Design, synthesis and antimetastatic evaluation of 1-benzothiazolylphenylbenzotriazoles for photodynamic therapy in oral cancer cells

Article abstract of DOI:10.1039/c6md00034g

We have designed and synthesized a new series of 1-benzothiazolylphenylbenzotriazoles 9a-p and studied their antimetastatic mechanism involved in photosensitive effects induced by UVA in oral cancer cell Ca9-22. Our results revealed that the compounds plus UVA significantly suppressed migration and invasion, as detected by wound healing assay and Boyden chamber assay. Quantitative RT-PCR assay indicated that compound 9i plus UVA induced an antimetastatic effect through up-regulation of syndecan-1 and TIMP-3 and down-regulation of heparanase, MMP-2 and MMP-9 mRNA expressions. Western blot analysis showed that Ca9-22 treated with 9i plus UVA resulted in decreased levels of p-EGFR and p-ERK, MMP-2 and MMP-9, and an increased level of TIMP-3. These results are the first to report the function of UVA-activated 1-benzothiazolylphenylbenzotriazoles in tumor metastasis and their underlying molecular mechanism, and thus suggest that compound 9i plus PDT may serve as a potential ancillary modality for the treatment of oral cancer.

Full text of DOI:10.1039/c6md00034g

View Article Online
View Journal
MedChemComm
Accepted Manuscript
This article can be cited before page numbers have been issued, to do this please use: G. C. Senadi, J.
Liao, K. Kuo, J. Lin, L. Chang, J. Wang and W. Hu, Med. Chem. Commun., 2016, DOI:
10.1039/C6MD00034G.
This is an Accepted Manuscript, which has been through the
Royal Society of Chemistry peer review process and has been
accepted for publication.
Accepted Manuscripts are published online shortly after
acceptance, before technical editing, formatting and proof reading.
Using this free service, authors can make their results available
to the community, in citable form, before we publish the edited
article. We will replace this Accepted Manuscript with the edited
and formatted Advance Article as soon as it is available.
You can find more information about Accepted Manuscripts in the
Information for Authors.
Please note that technical editing may introduce minor changes
to the text and/or graphics, which may alter content. The journal’s
standard Terms & Conditions and the Ethical guidelines still
apply. In no event shall the Royal Society of Chemistry be held
responsible for any errors or omissions in this Accepted Manuscript
or any consequences arising from the use of any information it
contains.
www.rsc.org/medchemcomm

Please do not adjust margins
MedChemComm
Page 1 of 9
View Article Online
DOI: 10.1039/C6MD00034G
Journal Name
ARTICLE
Design, Synthesis and Antimetastatic Evaluation of 1-
benzothiazolylphenylbenzotriazoles for Photodynamic Therapy in
Oral Cancer Cells
Received 00th January 20xx,
Accepted 00th January 20xx
Gopal Chandru Senadi,a Jie-Ming Liao,b Kung-Kai Kuo,c Jian-Cheng Lin,a Long-Sen Chang,d Jeh Jeng
Wang,a Wan-Ping Hu*b
DOI: 10.1039/x0xx00000x
www.rsc.org/
We have designed and synthesized a new series of 1-benzothiazolylphenylbenzotriazoles 9a-p and studied their
antimetastatic mechanism involved in photosensitive effects induced by UVA in oral cancer cell Ca9-22. Our results
revealed that compound plus UVA significantly suppressed the migration and invasion as detected by wound healing assay
and Boyden chamber assay. Quantitative RT-PCR assay indicated that compound 9i plus UVA induced antimetastatic effect
through up-regulation of syndecan-1 and TIMP-3 and down-regulation of heparanase, MMP-2, and MMP-9 mRNA
expressions. Western blot analysis showed that Ca9-22 treated by 9i plus UVA resulted in decreased levels of p-EGFR and
p-ERK, MMP-2 and MMP-9, increased level of TIMP-3. These results are the first to report the function of UVA-activated 1-
benzothiazolylphenylbenzotriazoles in tumor metastasis and its underlying molecular mechanism, and thus suggesting
compound 9i plus PDT may serve as
a potential ancillary modality for the treatment of oral cancer.
benzothiazole derivatives as a photosensitizers for PDT on BCC
cells6
and later we found that the 2-(4-
Introduction
aminophenyl)benzothiazole compounds containing halogen
groups, under UVA light exposure, induced A375 melanoma
cell apoptosis.7 Moreover, our research group have also found
that bicyclic[1,2,3]triazoles protect UVA-induced senescence-
like characteristics in fibroblast cells, which may provide
potential prevention against photoaging.8a On the other hand,
Oral cancer is the sixth most common type of cancer in the
world.1 It has a tendency to metastasis to regional or distant
sites after incomplete treatment. Photodynamic therapy (PDT)
might be a potential therapeutic modality for oral cancer.2,3 It
is recognized as a treatment strategy which is both minimally
invasive and toxic for cancer cells. Most modern PDT
applications involve three key components: a photosensitizer,
a light source and tissue oxygen. The wavelength of the light
source needs to be appropriate for exciting the photosensitizer
to produce oxygen free radicals, which are responsible for the
PDT-induced cytotoxicity.4 A previous study indicated that
tumor tissues have higher uptake or retention of
photosensitizer than the surrounding normal tissue.5 However,
there were also limitations of PDT, including the penetration
depth for both photosensitizer and its activating light source.
These limitations have prompted us to synthesize new
photosensitizers.
there is
a significant growth towards the design and
development of new therapeutic agents for the treatment of
cancers.8b In this context, various benzotriazole derivatives
have been found to possess excellent anticancer activity,8c for
example, commercial available anticancer drug 4,5,6,7-
tetrabromobenzotriazole (TBB)8d Furthermore, structurally
diversified benzothiazoles and their metal complexes have
shown the potentiality to overcome limitations of available
clinical drugs.8e By considering the importance of
benzotriazoles and our previously reported 2-(4-
aminophenyl)benzothiazole.6
synthesis of
Hereby, we describe the
new class of 1-
a
We have previously reported 2-(4-aminophenyl)-
benzothiazolylphenylbenzotriazoles compounds which has an
absorption in the UVA region. The synthesized compounds
have been studied for the in vitro analyses on oral cancer cells
(Ca9-22) for anti-migration effect under UVA irradiation. One
can speculate that UVA will produce side effects such as
carcinogenesis and photoaging, but in our system, these do
not appear because the exposure time required for 1-
benzothiazolylphenylbenzotriazoles activation was very short
and did not lead to chronic exposure to UVA.
Matrix metalloproteinases (MMPs) are a family of secreted
or transmembrane zinc endopeptidases that are capable of
This journal is © The Royal Society of Chemistry 20xx
J. Name., 2013, 00, 1-3 | 1
Please do not adjust margins

Please do not adjust margins
MedChemComm
Page 2 of 9
View Article Online
DOI: 10.1039/C6MD00034G
Journal Name
ARTICLE
digesting extracellular matrix (ECM).9 Among human MMPs, metastasis. Syndecan-1 is known to suppress the MMP-9 level
MMP-2 and MMP-9 are mostly associated with tumor in Ca9-22 cells13 and can be degraded by heparanase.14
migration and invasion for various cancers.10 Additionally, Heparanase can enhance tumor cell growth and migration and
clinical studies have also shown that MMP-2 and MMP-9 are induce the phosphorylation of epidermal growth factor
involved in tumor metastasis and their elevated expression has receptor (EGFR) and extracellular signal-regulated kinase
been with poor prognosis.11,12 Therefore, inhibition of MMP (ERK).15 In this regard, we have initiated experiments aimed at
activity is important for arresting metastasis. Syndecan-1 has characterizing the above signaling molecules in the process of
been shown to be a prognostic factor in various types of antimetastatic after Ca9-22 cells were treated with 2-
tumors, suggesting its correlation with malignancy and phenylbenzothiazoles-linked-benzotriazoles
plus
UVA.
Scheme 1. Total synthesis of 1-benzothiazolylphenylbenzotriazoles 9. Reagents and conditions: (i) method a: X = Cl, pyridine, reflux; method b: X = OH, SOCl2, benzene, reflux. (ii)
Lawesson’s reagent, chlorobenzene, 135 oC. (iii) K3Fe(CN)6 aq, NaOH, 90 oC. (iv) H2/Pd/C 10%, CH2Cl2, 25 oC. (v) NaNO2, NaN3, 2N HCl (vi). CsF, CH3CN, 55 oC, 12 h.
compound 9e, 9i and 9k shown to possess ≥50 % of inhibition
Results and Discussion
as compared with other agents. Hence, we decided to study
further biological studies of these 3 compounds compared
Syntheses
with the analogues 9f, 9j and 9l. The difference between these
The synthetic strategy for the newly proposed series of 1-
two sets is the presence of methoxy group (MeO-) in the
aromatic ring. However, these methoxy derivatives shown no
inhibition and it may be due to the strong electron-donating
nature of methoxy group, which can potentially undergo
further chemical transformation under UVA irradiation. From
Table 1 and Figure 1, cell viability was significantly inhibited at
1J/cm2 UVA irradiation. To evaluate the effects of PDT on the
migration and invasion of cancer cells, a sublethal dose that
killed about 20% of the cells was used (See Figure 1). Thus, the
concentration and light dose we used throughout this study
benzothiazolylphenylbenzotriazoles
The synthetic protocol for the construction of compounds
was carried out according to our previously published
literature protocol in good to excellent yields.6 Compounds
was obtained by reaction of compounds with NaNO2
followed by azidation with NaN3. The target compounds was
obtained by a slightly modified protocol of Larock et al16a with
2-(trimethylsilyl)phenyl trifluoromethanesulfonates and
azides
with CsF16b as base in CH3CN under heating condition
(55 °C). Compounds 9a were isolated in good yields and
9 was shown in Scheme 1.
6
7
6
9
8
7
was 2 µ
M and 0.5 J/cm2. Additionally, our data also showed
-p
characterized as described in experimental part.
Cytotoxicity of 2-phenylbenzothiazoles-linked-benzotriazoles plus
UVA to Ca9-22 cells
that 9i plus UVA exhibited a higher inhibitory activity more
than either UVA irradiation alone or treatment with exogenous
9i alone.
1-benzothiazolylphenylbenzotriazoles plus UVA suppressed
the migration and invasion of Ca9-22 cells
Migration17a and invasion of cancer cells are key steps of
tumor metastasis. To investigate the inhibitory effect of 1-
benzothiazolylphenylbenzotriazoles plus UVA on migration of
Ca9-22 cells, the wound healing assay was performed. The
The
effect
of
UVA-activated
1-
benzothiazolylphenylbenzotriazoles on Ca9-22 cell viability
was evaluated by the MTT assay. Cells were cultured with the
agents at 5 μM for 4 h before 1 J/cm2 UVA irradiation. Twenty-
four hours after irradiations, cell viability was measured for 16
compounds as shown in Table 1. The data revealed that
This journal is © The Royal Society of Chemistry 20xx
J. Name., 2013, 00, 1-3 | 2
Please do not adjust margins

Please do not adjust margins
Page 3 of 9
MedChemComm
View Article Online
DOI: 10.1039/C6MD00034G
Journal Name
ARTICLE
Table 1. Effect of compounds plus UVA on Ca9-22 cell viabilitya
A.
entry
1
Compound 9 +UVA
Survival (%)
100 ±0.2
95.5±0.4
104.4±0.2
108.7±0.7
113.6±0.7
50.2±0.6
73.1±0.2
91.8±0.1
104.9±0.2
44.1±0.3
81.1±0.8
48.6±0.2
79.6±0.7
82.1±0.1
63.3±0.3
89.4±0.6
112.9±0.2
UVA alone
2
9a
9b
9c
9d
9e
9f
3
4
5
6
7
8
9g
9h
9i
9
10
11
12
13
14
15
16
17
9j
9k
9l
9m
9n
9o
9p
aCells were cultured with compounds 9a-9p at 5 μM for 4 h before 1 J/cm2 UVA
irradiation. Twenty-four hours after irradiation, cell survival was assessed using
the MTT assay. The data are expressed as the mean ± SD.
125
Control
UVA
100
9i
9i+UVA
75
50
25
0
B.
0
0.5
1
Dose of irradiation (J/cm2)
Figure 1. Effect of compound 9i plus UVA cell viability. Ca9-22 cells were cultured
with or without 2 μM 9i before different dosage of UVA irradiation. Similar
results were obtained in three independent experiments.
confluent monolayer was scraped by a sterile micropipette tip
to create a scratch wound. Ca9-22 cells were treated with 2
μM agents for 2 h before 0.5 J/cm2 UVA irradiation. Sixteen
hours after irradiation, the cells migrated to the denuded zone
and the level of the wound closure area was analyzed. As
shown in Figure 2A, treatment of Ca9-22 cells with agents plus
UVA inhibited 70.1% (9e), 68.7% (9i), 45.8% (9k), 31.1% (9f),
51.7% (9j) and 18.5% (9l) of cell migration, respectively. To
further examine the effect of agents plus UVA on the invasive
ability of Ca9-22 cells, a Boyden chamber coated with Matrigel
was used. The results showed that the number of cells
invading the lower chamber was 47.0% (9e), 38.9% (9i), 47.6%
(
9k), 70.0% (9f), 108.6% (9j) and 75.9% (9l) after 2 μM agents
plus UVA, respectively, compared with that of control group
(Figure. 2B).
This journal is © The Royal Society of Chemistry 20xx
J. Name., 2013, 00, 1-3 | 3
Please do not adjust margins

Please do not adjust margins
MedChemComm
Page 4 of 9
View Article Online
DOI: 10.1039/C6MD00034G
Journal Name
ARTICLE
is closely related to the tumorigenesis and development of
malignant tumors.21-23 To examine whether agent plus UVA-
induced anticellular migration involves the regulation of the
expression of EGFR, ERK and MMPs, Ca9-22 cells treated with
2 μM agents for 2 h then 0.5 J/cm2 UVA irradiation were
subjected to the Western blotting assay. Our results showed
that 2-phenylbenzothiazoles-lined-benzotriazoles plus UVA
inhibiting metastasis cell was associated with decreased levels
of p-EGFR, p-ERK, MMP-2 and MMP-9, whereas the levels of
TIMP3 were increased (Figure. 4).
Figure
2. Effect of 1-benzothiazolylphenylbenzotriazoles plus UVA on the
migration and invasion of Ca9-22 cells. (A) 5 × 105 cells were seeded on a 12-well
plate, and cells were scraped to create a clean 1 mm wide wound area. Cells
then were treated with the agents at 2 μM for 2h before 0.5 J/cm2 UVA
irradiation. Sixteen hours after irradiation, the wound areas were then analyzed
and calculated using an online image analysis softwareWimasis. (B) In the
Boyden chamber invasion assay, cells were treated with 2 μM agents for 2 h then
0.5 J/cm2 UVA irradiation. Twenty-two hours after irradiation, the invasion ability
of cells was quantified by counting the number of cells that invaded the
undweside of the porous polycarbonate membrane under microscope. *p
0.05, ** p
obtained in three independent experiments.
＜
＜0.01 as compared with the control group. Similar results were
Metastasis-associated gene expression
Matrix metalloproteinases (MMPs) are highly expressed in
invasive tumors and the levels of MMP-2 and MMP-9 were
related to invasion of oral cancer.10 Syndecan-1 is a trans-
membrane heparan sulfate proteoglycan that involve in
processes such as cell growth, differentiation and adhesion.17b
Syndecan-1 is known to suppress the MMP-9 level in Ca9-22
cells13 and can be degraded by heparanase.14 Therefore, we
used the qPCR measurements for syndecan-1, heparanase,
MMP-2, MMP-9, and TIMP-3 (MMP inhibitor) expressions after
9i plus UVA treatment. As shown in Figure 3, the mRNA
expression of syndecan-1 and TIMP-3 had significant increase
after 9i plus UVA treatment, while the levels of heparanase,
MMP-2, MMP-9 were reduced, as compared with the control
group.
Figure
4. Western blot analysis showed the effect of compounds on the
expression of metastasis regulatory proteins. After exposure to UVA with agents,
cell lysates were collected and immunoblotted with specific antibodies as
indicated. For the internal control, the same amounts of protein extract were
also probed with antibody against β-Actin. Similar results were observed in three
separate experiments.
Conclusions
We have discovered new series of benzothiazoles linked
benzotriazoles by new synthetic strategy. The signaling
mechanism of oral cancer cells Ca9-22 antimetastasis induced
by 2-phenylbenzothiazoles-linked-benzotriazoles plus UVA
treatment was disclosed. Our data revealed that compounds
9
plus UVA significantly inhibited the migration and invasion of
Ca9-22. Data from quantitative RT-PCR assay indicated that
compound 9i plus UVA induced suppressive effect through up-
regulation of syndecan-1 and TIMP-3 and down-regulation of
heparanase, MMP-2, and MMP-9 mRNA expressions.
Figure 3. Expression of syndecan-1, heparanase, MMP-2, MMP-9, and TIMP-3
mRNA in different groups. The mRNA expression analyzed by quantitative real-
time PCR and the expressional levels were normalized to the level of β-Actin
mRNA. *p<0.05 vs control group. Similar results were obtained in three
independent experiments.
Furthermore, compound
9 plus UVA decreased protein
Metastasis-associated protein expression
expression of p-EGFR, p-ERK, MMP-2 and MMP-9, increased
level of TIMP-3. Taken together, our studies indicate that 9i
plus UVA inhibited the activity of both MMP-2 and MMP-9 via
EGFR/ ERK signaling pathway in Ca9-22 cells. These findings
The epidermal growth factor receptor (EGFR) is expressed at
18,19
high levels in most oral squamous cell carcinoma
and
associated with lower rates of survival.20 It has shown that ERK
is over expressed in many malignant tumor tissues and cell
reveal
a
new
therapeutic
potential
for
1-
benzothiazolylphenylbenzotriazoles -PDT on anti-metastatic
therapy.
lines,
such
as
hepatocellular
carcinoma,
breast
adenocarcinoma, and squamous cell carcinoma of head and
neck, indicating that abnormal regulation of the ERK pathway
This journal is © The Royal Society of Chemistry 20xx
J. Name., 2013, 00, 1-3 | 4
Please do not adjust margins

Please do not adjust margins
MedChemComm
Page 5 of 9
View Article Online
DOI: 10.1039/C6MD00034G
Journal Name
ARTICLE
NMR (CDCl3, 100 MHz): δ 166.26 (d,J=166,1C), 160.91, 154.11,
141.91, 138.92, 135.15, 133.53, 133.30, 128.98(d,J=3.8,2C),
126.59, 125.59, 123.44, 122.92 (2C), 122.52, 121.72, 121.16,
116.62, 55.83 (d, J = 11.4, 1C) HRMS (ESI+, m/s) for C20H15
N4OS, calcd: 359.0967, found: 359.0964; anal. calcd for:
C20H14N4OS; C, 67.02; H, 3.94; N, 15.63 found: C, 65.86; H,
3.91; N, 15.34.
Experimental Section
Chemistry
Materials and Methods Chemical reagents were used without
further purification. Solvents free distilled prior to use. Reactions
were monitored by thin layer chromatography, using Merck plates
60 F254. Flash chromatography was carried out on Merck Silica Gel
60 (40–63 lm) using the indicated solvents. Melting points were 1-[4-(6-Ethyl-benzothiazol-2-yl)-phenyl]-1H-benzotriazole
(9c). Yield 92%; White solid; mp = 190~192 oC; 1H NMR (DMSO-
d6, 400 MHz): δ 8.33 (dt, J = 8.8 Hz, 2H),8.19 (d, J = 8.4
Hz,1H),8.02 (d, J = 8.0 Hz, 1H), 7.96 (dt, J = 8.4 Hz, 2H), 7.83 (d,
J = 8.4 Hz, 1H), 7.76 (s, 1H), 7.61 (t, J = 7.2 Hz, 1H), 7.48 (t, J =
8.0 Hz, 1H), 7.38 (dd, J = 8.0 Hz, 1H), 2.82 (q, J = 7.6 Hz, 2H),
1.34 (t, J = 7.6 Hz, 3H); 13C NMR (CDCl3, 100 MHz); δ 165.28,
152.44, 146.69, 142.29, 138.65, 135.40, 133.84, 132.04, 128.86
(2C), 128.61, 127.20, 124.65, 123.07, 122.83 (2C), 120.57,
120.26, 110.36, 28.99, 15.79; HRMS (ESI, m/s) for C21H17N4S,
calcd: 357.1174, found: 357.1173; anal. calcd for: C21H16N4S;
C,70.76; H,4.52; N, 15.72 found: C, 69.88; H,4.52; N, 15.43.
1-[4-(6-Ethyl-benzothiazol-2-yl)-phenyl]-5-methoxy-1H-
determined using Fargo MP-2D and are uncorrected. 1H NMR and
13C NMR spectra were recorded on Varian UNITY plus-400 at 400
and 100 MHz, respectively, using CDCl3 as a solvent. 1H NMR
chemical shifts are referenced to TMS or CDCl3 (7.26 ppm). 13C NMR
was referenced to CDCl3 (77.0 ppm). Mass spectra were recorded
with Bruker APEX II spectrometer. Elemental analyses were
performed on Elementar vario EL III analyzer, and the results were
found to be ±0.4% of the theoretical values. Purity of tested
compounds was >95%.
The experimental procedures to obtain compound
6 was
followed according to our previously published literature
protocol.6
o
benzotriazole (9d). Yield 85%; Yellow solid; mp = 200~202 C;
1H NMR (CDCl3, 400 MHz); δ 8.32 (d, J = 8.8 Hz, 1H),8.31 (d, J =
8.8 Hz, 1H), 8.01 (d, J = 8.4 Hz, 1H), 7.93 (t, J = 9.2 Hz, 2H), 7.76
(s, 1H) , 7.69 (d, J = 9.2 Hz,1H), 7.48 (s,1H) 7.37 (d, J = 8.0 Hz,
1H), 7.26 (dd, J = 9.2 Hz, 1H), 7.09 (d, J = 8.8 Hz, 1H), 3.93 (d, J
= 8.0 Hz, 3H), 2.82 (q, J = 7.6 Hz, 2H) , 1.33 (t, J = 7.8 Hz, 3H);
13C NMR (CDCl3, 100 MHz); δ 165.27, 160.91, 157.55, 152.46,
147.85, 142.27, 138.70, 135.41, 133.76, 128.83 (2C), 127.17,
123.06, 122.54 (2C), 121.16, 120.25, 116.61, 111.01, 55.88,
29.98, 15.75 HRMS (ESI+, m/s) for C22H19N4OS, calcd: 387.1280,
found: 387.1281; anal. calcd for: C22H18 N4OS; C, 68.37; H, 4.69;
N, 14.50 found: C, 67.41; H, 4.66; N, 14.23.
General procedure for the synthesis of compound 9a-9p. To a
stirred solution of 2- (4-aminophenyl) benzothiazole
6 in 2N
HCl was added sodium nitrite (2.0 equiv) at 0 – 5 °C and stirred
for 10 minutes followed by the addition of sodium azide (3.0
equiv) at the same temperature and allowed to stir until the
completion of the starting material. The completion of the
reaction was monitored by TLC. After completion, the reaction
was diluted with water and extracted in ethyl acetate, dried
over Na2SO4 and concentrated under vacuum to get the
desired azide compounds
7. To the crude compounds 7, 2.0
equiv of 2-(Trimethylsilyl)phenyl trifluoromethanesulfonates
8
was added followed by the addition of 2.0 equiv of CsF and
heated at 55 °C for 12h in acetonitrile as solvent. The
completion of the reaction was monitored by TLC. After
completion, the reaction was diluted with water and extracted
with dichloromethane and dried over Na2SO4 and
1-[4-(6-Ethyl-benzothiazol-2-yl)-2-methyl-phenyl]-1H-
benzotriazole (9e). Yield 86%; White solid; mp = 150~152o C;
1H NMR (CDCl3, 400 MHz); δ 8.21 (s, 1H), 8.18 (d, J = 8.4
Hz,1H), 8.08 (dd, J = 8.4 Hz, 1H), 8.02 (d, J = 8.0 Hz, 1H), 7.54 (s,
1H), 7.53 (dd, J = 8.0 Hz, 2H), 7.45 (t, J = 7.2 Hz, 1H), 7.40 (d, J =
8.4 Hz,1H), 7.37 (dd, J = 8.4 Hz,1H), 2.81 (q, J = 7.6, 2H), 2.68 (s,
3H); 1.33 (t, J = 7.8, 3H); 13C NMR (CDCl3, 100 MHz); δ 165.33,
152.36, 145.67, 142.29, 136.88, 135.98, 135.41, 135.07,
133.67, 130.37,128.25, 127.31, 127.15, 125.95, 124.27, 123.04,
120.22, 120.16, 109.97, 28.93, 17.99, 15.72; HRMS (ESI+, m/s)
for C22H18N4SNa, calcd: 393.1150, found: 393.1148 anal. calcd
for: C22H18N4S; C, 71.32; H, 4.90; N, 15.12 found: C, 71.41; H,
4.91; N, 15.08.
concentrated to afford the final compounds 9a-9p in excellent
yields.
1-(4-Benzothiazol-2-yl-phenyl)-1H-benzotriazole (9a). Yield
95%; White solid; mp = 218~220 oC; 1H NMR (CDCl3, 400 MHz):
δ 8.35 (dt, J = 8.4 Hz, 2H), 8.19 (d, J = 8.4 Hz,1H), 8.12 (d, J = 8.0
Hz, 1H), 7.98 (dt, J = 8.4 Hz, 2H),7.95 (d, J = 8.0 Hz, 1H), 7.83 (d,
J = 8.4 Hz, 1H ), 7.62 (t, J = 7.2 Hz, 1H), 7.54 (t, J = 7.2 Hz, 1H),
7.48 (t, J = 7.2 Hz, 1H), 7.44 (t, J = 7.2 Hz, 1H); 13C NMR (CDCl3,
100 MHz): δ 166.24, 154.13, 146.70, 138.86, 135.16, 133.64,
132.01, 128.99 (2C), 128.64, 126.61, 125.60, 124.66, 123.45,
122.82 (2C) , 121.72, 120.58, 110.34; HRMS (ESI+, m/s) for
C19H13N4S, calcd: 329.0861, found: 329.0859; anal. calcd for:
C19H12N4S; C, 69.49; H,3.67; N, 17.06 found: C, 69.49; H, 3.68;
N, 17.08.
1-[4-(6-Ethyl-benzothiazol-2-yl)-2-methyl-phenyl]-5-methoxy-
1H-Benzotriazole (9f). Yield 85%; White solid; mp = 160~162
oC; 1H NMR (CDCl3, 400 MHz); δ 8.20 (s, 1H), 8.08 (d, J = 8.0 Hz,
1H),8.02 (d, J = 8.4 Hz, 1H), 7.76 (s, 1H),7.52 (d, J = 8.0 Hz,
1H),7.48 (s, 1H), 7.38 (d, J = 8.4 Hz, 1H),7.27 (d, J = 8.4 Hz,1H),
7.20 (d, J = 8.8 Hz, 1H), 3.94 (s, 3H),2.82 (q, J = 7.6 Hz, 2H), 2.28
(s, 3H), 1.33 (t, J = 7.6 Hz,3H); 13C NMR (CDCl3, 100 MHz); δ
165.39, 157.46, 152.41, 146.75, 142.32, 136.99, 135.90,
135.45, 135.05, 130.40, 129.24, 127.24, 127.19, 125.97,
123.09, 120.97, 120.25, 110.63, 98.95, 55.79, 28.97,
18.01,15.75; HRMS (ESI+, m/s) for C23H21N4OS, calcd:
1-(4-Benzothiazol-2-yl-phenyl)-5-methoxy-1H-benzotriazole
(9b). Yield 90%; White solid; mp = 186~188 oC; 1H NMR (CDCl3,
400 MHz): δ 8.34 (d, J = 8.8 Hz, 1H),8.33 (d, J = 8.8 Hz,1H), 8.12
(d, J = 7.6 Hz, 1H), 8.02 (d, J = 9.6 Hz, 1H), 7.94 (t, J = 8.8 Hz,
3H), 7.54 (t, J = 7.6 Hz, 1H), 7.43 (t, J = 7.6 Hz,1H), 7.26 (d, J =
6.4 Hz, 1H), 7.1 (d, J = 8.4 Hz, 2H), 3.93 (d, J = 6.4 Hz , 3H); 13
C
This journal is © The Royal Society of Chemistry 20xx
J. Name., 2013, 00, 1-3 | 5
Please do not adjust margins

Please do not adjust margins
MedChemComm
Page 6 of 9
View Article Online
DOI: 10.1039/C6MD00034G
Journal Name
ARTICLE
401.1437, found: 401.1431; anal. calcd for C23H20N4OS: C, 130.57, 128.31, 127.41, 126.61, 126.14, 125.64, 124.33,
68.98; H, 5.03; N, 13.99 found: C, 68.87; H, 4.99; N, 13.90.
123.48, 121.74, 120.24, 109.99, 18.05; HRMS (ESI+, m/s) for
C20H14N4SNa, calcd: 365.0837, found: 365.0839; anal. calcd for:
1-[4-(6-Trifluoromethyl-benzothiazol-2-yl)-phenyl]-1H-
o
benzotriazole (9g). Yield 84%; Yellow solid; mp = 272~274 C; C20H14N4S; C,70.15; H, 4.12; N, 16.36 found: C, 70.03; H, 4.13;
1H NMR (CDCl3, 400 MHz): δ 8.38 (d, J = 8.4 Hz, 2H), 8.26 (s, N, 16.21.
1H), 8.21 (d, J = 8.0 Hz, 2H), 8.02 (d, J = 8.8 Hz, 2H), 7.85 (d, J = 1-(4-Benzothiazol-2-yl-2-methyl-phenyl)-5-methoxy-1H-
8.4 Hz, 1H),7.78 (d, J = 8.8 Hz, 1H), 7.63 (t, J = 7.6 Hz, 1H), 7.50 benzotriazole (9l). Yield 83%; White solid; mp = 122~124 oC; 1H
(t, J = 7.8 Hz, 1H); 13C NMR (CDCl3, 100 MHz): δ 146.77, NMR (CDCl3, 400 MHz): δ 8.23 (s, 1H), 8.11 (t, J = 8.4 Hz,
139.48, 135.21, 132.95, 131.97, 129.30 (2C), 128.78, 124.78, 2H),7.96 (dt, J = 6.8 Hz,1H), 7.54 (d, J = 6.4 Hz, 2H),7.49 (d, J =
124.26 (q, J = 292.5, CF3), 123.78, 123.63, 123.60, 122.86 (2C), 2.4 Hz, 1H), 7.45 (t, J = 7.0 Hz, 1H), 7.27 (d, J = 3.2 Hz, 1H), 7.20
120.69, 119.47, 119.43, 114.21, 110.31; HRMS (ESI, m/s) for (dd, J = 8.8 Hz, 1H), 3.94 (s, 3H), 2.92 (s, 3H); 13C NMR (CDCl3,
C20H12N4S, calcd: 397.0730, found: 397.0729; anal. calcd for: 100 MHz): δ 166.36, 160.77, 157.45, 154.08, 146.75, 140.95,
C20H11F3N4S; C, 60.60; H, 2.80; N, 14.13 found: C, 59.00; H, 137.18, 135.96, 135.21, 130.55, 127.51, 126.01, 125.63,
2.77; N, 13.73.
124.71, 123.47, 116.69, 110.61, 98.93, 90.05, 55.81; HRMS
(ESI+, m/s) for C21H17N4OS, calcd: 373.1119, found: 373.1118.
5-Methoxy-1-[4-(6-trifluoromethyl-benzothiazol-2-yl)-
phenyl]-1H-Benzotriazole (9h). Yield 84%; White solid; mp = 1-[4-(6-Methoxy-benzothiazol-2-yl)-2-methyl-phenyl]-1H-
o
1
o
228~230 C; H NMR (CDCl3, 400 MHz): δ 8.37 (d, J = 8.8 Hz, Benzotriazole (9m). Yield 81%; white solid; mp = 176~178 C;
1H), 8.36 (d, J = 8.8 Hz, 1H), 8.25 (s, 1H ), 8.20 (d, J = 8.4 Hz, 1H NMR (CDCl3, 400 MHz): δ 8.18 (dt, J = 8.0 Hz, 2H), 8.05 (dd,
1H), 8.03 (dd, J = 9.6 Hz, 1H), 8.01 (s, 1H), 7.97 (d, J = 8.8 Hz, J = 8.4 Hz, 1H), 8.03 (d, J = 8.8 Hz, 1H), 7.54 (t, J = 8.0 Hz, 1H),
1H), 7.75 (dd, J = 8.4 Hz, 1H), 7.27 (d, J = 9.2 Hz, 1H), 7.11 (dd, J 7.52 (d, J = 8.0 Hz, 1H), 7.46 (t, J = 8.0 Hz,1H), 7.40 (dt, J = 9.2
= 8.4 Hz, 1H), 3.94 (d, J = 5.6 Hz, 3H); 13C NMR (CDCl3, 100 Hz, 2H), 7.14 (dd, J = 9.2 Hz,1H), 3.91 (s, 3H), 2.27 (s, 3H); 13C
MHz): δ 169.34, 160.99, 157.60, 156.02, 141.96, 139.51 (d, J = NMR (CDCl3, 100 MHz): δ 163.75, 158.07, 148.62, 145.65,
5.3, 1C), 135.20, 132.83, 129.28(d, J = 3.8 ,2C), 125.44 (q, J = 136.69, 136.64, 135.99, 135.07, 133.67, 130.15, 128.26,
270.6, CF3), 123.76, 123.60 (d, J = 3.8, 1C), 122.94 (2C), 122.56, 127.35, 125.76, 124.29, 123.96, 120.19, 116.06, 109.99,
121.26, 119.04 (d, J = 3.8, 1C), 116.64, 110.95, 55.85 (d, J = 104.08, 55.81, 18.02; HRMS (ESI+, m/s) for C21H16N4OSNa,
11.3, 1C) HRMS (ESI+, m/s) for C21H14 F3N4OS, calcd: 427.0840, calcd: 395.0942, found: 395.0945; anal. calcd for: C21H16N4OS;
found: 427.0843; anal. calcd for C21H13F3N4OS: C, 59.15; H, C, 67.72; H, 4.33; N, 15.04 found: C, 67.53; H, 4.33; N, 15.03.
3.07; N, 13.14 found: C, 58.87; H, 3.11; N, 13.04.
5-Methoxy-1-[4-(6-methoxy-benzothiazol-2-yl)-2-methyl-
1-[4-(6-Methoxy-benzothiazol-2-yl)-phenyl]-1H-benzotriazole phenyl]-1H-benzotriazole (9n). Yield 79%; White solid; mp =
o
(9i). Yield 86%; Yellow solid; mp = 176~178 C; 1H NMR (CDCl3, 162~164 oC; 1H NMR (CDCl3, 400 MHz): δ 8.17 (s, 1H), 8.04 (t, J
400 MHz); δ 8.29 (dt, J = 9.2 Hz, 2H),8.18 (dt, J = 8.4 Hz, = 6.4 Hz, 1H), 8.01 (d, J = 9.2 Hz, 1H), 7.51 (d, J = 8.0 Hz,1H),
1H),7.99 (dd, J = 9.2 Hz, 1H), 7.95 (dt, J = 8.8 Hz, 2H), 7.83 (dt, J 7.48 (s, 1H), 7.40 (s, 1H), 7.27 (d, J = 6.8 Hz, 1H),7.20 (d, J = 8.8
= 8.4 Hz, 1H ),7.61 (d, J = 7.6 Hz, 1H), 7.48 (t, J = 8.0 Hz, 1H), Hz,1H), 7.14 (d, J = 8.8 Hz, 1H), 3.94 (s, 3H), 3.92 (s, 3H), 3.94
7.39 (d, J = 2.4 Hz, 1H), 7.13 (dd, J = 9.2 Hz, 1H), 3.92 (s, 3H); (s, 3H); 13C NMR (CDCl3, 100 MHz): δ 163.79, 160.75, 158.10,
13C NMR (CDCl3, 100 MHz); δ 163.67, 158.07, 148.68, 146.66, 157.45, 148.66, 146.73, 136.66, 135.09, 130.17, 127.25,
138.45, 136.59, 133.81, 132.02, 128.63 (2C), 128..59, 124.63, 125.85, 123.98, 120.98, 116.68, 116.06, 110.03, 104.13, 98.92,
123.95, 122.83 (2C), 120.54, 116.03, 110.35, 104.13, 55.83; 90.06, 55.83, 55.79, 18.00; HRMS (ESI+, m/s) for C22H19N4O2S,
HRMS (ESI, m/s) for C20H15N4OS, calcd: 59.0958, found: calcd: 403.1230, found: 403.1223; anal. calcd for C22H18 N4O2S:
359.0961; anal. calcd for: C20H14N4OS; C, 67.02; H, 3.94; N, C, 65.65; H, 4.51; N, 13.92 found: C, 65.56; H, 4.56; N, 13.86.
15.63 found: C, 66.84; H, 3.94; N, 15.60.
1-[2-Methyl-4-(6-trifluoromethyl-benzothiazol-2-yl)-phenyl]-
5-Methoxy-1-[4-(6-methoxy-benzothiazol-2-yl)-phenyl]-1H-
1H-Benzotriazole (9o). Yield 84%; White solid; mp = 188~190
Benzotriazole (9j). Yield 81%; White solid; mp = 192~194 C; oC; 1H NMR (CDCl3, 400 MHz): δ 8.26 (s, 2H), 8.21 (d, J = 7.2 Hz,
1H NMR (CDCl3, 400 MHz): δ 8.27 (t, J = 8.4 Hz, 2H), 7.97 (t, J = 1H), 8.20 (dt, J = 8.0 Hz, 1H ), 8.15 (dd, J = 8.4 Hz, 1H), 7.78 (dd,
9.2 Hz, 1H), 7.91 (t, J = 8.0 Hz, 2H), 7.7 (d, J = 8.8Hz, 1H), 7.46 J = 8.4 Hz, 1H), 7.59 (d, J = 8.0 Hz, 1H), 7.56 (t, J = 8.0 Hz, 1H),
(s, 1H) , 7.11 (m, 2H), 7.97 (d, J = 8.8 Hz,1H), 7.75 (dd, J = 8.4 7.47 (t, J = 7.2 Hz, 1H),7.42 (dt, J = 8.4,1H), 2.31 (s, 3H); 13C
Hz,1H), 7.27 (d, J = 9.2 Hz, 1H), 3.92 (s, 6H); 13C NMR (CDCl3, NMR (CDCl3, 100 MHz): δ 169.46, 155.97, 145.72, 137.75,
100 MHz): δ 163.24, 160.54, 157.67, 157.16, 148.28, 138.08, 136.30, 135.26, 134.26, 133.61, 130.86, 128.42, 127.88,
136.22, 133.30, 132.92, 128.25, 123.50, 122.54, 122.13, 127.52, 126.65 (q, J = 244.8, CF3); 126.37, 124.42, 123.61,
120.60, 116.36, 115.68, 110.72, 103.77, 98.83, 90.52, 55.46; 123.56, 120.31, 119.47, 109.93, 18.14; HRMS (ESI+, m/s) for
HRMS (ESI+, m/s) for C21H17N4O2S, calcd: 389.1072, found: C21H14F3N4S, calcd: 411.0891, found: 411.0893; anal. calcd for:
o
389.1071.
C21H13F3N4S; C, 61.46; H, 3.19; N, 13.65 found: C, 61.43; H,
3.19; N, 13.66.
1-(4-Benzothiazol-2-yl-2-methyl-phenyl)-1H-benzotriazole
o
(9k). Yield 86%; White solid; mp = 156~158 C; 1H NMR (CDCl3, 5-Methoxy-1-[2-methyl-4-(6-trifluoromethyl-benzothiazol-2-
400 MHz): δ 8.23 (s, 1H), 8.19 (dt, J = 7.6 Hz, 1H),8.12 (t, J = 7.2 yl)-phenyl]-1H-benzotriazole (9p). Yield 83%; white solid; mp =
o
1
Hz, 2H), 7.96 (d, J = 7.2 Hz, 1H), 7.57-7.52 (m, 3H), 7.48-7.40 158~160 C; H NMR (CDCl3, 400 MHz): δ 8.30 (s, 1H), 8.26 (s,
(m, 3H), 2.29 (s, 3H); 13C NMR (CDCl3, 100 MHz): δ 166.37, 1H), 8.21 (d, J = 8.4 Hz, 1H), 8.16 (dd, J = 8.0 Hz, 1H), 7.78 (dd, J
154.09, 145.69, 137.14, 136.09, 135.22, 134.94, 133.68, = 8.8 Hz, 1H), 7.59 (d, J = 8.0 Hz, 1H), 7.49-7.47 (m, 1H),7.31 (d,
This journal is © The Royal Society of Chemistry 20xx
J. Name., 2013, 00, 1-3 | 6
Please do not adjust margins

Please do not adjust margins
MedChemComm
Page 7 of 9
View Article Online
DOI: 10.1039/C6MD00034G
Journal Name
ARTICLE
J = 9.2 Hz, 1H), 7.22 (dd, J = 8.8 Hz, 1H), 3.95 (s, 3H); 13C NMR resuspended in serum-free medium. Medium containing 10%
(CDCl3, 100 MHz): δ 168.99, 157.01, 155.46, 146.19, 137.24, FBS was added to the lower chamber as chemo attractant and
135.55, 134.81, 133.64, 130.34, 128.60, 127.09, 126.88, then the cells were seeded on the upper chamber at a density
125.87, 123.62 (q, J = 270.6, CF3), 123.27, 123.01 (d, J = 3.8, of 1 × 105 cells/well in 300 μL of serum-free medium. The
1C), 120.61, 119.04, 110.15, 98.39, 55.31, 17.58; HRMS (ESI+, chamber was incubated for 24 h at 37 °C. At the end of
m/s) for C22H16F3N4OS, calcd: 441.0998, found: 441.0991.
incubation, the cells in the upper surface of the membrane
were carefully removed with a cotton swab and cells invaded
across the Matrigel to the lower surface of the membrane
were fixed with methanol and stained with haematoxylin and
eosin. The invasive cells on the lower surface of the membrane
filter were counted with a microscope.
Biology
Cell culture. Human gingival carcinoma Ca9-22 cells were cultured
in DMEM-F12 medium (Gibco, Grand Island, NY). Cells were
supplemented with 10% fetal bovine serum (FBS), 100 U/mL
penicillin, 100 ꢀg/mL streptomycin, 0.03% glutamine, and
1mMsodiumpyruvate. Cells were kept at 37∘C in a humidified
atmosphere containing 5% CO2.
Quantitative RT-PCR. Total RNA was extracted from Ca9-22
cells with 2 μM 9i for 2h followed by 0.5 J/cm2 UVA irradiation.
Eight hours after irradiation and the Trizol reagent (Invitrogen)
was used. Two micrograms of total RNA were used for reverse
transcription using RevertAidTM H Minus First Strand cDNA
Synthesis Kit (Fermentas, MA, USA) following the
manufacturer’s instructions. For real-time qPCR, the ABI PRISM
7900 Sequence Detection System (ABI) was used. Nine
UVA irradiation. For UVA irradiation, a specific UVA lamp
emitting a peak wavelength of 365 nm (UVP, Upland, CA, USA)
was used. The cultured cells were pre-treated with different
agents at 2 μM for 2 h before UVA irradiation. The cultured
cells were rinsed with phosphate-buffered saline (PBS) and
then irradiated with UVA in PBS to avoid the formation of
medium-derived toxic photoproducts induced by UV exposure.
The doses of irradiation were measured by a UVX digital
radiometer (UVP, Upland, CA, USA) and the incident irradiance
at the surface of the cells was found to be 4.762 mW/cm2 at
the target distance of 17 cm. The calculation formula of
designated time for UVA treatment is energy (J/cm2) = power
microlitres of master-mix (2X Maxima
ⓇSYBR Green/ROXqPCR
Master Mix, 0.3 μM forward primer, 0.3 μM reverse primer)
and 1 microlitre of 100 nanograms cDNA were added to the
96-well plates and amplified using a suitable program. At the
completion of cycling, melting curve analysis was performed to
establish the specificity of the amplicon production. Data were
analyzed according to the comparative Ct method and were
normalized by β-Actin expression.
(W/cm2)
× exposure time (s). Immediately after photo
treatment, PBS was removed and media were added to the
cells. All the following experiments were performed three
times in triplicate.
The primers used for amplification were as follows.
syndecan-1: forward, 5’ – AGGACGAAGGCAGCTACTCCT - 3’;
reverse, 5’ – TTTGGTGGGCTTCTGGTAGG - 3’
Cell viability. Cell viability was assessed by the MTT assay, a
mitochondrial function assay based on the ability of viable cells
to reduce the redox indicator MTT to insoluble formazan
crystals by mitochondrial dehydrogenase. Briefly, cells were
seeded in a 96-well plate at the cell density of 10000 cells/well.
After an overnight incubation, the cells were treated with
compounds at 2 μM for 2 h followed by 0.5 J/cm2 UVA
irradiation and incubated for 24 h. The medium was then
discarded and replaced with 10 μL of MTT dye. Plates were
incubated at 37 °C for 2 h. The resulting formazan crystals
were solubilized in 100 μL DMSO, and the optical density was
read at 540 nm with a microplate reader (MRX-II, Dynex
technology, Chantilly, VA).
Wound healing assay. A total of 3 × 105 Ca9-22 cells were
seeded onto 12-well plates and then grown to complete
confluence. A 200 μL plastic pipette tip was used to scratch the
culture monolayer and create a clean 1 mm wide wound area.
Cells were treated with 2 μM agents for 2h followed by 0.5
J/cm2 UVA irradiation. Sixteen hours after irradiation, wound
gaps were photographed at each time interval. The wound
areas were then analyzed and calculated using the online
software Wimasis (Wimasis GmbH, Munich, Germany).
Cell invasion assay. The ability of Ca9-22 cells for passing
through Matrigel-coated filters was measured by the Boyden
chamber invasion assay. Cells were treated with 2 μM agents
for 2h followed by 0.5 J/cm2 UVA irradiation. Twenty two
hours after irradiation, cell were detached by trypsin and
heparanase: forward, 5’ – AGAACAGCACCTACTCAAGAAGC - 3’;
reverse, 5’ – ATTCCCATTCGGGCTGACAGG - 3’
MMP-9: forward, 5’ – GTGCTGGGCTGCTGCTTTGCTG - 3’;
reverse, 5’ - GTC GCCCTCAAAGGTTTGGAAT - 3’
MMP-2: forward, 5’ – TCACATACAGGATCATTGGCTAC - 3’;
reverse, 5’ – GCCAGGAGTCCGTCCTTA - 3’
TIMP-3: forward, 5’ – AAGCGATGTCAGAGGGCG - 3’;
reverse, 5’ – AACTGG ATGGGCAGCAGG - 3’
β-Actin: forward, 5’-GGAAATCGTGCGTGAC-3’;
reverse, 5’-ATGCCCAGGAAGGAA-3’
Protein extraction and western blot analysis. Total cell
extracts from cultured cells were obtained by lysing the cells in
ice-cold RIPA buffer (50 mM Tris-HCl, pH 7.5, 5 mM EDTA, 1
mM EGTA, 1% Triton X-100, and 0.25% sodium deoxycholate)
containing 2 mM PMSF, 2 μg/mL aprotinin, 2 μg/ml leupeptin,
2 mM Na3VO4 and 2 mM NaF. After centrifugation at 14,000
rpm for 10 min, protein in the supernatants was quantified by
Bradford method (Bio-Rad). Twenty micrograms of protein per
lane was applied in 10% SDS-poly-acrylamide gel. After
electrophoresis, protein was transferred from the gel to the
polyvinylidene difluoride (PVDF) membrane (Millipore,
Billerica, MA). The membranes were blocked at room
temperature for 1 h in PBS + 0.1% Tween 20 (PBS-T) containing
5% skim milk. After briefly rinsing with PBS-T, the membrane
was incubated with primary antibody at room temperature for
2 h or at 4 oC overnight.
This journal is © The Royal Society of Chemistry 20xx
J. Name., 2013, 00, 1-3 | 7
Please do not adjust margins

Please do not adjust margins
MedChemComm
Page 8 of 9
View Article Online
DOI: 10.1039/C6MD00034G
Journal Name
ARTICLE
14 J. Reiland, R. D. Sanderson, M. Waguespack, S. A. Barker, R.
,
Rabbit polyclonal antibodies against EGFR, ERK and p-ERK,
MMP-2, 9 and TIMP-3 were purchased from Santa Cruz
Biotechnology (Santa Cruz , CA), Cell Signaling Technology
(Beverly, MA), and Abgent (San Diego, CA), respectively. Goat
polyclonal antibody against p-EGFR was purchased from Santa
Cruz Biotechnology (Santa Cruz, CA). Mouse monoclonal
antibody against β-Actin was purchased from Millipore
(Billerica, MA). The membrane was incubated with the
corresponding horseradish peroxidase-labeled secondary
antibody (Santa Cruz Biotechnology) at room temperature for
1 h. Membranes were washed with PBS-T four times for 15
min, and the protein blots were visualized with Western
Lightning Chemiluminescence Reagent Plus (Perkin-Elmer Life
Sciences, Boston, MA). The relative amounts of specific
proteins were quantified by densitometry scanning of X-ray
films and analyzed by AlphaView Image software (Alpha
Innotech Corporation, CA).
Long, D. D. Carson and D. Marchetti, J Biol Chem. 2004, 279
8047.
15 V. Cohen-Kaplan, I. Doweck, I. Naroditsky, I. Vlodavsky, N.
Ilan, Cancer Res. 2008, 68, 10077.
16 a) F. Shi, J. P. Waldo, Y. Chen and R. Larock, Org.
Lett. 2008, 10, 2409. b) The reaction was carried out with
various other fluoride bases such as TBAF, TBAT and also
solvent and found CsF as best condition.
17 a) C. –C. Liang, A. Y. Park and J. L. Guan, Nature Protocols,
2007,
Hinkes, J. Spring, R. L. Gallo and E. J. Lose, Annu Rev Cell Biol.
1992, , 365.
4, 329. b) M. Bernfield, R. Kokenyesi, M. Kato, M. T.
8
18 K. K. Ang, B. A. Berkey, X. Tu, H. Z. Zhang, R. Katz, E. H.
Hammond, K. K. Fu and L. Milas, Cancer Res. 2002, 62, 7350.
19 S. Takaoka, M. Iwase, M. Uchida, S. Yoshiba, G. Kondo, H.
Watanabe, M. Ohashi, M. Nagumo and S. Shintani. Int. J.
Oncol. 2007, 30, 1469.
20 J. R. Grandis, M. F. Melhem, E. L. Barnes and D. J. Tweardy,
Cancer. 1996, 78, 1284.
21 Y. Ito, Y. Sasaki, M. Horimoto, S. Wada, Y. Tanaka, A.
Kasahara, T. Ueki, T. Hirano, H. Yamamoto, J. Fujimoto, E.
Okamoto, N. Hayashi and M. Hori, Hepatology. 1998, 27
951.
,
Acknowledgements
22 A. Adeyinka, Y. Nui, T. Cherlet, L. Snell and P. H. Watson, Clin
Cancer Res. 2002, , 1747.
The authors gratefully acknowledge the funding from Ministry
of Science and Technology (MOST).
8
23 J. Albanell, J. Codony-Servat, F. Rojo, J. M. Del Campo, S.
Sauleda, J. Anido, G. Raspall, J. Giralt, J. Rosello, R. I.
Nicholson, J. Mendelsohn and J. Baselga, Cancer Res. 2001,
61, 6500.
References
1
2
R. Mishra, Oral Oncol. 2012, 48, 578.
T. H. Yang, C. T. Chen, C. P. Wang and P. J. Lou, Oral Oncol.
2007, 43, 358.
R. Bhuvaneswari, Q. F. Ng, P. S. Thong and K. C. Soo,
Oncotarget. 2015, 6, 13487.
D. E. Dolmans, D. Fukumura and R. K. Jain, Cancer. 2003, 3,
380.
Q. Peng, K. Berg, J. Moan, M. Kongshaug and J. M. Nesland,
Photochem Photobiol. 1997, 65, 235.
W.-P. Hu, Y. K. Chen, C. C. Liao, H. S. Yu, Y. M. Tsai, S. M.
Huang, F. Y. Tsai, H. C. Shen, L. S. Chang, J. J. Wang, Bioorg.
Med. Chem. 2010, 18, 6197.
3
4
5
6
7
8
Y. -K. Chen, G. C. Senadi, C. -H. Lee, Y. -M. Tsai, Y. -R. Chen,
W. -P. Hu, Y. -W. Chou, K. -K. Kuo and J. -J. Wang, Chem. Res.
Toxicol. 2014, 27, 1187.
a) H. -Y. Hsieh, W. -C. Lee, G. C. Senadi, W. -P. Hu, J. -J. Liang,
T. -R. Tsai, Y. -W. Chou, K. -K. Kuo, C. -Y. Chen and J. -J.
Wang, J. Med. Chem. 2013, 56, 5422. b) Y. Ren, L. Zhang, C. –
H. Zhou and R. –X. Geng, Med. Chem. 2014, 4, 640. c) S.
Zhang, Y. Luo, L. –Q. He, Z. –J. Liu and A. –Q. Jiang, Bioorg.
Med. Chem. 2013, 21, 3723. d) J. S. Duncan, L. Gyenis, J.
lenehan, M. Bretnar, L. M. Graves, T. A. Haystead, and T. W.
Litchfield, Mol. Cell. Proteomics, 2008, 6, 1077. e) M.
Entezar, M. safari, M. Hekmati, and A. Azin, Med. Chem. Res.
2014, 23, 487.
9
P. L. Lee, H. V. Weelden and P. L. B. Bruijnzeel Photochem.
Photobiol. 2008, 84, 1528.
10 K. Kessenbrock, V. Plaks and Z. Werb, Cell. 2010, 141, 52.
11 S. Chakraborti, M. Mandal, S. Das and A. Mandal, Mol Cell
Biochem. 2003, 253, 269.
12 E. I. Deryugina and J. P. Quigley, Cancer Metastasis Rev
2006, 25, 9.
.
13 T. Muramatsu, M. Saitoh, Y. Ro, T. Uekusa, E. Iwamura, K.
Ohta, Y. Kohno, Y. Abiko and M. Shimono, Oncol Rep. 2008,
20, 1353.
This journal is © The Royal Society of Chemistry 20xx
J. Name., 2013, 00, 1-3 | 8
Please do not adjust margins

Page 9 of 9
MedChemComm
View Article Online
DOI: 10.1039/C6MD00034G
TOC Graphic