND1-R, GACCTCCTCCTCGCA

CTTCT; p21 (CDKN1A)-F, TCACTGTCTTGTACCCTT

Result and Discussion

Chemistry

As a strategy to analyze the behavior of substituents into

pyridine moiety, we envisioned using the same linker

1 3

DARU Journal of Pharmaceutical Sciences

and ZBG groups because previously, the efect of these

moieties was reported [27, 28]. The synthetic procedures

adopted to obtain the targ et compounds are depicted in

Scheme 1. Using previously reported methodologies

2-pyridones derivatives 10a-k were obt ained by MCR

procedure in good yields (87–92%) [29, 30]. Thus, lat-

ter compounds (10a-k) underwent to chlor ination process

through excess phosphorus oxychloride and N,N-dimethy-

laniline as a base to produce the compounds (11a-k) [36],

the structures were con frmed by spectroscopy analysis

and X-ray studies (Fig. 2). The structure for 11i is shown;

the ORTEP diagram analysis was carried out where the

dihedral angle between the pyridine nucleus and the aro-

matic ring at position 4 is 62.02°, while the length of C–Cl

bond is 1.73 Å. The next step was to analyze the reactivity

between 11a-k and amine 12; previous reports show that to

af ord this reaction, it is necessary to use transition metals

[37]. However, this reaction was performed without the

use of metals, and the best reaction conditions were micro-

wave-heating at 140 °C in TEA and ethanol as solvent

to aford 13a-k by nucleophilic aromatic substitution in

good yields (78–90%). The structures were elucidated by

NMR and HRMS; in all NMR spectra, it was possible to

observe a triplet signal between 5.3 and 5.5 ppm showing a

corresponding hydrogen NH bond; all compounds showed

characteristic signals according to their identity. As a later

stride, hydrolysis of the methyl ester group in the com-

pounds 13a-k was performed using saponifcation reac-

tion conditions, through lithium hydroxide in a mixture

THF/water and stirring 12 h in room temperature to give

the corresponding acids 14a-k in good yields (78–97%)

[38], the structures were confrmed by spectroscopy analy-

sis and X-ray studies of 14f (Fig. 2). Finally, the conver-

sion of carboxylic acids 14a-k to hydroxamic derivatives

15a-k was achieved through reaction with hydroxylamine

hydrochloride, 4-N,N-dimethylaminopyridine (DMAP),

and 1,1´-carbonyldiimidazole in dichloromethane as a

solvent, yielding the desired products 15a-k [39] in good

yields (75–84%), all compounds were elucidated by NMR

and HRMS.

Biological activity

Efects of compounds 15a‑k on cell proliferation

HDAC inhibitors include diverse compounds, which vary

in structure, biological activity, and specifcity. They afect

many biological processes, including cell cycle, DNA

repair, apoptosis, and gene expression alterations [41].

Consequently, HDAC inhibitors, such as SAHA, have been

emerging as drugs with potential cancer treatment applica-

tions [42].

SAHA has been considering as a potential therapeu-

tic agent for human breast cancer treatment. In fact, this

inhibitor suppresses cell proliferation of various cancer

cell lines, including human breast and prostate cancer cells

[15, 43–45]. Therefore, the latter two cancer cell lines were

emplo y ed to determine the possible antiproliferative activity

of compounds 15a-k. Breast (BT-474 and MDA-MB-231)

and prostate (PC3) cancer cells were incubated in the pres-

ence of diferent concentrations of the new synthesized com-

pounds or SAHA as a reference control. Most compounds

inhibited cancer cell proliferation in a dose-dependent man-

ner (Fig. 3). Based on the calculated IC₅₀values (Table 1),

the sensitivity of the cells to the compounds varied depend-

ing on the chemical structure of the compounds; although

in general, for most the IC₅₀value is in the range of 1–3 µM,

except for 15i, which did not modify cell growth and 15d

that showed few activities at 10 µM concentration in BT-474

and PC3 cells, whence its IC₅₀value cannot obtain. Even

SAHA holds the smallest value of the series, the displayed

IC₅₀values of the proposed molecules reach the µM scale,

which represents an excellent goal of an anticancer drug.

Fig. 2 The ORTED diagram for the X-ray resolved structure of 11i and 14f [40]

1 3

DARU Journal of Pharmaceutical Sciences

with non-treated cells, with diferent potencies among the

cell lines tested. The compounds 15a, 15c, 15j, and 15k, as

well as 15 g, 15j, and 15k, showed similar growth inhibi-

tor efects that SAHA on BT-474 and MDA-MB231 cells,

respectively. Notably, these compounds obtained lesser

IC₅₀values in each cell line. In the case of PC3 cells, the

15k compound exhibited an inhibitory efect comparable

to SAHA. Notably, the 15k compound exerted the greatest

antiproliferative activity in all cancer cell lines (Table 2).

Another compound with an important growth inhibitory

efect was 15j, being that it inhibits the proliferation of both

breast cancer cell lines similar to the reference control.

The structure–activity relationship was important in the

activity of the compounds. In this sense, in compounds 15k

and 15j, the addition of the furan and thiophene substitu-

ents at C4 of pyridine conferred relevant antiproliferative

properties since 15k showed the greatest antiproliferative

efect in the three cancer cell lines used in this study and

15j in the breast cancer lines. It is important since both com-

pounds can afect cell prolifer ation of cancer cell lines with

an aggressive phenotype [46, 47]. The C₆H₅, 3-NO₂C₆H₄,

4-OCH₃C₆H₄substituents at C4 of pyridine also confer

antiproliferative activity to compounds 15a, 15c, and 15g,

respectively, which was comparable to SAHA in breast can-

cer cells. In contrast, the addition of 2,4-Cl₂C₆H₄substituent

to compound 15i implied the total loss of the antiprolifera-

tive efect in the three cancer cell lines.

Efects of compounds 15a, 15c, 15j, and 15 k on the expres‑

sion of cell cycle regulatory genes

Considering that compounds 15a, 15c, 15j, and 15k have

antiproliferative properties like SAHA in BT-474 cells, we

evaluated their efects on mRNA expression of three genes

related to the cell cycle progression in this cell line. For

these experiments, the cells were cultured in the absence

or presence of the compounds or SAHA. The results dem-

onstrated that the compounds significantly upregulated

CDKN1A (p21) and downregulated CCND1 (cyclin D1)

and TP53 (p53) gene expression when compared to vehicle-

treated cells. Compound 15c did not modify mRNA expres-

sion levels of p21 (Fig. 4).

Overexpression and aberrant activity of HDACs are

critical in tumorigenesis by regulating the transcription of

genes essential for controlling normal cell growth and dif-

ferentiation. This has led to the development of many small

molecules with the capacity to interfere with HDAC activ-

ity, and therefore with potential application to cancer treat-

ment. SAHA has been the frst HDAC inhibitor approved

by the FDA to treat cutaneous T-cell lymphoma (CTCL),

and sev eral HDAC inhibitors are currently in clinical tri-

als [48, 49]. SAHA inhibits growth and induces cell cycle

arrest t hrough p21, p53, and cyclin D1 regulation in cancer

Fig. 3 Antiproliferative efect of new synthesized compounds on can-

cer cells. A BT-474, B MDA-MB-231, and C PC3 cancer cell lines

were incubated in the presence of diferent concentrations of com-

pounds 15a-k or SAHA for 3–6 days. Cell proliferation was evaluated

by the SRB assay. Results are shown as the mean S.D. of triplicate

determinations of three independent experiments. Data from vehicle-

treated cells (0) were normalized to 100%

Concerning growth inhibitory efects exerted by com-

pounds in cancer cells at 10 µM concentration, all com-

pounds signifcantly diminished cell proliferation compared

1 3

DARU Journal of Pharmaceutical Sciences

Table 1 IC₅₀values of new compounds on breast and prostate cancer cell proliferation

Compound

R

BT-474 (µM)

MDA-MB-231 (µM)

PC3 (µM)

SAHA

15a

15b

15c

15d

15e

15f

15g

15h

15i

0.55 0.01

2.93 0.54

2.49 0.46

2.06 0.37

-

3.35 0.47

2.46 0.47

2.90 0.30

2.87 0.44

-

0.55 0.12

1.85 0.46

1.74 0.37

1.90 0.28

2.07 0.77

2.52 0.19

1.89 0.32

1.75 0.82

2.76 0.33

-

0.88 0.09

2.20 0.49

2.03 0.44

1.93 0.37

-

1.84 1.22

2.08 1.29

2.29 0.69

3.11 0.78

-

C₆H₅-

4-NO₂C₆H₄-

3-NO₂C₆H₄

4-FC₆H₄

4-BrC₆H₄

4-ClC₆H₄

4-OCH₃C₆H₄

3-ClC₆H₄

2,4-Cl₂C₆H₃

2-C₅H₃S

15j

15k

3.11 1.44

2.92 1.46

1.39 0.89

1.78 0.36

1.64 0.06

2.29 0.33

2-C₅H₃O

Results are expressed as the mean S.D

cells [50–52]. In particular, in the MDA-MB-231 breast can-

cer cells (p53 mutated), SAHA treatment down-regulated

p53 and induced p21; and in MCF7 breast cancer cells, the

mRNA encoding cyclin D1 was diminished by treatment

with SAHA [44, 52]. Similar to these results, BT-474 cells

(p53 mutated) tr eated with compounds 15a, 15c, 15j, and

15k reduced p53 and cyclin D1 mRNA levels and increased

p21 gene expression. Except for 15c, which did not modify

p21 mRNA expression.

it did not alter p21 mRNA levels in BT-474 cells. Maybe,

3-NO₂C₆H₄substituent to compound 15c can confer anti-

proliferative activity but hinder some level of transcriptional

induction of p21, but it deserves further investigations. Like

these results, RG7388, a small molecule that induces cell

cycle arrest and triggers cell death, did not elevate p21; but

it signifcantly increased p53 levels in MCF-7 cells (p53

wild-type) [50].

Concerning p21, it has been demonstrated that SAHA

increases the accumulation of acetylated histone H3 and H4

in the p21 promoter, which was associated with the increase

Interestingly, compound 15c was able to suppress cell

growth and diminish cyclin D1 and p53 gene expression, but

Table 2 Growth inhibitory

efects (GI%) exerted by

compounds 15a-k on breast and

prostate cancer cells

Compound^a

R

BT-474

MDA-MB-231

PC3

SAHA

15a

15b

15c

15d

15e

15f

15g

15h

15i

98.22 1.82^b

97.54 1.59^b

89.60 2.35^b,c

86.71 3.65^b,c

86.79 3.96^b,c

74.71 3.43^b,c

84.68 4.36^b,c

80.15 3.75^b,c

93.75 3.20^b

79.50 5.89^b,c

0.43 6.28^c

87.86 7.85^b

C₆H₅

82.32 3.40^b

63.62 13.55^b,c

64.32 9.72^b,c

74.20 7.61^b,c

36.73 18.26^b,c

66.14 5.81^b,c

54.59 10.20^b,c

58.98 11.75^b,c

57.71 6.44^b,c

0.00 9.34^b,c

4-NO₂C₆H₄

3-NO₂C₆H₄

4-FC₆H₄

4-BrC₆H₄

4-ClC₆H₄

4-OCH₃C₆H₄

3-ClC₆H₄

2,4-Cl₂C₆H₃

2-C₅H₃S

65.82 20.06^b,c

84.14 11.11^b

27.68 18.59^b,c

74.75 17.70^b,c

56.81 23.23^b,c

76.07 22.49^b,c

54.85 23.48^b,c

1.60 6.90^c

15j

15k

82.32 11.41^b

96.18 2.63^b

93.31 1.86^b

98.42 1.09^b

68.46 7.04 ^b,c

81.31 15.35^b

2-C₅H₃O

Results are expressed as the mean S.D. percent growth inhibition of triplicate determinations and repre-

sent at least three diferent experiments. ^a10μM, ^bP<0.05 vs. vehicle, ^cP<0.001 vs. SAHA

1 3

DARU Journal of Pharmaceutical Sciences

Table 3 Interaction energies of molecules docked into the active site

of isoforms HDAC

Ligand

HDAC1*

HDAC6*

HDAC8*

SAHA

15a

15c

15g

15j

15k

-8.05

-7.97

-10.01

-8.32

-9.43

-8.19

-9.79

-9.27

-11.42

-10.17

-10.32

-9.49

-8.86

-9.65

-10.57

-8.26

-9.97

-9.64

*Kcal/mol

These results indicate that the new compounds derived

from pyridine with substituents 2-furan (15k) and 2-thio-

phene (15j) could be proposed as good candidates for con-

tinuing with future preclinical assays due to their inhibition

of cell growth and regulation of genes related to cell cycle

progression in highly metastatic cancer cells.

Docking studies

The HDACs are a group of corepressors of transcriptional

activators, and their levels of expression are potentially dys-

regulated in cancer [54]. We investigated the antiprolifera-

tive efect of compounds with a high substituted pyridine

as capping in breast and prostate cancer cell lines, which

overexpress certain HDAC isoforms. The overexpression of

HDAC1 is present in the BT-474 [55] and PC3 cell lines [43,

54]. In the MDA-MB-231 cell line, HDAC6 and HD A C8

play a critical role in proliferation and metastasis [56, 57].

Hence, such isoforms are ideal biological targets for doc king

experiments. Compounds 15a, 15c, 15 g, 15j, and 15k were

docked into the active site of HDAC1, HDAC6, and HDAC8

to gain insight into the ligand-receptor binding mode. The

negative interaction fr ee energies and ligand efciencies,

shown in Tables 3 and 4. Binding modes of SAHA, 15a,

15c, 15g, 15j, and 15k with HDAC1, HDAC6, and HDAC8

are displayed in Figs. 5, 6, and 7, respectively.

The results of binding ener gies indicate a favorable inter-

action between ligands and HDAC isoforms. The dock-

ing between active site HDAC1 and SAHA showed the

hydroxamic group inside the pocket is coordinated with the

zinc atom in a mono-dentate fashion. However, the interac-

tion at the active site of HDAC1 and the fve ligands (15a,

15c, 15 g, 15j, and 15k) does not display a coordination

interaction with the zinc atom at all. The compounds 15a,

15 g, and 15k remain on the surface and do not penetrate

through the HDAC1 active site pocket, while 15c and 15j

came closer to the Zn II cofactor than the rest of the ligands.

The ligands 15c, 15j, and 15k display larger interaction

energy and ligand efciency with HDAC1. Such a fact cor-

relates with the fnding that these molecules displayed the

Fig. 4 Efects of the compounds 15a, 15c, 15j, and 15 k on the

expression of genes implicated in the cell cycle. BT-474 cells were

incubated in the absence (C) and presence of 10 µM of compounds or

SAHA for 24 h. Results shown are the mean S.D. of genes/GAPDH

mRNA normalized ratio of three independent experiments per tripli-

cate. The value of vehicle-treated cells (C) was set to one. *P≤0.05

vs. C

of its gene expression [53]. Therefore, future research is

needed to directly analyze the compounds’ efects in histone

acetylation and resulting changes in chromatin structure to

provide further insight into the mechanism action of new

compounds.

1 3

DARU Journal of Pharmaceutical Sciences

Table 4 Ligand efcient of molecules docked into the active site of

zinc atom inside the enzyme pocket. The docking calcula-

tions show that the capping group of fve analogs is located

in a zone farther to the HDAC6 active site pocket entrance

than the SAHA capping group. Besides, it is observed a

binding interaction between 15j with histidine-500 HDAC6

residue through an acceptor hydrogen bond. This interac-

tion could be responsible for the fact that the ligand 15j was

not sufciently introduced to form bidentate chelation with

the Zn cofactor. In general, we obtained the largest interac-

tion energy with HDAC6, and this is consistent with the

antiproliferative efect in the cell line MDA-MB-231 that

overexpresses this isoform.

isoforms HDAC

Ligand

HDAC1*

HDAC6*

HDAC8*

SAHA

15a

15c

15g

15j

15k

-0.42

-0.27

-0.30

-0.26

-0.32

-0.28

-0.51

-0.31

-0.34

-0.32

-0.36

-0.33

-0.47

-0.32

-0.26

-0.34

-0.33

*Kcal/mol

Regarding the docking calculations in the active site of

HDAC8, the hydroxamic group of compounds 15a, 15g,

and 15k displays bi-dentate chelation with Zn II, unlike

15c and 15j, displaying a mono-dentate interaction. The

ligand 15k displays a binding mode pretty similar to the

one displayed by SAHA, in which a donor hydrogen-bond

interaction is observed with histidine 142 residues. Besides,

three π-staking interactions are displayed, those with

highest percentage of growth inhibition for PC3 and BT-747

culture cells, which overexpress HDAC1.

Considering the docking of HDAC6, we observe that

compounds 15a, 15c, 15 g, and 15k display a binding mode

similar to the displayed by SAHA, a bidentate chelation

geometry is observed. Nevertheless, the hydroxamic group

of the ligand 15j displays a mono-dentate geometry with the

Fig. 5 The binding modes for SAHA and compounds 15a, 15c, 15g,

15j, and 15k at the active site of HDAC1, according to molecular

docking calculations. The stacking interactions are shown as a pink

line, hydrogen bonds are displayed as green dotted lines, π-alkyl

interaction is displayed as middle pink, Van der Waals attraction is

placed as green circles, interaction π-σ is displayed as purple lines,

the coordination bond with zinc is shown as a purple circle. The

observed distances of interaction between zinc and the closest oxygen

of hydroxamic acid moiety of SAHA, 15a, 15c, 15g, 15j, and 15k are

3.9, 12.7, 5.8, 7.2, 5.0, and 14.4 Å, respectively

1 3

DARU Journal of Pharmaceutical Sciences

Fig. 6 Interactions between compounds and the residue in the active

site of HDAC6. The stacking interactions are shown as a pink line,

hydrogen bonds are displayed as green dotted lines, Van der Waals

attraction is placed as green circles, interaction π-σ is displayed as

purple lines, π-sulfur interaction is shown as yellow lines, the coor-

dination bond with zinc are shown as purple lines. The observed

distances of interaction between zinc and the closest oxygen of

hydroxamic acid moiety of SAHA, 15a, 15c, 15g, 15j, and 15k are

2.0, 2.4, 2.1, 2.8, 2.3, and 2.3 Å, respectively

phenylalanine 152, histidine 108, and phenylalanine 208

residues. Moreover, 15c and 15j show binding interactions

with two residues located in the upper part of the HDAC8

active pocket, such resides are lysine 33 and aspartate 101.

It is observed that the diferences in the heteroatom of

15j and 15k afect the binding interactions with the enzyme

pocket. Also, the properties of the oxygen belonging to the

furan of the 15 k display a more efective interaction mode

than 15j with the active site cavity of HDAC6 and HDAC8.

The fundamental diference between the heteroatom of 15j

and 15k is the size and electronegativity; the oxygen dis-

played by 15k is more electronegative and has a smaller

atomic radius than the sulfur of 15j. Consequently, 15 k het-

eroatom holds the right size and electronegativity to pen-

etrate the active site of HDAC6 and HDAC8 to form more

stable interactions with amino acid residues. In recent stud-

ies has been suggested that HDAC6 inhibition may block

breast cancer tumor metastasis [57]. Experimental and com-

putational results in this study suggest that compounds 15a,

15c, 15 g, 15j, and 15k showed selectivity for the HDAC

isoforms, overexpressed in highly metastatic breast cancer

(MDA-MB-231). Finally, the general behavior displayed

by all the tested molecules, 15a-k, is the improvement of

the strength of the interactions of the capping moiety com-

pared with SAHA, pyridine derivatives used in this study

hold functional groups with the capability to perform stack-

ing, hydrogen bond, and Van der Waals interactions in an

efcient manner to block the active site of HDACs. How-

ever, the possible enzymatic inhibition of HDACs by 15a-k

deserves future experimental confrmation.

Pharmacokinetic of 15a‑k compounds

The determination of the pharmacokinetic and physico-

chemical properties of SAHA, 15a, 15c, 15g, 15j, and 15k,

were calculated through the free server for pharmacokinetic

evaluations SwissADME [58 ]. The calculated pharmacoki-

netic properties are displayed in Table 5, and the obtained

physicochemical properties are shown in Table 6.

It is observed that SAHA has a large polar surface area

(PSA) and good solubility in water. In respect of the par-

tition coefficient n-octanol/water (log Po/w), the more

positive Log Po / w, the more lipophilic properties are dis-

played. Then, SAHA and 15a-k are within the optimal range

(−0.7,+5.0); therefore, the compounds 15a, 15c, 15 g, 15j,

and 15k are more lipophilic than SAHA. Also, the predic-

tion for passive human gastrointestinal absorption (HIA) was

high for SAHA and 15a but low for the rest of the com-

pounds. In addition, it was found that the permeability of

1 3

DARU Journal of Pharmaceutical Sciences

Fig. 7 Interactions between compounds and the residue in the active

site of HDAC8. The stacking interactions are shown as a pink line,

π-alkyl interactions are displayed as middle pink, interaction π-σ are

displayed as purple lines, Van der Waals attraction is placed as green

circles, π-anion interaction is orange, hydrogen bond is displayed

as blue dotted lines and zinc is gray color. The observed distance

between the zinc cofactor and the closest oxygen of hydroxamic moi-

ety of SAHA, 15a, 15c, 15 g, 15j, and 15k is 2.3, 3.0, 3.7, 3.2, 3.2,

and 3.2 Å, respectively

the blood–brain barrier (BBB) is negative for SAHA and

15a-k. Besides, it is observed that SAHA and 15a-k do not

have permeability at the BBB.

It was found that SAHA, 15c, 15j y 15k, efcient interacts

with glycoprotein P (P-gp), while 15a and 15g do not exhibit

such behavior. To further clarify the binding to the glyco-

protein, we calculate a molecular coupling between analogs

Table 5 Pharmacokinetic parameter of compounds 15a-k

Table 6 Physicochemical parameter values of compounds 15a-k

Structure

HIA

BBB

P-gp

Bioavailability

Score

Structure PSA (Å²) Log P Solubility (mg/

Solubility

Class

substrate

ml)

SAHA

15a

15c

15g

15j

15k

High

Low

No

Yes

No

Yes

No

Yes

0.55

SAHA

15a

15c

15g

15j

15k

108.64

124.34

170.16

133.57

152.58

137.48

1.92 0.509

Soluble

3.52 0.0000783

3.34 0.0000662

3.49 0.0000647

3.23 0.000113

2.62 0.000345

Moderately soluble

Soluble

1 3

DARU Journal of Pharmaceutical Sciences

and P-gp (code PDB 6QEX) [59]; results are displayed in

Table 7 (Figure S2 is placed in the SI). The docking results

show that compounds 15g and 15k display the lowest ligand

efciency in the coupling with P-gp. Even though it has a

union with the cellular efux pump, 15g and 15k are the

compounds that best inhibited the proliferation of cancer

cells, of which, the one with the highest growth inhibition

percentage was 15k.

of the biological evaluation. With reference to the pharma-

cokinetic properties, it was observed that 15a-k exhibit good

absorption and favorable permeability to the cell´s interior.

Besides, compounds 15g and 15k display the lowest binding

properties with glycoprotein P.

The general conclusion is that the two synthesized pyri-

dine derivatives with the best performance in this study,

2-thiophene (15j) and 2-furan (15k), may serve for the

research of new HDAC inhibitors. Such asseveration is

confrmed by the displayed inhibition of cell growth, regu-

lation of genes related to cell cycle progression HDACs in

highly metastatic cancer cells and the binding properties

with HDACs.

Therefore, we can infer that the compounds 15a-k exhibit

good absorption, favorable permeability to the cell´s interior.

Conclusions

Supplementary Information The online version contains supplemen-

The synthesis of 15a-k was performed with overall yields

from 40 to 71%, the compounds were confrmed by spectro-

scopic, NMR, and crystallographic experiments. About the

biological activity, 15k displays the highest antiproliferative

activity for the BT-474 and MDA-MB-231 breast cancer cul-

tures and the PC3 prostate cancer cell line at a concentration

of 10 µM. Besides, 15j inhibited cell proliferation in a simi-

lar fashion to SAHA in both breast cancer cell lines. Also,

15j and 15k increased p21 mRNA levels and decreased

cyclin D1 and p53 gene expression, a similar behavior is

displayed by SAHA. Such behavior can be rationalized in

the following way: inhibition of cell proliferation induced by

15j and 15k is performed through a cooperative efect, the

induction of p21, and downregulation of cyclin D1 and p53

gene expressions. Besides, IC₅₀values of 15j and 15k are

located in the µM scale, which is in the direction to discover

candidates for antiproliferative molecules.

tary material available at https://doi.org/10.1007/s40199-021-00406-8.

Acknowledgements The authors appreciate of the Guanajuato National

Laboratory (UG-UAA-CONACyT (#123732) for their generous allo-

cation of analytical and computing resources. We are also thankful

the Unit for Industry and Research Support (USAII) at the School of

Chemistry at UNAM and Dr. Marcos Flores-Álamo for X-ray crystal-

lography support. Thanks to “Fundación para la Salud y la Educación

Dr. Salvador Zubirán” and “FOINS-INCMNSZ” by postdoctoral fel-

lowship to N.S-M (A-307-7). The authors would like to thank the Pro-

grama de Investigación en Cáncer de Mama, Universidad Nacional

Autónoma de México and Biol. Salvador Ramirez Jiménez, who is

responsible of the repository of breast cancer cell lines.

Funding This research was funded by Consejo Nacional de Ciencia y

Tecnología (CONACYT) (Grant A1-S-27694) and DAIP-UG (Grants

034/2021, 131/2021) and by Programa de Apoyo a Proyectos de Inves-

tigación e Innovación Tecnológica (PAPIIT, Grant IN208520), Direc-

ción General de Asuntos del Personal Académico (DGAPA), Univer-

sidad Nacional Autónoma de México (UNAM) to R.G-B. F.H.B. and

I.M.S acknowledge CONACYT for a graduate scholarships (#482137

and #673473, respectively).

Regarding the investigation of the binding properties

behind such biological activity, the molecular coupling

analysis performed showed an increment in the number of

interactions performed by the capping moiety, and conse-

quently in the strength of the capping group interaction, of

the tested molecules compared with SAHA. The interactions

responsible for improving the caping group interactions are

Van der Waals, stacking, and hydrogen bond. Finally, 15j

and 15k display the larger bonding interactions with the bio-

logical targets, in agreement with the observed performance

Declarations

Conflicts of Interest The authors confrm that the content of this article

has no confict of interest.

References

1. Egger G, Liang G, Aparicio A, Jones PA. Epigenetics in

human disease and prospects for epigenetic therapy. Nature.

2004;429:457–63.

Table 7 Interaction energies

P-gp

(IE) and ligand efciency (LE)

2. Wang A, Qu L, Wang L. At the crossroads of cancer stem cells

and targeted therapy resistance. Cancer Lett. 2017;385:87–96.

3. Dokmanovic M, Clarke C, Marks PA. Histone deacetylase inhibi-

tors: overview and perspectives. Mol Cancer Res. 2007;5:981–9.

4. Xu WS, Parmigiani RB, Marks PA. Histone deacetylase inhibitors:

molecular mechanisms of action. Oncogene. 2007;26:5541–52.

5. West AC, Johnstone RW. New and emerging HDAC inhibitors for

cancer treatment. J Clin Invest. 2014;124:30–9.

of molecules docked into the

active site of P-gp

Ligand

IE*

LE*

SAHA

15a

15c

15g

15j

15k

-9.19

-0.48

-0.36

-0.35

-0.38

-0.35

-10.74

-11.72

-11.31

-10.92

-10.20

6. Glozak MA, Seto E. Histone deacetylases and cancer. Oncogene.

2007;26:5420–32.

*Kcal/mol

1 3

DARU Journal of Pharmaceutical Sciences

inhibitors as a rapid route to drug discovery. J Comb Chem.

2008;10:624–7.

7. Raynal NJ-M, Da Costa EM, Lee JT, Gharibyan V, Ahmed S,

Zhang H, et al. Repositioning FDA-approved drugs in combina-

tion with epigenetic drugs to reprogram colon cancer epigenome.

Mol Cancer Ther. 2017;16:397–407.

23. Salmi-Smail C, Fabre A, Dequiedt F, Restouin A, Castellano R,

Garbit S, Roche P, Morelli X, Brunel JM, Collette Y. Modifed

cap group suberoylanilide hydroxamic acid histone deacetylase

inhibitor derivatives reveal improved selective antileukemic

activity. J Med Chem. 2010;53:3038–47.

8. Taby R, Issa J-PJ. Cancer epigenetics. C A Cancer J Clin.

2010;60:376–92.

9. Chang DK. Cancer epigenetics. Korean J Gastroenterol.

2004;44:1–12.

24. Ghosh B, Zhao W-N, Reis SA, Patnaik D, Fass DM, Tsai L-H,

et al. Dissecting structure–activity-relationships of crebinostat:

brain penetrant HDAC inhibitors for neuroepigenetic regulation.

Bioorg Med Chem Lett. 2016;26:1265–71.

10. Mottamal M, Zheng S, Huang TL, Wang G. Histone deacetylase

inhibitors in clinical studies as templates for new anticancer

agents. Molecules. 2015;20:3898–941.

25. Walton JW, Cross JM, Riedel T, Dyson P. Perfuorinated HDAC

inhibitors as selective anticancer agents. Org Biomol Chem.

2017;15:9186–90.

11. Plumb J, Finn PW, Williams RJ, Bandara MJ, Romero MR, Wat-

kins CJ, La Thangue NB, Brown R. Pharmacodynamic response

and inhibition of growth of human tumor xenografts by the

novel histone deacetylase inhibitor PXD101. Mol Cancer Ther.

2003;2:721–8.

26. Hesham HM, Lasheen DS, Abouzid KAM. Chimeric HDAC

inhibitors: Comprehensive review on the HDAC-based strategies

developed to combat cancer. Med Res Rev. 2018;38:2058–109.

27. García S, Mercado-Sánchez I, Bahena L, Alcaraz Y, García-

Revilla MA, Robles J, Santos-Martínez N, Ordaz-Rosado D,

García-Becerra R, Vazquez M. Design of fuorescent coumarin-

hydroxamic acid derivatives as inhibitors of HDACs: synthesis,

anti-proliferative evaluation and docking studies. Molecules.

2020;25:5134.

12. Atadja P. Development of the pan-DAC inhibitor panobi-

nostat (LBH589): successes and challenges. Cancer Lett.

2009;280:233–41.

13. Cao J, Lv W, Wang L, Xu J, Yuan P, Huang S, He Z, Hu J.

Ricolinostat (ACY-1215) suppresses proliferation and pro-

motes apoptosis in esophageal squamous cell carcinoma via

miR-30d/PI3K/AKT/mTOR and ERK pathways. Cell Death Dis.

2018;9:817.

28. Bahena L, Cervantes C, Soto-Arredondo KJ, Martínez-Alfaro

M, Zarco N, García-Revilla MA, Alcaraz-Contreras, Palma

Tirado L, Vázquez MARJ. In silico, synthesis and biologi-

cal investigations of Pyrrolo-[3,4-c]pyrrole hydroxamic acid

derivatives as potential anticancer agents. J Mex Chem Soc.

2017;61:297–308.

14. Fournel M, Bonfls C, Hou Y, Yan PT, Trachy-Bourget M, Kalita

A, Liu J, Lu A–H, Zhou NZ, Robert M, Gillespie J, Wang JJ, Ste-

Croix H, Rahill J, Lefebvre S, Moradei O, Delorme D, MacLeod

A, Besterman J, Li Z. MGCD0103, a novel isotype-selective his-

tone deacetylase inhibitor, has broad spectrum antitumor activity

in vitro and in vivo. Mol Cancer Ther. 2008;7:759–68.

15. Gediya LK, Belosay A, Khandelwal A, Purushottamachar P, Njar

VCO. Improved synthesis of histone deacetylase inhibitors (HDIs)

(MS-275 and CI-994) and inhibitory efects of HDIs alone or

in combination with RAMBAs or retinoids on growth of human

LNCaP prostate cancer cells and tumor xenografts. Bioorg Med

Chem. 2008;16:3352–60.

29. Hernández F, Sánchez A, Rendón-Vallejo P, Millán-Pacheco C,

Alcaraz Y, Delgado F, Vázquez MA, Estrada-Soto S. Synthesis,

ex vivo and in silico studies of 3-cyano-2-pyridone derivatives

with vasorelaxant activity. Eur J Med Chem. 2013;70:669–76.

30. Hernández F, De la Cruz F, López J, Peña E, Delgado F, Alcaraz

Y, Robles J, Martínez-Alfaro M, Vázquez M. A green approach

to the production of 2-pyridone derivatives promoted by infra-

red irradiation. J Mex Chem Soc. 2014;58:152–8.

16. Gong K, Xie J, Yi H, Li W. CS055 (Chidamide/HBI-8000), a

novel histone deacetylase inhibitor, induces G1 arrest, ROS-

dependent apoptosis and diferentiation in human leukaemia cells.

Biochem J. 2012;443:735–46.

31. Keepers YP, Pizao PE, Peters GJ, van Ark-Otte J, Winograd B,

Pinedo HM. Comparison of the sulforhodamine B protein and

tetrazolium (MTT) assays for in vitro chemosensitivity testing.

Eur J Cancer Clin Oncol. 1991;27:897–900.

17. Ning ZQ, Li ZB, Newman MJ, Shan S, Wang XH, Pan DS,

Zhang J, Dong M, Du X, Lu X. Chidamide (CS055/HBI-8000):

a new histone deacetylase inhibitor of the benzamide class

with antitumor activity and the ability to enhance immune cell-

mediated tumor cell cytotoxicity. Cancer Chemother Pharmacol.

2012;69:901–9.

32. Frisch, M J, Trucks, G W, Schlegel, H B, Scuseria, G E, Robb,

M A, Cheeseman, J R, Scalmani, G, Barone, V, Mennucci, B,

Petersson, G A, Nakatsuji, H, Caricato, M, Li, X, Hratchian, H

P, Izmaylov, A F, Bloino, J, Zheng, G, Sonnenberg, J L, Hada,

M, Ehara, DJ. Gaussian 09, Revision B.01. Gaussian 09, Revis.

B.01, Gaussian, Inc., Wallingford CT. 2009.

18. Sundarapandian T, Shalini J, Sugunadevi S, Woo LK. Docking-

enabled pharmacophore model for histone deacetylase 8 inhibitors

and its application in anti-cancer drug discovery. J Mol Graph

Model. 2010;29:382–95.

33. Turnbull RE, Fairall L, Saleh A, Kelsall E, Morris KL, Ragan

TJ, Savva CG, Chandru A, Millard CJ, Makarova OV, Smith CJ,

Roseman AM, Fry AM, Cowley SM, Schwabe J. The MiDAC

histone deacetylase complex is essential for embryonic devel-

opment and has a unique multivalent structure. Nat Commun.

2020;11:3252.

19. Marks PA, Rifkind RA, Richon VM, Breslow R, Miller T, Kelly

WK. Histone deacetylases and cancer: causes and therapies. Nat

Rev Cancer. 2001;1:194–202.

34. Hai Y, Christianson D. Histone deacetylase 6 structure and

molecular basis of catalysis and inhibition. Nat Chem Biol.

2016;12:741–7.

20. Huang WJ, Chen CC, Chao SW, Lee SS, Hsu FL, Lu YL, Hung

MF, Chang C. Synthesis of N-Hydroxycinnamides capped with

a naturally occurring moiety as inhibitors of histone deacetylase.

ChemMedChem. 2010;5:598–607.

35. Somoza JR, Skene RJ, Katz BA, Mol C, Ho JD, Jennings AJ,

Luong C, Arvai A, Buggy JJ, Chi E, Tang J, Sang BC, Verner E,

Wynands R, Leahy EM, Dougan DR, Snell G, Navre M, Knuth

MW, Swanson RV, McRee DE, Tari L. Structural snapshots of

human HDAC8 provide insights into the class I histone deacety-

lases. Structure. 2004;12:1325–34.

21. Wang H, Yu N, Song H, Chen D, Zou Y, Deng W, Lye PL, Chang

J, Ng M, Blanchard S, Sun ET, Sangthongpitag K, Wang X, Goh

KC, Wu X, Khng HH, Lijuan M. N-Hydroxy-1,2-disubstituted-

1H-benzimidazol-5-yl acrylamides as novel histone deacetylase

inhibitors: design, synthesis, SAR studies, and in vivo antitumor

activity. Bioorg Med Chem Lett. 2009;19:1403–8.

36. Varano F, Catarzi D, Squarcialupi L, Betti M, Vincenzi F,

Ravani A, et al. Exploring the 7-oxo-thiazolo[5,4-d]pyrimi-

dine core for the design of new human adenosine A3 receptor

22. Pirali T, Pagliai F, Mercurio C, Boggio R, Canonico PL, Sorba

G, Tron GC, Genazzani A. Triazole-modifed histone deacetylase

1 3

DARU Journal of Pharmaceutical Sciences

50. Natarajan U, Venkatesan T, Radhakrishnan V, Samuel S, Rasap-

pan P, Rathinavelu A. Cell cycle arrest and cytotoxic efects of

SAHA and RG7388 mediated through p21(WAF1/CIP1) and

p27(KIP1) in cancer cells. Medicina (Kaunas). 2019;55:30.

51. Patra N, De U, Kim TH, Lee Y, Ju A, Mee Young Kim ND, Yoon

JH, Choi WS, Moon HR, Lee BM, Kim H. A novel histone dea-

cetylase (HDAC) inhibitor MHY219 induces apoptosis via up-

regulation of androgen receptor expression in human prostate

cancer cells. Biomed Pharmacother. 2013;67:407–15.

antagonists. Synthesis, molecular modeling studies and phar-

macological evaluation. Eur J Med Chem. 2015;96:105–21.

37. Wagaw S, Buchwald SL. The synthesis of aminopyridines: a

method employing palladium-catalyzed carbon−nitrogen bond

formation. J Org Chem. 1996;61:7240–1.

38. Tan Q, Zhang Z, Hui J, Zhao Y, Zhu L. Synthesis and anticancer

activities of thieno[3,2-d]pyrimidines as novel HDAC inhibitors.

Bioorg Med Chem. 2014;22:358–65.

39. Usachova N, Leitis G, Jirgensons A, Kalvinsh I. Synthesis

of hydroxamic acids by activation of carboxylic acids with N,

N′-Carbonyldiimidazole: exploring the efciency of the method.

Synth Commun. 2010;40:927–35.

52. Knutson Kekapa’a A, Welsh J, Taylor T, Roy S, Wang Winnie

WL, Tenniswood M. Comparative efects of histone deacetylase

inhibitors on p53 target gene expression, cell cycle and apoptosis

in MCF-7 breast cancer cells. Oncol Rep. 2012;27:849–53.

53. Richon VM, Sandhoff TW, Rifkind RA, Marks PA. Histone

deacetylase inhibitor selectively induces p21WAF1 expression

and gene-associated histone acetylation. Proc Natl Acad Sci.

2000;97:10014–9.

40. Deposition Numbers (CCDC): 1569641(11i), 2055316

(14f). www.ccdc.cam.ac.uk/structures.

41. Lakshmaiah K, Jacob L, Aparna S, Lokanatha D, Saldanha S.

Epigenetic therapy of cancer with histone deacetylase inhibitors.

J Cancer Res Ther. 2014;10:469–78.

54. Wang L, Zou X, Berger AD, Twiss C, Peng Y, Li Y, Chiu J, Guo

H, Satagopan J, Wilton A, Gerald W, Basch R, Wang Z, Osman

I, Lee P. Increased expression of histone deacetylaces (HDACs)

and inhibition of prostate cancer growth and invasion by HDAC

inhibitor SAHA. Am J Transl Res. 2009;1:62–71.

42. Peng X, Sun Z, Kuang P, Chen J. Recent progress on HDAC

inhibitors with dual targeting capabilities for cancer treatment.

Eur J Med Chem. 2020;208:112831.

43. Kim NH, Kim SN, Kim Y. Involvement of HDAC1 in E-cadherin

expression in prostate cancer cells; its implication for cell motility

and invasion. Biochem Biophys Res Commun. 2011;404:915–21.

44. Huang L, Pardee AB. Suberoylanilide hydroxamic acid as a poten-

tial therapeutic agent for human breast cancer treatment. Mol

Med. 2000;6:849–66.

55. Greer CB, Tanaka Y, Kim, Yoon J, Xie P, Zhang MQ, Park IH,

Kim T. Histone deacetylases positively regulate transcription

through the elongation machinery. Cell Rep. 2015;13:1444–55.

56. Mravljak J, Ojsteršek T, Pajk S, Sollner DM. Coumarin-based dual

fuorescent spin-probes. Tetrahedron Lett. 2013;54:5236–8.

57. Ediriweera MK, Tennekoon KH, Samarakoon SR. Emerging role

of histone deacetylase inhibitors as anti-breast-cancer agents.

Drug Discov Today. 2019;24:685–702.

45. Butler LM, Agus DB, Scher HI, Higgins B, Rose A, Cordon-

Cardo C, et al. Suberoylanilide hydroxamic acid, an inhibitor of

histone deacetylase, suppresses the growth of prostate cancer cells

in vitro and in vivo. Cancer Res. 2000;60:5165–70.

58. Daina A, Michielin O, Zoete V. SwissADME: a free web tool to

evaluate pharmacokinetics, drug-likeness and medicinal chemistry

friendliness of small molecules. Sci Rep. 2017;7:42717.

46. Dai X, Cheng H, Bai Z, Li J. Breast cancer cell line classifca-

tion and its relevance with breast tumor subtyping. J Cancer.

2017;8:3131–41.

59. Alam A, Kowal J, Broude E, Roninson I, Locher K. Structural

insight into substrate and inhibitor discrimination by human

P-glycoprotein. Science. 2019;363:753–6.

47. Kaighn ME, Narayan KS, Ohnuki Y, Lechner JF, Jones LW. Estab-

lishment and characterization of a human prostatic carcinoma cell

line (PC-3). Invest Urol. 1979;17:16–23.

48. Hontecillas-Prieto L, Flores-Campos R, Silver A, de Álava E,

Hajji N, García-Domínguez D. Synergistic enhancement of cancer

therapy using hdac inhibitors: opportunity for clinical trials. Front

Genet. 2020;11:1113.

Publisher’s note Springer Nature remains neutral with regard to

jurisdictional claims in published maps and institutional afliations.

49. Botrugno OA, Santoro F, Minucci S. Histone deacetylase inhibi-

tors as a new weapon in the arsenal of diferentiation therapies of

cancer. Cancer Lett. 2009;280:134–44.

1 3

Article Doi

Exploring novel capping framework: high substituent pyridine-hydroxamic acid derivatives as potential antiproliferative agents

DOI: 10.1007/s40199-021-00406-8

Source and publish data:

Authors:

Article abstract of DOI:10.1007/s40199-021-00406-8

Full text of DOI:10.1007/s40199-021-00406-8

Products guided by the article

R&D Labs maybe for 78942-25-3

Relevant to this article

Hot Product