Total synthesis and pharmacological characterization of solomonsterol A, a potent marine pregnane-X-receptor agonist endowed with anti-inflammatory activity

Article abstract of DOI:10.1021/jm200241s

Recently, we reported the identification of a novel class of pregnane-X-receptor (PXR) agonists, solomonsterols A and B, isolated from the marine sponge Theonella swinhoei. Preliminary pharmacological studies demonstrated that these natural compounds are potential leads for the treatment of human disorders characterized by dysregulation of innate immunity. In this article, we describe the first total synthesis of solomonsterol A and its in vivo characterization in animal models of colitis. Using transgenic mice expressing the human PXR, we found that administration of synthetic solomonsterol A effectively protects against development of clinical signs and symptoms of colitis and reduced the generation of TNFα, a signature cytokine for this disorder. In addition, we have provided the first evidence that solomonsterol A might act by triggering the expression of TGFβ and IL-10, potent counter-regulatory cytokines in inflammatory bowel diseases (IBD). Finally, we have shown that solomonsterol A inhibits NF-κB activation by a PXR dependent mechanism. In summary, solomonsterol A is a marine PXR agonist that holds promise in the treatment of inflammation-driven immune dysfunction in clinical settings.

Full text of DOI:10.1021/jm200241s

ARTICLE
pubs.acs.org/jmc
Total Synthesis and Pharmacological Characterization of
Solomonsterol A, a Potent Marine Pregnane-X-Receptor Agonist
Endowed with Anti-Inflammatory Activity
Valentina Sepe,† Raffaella Ummarino,† Maria Valeria D’Auria,† Andrea Mencarelli,‡ Claudio D’Amore,‡
Barbara Renga,‡ Angela Zampella,*,†,§ and Stefano Fiorucci‡,§
†Dipartimento di Chimica delle Sostanze Naturali, Universitꢀa di Napoli “Federico II”, via D. Montesano 49, 80131 Napoli, Italy
‡Dipartimento di Medicina Clinica e Sperimentale, Universitꢀa di Perugia, Nuova Facoltꢀa di Medicina e Chirurgia, Via Gerardo Dottori 1,
S. Andrea delle Fratte, 06132 Perugia, Italy
ABSTRACT: Recently, we reported the identification of a
novel class of pregnane-X-receptor (PXR) agonists, solomon-
sterols A and B, isolated from the marine sponge Theonella
swinhoei. Preliminary pharmacological studies demonstrated
that these natural compounds are potential leads for the
treatment of human disorders characterized by dysregulation
of innate immunity. In this article, we describe the first total
synthesis of solomonsterol A and its in vivo characterization in
animal models of colitis. Using transgenic mice expressing the
human PXR, we found that administration of synthetic solo-
monsterol A effectively protects against development of clinical
signs and symptoms of colitis and reduced the generation of TNFR, a signature cytokine for this disorder. In addition, we have
provided the first evidence that solomonsterol A might act by triggering the expression of TGFβ and IL-10, potent counter-
regulatory cytokines in inflammatory bowel diseases (IBD). Finally, we have shown that solomonsterol A inhibits NF-kB activation
by a PXR dependent mechanism. In summary, solomonsterol A is a marine PXR agonist that holds promise in the treatment of
inflammation-driven immune dysfunction in clinical settings.
’ INTRODUCTION
their transcriptional activation.5ꢀ7 Ligands for PXR, such as
rifaximin,5,7 a broad-spectrum semisynthetic rifamycin deriva-
tive, have been shown effective in treating human IBDs. Thus,
rifaximin is efficient in inducing clinical remission of moderately
active Crohn’s.8 In addition, rifaximin could contribute to the
maintenance of the intestinal barrier integrity by regulating the
metabolism of xenobiotics by increasing the expression and
activity of PXR and PXR-regulated genes.7,9 The preventive
and therapeutic role of rifaximin has been demonstrated in
rodent models of colitis using transgenic mice that express the
human PXR.10
Steroids have always attracted considerable attention because
of being a fundamental class of biological signaling molecules.
Their profound biological, scientific, and clinical importance is
now well validated.11,12 They can regulate a variety of biological
processes and thus have the potential to be developed as drugs
for the treatment of a large number of diseases13,14 including
cardiovascular,15 autoimmune diseases,16 and cancer.17 In recent
years, a variety of steroids with unusual and interesting structures
have been isolated from a wide range of marine organisms,
particularly from sponges and echinoderms.18
Inflammatory bowel diseases (IBD), encompassing Crohn’s
disease (CD) and ulcerative colitis (UC), are two progressive and
self-destructive disorders of the small intestine and colon arising
from a genetically driven dysregulation of innate and adaptive
immunity. In recent years, a growing body of evidence has been
accumulated, indicating that dysregulation of innate immunity
plays a role in IBD development and self-perpetuation. The
innate immune system has dual roles in host defense, providing
direct and immediate response against microbial invaders as well
as playing an instructive role in influencing the nature of adaptive
immunity. This instructive role of the innate immune system is
served by a subset of intestinal mucosal immune cells, the antigen
presenting cells (APCs), which includes macrophages and
dendritic cells,1,2 suggesting that attenuation of unbalanced
generation of pro-inflammatory mediators by intestinal macro-
phages might be effective in protecting against IBD development.1
At least 27 nuclear receptors (NRs) are expressed in the colon
and intestine3 including steroid and xenobiotic receptor (SXR),
also known as pregnane-X-receptor (PXR), a transcription
factor important for xenobiotic metabolism.4 Following ligand
binding, PXR forms a heterodimer with the retinoid-X-receptor
(RXR) that binds to specific PXR response elements (PXREs),
located in the 50-flanking regions of PXR target genes, resulting in
Received: March 1, 2011
Published: May 22, 2011
r
2011 American Chemical Society
4590
dx.doi.org/10.1021/jm200241s J. Med. Chem. 2011, 54, 4590–4599
|

Journal of Medicinal Chemistry
ARTICLE
Figure 1. Solomonsterols A and B from Theonella swinhoei.
Scheme 1a
a Reagents and conditions: (a) CH2N2, quantitative; (b) p-TsCl, pyridine, quantitative; (c) CH3COOK, DMF/H2O 7:1, reflux, 78%; (d) H2 (1 atm), Pd/C,
THF/MeOH 1:1, 80%; (e) p-TsCl, pyridine; (f) LiBr, LiCO3, DMF, reflux, 83% over two steps; (g) mCPBA, Na2CO3, CH2Cl2/H2O 1:0.7; (h) H2SO4 1N,
THF, 73% over two steps; (i) LiBH4, MeOH/THF, 0 °C, 92%; (l) Et3N.SO3, DMF, 95°C; (m) Amberlite CG-120, sodium form, MeOH, 90% over two steps.
In the course of our interest in marine natural products as NR
ligands,19 we found the sponge Theonella swinhoei as an extra-
ordinary source of bioactive compounds.20ꢀ24 Among these,
the cyclic peptides, perthamides20 and solomonamides,21 are endowed
with anti-inflammatory activity whereas solomonsterols A and B,22
represent the first example of natural marine PXR agonists (Figure 1).
Effectively, in our previous paper,22 we demonstrated that
solomonsterols were potent inducers of PXR transactivation in a
human hepatocyte cell line (HepG2 cells) boosting the receptor
activity by 4ꢀ5-fold and were at least as potent as rifaximin. In
addition, both agents stimulated the expression of CYP3A4 and
MDR1 (cytochrome P450 3A4 and multidrug resistance 1), two
well characterized PXR responsive genes in the same cell line.25
Therefore, solomonsterols A and B are potential leads for the
treatment of human disorders characterized by inflammation and
dysregulation of innate immunity. Unfortunately, due to the
scarcity of biological material isolated from the marine sponge
Theonella swinhoei, further in vivo experiments were hampered.
In this article, we report the first total synthesis of solomonsterol
A (1) and its in vivo characterization in animal models of colitis.
’ RESULTS AND DISCUSSION
Chemistry. Key structural features of 1 are the presence of a
truncated C24 side chain, and three sulfate groups at C2, C3, and
C24. We envisaged that the commercially available hyodeoxy-
cholic acid (2) could be a suitable starting material to set up a
robust route to prepare solomonsterol A in large amounts. Thus,
the total synthesis of solomonsterol A (1) started with 2, which
was methylated with diazomethane and treated with tosyl
chloride in pyridine to give the corresponding 3,6-ditosylate
(4) in nearly quantitative yield (Scheme 1). When 4 was treated
with boiling DMF in the presence of CH3COOK for 1 h,
simultaneous inversion at the C-3 position and elimination at
the C-6 position took place to give methyl 3-hydroxy-5-cholen-
24-oate (5),26,27 which in turn was hydrogenated to give the
4591
dx.doi.org/10.1021/jm200241s |J. Med. Chem. 2011, 54, 4590–4599

Journal of Medicinal Chemistry
ARTICLE
Figure 2. Luciferase reporter assay performed in HepG2 transiently transfected with pSG5-PXR, pSG5-RXR, pCMV-βgal, and p(cyp3a4)TKLUC
vectors and stimulated for 18 h with rifaximin or solomonsterol A (0.1, 1, and 10 μM). *P < 0.05 versus not treated (NT) (n = 4).
required A/B trans ring junction in 6.28 The simultaneous
introduction of the 2β,3R-dihydroxy functionality was achieved
by the following three-step sequence:29,30 (a) elimination at the
C3-position and consequent introduction of the Δ-2 double
bond; (b) epoxidation with m-CPBA; and (c) acid catalyzed ring-
opening of the epoxide to afford diol 10. β-Elimination and
epoxidation were found to proceed with excellent regioselectivity
and stereoselectivity, respectively, as determined by an analysis of
NMR spectra and comparison of the NMR data of 8 and 9 with
related compounds.29,30 According to the F€urstꢀPlattner rule,31
epoxide ring-opening with sulphuric acid in THF provided the
desired 2β,3R-diol 10, exclusively.30 The 1H NMR signals of H-2
and H-3 (broad singlet at 3.89 ppm and broad singlet at 3.85
ppm, respectively) also confirmed the trans-diaxial disposition of
the two hydroxy groups in 10.
Reduction of the methyl ester at C24 with LiBH4 afforded triol
11 in 92% yield. Treatment of 11 with 10 equivalents of the
triethylammoniumꢀsulfur trioxide complex at 95 °C afforded
the ammonium sulfate salt of solomosterol A, which was
transformed via ion exchange into the desired target trisodium
salt 1 (Scheme 1). The complete match of optical rotation, NMR,
and HRMS data of solomonsterol A with that of the natural
product secured the identity of the synthetic derivative.
This synthesis was completed in a total of 10 steps starting
from commercially available hyodeoxycholic acid (2) and had an
overall yield of 31%. This route enabled us to prepare sufficient
quantities of solomonsterol A (1) to be further characterized in
pharmacological tests.
cells. The relative EC50 was 2.2 ( 0.3 μM for rifaximin and
5.2 ( 0.4 μM for solomonsterol A (n = 3).
Colon inflammation that develops in mice administered
TNBS (trinitrobenzenesulfonic acid) is a model of a Th1-mediated
disease with dense infiltrations of lymphocytes/macrophages in
the lamina propria and thickening of the colon wall.32,33 In order
to assess whether solomonsterol A would exert immune-mod-
ulatory activity, TNBS was administered to C57Bl/6 transgenic
mice expressing the human PXR. The hPXR mice express the
human PXR in the mice PXR-null background.10 Previous
studies have shown that the intestinal inflammation that deve-
lops in these mice in response to TNBS and other chemical agents
could be rescued by using agonists for hPXR, and therefore, this
mouse strain represents a validated model to study the effects of
hPXR activation. A previous report has shown that treating hPXR
transgenic mice with rifaximin, a human PXR agonist, rescues the
animals form colitis induced by TNBS.10 In these experiments,
mice were treated with solomonsterol A (1) and rifaximin for
7 days starting 3 days before intrarectal administration of TNBS
(Figure 3). As shown, administering hPXR transgenic mice with
solomonsterol A (1) effectively attenuated colitis development as
measured by assessing local and systemic signs of inflammation.
Thus, similarly to rifaximin, treatment with 1 at the dose of 10 mg/kg
protected against the development colitis, as measured by the
diarrhea score and weight loss (Figure 3A and B, n = 6ꢀ7; *p <
€
0.05 versus naive; **p < 0.05 versus TNBS group), and reduced
the macroscopic score of colitis as well as the microscopic score
€
(Figure 3CꢀD, n = 6ꢀ7; *p < 0.05 versus naive; **p < 0.05 versus
TNBS group). As shown in Figure 3E, histopathological samples
of colon removed from hPXR transgenic miceadministered TNBS
had an extensive cellular infiltrate, submucosal edema, and large
areas of epithelial erosions. These changes were robustly attenu-
ated by pretreatment with solomonsterol A (1) or rifaximin.
These effects were supported by an attenuation of signs of
inflammation-driven immune dysfunction induced by TNBS
administration. Thus, similarly to rifaximin, solomonsterol A
’ PHARMACOLOGICAL EVALUATION
Anti-Inflammatory Activity of Solomonsterol A in a Model
of Colitis Induced by TNBS Administration to PXR Trans-
genic Mice. We have first investigated whether the synthetic
solomonsterol A (1) transactivates hPXR in PXR transactivation
assay. As illustrated in Figure 2, solomonsterol A (1) was equally
effective as rifaximin in transactivating the hPXR in HepG2
4592
dx.doi.org/10.1021/jm200241s |J. Med. Chem. 2011, 54, 4590–4599

Journal of Medicinal Chemistry
ARTICLE
Figure 3. Colitis was induced by intrarectal administration of 0.5 mg of TNBS per hPXR mouse, and animals were sacrificed 4 days after TNBS
administration. Solomonsterol A (1), 10 mg/kg, and rifaximin, 10 mg/kg, were administered once daily intraperitoneally (I.P.) or orally (per os),
respectively, for 3 days before TNBS. The severity of TNBS-induced inflammation (A, diarrhea score; B, weight loss; and C, macroscopic colon damage)
is modulated by rifaximin and solomonsterol A (1) administration. (D) Microscopic colon damage. (E) Histological analysis of colon samples (original
magnification 40ꢁ, H&E staining). TNBS administration causes colon wall thickening and massive inflammatory infiltration in the lamina propria.
(1) reduced neutrophil accumulation in the colonic mucosa as
assessed by measuring MPO (myeloperoxidase) activity, as well
as the expression of a number of signature cytokines and
chemokines including TNFR (tumor necrosis factor alfa), IFNγ
(interferon gamma), IL-12p70 (interleukin-12 p70 subunit), and
MIP-1R (macrophage inflammatory protein-1R) (Figure 4). Of
interest, both rifaximin and solomonsterol A (1) effectively
increased the colon expression of IL-10 (interleukin-10), a
key counter-regulatory cytokine. A similar pattern, thought
nonsignificant for solomonsterol A (1), was observed for
TGFβ (transforming growth factor beta) mRNA, a growth
factor whose colon expression is linked to the generation of a
subset of regulatory T cells (Treg, regulatory T cells)34
Solomonsterol A Inhibits LPS-Induced NF-jB DNA Bind-
ing Activity. In addition, we have evaluated the effect of
solomonsterol A on NF-kB (nuclear factor-kappaB) DNA
binding activity in LPS (lipopolysaccharide)-activated monocyte
cell line. As shown in Figure 5, compared to LPS alone,
cotreatment with solomonsterol A resulted in robust reduction
of LPS induced NF-kB DNA binding activity as measured in
EMSA assay. These results suggest that solomonsterol A inhibits
the LPS-induced cytokines and chemokine expression by sup-
pressing NF-kB DNA-binding activity.
Therapeutic Effect of Solomonsterol A. Because these data
demonstrated that prophylactic treatment with solomonsterol A
(1) effectively protects against colitis development, we have
investigated whether this agent is effective in driving the healing
of an established active colitis.
€
(Figure 4F and G, n = 6ꢀ7; *p < 0.05 versus naive; **p < 0.05
versus TNBS).
For this purpose, solomonsterol A was administered in a
therapeutic manner in mice rendered colitic by TNBS adminis-
tration. As illustrated in Figure 6, when administered to mice on
day 1 after TNBS administration, solomonsterol A (1) effectively
attenuated clinical signs of colitis (Figure 6A and B), including
the diarrhea score and wasting disease. In addition, solomon-
sterol A (1) attenuated the macroscopic and microscopic scores
as well as the MPO activity, a measure of neutrophil infiltration
into the colonic mucosa (Figure 6CꢀE).
Finally we found that administering hPXR mice with solo-
monsterol A (1) effectively triggered PXR activation in vivo.
Indeed, as shown in Figure 4H, both solomonsterol A (1) and
rifaximin caused a potent induction in the expression of
Cyp3A11. In the mice, Cyp3A11 is the orthologue of the human
CYP3A4 gene, and it is a PXR regulated gene highly expressed in
the intestine. These data strongly indicated that solomonsterol A
and rifaximin are PXR agonists in vivo (Figure 4H, n = 6ꢀ7; *p <
€
0.05 versus naive; **p < 0.05 versus TNBS).
4593
dx.doi.org/10.1021/jm200241s |J. Med. Chem. 2011, 54, 4590–4599

Journal of Medicinal Chemistry
ARTICLE
Figure 4. MPO (A), TNFR (B), INFγ (C), IL-12 p70 (D), MIP-1R (E), TGF-β1 (F), and IL-10 (G) protein levels in colons obtained 5 days after the
administration of TNBS alone or in combination with rifaximin and 1. Treatments inhibit the increase of neutrophil infiltration (MPO levels) and
€
proinflammatory factors induced by intrarectal administration of TNBS. Data represent the mean ( SE of 6ꢀ7 mice per group. (*p < 0.05 vs naive; **p <
0.05 vs TNBS). (H) Effects of rifaximin and solomonsterol A in colon mRNA levels of a PXR target gene such as Cyp3A11 (data are the mean ( SE of 5
mice per group; *p < 0.05 solomonsterol A vs rifaximin; **p < 0.05 vs TNBS).
Figure 5. Rifaximin and solomonsterol A (1) suppress LPS-induced NF-kB DNA binding activity in THP-1 (human acute monocytic leukemia) cells,
a monocyte-like cell line. The cells were pretreated with rifaximin (10 μM), 1 (10 μM), or vehicle for 3 h and then stimulated with LPS (1 μg/mL) for 20 h.
(A) DNA binding activity of the NF-kB p65 subunit was analyzed by EMSA. For the competition assay, a 250-fold excess of unlabeled probe was added
together with the labeled probe. For the supershift assay, 1 μg of antibody against NF-kB p65 was added together with the nuclear extract. Similar results
were observed in three independent experiments. (B) Densitometric analysis of p65 binding to NF-kB responsive elements.
’ CONCLUSIONS
target gene of PXR in colon, such as Cyp3A11 (Figure 4 H). The
synthetic route, short and amenable to scale-up, allowed us to
prepare sufficient quantities of solomonsterol A and to evaluate it
in animal models of colitis. In this study, we have shown that
activation of PXR receptor by solomonsterol A (1) exerts
In the present study, we have reported the first total synthesis
of solomonsterol A, a marine natural product endowed with
potent anti-inflammatory activity, mediated by its ability to act as
an hPXR agonist as demonstrated by the induction of a canonical
4594
dx.doi.org/10.1021/jm200241s |J. Med. Chem. 2011, 54, 4590–4599

Journal of Medicinal Chemistry
ARTICLE
Figure 6. Colitis was induced by intrarectal administration of 0.5 mg of TNBS per mouse, and animals were sacrificed 5 days after TNBS administration.
Solomonsterol A (1), 10 mg/kg, was administered once daily starting on day 1 after TNBS administration. The severity of TNBS-induced inflammation
(A, diarrhea score; B, weight loss; C, macroscopic colon damage; D, microscopic score damage; and E, MPO activity) was reduced by solomonsterol A
(1) administration. Body weight is expressed as delta percentage versus the weight of mice on the day before TNBS administration. Data represent the
€
mean ( SE of 4ꢀ6 mice per group (*p < 0.05 vs naive; **p < 0.05 vs TNBS).
beneficial effects on the development of colitis induced by TNBS
in transgenic mice harboring human PXR. PXR is a master gene
regulating the activity of a variety of genes involved in xeno- and
endobiotic metabolism in the liver and gastrointestinal tract.4ꢀ7
However, in recent years it has been demonstrated that PXR
activation regulates important effector functions in the immune
system, preventing the activation of NF-kB in epithelial and
immune cells.7,35
TLR4 responds to LPS by regulating the expression/activity of
NF-kB, a master regulator of inflammation, whose hyper-activa-
tion in the intestinal mucosa is mechanistically linked to the
development of inflammation and dysregulated immunity in
patients with Crohn’s disease (CD) and ulcerative colitis
(UC).36 Because NF-kB is essential in regulating inflammatory
signals in IBD, we investigated whether the beneficial effects
exerted by solomonsterol A could be linked to the inhibition of
this signaling mechanism. Indeed, supporting previous observa-
tions made with rifaximin, our results demonstrate that hPXR
activation by solomonsterol A (1) prevents the binding of the
p65 subunit of NF-kB to its responsive element in target genes.
Reduction of p65 binding in the EMSA could be the result of
several biochemical interactions of NF-kB with hPXR. One
possible explanation is the formation of a proteinꢀprotein
complex between p65 and PXR, thereby reducing the amount
of p65 that translocates into the nucleus.35
effects of solomonsterol A (1) in TNBS-induced colitis. Another
important observation we made is that both rifaximin and
solomonsterol A induced the expression of IL-10 and TGFβ in
the colon of colitic mice. Because IL-10 and TGFβ are key
counter-regulatory cytokines instrumental in the generation of
regulatory T cells, i.e., a subset of T cells that attenuates adaptive
dysregulated immunity; these data, seem to support a novel
concept, i.e., that PXR activation is endowed with the potential to
induce regulatory T cells in inflammation.
In conclusion, we have demonstrated that solomonsterol A
(1) is a potent agonist of hPXR. Using transgenic mice expressing
the hPXR, we have provided evidence that the novel compound
attenuates colitis development and modulates the expression of
pro-inflammatory cytokines by a NF-kB dependent mechanism.
In addition, we have provided the first evidence that solomon-
sterol A (1) might trigger the expression of counter-regulatory
cytokines (IL-10, TGFβ).
’ EXPERIMENTAL SECTION
Chemistry. Specific rotations were measured on a Jasco P-2000
polarimeter. High-resolution ESI-MS spectra were performed with a
Micromass Q-TOF mass spectrometer. NMR spectra were obtained on
Varian Inova 400 and Varian Inova 500 NMR spectrometers (1H at 400
and 500 MHz, 13C at 100 and 125 MHz, respectively) equipped with a
SUN microsystem ultra5 hardware and recorded in CDCl3 (δH =7.26
and δC =77.0 ppm) and CD3OD (δH = 3.30 and δC = 49.0 ppm). All of
the detected signals were in accordance with the proposed structures.
Coupling constants (J values) are given in Hertz (Hz), and chemical
shifts (δ) are reported in ppm and referred to CHCl3 and CHD2OD as
In addition, we have demonstrated that treating TNBS mice
with solomonsterol A (1) attenuated the release of TNFR in the
inflamed tissue. TNFR is a signature cytokine in IBD and a
validated therapeutic target in these disorders. Therefore, inhibi-
tion of TNFR might have mechanistic relevance in the beneficial
4595
dx.doi.org/10.1021/jm200241s |J. Med. Chem. 2011, 54, 4590–4599

Journal of Medicinal Chemistry
ARTICLE
internal standards. Spin multiplicities are given as s (singlet), br s (broad
singlet), d (doublet), or m (multiplet).
35.8, 35.5, 34.3, 32.0, 31.3, 31.1, 30.5, 28.9, 28.3, 24.4, 21.1, 18.5, 12.2 (2C);
HRMS-ESI m/z 373.3117 ([M þ H]þ, C25H41O2 requires 373.3107.
Methyl 2R,3R-Epoxy-5R-cholan-24-oate (9). To a solution of 8
(1.09 g, 2.93 mmol) in CH2Cl2 (66 mL) were added water (46.2 mL)
and Na2CO3 (1.15 g, 10.8 mmol). The reaction mixture was stirred
vigorously, and m-chloroperbenzoic acid (708 mg, 4.10 mmol) was added
slowly. The mixture was stirred for 4 h at room temperature, and then
the aqueous layer was extracted with CH2Cl2 (3 ꢁ 35 mL). The
combined CH2Cl2 extracts were washed successively with 5% Na2SO3
solution (100 mL), saturated NaHCO3 solution (100 mL), and water
(100 mL), dried over anhydrous MgSO4, and evaporated to dryness to
give 1.13 g of crude epoxide 9, which was subjected to the next step
without any purification. Selected 1H NMR (400 MHz, CDCl3): δ 3.65
(3H, s), 3.14 (1H, br s), 3.09 (1H, br s), 2.34 (1H, m), 2.20 (1H, m),
0.90 (3H, d, J = 6.7 Hz), 0.74 (3H, s), 0.63 (3H, s). 13C NMR (100 MHz,
CDCl3): δ 175.2, 56.5, 56.0, 53.8, 52.6, 51.7, 51.3, 42.6, 40.2, 40.7, 38.5,
36.4, 35.8, 35.6, 31.9, 31.3, 31.2, 30.9, 28.6, 28.3, 24.4, 21.1, 18.5, 13.2,
12.2; HRMS-ESI m/z 389.3036 ([M þ H]þ, C25H41O3 requires
389.3056.
Methyl 2β,3R-Dihydroxy-5R-cholan-24-oate (10). A solution of
epoxide 9 (1.13 g, 2.93 mmol) in THF (70 mL) was treated with 1 N
H2SO4 (7.32 mL, 7.32 mmol) solution and stirred for 24 h at room
temperature. After neutralization with saturated NaHCO3 solution, the
mixture was evaporated to a fifth of the initial volume, diluted with water
(50 mL), and extracted with ethyl acetate (3 ꢁ 50 mL). The combined
organic extracts were washed with water, dried over anhydrous MgSO4,
filtered, and evaporated to dryness. Purification on a silica gel column by
eluting with CH2Cl2ꢀMeOH (9:1) afforded pure 10 (870 mg, 73% over
two steps). [R]24D = þ0.67 (c 0.46, CHCl3). Selected 1H NMR (400
MHz, CDCl3): δ 3.89 (1H, br s), 3.85 (1H, br s), 3.64 (3H, s), 2.34 (1H,
m), 2.20 (1H, m), 0.97 (3H, s), 0.89 (3H, d, J = 6.7 Hz), 0.63 (3H, s). 13C
NMR (100 MHz, CDCl3): δ 175.4, 72.1, 70.9, 56.6, 56.0, 53.7, 51.7,
42.6, 40.7, 40.2, 39.2, 36.3, 35.6, 35.1, 32.1, 31.9, 31.3, 31.2, 28.4, 28.3,
24.4, 21.1, 18.5, 14.9, 12.4; HRMS-ESI m/z 407.3181 ([M þ H]þ,
C25H43O4 requires 407.3161.
5R-Cholan-2β,3R,24-triol (11). Dry methanol (320 μL, 7.88 mmol)
and LiBH4 (3.94 mL, 2 M in THF, 7.88 mmol) were added to a solution
of the methyl ester 10 (800 mg, 1.97 mmol) in dry THF (10 mL) at 0 °C
under argon, and the resulting mixture was stirred for 4 h at 0 °C. The
mixture was quenched by the addition of NaOH (1 M, 4 mL) and then
allowed to warm to room temperature. Ethyl acetate was added, and the
separated aqueous phase was extracted with ethyl acetate (3 ꢁ 1 5 mL).
The combined organic phases were washed with water, dried (Na2SO4),
and concentrated. Purification by silica gel eluting with CH2Cl2ꢀMeOH
(9:1) gave alcohol 11 as a white solid (685 mg, 92%). [R]24D = ꢀ1.2
(c 0.12, CHCl3). Selected1H NMR(400 MHz, CD3OD): δ 3.81 (1H, br s),
3.77 (1H, m), 3.67 (1H, br s), 3.52 (1H, m), 1.01 (3H, s), 0.96 (3H, d, J =
6.0 Hz), 0.70 (3H, s). 13C NMR (100, CD3OD): δ 73.3, 70.5, 63.1, 57.0,
56.6, 55.6, 43.0, 41.6, 40.5, 40.2, 36.0, 35.3, 35.2, 32.3, 31.7, 29.6, 29.5,
28.7, 28.6, 24.6, 21.1, 18.9, 14.2, 12.3; HRMS-ESI m/z 379.3154 ([M þ
H]þ, C24H43O3 requires 378.3134.
HPLC was performed with a Waters Model 510 pump equipped with
Waters Rheodine injector and a differential refractometer, model 401.
The purity of all of the intermediates, checked by 1H NMR and HPLC,
was greater than 95%. The purity of tested solomonsterol A was
determined to be always greater than 95% by analytical HPLC analysis
on a Macherey-Nagel Nucleodur 100-5 C18 (5 μm; 10 mm i.d. ꢁ
250 mm) column using 32% MeOH/H2O (isocratic mode) at a flow
rate of 1 mL/min.
Reaction progress was monitored via thin-layer chromatography
(TLC) on Alugram silica gel G/UV254 plates. Silica gel MN Kieselgel
60 (70ꢀ230 mesh) from Macherey-Nagel Company was used for
column chromatography. All chemicals were obtained from Sigma-
Aldrich, Inc. Solvents and reagents were used as supplied from com-
mercial sources with the following exceptions. Tetrahydrofuran, toluene,
dichloromethane, ether, and triethylamine were distilled from calcium
hydride immediately prior to use. All reactions were carried out under
argon atmosphere using flame-dried glassware. Compounds 3ꢀ5 were
prepared as described previously.26
Methyl 3β-Hydroxy-5R-cholan-24-oate (6). An oven-dried 250 mL
flask was charged with 10% palladium on carbon (100 mg) and
compound 5 (2.00 g, 5.15 mmol), and the flask was evacuated and
flushed with argon. Absolute methanol (50 mL) and dry THF (50 mL)
were added, and the flask was flushed with hydrogen. The reaction was
stirred at room temperature under H2 (1 atm) for 4 h. The mixture was
filtered through Celite, and the recovered filtrate was concentrated to
give 1.70 g of crude product. The residue was subjected to column
chromatography on silica gel eluting with hexaneꢀEtOAc (9:1, 0.5%
TEA) to give 1.60 g of pure 6 (80%). [R]24D = þ3.4 (c 0.54, CHCl3);
selected 1H NMR (400 MHz, CDCl3): δ 3.64 (3H, s), 3.56 (1H, m),
2.33 (1H, m), 2.19 (1H, m), 0.89 (3H, d, J = 6.3 Hz), 0.78 (3H, s), 0.63
(3H, s). 13C NMR (100 MHz, CDCl3): δ 174.8, 71.3, 56.4, 55.8, 54.3,
51.5, 44.8, 42.6, 41.1, 38.0, 36.9, 35.4, 35.3 (2C), 32.0, 31.3, 31.0, 30.9,
28.6, 28.1, 24.1, 21.2, 18.2, 12.5, 12.3; HRMS-ESI m/z 391.3227 ([M þ
H]þ, C25H43O3 requires 391.3212.
Methyl3β-Tosyloxy-5R-cholan-24-oate (7). Toa solution of 6(1.50g,
3.84 mmol) in dry pyridine (30 mL), p-toluenesulfonyl chloride (2.20 g,
11.5 mmol) was added. The solution was stirred at room temperature for
24 h and then poured into cold water (20 mL) and extracted with CH2Cl2
(3 ꢁ 15 mL). The combined organic layer was washed with saturated
NaHCO3 solution (30 mL) and water (30 mL), and then dried over
anhydrous MgSO4 and evaporated in vacuo to give 2.09 g of 7, which was
1
subjected to the next step without any purification. Selected H NMR
(400 MHz, CDCl3): δ 7.79 (2H, d, J = 8.2 Hz), 7.33 (2H, d, J = 8.2 Hz),
4.41 (1H, m), 4.23 (1H, m), 3.66 (3H, s), 2.45 (3H, s), 2.34 (1H, m), 2.22
(1H, m), 0.89 (3H, d, J = 5.9 Hz), 0.77 (3H, s), 0.63 (3H, s). 13C NMR
(100 MHz, CDCl3): δ 174.8, 148.8, 129.8 (2C), 127.7 (2C), 124.3, 82.7,
56.6, 56.1, 54.2, 51.7, 45.0, 41.6, 40.1, 37.0, 35.5 (2C), 35.2, 35.0, 32.1,
31.3, 31.2, 29.9, 28.6, 28.3, 24.4, 21.9, 21.4, 18.5, 14.4, 12.3; HRMS-ESIm/
z 545.3311 ([M þ H]þ, C32H49O5S requires 545.3301.
Methyl 5R-Chol-2-en-24-oate (8). Lithium bromide (3.30 g, 38.4 mmol)
and lithium carbonate (2.8 g, 38.4 mmol) were added to a solution of 7(2.08
g, 3.84 mmol) in dry DMF (150 mL), and the mixture was refluxed for 1.5 h.
After cooling to room temperature, the mixture was slowly poured into 10%
HCl solution (150 mL) and extracted with CH2Cl2 (3 ꢁ 150 mL). The
combined organic layer was washed successively with water, saturated
NaHCO3 solution, and water, and then dried over anhydrous MgSO4 and
evaporated to dryness to give a white solid residue that was purified on a silica
gel column by eluting with hexaneꢀEtOAc (9:1, 0.5% TEA) to obtain pure
8 (1.19 g, 83% over two steps). [R]24D = þ18.6 (c 2.07, CHCl3). Selected
1H NMR (400 MHz, CDCl3): δ 5.48 (2H, br s), 2.25 (1H, m), 2.11 (1H,
m), 0.83 (3H, d, J=6.2Hz), 0.65(3H, s),0.56(3H, s).13C NMR (100 MHz
CDCl3): δ 175.2, 126.2 (2C), 56.7, 56.0, 54.2, 51.7, 42.8, 41.6, 40.2, 39.9,
5R-Cholan-2β,3R,24-tryl-2,3,24-sodium trisulfate (1). The triethyl-
amineꢀsulfur trioxide complex (2.80 g, 15.8 mmol) was added to a
solution of triol 11 (600 mg, 1.58 mmol) in dry DMF (2 mL) under an
argon atmosphere, and the mixture was stirred at 95 °C over the
weekend. Then, the reaction mixture was quenched with water
(1.6 mL). The solution was poured over a silica gel column to remove
excess SO3 NEt3. The product was eluted by MeOH and followed by
3
evaporation of the solvent to yield a yellow solid [tris-(triethyl-
ammonium sulfate) salt]. To the solution of the solid in methanol
(15 mL) was added Amberlite CG 120 sodium form (20 g). The mixture
was stirred for 5 h at room temperature. The resin was removed by
filtration, and the filtrate was concentrated to obtain compound 1 as a
D
white solid (972 mg, 90%). [R]24 = þ4.6 (c 0.8, CH3OH). Selected
4596
dx.doi.org/10.1021/jm200241s |J. Med. Chem. 2011, 54, 4590–4599

Journal of Medicinal Chemistry
ARTICLE
1H NMR (400 MHz, CD3OD): δ 4.73 (1H, br s), 4.70 (1H, br s), 3.69
(2H, m), 1.00 (3H, s), 0.95 (3H, d, J = 6.3 Hz), 0.69 (3H, s). 13C NMR
(400 MHz, CD3OD): δ 76.2, 75.6, 69.3, 57.5, 57.3, 56.4, 43.2, 41.3, 39.7,
38.5, 36.4, 36.2 (2C), 32.8, 32.6, 30.3, 28.8, 28.7, 26.9, 24.7, 21.5, 18.6,
14.4, 12.3. HRMS-ESI m/z 661.1415 [M ꢀ Na]ꢀ, C24H39Na2O12S3
requires 661.1399.
of antibody against NF-kB p65 was added together with the nuclear
extract.
Animals. For the TNBS studies, humanized (h)PXR mice, 8ꢀ10
weeks of age, were provided by Frank J. Gonzalez (Laboratory of
Metabolism, Centre for Cancer Research, National Cancer Institute,
National Institutes of Health, Bethesda, Maryland). hPXR male mice
were housed in temperature- and light-controlled rooms and were given
tap water and pelleted standars mouse chow ad libitum. Mice were
housed under controlled temperatures (22 °C) and photoperiods
(12:12-h light/dark cycle), and allowed unrestricted access to standard
mouse chow and tap water. The present protocol was approved by the
Italian Minister of Health and conforms to national guidelines. The ID
for this project is #11/2010-B and authorization was released to
Professor Stefano Fiorucci, as principal investigator, last on January
25, 2010.
Induction of Colitis. Mice were fasted for 16 h and lightly anesthetized
by intraperitoneal injection of 100 μL of ketamine/xylazine solution32
for 10 g body weight and then administered intrarectally (i.r.) with the
haptenating agent TNBS (0.5 mg/mouse) dissolved in 50% ethanol, via
a 3.5 French (F) catheter equipped with a 1 mL syringe. The catheter
was advanced into the rectum for 4 cm, and then the haptenating agent
was administered in a total volume of 150 μL. To ensure the distribution
of the agent within the entire colon and cecum, mice were held in a
vertical position for 30 s.
Solomonsterol A (10 mg/kg) and rifaximin (10 mg/kg) were
dissolved in DMSO (10 mg/100 μL), diluted in methylcellulose 1%,
and administered intraperitoneally (i.p.) or orally, once daily, respec-
tively, at the final volume of 100 μL/mouse, 3 days before the induction
of colitis. At this time, the TNBS-alone group received the vehicle alone
(methylcellulose 1% in a final volume of 100 μL/mouse) every day.
In another experiment, a therapeutic model, solomonsterol A (10 mg/kg)
was administrated once daily starting on day 1 after colitis induction.
Mice were analyzed for the presence of diarrhea, body weight, and
survival. The body weight was expressed as delta percentage versus the
weight of mice on the day before TNBS administration.
Four days after TNBS administration, surviving mice were sacrificed,
colons were removed and either immediately snap-frozen in liquid
nitrogen and stored at ꢀ80 °C until use or formalin fixed. The
macroscopic appearance was analyzed considering the presence of
indurations, edema, thickness, and evidence of mucosal hemorrhage.
Grading was performed in a blind fashion. For histological examination,
tissues were fixed in 10% buffered formalin phosphate, embedded in
paraffin, sectioned, and stained with hematoxylin and eosin (H&E).
Histology images were captured by a digital camera (SPOT-2; Diagnos-
tic Instruments Inc., Burroughs, MI) and analyzed by specific software
(Delta Sistemi, Rome, Italy). The degree of colon inflammation was
examined microscopically in transversal sections33 and graded semi-
quantitatively from 0 to 4 (0, no signs of inflammation; 1, very low
level; 2, low level of leukocyte infiltration; 3, high level of leukocyte
infiltration, high vascular density, and thickening of the colon wall; 4,
transmural infiltration, loss of goblet cells, high vascular density, and
thickening of the colon wall). Grading was performed blind by
observers.
Biological Assays. Plasmids, Cell Culture, Transfection, and
Luciferase Assays. All transfections were made using Fugene HD
transfection reagent (Roche). For PXR mediated transactivation,
HepG2 cells, plated in a 6-well plate at 5 ꢁ 105 cells/well, were
transfected with 100 ng of pSG5-PXR, 100 ng of pSG5-RXR, 200 ng
of pCMV-β-galactosidase, and with 500 ng of the reporter vector
containing the PXR target gene promoter (CYP3A4 gene promoter)
cloned upstream of the luciferase gene (pCYP3A4promoter-TKLuc). At
48 h post-transfection, cells were stimulated for 18 h with rifaximin or
solomonsterol A (0.1, 1, and 10 μM). Cells were lysed in 100 μL of
diluted reporter lysis buffer (Promega), and 0.2 μL of cellular lysate was
assayed for luciferase activity using the Luciferase Assay System
(Promega). Luminescence was measured using an automated lumin-
ometer. Luciferase activities were normalized for transfection efficiencies
by dividing the relative light units by β-galactosidase activity expressed
from cells cotransfected with pCMV-βgal.
Quantitative Real-Time PCR. A 50 ng template was added to the PCR
mixture (final volume 25 μL) containing the following reagents: 0.2 μM
of each primer and 12.5 μL of 2X SYBR Green qPCR master mix
(Invitrogen, Milan, Italy). All reactions were performed in triplicate, and
the thermal cycling conditions were 2 min at 95 °C, followed by 40 cycles
at 95 °C for 20 s, 55 °C for 20 s, and 72 °C for 30 s in a iCycler iQ
instrument (Biorad, Hercules, CA). The mean value of the replicates for
each sample was calculated and expressed as cycle threshold (CT: cycle
number at which each PCR reaction reaches a predetermined fluores-
cence threshold, set within the linear range of all reactions). The amount
of gene expression was then calculated as the difference (ΔCT) between
the CT value of the sample for the target gene and the mean CT value of
that sample for the endogenous control (GAPDH). Relative expression
was calculated as the difference (ΔΔCT) between the ΔCT values of the
test sample and of the control sample (not treated) for each target gene.
The relative quantitation value was expressed and shown as 2 ꢀΔΔCT. All
PCR primers were designed with PRIMER3-OUTPUT software using
published sequence data from the NCBI database. The primers' sequences
were as follows: mGAPDH, CTGAGTATGTCGTGGAGTCTAC and
GTTGGTGGTGCAGGATGCATTG; mCyp3A11, TGAAACCACC-
AGTAGCACAC and CCATATCCAGGTATTCCATCTCC.
Electrophoretic Mobility Shift Assay (EMSA). The NF-kB DNA-
binding activity was determined by EMSA. After treatment, nuclear and
cytoplasmic extracts were prepared using NE-PER Nuclear and Cyto-
plasmic Extraction Reagents (Pierce Biotechnology, Inc.). EMSA probes
were created by biotinylating the 30 end of the single stranded
oligonucleotides using a biotin 30 end DNA labeling kit (Pierce
Biotechnology, Inc.) according to the manufacturer’s protocol. The
biotinylated oligonucleotides were annealed by boiling for 1 min and
then allowing them to slowly cool to room temperature. The consensus
nucleotide sequence for NF-kB was 50-AGA GAT TGC CTG ACG
TCA GAC AGC TAG-30. The EMSA binding reaction was performed
by utilizing a LightShift chemiluminescent EMSA kit (Pierce Biotech-
nology, Inc.). A nuclear extract was incubated in 1ꢁ binding reaction
buffer containing 50 mM KCl, 10 mM EDTA, 25 ng/mL poly dI-dC,
5 mM MgCl2, and the biotinylated probe. After a 20 min incubation at
room temperature, the reaction mixture was electrophoresed on a
nondenaturing 6% polyacrylamide gel and then transferred to a nylon
membrane. The transferred mixture was UV-cross-linked to the mem-
brane anddetectedby chemioluminescent reagents(Pierce Biotechnology,
Inc.). For the competition assay, a 200-fold excess of unlabeled probe
was added together with the labeled probe. For the supershift assay, 1 μg
Colon Myeloperoxidase (MPO) Activity and Cytokine Levels. Colon
samples were lysed in 1 mL of lysis buffer T-PER (Pierce, Rockford,
USA) and finely minced. Afterward, tissues were centrifuged at 10,000g
for 15 min at 4 °C. Colon homogenates were used to determine MPO
activity, after two freeze/thaw cycles, using a spectrophotometric assay
with trimethylbenzidine (TMB) as a substrate and normalized for the
protein levels. Colon TNFR and IL-10 levels in tissue homogenates were
quantified by ELISA (SABioscences) according to the manufacturer’s
instructions and normalized for the protein levels.
Statistical Analysis. All values are expressed as the mean ( SE. The
number (n) of experiments or mice used in the experiments is shown.
4597
dx.doi.org/10.1021/jm200241s |J. Med. Chem. 2011, 54, 4590–4599

Journal of Medicinal Chemistry
ARTICLE
Comparisons of more than 2 groups were made with a one-way analysis
of variance with post-hoc Tukey tests. Differences were considered
statistically significant if p was <0.05.
(10) Cheng, J.; Shah, Y. M.; Ma, X.; Pang, X.; Tanaka, T.; Kodama,
T.; Krausz, K. W.; Gonzalez, F. J. Therapeutic role of rifaximin in
inflammatory bowel disease: clinical implication of human pregnane X
receptor activation. J. Pharmacol. Exp. Ther. 2010, 335, 32–41.
(11) O’Malley, B. W. Hormones and Signalling; Academic Press:
San Diego, CA, 1998.
’ AUTHOR INFORMATION
(12) Parker, M. G. Steroid Hormone Action; IRL Press: Oxford, U.K.,
1993.
(13) Sheridan, P. J; Blum, K.; Trachtenberg, M. Steroid Receptors and
Disease; Marcel Dekker: New York, 1988; pp 289ꢀ564.
(14) Moudgil, V. K. Steroid Receptors in Health and Disease; Plenum
Press: New York/London, 1987.
Corresponding Author
*Tel: (0039) 081-678525. Fax: (0039) 081-678552. E-mail:
angela.zampella@unina.it.
Author Contributions
§These authors contributed equally to this work.
(15) Dubey, R. K; Oparil, S.; Imthurn, B.; Jackson, E. K. Sex
hormones and hypertension. Cardiovasc. Res. 2002, 53, 688–708.
(16) Latham, K. A.; Zamora, A.; Drought, H.; Subramanian, S.;
Matejuk, A.; Offner, H. Estradiol treatment redirects the isotype of the
autoantibody response and prevents the development of autoimmune
arthritis. J. Immunol. 2003, 171, 5820–5827.
(17) Carvalho, J. F. S.; Silva, M. M. C.; Moreira, J. N.; Simoes, S.;
Sꢁa e Melo, M. L. Sterols as anticancer agents: synthesis of ring-B
oxygenated steroids, cytotoxic profile, and comprehensive SAR analysis.
J. Med. Chem. 2010, 53, 7632–7638.
’ ACKNOWLEDGMENT
This work was supported by grants from MAREX—Exploring
Marine Resources for Bioactive Compounds: From Discovery to
Sustainable Production and Industrial Applications (Call FP7-
KBBE-2009-3, Project nr. 245137). NMR spectra were provided
by the CSIAS, Centro Interdipartimentale di Analisi Strumentale,
Faculty of Pharmacy, University of Naples.
(18) Blunt, J. W.; Copp, B. R.; Munro, M. H. G; Northcote, P. T.;
Prinsep, M. R. Marine natural products. Nat. Prod. Rep 2011, 28,
196–268 and previous articles in this series.
’ ABBREVIATIONS USED
(19) Sepe, V.; Bifulco, G.; Renga, B.; D’Amore, C.; Fiorucci, S.;
Zampella, A. Discovery of sulfated sterols from marine invertebrates as a
new class of marine natural antagonists of farnesoid-X-receptor. J. Med.
Chem. 2011, 54, 1314–1320.
(20) Festa, C.; De Marino, S.; Sepe, V.; Monti, M. C.; Luciano, P.;
D’Auria, M. V.; Debitus, C.; Bucci, M.; Vellecco, V.; Zampella, A. Perthamides
C and D, two new potent anti-inflammatory cyclopeptides from a Solomon
Lithistid sponge Theonella swinhoei. Tetrahedron 2009, 65, 10424–10429.
(21) Festa, C.; De Marino, S.; Sepe, V.; D’Auria, M. V.; Bifulco, G.;
Debitus, C.; Bucci, M.; Vellecco, V.; Zampella, A. Solomonamides A and
B, new anti-inflammatory peptides from Theonella swinhoei. Org. Lett.
2011, 13, 1532–1535.
(22) Festa, C.; De Marino, S.; D’Auria, M. V.; Bifulco, G.; Renga, B.;
Fiorucci, S.; Petek, S.; Zampella, A. Solomonsterols A and B from
Theonella swinhoei. The first example of C-24 and C-23 sulfated sterols
from a marine source endowed with a PXR agonistic activity. J. Med.
Chem. 2011, 54, 401–405.
(23) De Marino, S.; Ummarino, R.; D’Auria, M. V; Chini, M. G.;
Bifulco, G.; Renga, B.; D’Amore, C.; Fiorucci, S.; Debitus, C.; Zampella,
A. Theonellasterols and conicasterols from Theonella swinhoei. Novel
marine natural ligands for human nuclear receptors. J. Med. Chem. 2011,
54, 3065–3075.
(24) De Marino, S.; Sepe, V.; D’Auria, M. V.; Bifulco, G.; Renga, B.;
Petek, S.; Fiorucci, S.; Zampella, A. Towards new ligands of nuclear
receptors. Discovery of Malaitasterol A, an unique bis-secosterol from
marine sponge Theonella swinhoei. Org. Biomol. Chem. 2011, DOI:
10.1039/C1OB05378G.
(25) Shah, Y. M.; Ma, X.; Morimura, K.; Kim, I.; Gonzalez, F. J.
Pregnane X receptor activation ameliorates DSS-induced inflammatory
bowel disease via inhibition of NF-{kappa}B target gene expression. Am.
J. Phys. 2007, 292, G1114–1122.
APCs, antigen presenting cells; CD, Crohn’s disease; CYP3A4,
cytochrome P450 3A4; HepG2, human hepatocyte; IBD, inflam-
matory bowel diseases; IFNγ, interferon gamma; IL-10, interleukin-
10; IL-12p70, (interleukin-12 p70 subunit); LPS, lipopolysac-
charide; MDR1, multidrug resistance 1; MIP-1R, macrophage
inflammatoryprotein-1R;MPO, myeloperoxidase;NF-kB, nuclear
factor-kappaB; NRs, nuclear receptors; PXR, pregnane-X-recep-
tor; PXREs, PXR response elements; RXR, retinoid-X-receptor;
TGFβ, transforming growth factor beta; ;TNBS, trinitrobenzene-
sulfonic acid; THP-1, human acute monocytic leukemia; TNFR,
tumor necrosis factor alpha; UC, ulcerative colitis
’ REFERENCES
(1) Niess, J. H. Role of mucosal dendritic cells in inflammatory
bowel disease. World J. Gastroenterol. 2008, 14, 5138–5148.
(2) Sturm, A.; de Souza, H. S. P.; Fiocchi, C. Mucosal T cell
proliferation and apoptosis in inflammatory bowel disease. Curr. Drug
Targets 2008, 5, 381–387.
(3) Bookout, A. L.; Jeong, Y.; Downes, M.; Yu, R. T.; Evans, R. M.;
Mangelsdorf, D. J. Anatomical profiling of nuclear receptor expression
reveals a hierarchical transcriptional network. Cell 2006, 126, 789–799.
(4) Rock, K. L.; Latz, E.; Ontiveros, F.; Kono, H. The sterile
inflammatory response. Annu. Rev. Immunol. 2010, 28, 321–342.
(5) Ma, X.; Shah, Y. M.; Guo, G. L.; Wang, T.; Krausz, K. W.; Idle,
J. R.; Gonzalez, F. J. Rifaximin is a gut-specific human pregnane X
receptor activator. J. Pharmacol. Exp. Ther. 2007, 322, 391–398.
(6) Fiorucci, S.; Cipriani, S.; Baldelli, F.; Mencarelli, A. Bile acid-
activated receptors in the treatment of dyslipidemia and related dis-
orders. Prog. Lipid Res. 2010, 49, 171–185.
(26) Iida, T.; Kakiyama, G.; Hibiya, Y.; Miyata, S.; Inoue, T.;
Ohno, K.; Goto, T.; Mano, N.; Goto, J.; Nambara, T.; Hofmann, A. F.
Chemical synthesis of the 3-sulfooxy-7-N- acetylglucosaminyl-24-ami-
dated conjugates of 3β,7β-dihydroxy-5-cholen-24-oic acid, and related
compounds: unusual, major metabolites of bile acid in a patient with
Niemann-Pick disease type C1. Steroids 2006, 71, 18–29.
(27) Iida, T.; Momose, T.; Tamura, T.; Matsumoto, T.; Chang,
F. C.; Goto, J; Nambara, T. Potential bile acid metabolites. 13. Improved
routes to 3,6 and 3,6-dihydroxy-5-cholanoic acids. J. Lipid. Res. 1988,
29, 165–171.
(7) Mencarelli, A.;Migliorati, M.; Barbanti, M.; Cipriani, S.; Palladino,
G.; Distrutti, E.; Renga, B.; Fiorucci, S. Pregnane-X-receptor mediates the
anti-inflammatory activities of rifaximin on detoxification pathways in
intestinal epithelial cells. Biochem. Pharmacol. 2010, 80, 1700–1707.
(8) Prantera, C.; Lochs, H.; Gionchetti, P. Rifaximin-EIR (Extended
Intestinal Release) 400 mg tablets in the treatment of moderately active
Crohn’s disease: results of the international multicentre, randomised,
double-blind, placebo-controlled trial. 18th Annual United European
Gastroenterology Week, Abstract 3075, 26 Octꢀ8 Nov 2010.
(9) Jiang, Z. D.; Ke, S.; DuPont, H. L. Rifaximin-induced alteration
of virulence of diarrhoea-producing Escherichia coli and Shigella sonnei.
Int. J. Antimicrob. Agents 2010, 35, 278–281.
(28) MacNevin, C. J.; Atif, F.; Sayeed, I.; Stein, D. G.; Liotta, D. C.
Development and screening of water-soluble analogues of progesterone
4598
dx.doi.org/10.1021/jm200241s |J. Med. Chem. 2011, 54, 4590–4599

Journal of Medicinal Chemistry
ARTICLE
and allopregnanolone in models of brain injury. J. Med. Chem. 2009,
52, 6012–6023.
(29) Santos, G. A. G.; Murray, A. P.; Pujol, C. A.; Damonte, E. B.;
Maier, M. S. Synthesis and antiviral activity of sulfated and acetylated
derivatives of 2β,3R-dihydroxy-5R-cholestane. Steroids 2003, 68, 125–
132.
(30) Cong, R.; Zhang, Y.; Tian, W. A concise synthesis of the
steroidal core of clathsterol. Tetrahedron Lett. 2010, 51, 3890–3892.
(31) Voigt, B.; Porzel, A.; Adam, G.; Golsch, D.; Adam, W.; Wagner,
C.; Merzweiler, K. Synthesis of 2,24-diepicastasterone and 3,24-diepicas-
tasterone as potential brassinosteroid metabolites of the Cockroach
Periplaneta americana. Collect. Czech. Chem. Commun. 2002, 67, 91–102.
(32) Fiorucci, S.; Mencarelli, A.; Palazzetti, B.; Sprague, A. G.;
Distrutti, E.; Morelli, A.; Novobrantseva, T. I.; Cirino, G.; Koteliansky,
V. E.; de Fougerolles, A. R. Importance of innate immunity and collagen
binding integrin alpha1beta1 in TNBS-induced colitis. Immunity 2002,
17, 769–780.
(33) Mencarelli, A.; Renga, B.; Palladino, G.; Distrutti, E.; Fiorucci,
S. The plant sterol guggulsterone attenuates inflammation and immune
dysfunction in murine models of inflammatory bowel disease. Biochem.
Pharmacol. 2009, 78, 1214–1223.
(34) Rimoldi, M.; Chieppa, M.; Salucci, V.; Avogadri, F.; Sonzogni,
A.; Sampietro, G. M.; Nespoli, A.; Viale, G.; Allavena, P.; Rescigno, M.
Intestinal immune homeostasis is regulated by the crosstalk between
epithelial cells and dendritic cells. Nat. Immunol. 2005, 6, 507–514.
(35) Zhou, C.; Tabb, M. M.; Nelson, E. L.; Gr€un, F.; Verma, S.;
Sadatrafiei, A.; Lin, M.; Mallick, S.; Forman, B. M.; Thummel, K. E.;
Blumberg, B. Mutual repression between steroid and xenobiotic receptor
and NF-kappaB signaling pathways links xenobiotic metabolism and
inflammation. J. Clin. Invest. 2006, 116, 2280–2289.
(36) Franchimont, D; Vermeire, S; El Housni, H; Pierik, M; Van
Steen, K; Gustot, T; Quertinmont, E; Abramowicz, M; Van Gossum, A;
Deviꢀere, J; Rutgeerts, P. Deficient host-bacteria interactions in inflam-
matory bowel disease? The toll-like receptor (TLR)-4 Asp299gly
polymorphism is associated with Crohn’s disease and ulcerative colitis.
Gut 2004, 53, 987–992.
4599
dx.doi.org/10.1021/jm200241s |J. Med. Chem. 2011, 54, 4590–4599