New conjugated poly(pyridinium salt) derivative: AIE characteristics, the interaction with DNA and selective fluorescence enhancement induced by dsDNA

Article abstract of DOI:10.1039/c5ra22653h

Herein, a new conjugated poly(pyridinium salt) derivative L was synthesized by ring-transmutation polymerization reaction for the purpose of sensitive and selective fluorescence sensing of DNA. Cationic L exhibits aggregation-induced emission (AIE) characteristics that is weakly emissive in solution but highly luminescent in the aggregate state. Based on its AIE activity, a fluorescence turn-on biosensor for calf thymus DNA (ctDNA) detection is developed, which shows excellent selectivity with a detection limit down to the 10^-8 M^-1 in CH₃CN-phosphate buffer solution (PBS) (2 mM, pH 7.4) (v/v 1: 1). Further, the interactions between L and ctDNA are carefully investigated by UV-vis absorption spectra, dynamic light scattering (DLS) measurements, thermal denaturation studies, circular dichroism (CD) measurements, as well as competing experiments with ethidium bromide (EB). More interestingly, L exhibits selective fluorescence enhancement induced by double-stranded DNA (dsDNA), therefore, L was also successfully utilized as fluorescent probe to follow the ctDNA cleavage process by bovine pancreatic deoxyribonuclease I (DNase I).

Full text of DOI:10.1039/c5ra22653h

View Article Online
View Journal
RSC Advances
This article can be cited before page numbers have been issued, to do this please use: Y. Chang, L. Jin, J.
Duan, Q. Zhang, J. Wang and Y. Lu, RSC Adv., 2015, DOI: 10.1039/C5RA22653H.
This is an Accepted Manuscript, which has been through the
Royal Society of Chemistry peer review process and has been
accepted for publication.
Accepted Manuscripts are published online shortly after
acceptance, before technical editing, formatting and proof reading.
Using this free service, authors can make their results available
to the community, in citable form, before we publish the edited
article. This Accepted Manuscript will be replaced by the edited,
formatted and paginated article as soon as this is available.
You can find more information about Accepted Manuscripts in the
Information for Authors.
Please note that technical editing may introduce minor changes
to the text and/or graphics, which may alter content. The journal’s
standard Terms & Conditions and the Ethical guidelines still
apply. In no event shall the Royal Society of Chemistry be held
responsible for any errors or omissions in this Accepted Manuscript
or any consequences arising from the use of any information it
contains.
www.rsc.org/advances

Page 1 of 7
RSC Advances
Dynamic Article Links ►
View Article Online
DOI: 10.1039/C5RA22653H
Cite this: DOI: 10.1039/c0xx00000x
www.rsc.org/xxxxxx
Full Paper
New conjugated poly(pyridinium salt) derivative: AIE characteristics,
the interaction with DNA and selective fluorescence enhancement
induced by dsDNA
Ying Chang, Lu Jin, Jingjing Duan, Qiang Zhang, Jing Wang and Yan Lu
*
5
Received (in XXX, XXX) Xth XXXXXXXXX 20XX, Accepted Xth XXXXXXXXX 20XX
DOI: 10.1039/b000000x
Herein, a new conjugated poly(pyridinium salt) derivative L was synthesized by the ringꢀtransmutation
polymerization reaction for the purpose of sensitive and selective fluorescence sensing of DNA. Cationic
L exhibits aggregationꢀinduced emission (AIE) characteristics that is weakly emissive in solution but
10 highly luminescent in the aggregate state. Based on its AIE activity, a fluorescence turnꢀon biosensor for
calf thymus DNA (ctDNA) detection is developed, which shows excellent selectivity with a detection
limit down to the 10ꢀ8 Mꢀ1 in CH3CNꢀphosphate buffer solution (PBS) (2 mM, pH 7.4) (v/v 1:1). Further,
the interactions between L and ctDNA are carefully investigated by UVꢀvis absorption spectra, dynamic
light scattering (DLS) measurements, thermal denaturation studies, circular dichroism (CD)
15 measurements, as well as competing experiments with ethidium bromide (EB). More interestingly, L
exhibits selective fluorescence enhancement induced by doubleꢀstranded DNA (dsDNA), therefore, L
was also successfully utilized as fluorescent probe to follow the ctDNA cleavage process by bovine
pancreatic deoxyribonuclease I (DNase I).
(HPS), tetraphenylethene (TPE) and their derivatives. So,
creation of new fluorogenic CPEs with AIE attributes is still
required for the development of new sensing system with high
50 sensitive and selectivity.
We have been devoting ourselves to develop a new kind of
CPEs based on poly(pyridinium salt)s derivatives for bioꢀrelated
molecules sensing.7 Unlike most of CPEsꢀbased fluorescent
probes which are characterized by a backbone with a delocalized
55 electronic structure and the charged functional side chains,
poly(pyridinium salt)s derivatives belong to a class of mainꢀchain
Introduction
20 Fluorescent biosensors for DNA detection have received great
attention because of their ultrasensitivity and rapid and easy
operations, and accordingly, they show widespread applications
in gene expression profiling, clinical disease diagnostics, and the
drug industry.1 Conjugated polyelectrolytes (CPEs) integrate the
25 optoelectronic properties of conjugated polymers with the
electrostatic behavior of polyelectrolytes, providing a unique
platform for the construction DNA biosensors.2 Thanks to the
enthusiastic efforts of scientists, a variety of CPEs such as
polyfluorene, polyarylene and polythiophene derivatives have
30 been developed for sensing of a wide range of DNAꢀrelated
events.2 Most of them involved in the fluorescence resonance
energy transfer (FRET) from cationic polyfluorenes to
fluoresceinꢀlabeled DNA. This entails the cost, complexity, and
time required. Moreover, it is not favorable for practical use that
35 the fluorescence of polyfluorenes is quenched by DNA.3 Recently,
a breakthrough in the synthesis of fluorescent organic dyes, with
intriguing aggregationꢀinduced emission (AIE) phenomena,
offers a new platform for developing new sensing systems that
operate in a "turnꢀon" mode.4 These AIEꢀactive dyes are weakly
40 fluorescent in solution but become highly fluorescent upon
aggregation induced by analytes. For example, Tang et al.
developed a versatile AIE probes for nucleic acid detection and
quantitation.5 Liu et al. reported a simple singly labelled DNA
probe with AIE characteristics for specific DNA hybridization
45 detection.6 However, AIE luminogen (AIEgen) reported is
relatively limited so far, which mainly includes hexaphenylsilole
polyelectrolytes,
consist
of
4,4'ꢀ(1,4ꢀphenylene)bis(2,6ꢀ
diphenylpyridinium) ions along the backbone. Besides good
thermoꢀstability as well as abundant and tunable photoelectric
60 properties,8 the charged nature of their mainꢀchains also permits
coordination of electrostatic forces with oppositely charged
analyte targets. Recently, we reported an alternative conjugated
poly(pyridinium salt)s containing carbazole in the main chain,
which exhibited AIE characteristics and have been used as
65 fluorescent turnꢀon DNA sensors by taking advantage of
complexationꢀinduced aggregation through electrostatic attration
between poly(pyridinium salt)s and DNA.7c
Herein, we report a new conjugated poly(pyridinium salt)
derivative (L) with AIE characteristics for fluorescence turnꢀon
70 detection of DNA based on complexationꢀinduced aggregation by
the synergistic electrostatic attration and intercalating interaction.
L exhibits selective fluorescence enhancement induced by
doubleꢀstranded DNA (dsDNA), therefore, L is also successfully
employed to follow the DNA cleavage process by nuclease.
This journal is © The Royal Society of Chemistry [year]
[journal], [year], [vol], 00–00 | 1

RSC Advances
Page 2 of 7
View Article Online
DOI: 10.1039/C5RA22653H
55 Synthesis of N,Nꢀbis(4ꢀaminophenyl)ꢀN′,N′ꢀdiphenylꢀ1,4ꢀ
phenylenediamine (4)
Experimental section
Materials
Compound
4 were synthesized from a similar procedure
described in the literature.12 Compound 3 (1.02 g, 2.03 mol),
Pd/C catalyst (23 mg, 0.2 mmol) and hydrazine monohydrate (1.0
60 mL) were mixed in 25 mL of ethanol, and stirred at reflux for 7h
at 95 °C. After cooling, the resulting precipitate was dissolved in
THF (50 mL). The solution was filtrated to remove Pd/C, filtrate
was distilled until the solvent evaporated. The crude product was
washed with methanol and recrystallized from acetonitrile in
65 nitrogen, and then dried under reduced pressure to give lightꢀ
beige compound 4 (0.70 g, 78%). m.p. 241ꢀ242 °C; 1H NMR
(400 MHz, d6ꢀDMSO, ppm): δ 7.23 (t, J = 7.8 Hz, 4H), 6.92 (t, J
= 7.0 Hz, 6H), 6.83 (d, J = 7.9 Hz, 6H), 6.59 (d, J = 8.5 Hz, 2H),
6.54 (d, J = 8.4 Hz, 4H), 4.97 (s, 4H). 13C NMR (100 MHz, d6ꢀ
70 DMSO, ppm): δ 148.16, 147.70ꢀ146.57 (m), 146.03, 138.74ꢀ
136.99 (m), 136.76ꢀ135.36 (m), 129.52, 127.76, 122.18, 118.11,
115.31.
All chemical reagents were obtained commercially and used as
received unless otherwise stated. Calf thymus DNA (ctDNA) was
purchased from Beijing Sunbiotech Co. Ltd, and purified by
phenol extraction until UV absorbance 260nm/ 280nm was > 1.9.
The DNA concentration per nucleotide was determined by
absorption spectroscopy by using the molar absorption coefficient
5
(
ε
= 6600 molꢀ1 m3 cmꢀ1) at 260 nm. Bovine pancreatic
10 deoxyribonuclease I (DNase I) and singleꢀstranded DNA (ssDNA)
are purchased from Sigma Co. ssDNA with 24 bases: 5'ꢀ
GGTGGCCATTACCTTTGACTCTTCꢀ3' (ssDNA1), ssDNA
with 34 bases: 5'ꢀCCACCTGTTGGTAGTCCTTGTATTTAGTꢀ
ATCATCꢀ3') (ssDNA2). MilliꢀQ water (18.2 Mꢀ) was used for
15 all the experiments. Phosphate buffer solution (PBS) was
purchased from Beijing Dingguo Biotechnology Co. Ltd.
General characterization
1H and 13C NMR spectra were measured on a Varian UNITY
Plusꢀ400 NMR spectrometer (400 MHz) using tetramethylsilane
20 (TMS) as an internal reference for NMR analyses. The element
analysis was performed on a PerkinꢀElmer 2400C instrument.
Synthesis of 4,4'ꢀ(1,4ꢀphenylene)bis(2,6ꢀdiphenꢀylꢀpyrylium)
ditosylate (5)
75 Compounds 5 were synthesized according to our previous work
with 75 % yield as orange powder.7 1H NMR (400 MHz, d6ꢀ
DMSO, ppm): δ 9.36 (s, 4H), 9.16 (s, 4H), 7.59ꢀ8.93 (m,
20H),7.47 (d, J = 6.7 Hz, 4H), 7.10 (d, J = 7.7 Hz, 4H), 2.27 (s,
6H). 13C NMR (100 MHz, d6ꢀDMSO, ppm): δ 146.12, 138.11,
80 132.38ꢀ127.49 (m), 125.96, 39.96, 21.39.
GPC analysis was conducted with
a Waters 2690 liquid
chromatography system equipped with Waters 996 photodiode
detector and Phenogel GPC columns, using polymethyl
25 methacrylate as the standard and DMF as the eluent at a flow rate
of 1.0 mL/min at 35°C. A 50 ꢁL of 0.2 wt% of polymer in DMF
containing 0.01M LiBr was injected in the columns. The pH
measurements were carried out on a MettlerꢀToledo Delta 320 pH
meter. UVꢀvis absorption spectra were recorded on a Shimadzu
30 UVꢀ2550 spectrometer. Fluorescence spectra were measured on a
Hitachi Fꢀ4600 fluorescence spectrophotometer equipped with a
xenon lamp excitation source. All circular dichroism (CD)
spectra were measured on a Jasco Jꢀ715 WI spectropolarimeter
using a cylindrical quartz cell with a pathlength of 10 mm. All the
35 spectrum measurements were performed at 25 °C. Dynamic light
scattering (DLS) measurements were performed using a Zetasizer
Nano ZS90 (Malvern Instruments Co., UK) equipped with a Heꢀ
Ne laser.
Polymer synthesis
The synthesis pathway of polymer was shown in Scheme 1. A
solution of monomer 4 (0.33 g, 0.75 mmol) and another monomer
5 (0.67 g, 0.75 mmol) in 20 mL of DMSO was vigorously stirred
85 and heated at 110 °C under nitrogen for 2 h. Toluene (10 mL)
was then added so that the water generated by the transformation
of the pyrylium ring to the pyridinium ring could be removed as a
toluene/water azeotrope. Then, the bath temperature was
increased to 150 °C and the azeotrope and the excess toluene
90 were gradually distilled from the reaction mixture using a Dean–
Stark trap over 4ꢀ5 h. The bath temperature was maintained at
that temperature for 48 h. the resulting viscous solution was
slowly poured into a large excess (25 times in volume) of rapidly
stirred ethyl acetate. The precipitate was collected by filtration,
95 washed with water and dried under reduced pressure at 120 °C
Synthesis of 4ꢀnitrotriphenylamine (1)
40 Compounds 1 were synthesized from a procedure described in the
literature.9 m.p. 144 ꢀ145 °C; 1H NMR (400 MHz, d6ꢀDMSO,
ppm): δ 8.08 (m, 2H), 7.47 (m, 4H), 7.29 (ddd, J = 8.5, 7.4, 3.0
Hz, 6H), 6.81 (m, 2H).
1
overnight to give polymer L (0.90 g, 90%). H NMR (400 MHz,
d6ꢀDMSO, ppm): δ 8.86 (s, 4H), 8.66 (s, 4H), 7.37 (m, 32H), 7.03
(m, 12H), 6.50 (s, 6H), 2.26 (s, 6H). 13C NMR (101 MHz, d6ꢀ
DMSO, ppm): δ 157.11, 146.91, 137.97, 133.55, 131.64ꢀ127.36
100 (m), 126.81ꢀ121.20 (m), 40.02, 21.25. IR (KBr, cmꢀ1): 3051.38
(=CꢀH aromatic stretching), 1594.62ꢀ1452.89 (C=C and C=H
aromatic ring stretching), 1222.8 (CꢀN+), 1119.55 (S=O
asymmetric stretching), 1032.55ꢀ1011.82 (symmetric stretching),
846.24ꢀ679.01 (=CꢀH outꢀofꢀplane bending). Anal. calcd for
105 C84H64N4O6S2: C, 78.17; H, 5.08; N, 4.34. Found: C, 78.21; H,
5.35; N, 4.41%. Mn = 40 617, polydispersity induces (PDI) =
1.44.
Synthesis of 4ꢀaminotriphenylamine (2)
45 Compounds 2 were prepared according to the known procedure.10
1
m.p. 148ꢀ149 °C; H NMR (400 MHz, d6ꢀDMSO, ppm): δ 7.13
(dd, J = 20.6, 13.0 Hz, 6H), 6.90 (m, 8H), 6.58 (s, 2H).
Synthesis
of
N,Nꢀbis(4ꢀnitrophenyl)ꢀN′,N′ꢀdiphenylꢀ1,4ꢀ
phenylenediamine (3)
50 Compounds 3 were synthesized according to the reported
method.11 m.p. 219ꢀ220 °C; 1H NMR (400 MHz, d6ꢀDMSO, ppm):
δ 8.20 (m, 4H), 7.33 (tt, J = 3.9, 2.0 Hz, 4H), 7.21 (m, 2H), 7.19
(t, J = 2.0 Hz, 4H), 7.17 (d, J = 0.9 Hz, 2H), 7.10 (ddd, J = 7.0,
5.0, 2.7 Hz, 4H), 7.01 (m, 2H).
Results and discussion
Polymer synthesis and characterization
2
|
Journal Name, [year], [vol], 00–00
This journal is © The Royal Society of Chemistry [year]

Page 3 of 7
RSC Advances
View Article Online
DOI: 10.1039/C5RA22653H
overlapping emission bands started to emerge and to have
enhanced emission magnitudes with increasing concentration.
30 The shortꢀ and longwavelength emissions are supposed to be due
to the L itself and the aggregation emissions, respectively.13
The AIE effect can also be characterized by examining the
emission behavior of L in solvent mixtures with different
fractions of CH3CN and water (Fig. S12, ESI). Since water is
35 nonsolvent for L, the hydrophobic polymer chains of L are
considered to form aggregates in the CH3CN/water mixtures.
Mixtures of L in CH3CN/water were vigorously stirred to ensure
uniform dispersion of the polymer aggregates before emission
measurements. All the resultant mixture solutions (5 ꢁM, relative
40 to repeat unit) are macroscopically homogeneous with no
precipitate up to water fraction of 50 vol % water, and upon
further increasing the water fraction, the solution becomes
visually opaque. These results indicate the formation of aggregate
upon the addition of water. As shown in Fig. S12, upon excitation
45 at 430 nm, the solution (5 ꢁM) of L in pure CH3CN emitted
weakly, and with the increasing amount of water added, the
corresponding mixture solution exhibited a obvious increase in
the emission intensity. For the 50 vol% water solution, about 3.5ꢀ
fold emission enhancement along with a redꢀshift of emission
Scheme 1 Synthesis route for conjugated poly(pyridinium salt) L.
Scheme 1 outlines the reaction sequence applied for the synthesis
of probe L. The new conjugated poly(pyridinium salt)s L were
prepared by the ringꢀtransmutation polymerization reaction that
was carried out on heating in DMSO as previously reported.7, 8
5
The chemical structure of L are consistent with the spectra of 50 peak from 528 nm to 541 nm was observed compared to L in
FTIR, 1H and 13C NMR spectroscopy, and elemental analysis.
The numberꢀaverage molecular weight and polydispersity of L
10 were 40 617 and 1.44 respectively, determined by gelꢀpermeation
chromatography (GPC) using DMF containing 0.01M LiBr as the
solvent, and polymethyl methacrylate as standards. The detailed
information is also presented in ESI.
pure CH3CN. These data indicate that the fluorescence of L tends
to be enhanced by aggregation, which may be attributed to the
restrictions of intramolecular rotations of conjugated backbone of
L in the aggregate state.14
Since cooling can also fortify the RIR process, we studied the
temperature effect on L emission to further confirm the AIE
activity of L. DMF is used in the study because of its strong
solvating power and low melting point (− 61 °C), which can help
keep the solution molecules in the solution state at low
55
AIE properties of polymer
60 temperatures. When a DMF solution of L is cooled, its emission
intensity is increased as shown in the Fig. S13 (ESI), which
should be attributed to the molecular rotation are greatly
restrained at lower temperature.
UVꢀvis absorption spectra response to ctDNA addition
15
Fig. 1 Photoluminescent spectra of L in CH3CNꢀH2O (v/v =1:1) of
various concentrations. (excited at 430 nm).
Effect of concentration was emphasized by the unnormalized PL
emission spectra as shown in Fig. 1, which exhibited the
20 continuous accession of the emission intensity with increasing
concentration. Whereas solution thickening often quenches light
fluorophore’s emission, L solutions become more emissive with
higher concentration. This peculiar phenomenon of
concentrationꢀenhanced emission is possibly due to the AIE
25 effect, as we will discuss later. Here, solution (10ꢀ6 M) with very
low fluorophore content is essentially weak in emission, but upon
65
Fig. 2 UVꢀvis absorption spectra of L ([L] = 5 ꢁM) in the presence of
different concentrations of ctDNA in CH3CNꢀH2O (v/v =1:1). [ctDNA] =
0, 1.25, 2, 3, 4.25, 5, 5.5, 5.7, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 7.5, 9.5, 11.0
ꢁM. Inset: Job's plot. A0 is the initial absorbance of the free L, Ai is the
70 recorded absorbance of complexes at different ctDNA concentrations in
CH3CNꢀH2O (v/v =1:1), and Xi is the molar fraction of ctDNA.
increasing the concentration of L to 10ꢀ5
M range, two
This journal is © The Royal Society of Chemistry [year]
Journal Name, [year], [vol], 00–00 |
3

RSC Advances
Page 4 of 7
View Article Online
DOI: 10.1039/C5RA22653H
The interaction between L and ctDNA was firstly performed by
exploring the UVꢀvis spectra changes of L when titrated with
To further examine binding mode of L with ctDNA, UVꢀmelting
transition were measured and shown in Fig. S15 (ESI). The
ctDNA melting temperature (Tm), i.e., the temperature at which a
ctDNA. Since
L are cationic conjugated polyelectrolytes,
whereas ctDNA carries highly electronegative charges on the 45 doubleꢀtoꢀsingle strand transition happens and are determined by
5
phosphate groups, they can form complexes through electrostatic
attraction. As shown in Fig. 2, L exhibits a maximal absorption at
337 nm (ε = 1.0 × 105 Mꢀ1 cmꢀ1), which is associated to the π–π*
transition of the conjugated polymer L backbone. With the
monitoring the absorption of DNA at 260 nm reaches 50% of the
maximal value in the presence and absence of L. Fig. S15
exhibits an increase in the melting point by 8 °C in the presence
of L, which indicates that polymer L binding to ctDNA stabilized
increment of ctDNA, the absorbance at 337 nm of L decreased 50 the double helix. The significant increase of Tm demonstrates that
10 gradually, which was concomitant with redꢀshift of maximal
absorption peak by about 10 nm, signifying significant aggregate
between the L and ctDNA was formed.
L can intercalate abilities into the double helical DNA.17
Circular dichroism measurements
Job's plot yielded from UVꢀvis absorption shows a nearly 1:2
stoichiometry for the complexes of L with ctDNA (see inset in
15 Fig. 2). The binding constants of LꢀctDNA complexes is
estimated to be 1.07×105 Mꢀ1 according to the reported method.15
DLS analysis of the L complexes with ctDNA
Fig. 4 Circular dichroism spectra of ctDNA (60 µM) in CH3CNꢀH2O (v/v
55 = 1:1) upon addition of polymer L. [L] = 0, 8, 12, 16, 22 and 24 µM from
a to f, respectively.
In order to check whether the ctDNA structure changes upon
binding to cationic polymer L, CD measurements of ctDNA were
performed in the presence and absence of L in CH3CNꢀH2O (v/v
60 1:1) (Fig. 4). As shown in Fig. 4, the intrinsic CD activity of the
L was recorded and found to be negligible. In the absence of L,
the CD spectrum of ctDNA was of typical Bꢀform, which
exhibited a positive Cotton effect at about 275 nm due to base
stacking and a negative Cotton effect at about 245 nm attributed
65 to the rightꢀhanded helicity of ctDNA.18 Upon addition of
polymer L, the intensites of both the negative peak at 245 nm and
the positive peak at 275 nm in the CD spectra increased as the
concentration of L was increased from 0 to 24 µM, indicating an
significant change in conformation of the ctDNA structure as L
70 binds to the duplex.
Fig. 3 Hydrodynamic diameter of L (5 ꢁM) in the presence of ctDNA and
20
DNase I in an CH3CNꢀH2O (v/v =1:1) obtained from DLS.
To probe the polymer aggregation in acetonitrile aqueous solution,
DLS experiments were performed and shown in Fig. 3. L formed
small aggregates with a mean diameter of about 90 nm, which is
ascribed to its poor water solubility. Upon the addition of ctDNA,
25 the hydrodynamic diameter of the aggregates increased
significantly. The mean diameter is of about 890 nm at [ctDNA]
= 50 ꢁM. Thus, near the endpoint of the UV spectra titration, Lꢀ
ctDNA complexes exist in a highly aggregated state.
Competing experiments with EB
Changes in the intensity of the CD peak at 245 nm have been
associated with alteration of hydration of the helix in the vicinity
of phosphate or the ribose ring as the ionic concentration is
altered.19 Therefore, it would be reasonable to suggest that
75 exchanging a cationic polymer L, with sodium ion would lead to
changes in hydration near the phosphate group of the DNA helix.
While the changes in the intensity of the CD peak at 275 nm
should be attributed to the intercalation interaction between the
phenyl groups on the side chain of polymer L and the ctDNA
80 base pairs via hydrophobic force as demonstrated by competing
experiments with EB. Thus, the synergetic electrostatic attraction
and intercalation interaction should be responsible for the binding
of ctDNA with L.
30 It is well known that EB can intercalates within the internally
stacked bases of dsDNA, resulting in an increase in its
fluorescence intensity.16 To explore whether L binds to ctDNA
by intercalative interaction, the competing experiments of L with
EB was performed. Upon addition of 10 equiv of ctDNA to the
35 solutions of EB, an increase of the florescent emission positioned
at 623 nm with an enhancement factor of 14.7ꢀfold was observed
as shown in Fig. S14 (ESI). Then adding L to an equilibrated EBꢀ
ctDNA solution, resulted in the decrease of emission intensity of
EB at 623 nm. The results indicated that probe L can weakly
40 intercalative binding to duplex ctDNA.
Thermal denaturation studies
4
|
Journal Name, [year], [vol], 00–00
This journal is © The Royal Society of Chemistry [year]

Page 5 of 7
RSC Advances
View Article Online
DOI: 10.1039/C5RA22653H
Complexationꢀenhanced fluorescence
fluorescence emission by AIE effect. This results suggests that L
can be used as a selective fluorescent probe for ctDNA in the
45 presence of other types of ssDNA and other various anions which
can compete with ctDNA to bind with L.
Fig. 5 shows the fluorescence spectra of L ([L] = 5 ꢁM) and
those in the presence of different concentration of ctDNA
in CH3CNꢀPBS (2 mM, pH 7.4) (v/v 1:1). As shown in Fig. 5, L
was weakly emissive in solution with maximum emission peak at
541 nm. However, upon addition of ctDNA to the solution of L,
the fluorescence intensity at 541 nm enhanced sharply to 10.2
times its individual intensity in the absence of ctDNA, then
tended to saturation when the ctDNA concentration reached 23.6
5
10 ꢁM. At the saturation point, the negative charges from DNA are
more than positive charges from L, thus, aggregation of polymer
L occurs around ctDNA should be formed, which restricts the
structure torsional of L, thereby, reducing energy consumption
and enhancing the fluorescent intensity.
Fig. 6 Change in the ratio ((Fi ꢀ F0)/ F0) of fluorescence intensity of L (5
µM) in CH3CNꢀH2O (v/v 1:1) in the presence of 5 equiv of various anions.
50
Fi and F0 are the intensities at 541 nm in the presence and absence of
different anions, respectively. 1: L; 2: L + Cl−; 3: L + Br−; 4: L + ssDNA1;
−
5: L + ctDNA; 6: L + ssDNA2; 7; L + HCO3 ; 8: L + HPO42−; 9: L +
−
ꢀ
2ꢀ
HSO4 ; 10: L + Iꢀ; 11: L + P2O74ꢀ; 12: L + PO4 ; 13: L + SO4
(λex = 430
nm).
55 Labelꢀfree fluorescence nuclease assay
15
Fig. 5 Fluorescent titration spectra of L (5 ꢁM) in CH3CNꢀPBS (2 mM,
pH 7.4) (v/v 1:1) in the presence of ctDNA at different concentrations
ranging from 0 to 23.6 ꢁM (λex = 430 nm). Inset: α as a function of
[ctDNA] at low ctDNA concentration. The data are based on the average
20
of four independent experiments.
In order to determine the detection limit of probe L for ctDNA,
lower ctDNA concentration ranging from 0.15 to 0.90 ꢁM were
studied by fixing concentration of L at 5 ꢁM and then adding
aliquots of stock solution of ctDNA. We define α as: α = (F ꢀ F0)
25 / F0, where F and F0 are the intensities at 541 nm in the presence
and absence of ctDNA, respectively. Inset (Fig. 5) shows α as a
function of ctDNA concentration. A linear regression curve was
obtained with a correlation coefficient of 0.995. The point at
which this line crossed the horizontal axis was taken as the
30 detection limit and equaled approximately 3.2×10ꢀ8 Mꢀ1 free
ctDNA in CH3CNꢀPBS (2 mM, pH 7.4) (v/v 1:1).20 The slope is
0.469 ꢁMꢀ1, indicating the high sensitivity of L to ctDNA, which
is consistent with the strong complexation of L to ctDNA.
Fig. 7 Plot of fluorescence intensity at 541 nm of L (5 ꢁM) in CH3CNꢀ
PBS (2 mM, pH 7.4) (v/v 1:1) against time in the presence of 10 equiv of
ctDNA upon addition of 3 equiv DNase I.
60 DNA cleavage reactions catalyzed by various enzymes such as
restriction nuclease and nonspecific nuclease are very important
in biological processes involving the replication, repair, and
recombination of DNA.21 In the present work, bovine pancreatic
deoxyribonuclease I (DNase I), which is an endonuclease that
Selectivity
35 To investigate the selectivity of probe L, various anions sodium
salts as well as two ssDNA with different base length have been
added to L solutions. As shown in Fig. 6 and Fig. S16 (ESI), after
addition of 5 equiv amount of these anions to solutions of L, the
solutions did not lead to significant fluorescence increase. The
40 good selectivity for ctDNA is associated with synergetic
electrostatic attraction and intercalation interaction between
ctDNA and L, which consequently induces enhanced
65 preferentially splits phosphodiester linkages adjacent to
a
pyrimidine nucleotide, yielding 5'ꢀphosphate terminated
polynucleotides with a free hydroxyl group at the 3' position, is
employed to demonstrate the potential application of L as a
fluorescent probe to follow the DNA cleavage process by
70 nuclease. Furthermore, such labelꢀfree fluorescence nuclease
assay could be used for nuclease inhibitor screening.
This journal is © The Royal Society of Chemistry [year]
Journal Name, [year], [vol], 00–00 | 5

RSC Advances
Page 6 of 7
View Article Online
DOI: 10.1039/C5RA22653H
2006, 128, 10281; (g) K. Lee, L. K. Povlich and J. Kim, Adv. Funct.
Mater., 2007, 17, 2580; (h) B. Liu and G. C. Bazan , Chem. Mater.,
2004, 16, 4467; (i) W. J. Zhang, L. Xu, J. G. Qin and C. L. Yang,
Macromol. Rapid Commun., 2013, 34, 442; (j) C. L. Zhu, L. B. Liu,
Q. Yang, F. T. Lv and S. Wang, Chem. Rev., 2012, 112, 4687.
(a) S. Wang, B. Liu, B. S. Gaylord and G. C. Bazan, Adv. Funct.
Mater., 2003, 13, 463; (b) H.ꢀA. Ho, M. Boissinot, M. G. Bergeron,
G. Corbeil, K. Doré, D. Boudreau and M. Leclerc, Angew. Chem. Int.
Ed., 2002, 41, 1548.
Before the reaction of ctDNA with DNase I, the ensemble of L
and ctDNA exhibited rather strong fluorescence as shown in Fig.
7. But, the fluorescence of the ensemble of was gradually reduced
after ctDNA hydrolyzed by DNase I with prolonging the reaction
time. It should be pointed out that the fluorescence enhancement
of L after mixing DNase I under the same conditions can be
neglected. With the DNA cleavage by DNase I, the aggregation
of L becomes less efficient, as a result, the mean hydrodynamic
diameter decreases to 560 nm as shown in Fig. 3. The preliminary
60
65
70
75
80
85
90
95
5
3
4
5
(a) J. Luo, Z. Xie, J. W. Y. Lam, L. Cheng, H. Chen, C. Qiu, H. S.
Kwok, X. Zhan, Y. Liu, D. Zhu and B. Z. Tang, Chem. Commun.,
2001, 1740; (b) R. T. K. Kwok, C. W. T. Leung, J. W. Y. Lamab and
B. Z. Tang, Chem. Soc. Rev., 2015, 44, 4228.
Y. Hong, H. Xiong, J. W. Y. Lam, M. Häußler, J. Liu, Y. Yu, Y.
Zhong, H. H. Y. Sung, I. D. Williams, K. S. Wong and B. Z. Tang,
Chem.ꢀEur. J., 2010, 16, 1232; (b) Y. Hong, S. Chen, C. W. T.
Leung, J. W. Y. Lam and B. Z. Tang, Chem.ꢀAsian J., 2013, 8, 1806.
Y. Li, R. T. K. Kwok, B. Z. Tang and B. Liu, RSC Adv., 2013, 3,
10135.
(a) Y. Lu, C. C. Xiao, Z. F. Yu, X. S. Zeng,Y. Ren and C. X. Li, J.
Mater. Chem., 2009, 19, 8796; (b) F. L. Han, Y. Lu, Q. Zhang, J. F.
Sun, X. S. Zeng and C. X. Li, J. Mater. Chem., 2012, 22, 4106; (c) J.
F. Sun, Y. Lu, D. D. Cheng, Y. J. Sun and X. S. Zeng, Polym. Chem.,
2013, 4, 4045; (d) L. Wang, Y. D. Li, J. F. Sun, Y. Lu, Y. J. Sun, D.
D. Cheng and C. X. Li, J. Appl. Polym. Sci., 2014, 131, 40933; (e) Y.
J. Sun, J. Wang, L. Jin, Y. Chang, J. J. Duan, Y. Lu, Polym. J., 2015,
DOI: 10.1038/pj.2015.62.
P. K. Bhowmik, H. Han, J. J. Cebe, I. K. Nedeltchev, S. W. Kang and
S. Kumar, Macromolecules, 2004, 37, 2688; (b) P. K. Bhowmik, S.
Kamatam, H. Han and A. K. Nedeltchev, Polymer, 2008, 49, 1748;
(c) P. K. Bhowmik, H. Han, and A. K. Nedeltchev, Polymer, 2006,
47, 8281.
10 results indicate the potential application of L as a fluorescent
probe to develop a labelꢀfree fluorescence nuclease assay.
Conclusions
In summary, a new fluorescent poly(pyridinium salt) derivative L
was synthesized via the ringꢀtransmutation polymerization
15 reaction. L exhibits interesting AIE activity, providing a new
sensing platform for biomolecules detection. The interactions
between L and ctDNA were carefully investigated by UVꢀvis
absorption spectra, DLS measurements, thermal denaturation
studies, CD measurements, as well as competing experiments
20 with EB. These results indicate the synergetic electrostatic
attraction and intercalation interaction should be responsible for
the binding of ctDNA with L. Furthermore, fluorescence turnꢀon
DNA biosensor with high sensitivity and selectivity was
developed by taking advantage of AIE effect of L. L was then
25 utilized successfully as fluorescent probe to follow the DNA
cleavage process by nuclease. With smart structural design, we
anticipate that this type of polymers has ideal properties to be
used as fluorescence turnꢀon biosensors for detection of other
bioꢀrelated molecules.
6
7
8
9
R. Gujadhur, D. Venkataraman and J. T. Kintigh, Tetrahedron Lett.,
2001, 42, 4791.
10 S. Urgaonkar, J. H. Xu and J. G. J. Verkade, Org. Chem., 2003, 68,
8416.
11 S. H. Chen, S. H. Hsiao, T. H. Su and G. S. Liou, Macromolecules,
2005, 38, 307.
12 H. J. Niu, H. Q. Kang, J. W. Cai, C. Wang, X. D. Bai and W. Wang,
Polym. Chem., 2011, 2, 2804.
30 Acknowledgements
This work was financially supported by the National Natural
Science Foundation of China (NO: 21074093, 20972111) and the
Program for New Century Excellent Talents in University
(NCETꢀ12ꢀ1066).
100 13 R.ꢀH. Chien, C.ꢀT. Lai and J.ꢀL. Hong, J. Phys. Chem. C, 2011, 115,
5958.
14 Y. Hong, J. W. Y. Lam and B. Z. Tang, Chem. Commun., 2009, 4332
15 (a) J. J. Stephanos, J. Inorg. Biochem., 1996, 62, 155; (b) E.
Froehlich, J. S. Mandeville, C. M. Weinert, L. Kreplak and H. A.
105
TajmirꢀRiahi, Biomacromolecules, 2011, 12, 511.
16 (a) J. B. LePecq and C. Paoletti, J. Mol. Biol., 1967, 27, 87; (b) A. R.
Morgan and D. E. Pulleyblank, Biochem. Biophys. Res. Commun.,
1974, 61, 346; (c) H. C. Birnboim and J. J. Jevcak, Cancer Res.,
1981, 41, 1889.
35 Notes and references
Tianjin Key Laboratory for Photoelectric Materials and Devices, School
of Materials Science & Engineering, Tianjin University of Technology,
Tianjin 300384, China.
Fax: +86ꢀ22ꢀ60214500; Tel: +86ꢀ22ꢀ60216748; Eꢀmail:
40 luyan@tjut.edu.cn
† Electronic Supplementary Information (ESI) available: [Synthesis and
characterization data of compounds 1ꢀ5; Calt thymus DNA melting
curves in the absence and presence of Poly1; PL spectra of Poly1 in PBS
solution in the presence of different concentrations of calf thymus DNA].
45 See DOI: 10.1039/b000000x/
110 17 Y. Liu, L. Yu, Y. Chen, Y.ꢀL. Zhao and H. Yang, J. Am. Chem. Soc.,
2007, 129, 10656.
18 (a) C. A. Sprecher, W. A. Baase and W. C. Johnson Jr, Biopolymers,
1979, 18, 1009; (b) C. Zimmer and G. Luck, Biochim. Biophys. Acta,
1974, 361, 11; (c) V. I. Ivanov, L. E. Minchenkova, A. K. Schyolkina
and A. I. Poletayev, Biopolymers, 1973, 12, 89.
19 (a) S. Hanlon, S. Brudno, T. T. Wu and B. Wolf, Biochemistry, 1975,
14, 1648; (b) B. Wolf and S. Hanlon, Biochemistry, 1975, 14, 1661;
(c) H. S. Charles and B. C. Jonathan, J. Am. Chem. Soc., 1997, 119,
10920.
115
1
(a) H. A. Ho, A. Naiari and M. Leclerc, Acc. Chem. Res., 2008, 41,
168; (b) S. W. Thomas, G. D. Joly and T. M. Swager, Chem. Rev.,
2007, 107, 1339; (c) C. Debouck and P. N. Goodfellow, Nat. Genet.,
1999, 21, 48; (d) M. J. Heller, Annu. Rev. Biomed. Eng., 2002, 4,
129.
120 20 M. Shortreed, R. Kopelman, M. Kuhn and B. Hoyland, Anal. Chem.,
1996, 68, 1414.
50
55
21 (a) S. M. Linn and R. J. Roberts, Nucleases, Cold Spring Harbor
Labortary Press: Cold Spring Harbor, NY, 1982. (b) J. Sambrook, E.
F. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual,
2
(a) C. Chi, A. Mikhailovsky and G. C. Bazan, J. Am. Chem. Soc.,
2007, 129, 11134; (b) B. Liu and G. C. Bazan, Chem. Asian J., 2007,
2, 499; (c) B. S. Gaylord, A. J. Heeger and G. C. Bazan, J. Am.
Chem. Soc., 2003, 125, 896; (d) M. Yu, Y. Tang, F. He, S. Wang, D.
Zheng, Y. Li and D. Zhu, Macromol. Rapid Commun., 2006, 27,
1739; (e) X. F. Liu, Q. L. Fan and W. Huang, Biosens. Bioelectron.,
2011, 26, 2154; (f) W. Lv, N. Li, Y. Li and A. Xia, J. Am. Chem. Soc.,
125
2nd ed., Cold Spring Harbor Laboratory Press: Cold Spring Harbor,
New York, 1989.
6
|
Journal Name, [year], [vol], 00–00
This journal is © The Royal Society of Chemistry [year]

Page 7 of 7
RSC Advances
View Article Online
DOI: 10.1039/C5RA22653H
New conjugated poly(pyridinium salt) derivative: AIE
characteristics, the interaction with DNA and selective
fluorescence enhancement induced by dsDNA
Ying Chang, Lu Jin, Jingjing Duan, Qiang Zhang, Jing Wang and Yan Lu
*
Graphical Abstract:
A new conjugated poly(pyridinium salt) with aggregation-induced emission characteristics was
designed and synthesized for the purpose of fluorescence turn-on sensing of DNA. The probe
shows excellent sensitivity and selectivity for double-stranded DNA, therefore, it was also
successfully utilized to follow the DNA cleavage process by bovine pancreatic deoxyribonuclease
I (DNase I).