Select pyrimidinones inhibit the propagation of the malarial parasite, Plasmodium falciparum

Article abstract of DOI:10.1016/j.bmc.2009.01.024

Plasmodium falciparum, the Apicomplexan parasite that is responsible for the most lethal forms of human malaria, is exposed to radically different environments and stress factors during its complex lifecycle. In any organism, Hsp70 chaperones are typicall

Full text of DOI:10.1016/j.bmc.2009.01.024

Bioorganic & Medicinal Chemistry 17 (2009) 1527–1533
Contents lists available at ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc
Select pyrimidinones inhibit the propagation of the malarial parasite,
Plasmodium falciparum
Annette N. Chiang a, Juan-Carlos Valderramos b, Raghavan Balachandran c, Raj J. Chovatiya a, Brian P. Mead a,
Corinne Schneider a, Samantha L. Bell a, Michael G. Klein d, Donna M. Huryn c, Xiaojiang S. Chen d,
Billy W. Day c, David A. Fidock b, Peter Wipf c, Jeffrey L. Brodsky a,
*
a Department of Biological Sciences, University of Pittsburgh, 274 Crawford Hall, Pittsburgh, PA 15260, USA
b Department of Microbiology, Columbia University, New York, NY 10032, USA
c Department of Chemistry and Department of Pharmaceutical Sciences, Center for Chemical Methodologies and Library Development,
University of Pittsburgh, Pittsburgh, PA 15260, USA
d Department of Molecular and Computational Biology, University of Southern California, Los Angeles, CA 90089, USA
a r t i c l e i n f o
a b s t r a c t
Article history:
Plasmodium falciparum, the Apicomplexan parasite that is responsible for the most lethal forms of human
malaria, is exposed to radically different environments and stress factors during its complex lifecycle. In
any organism, Hsp70 chaperones are typically associated with tolerance to stress. We therefore reasoned
that inhibition of P. falciparum Hsp70 chaperones would adversely affect parasite homeostasis. To test
this hypothesis, we measured whether pyrimidinone-amides, a new class of Hsp70 modulators, could
inhibit the replication of the pathogenic P. falciparum stages in human red blood cells. Nine compounds
Received 7 August 2008
Revised 1 January 2009
Accepted 8 January 2009
Available online 20 January 2009
Keywords:
Molecular chaperone
Hsp70
Hsp40
J domain
with IC50 values from 30 nM to 1.6 lM were identified. Each compound also altered the ATPase activity of
purified P. falciparum Hsp70 in single-turnover assays, although higher concentrations of agents were
required than was necessary to inhibit P. falciparum replication. Varying effects of these compounds on
Hsp70s from other organisms were also observed. Together, our data indicate that pyrimidinone-amides
constitute a novel class of anti-malarial agents.
ATPase
Pyrimidinone
Ó 2009 Elsevier Ltd. All rights reserved.
1. Introduction
are also polypeptide-binding proteins.6 Hsp70s and Hsp40s can
constitute a significant amount of total cellular protein, a percent-
Plasmodium falciparum malaria kills ꢀ3000 people each day,
mostly children in sub-Saharan Africa. Several anti-malarial agents
are available that—in principle—could prevent this disease. Unfortu-
nately, the use of some of these agents is compromised by parasite
resistance, high cost, and/or dangerous or unpleasant side-effects.
Also, some therapies are combinations of existing drugs (e.g.,
artemether-lumefantrine, dihydroartemisinin-piperaquine, or
artesunate-amodiaquine)1,2 that depend on the inability of the
parasite to become resistant to artemisinin derivatives. Therefore,
continued efforts to identify novel compounds that kill P. falciparum
are critical.
The P. falciparum genome encodes six Hsp70 and forty-three
Hsp40 molecular chaperones.3,4 Hsp70 molecular chaperones cou-
ple the hydrolysis of ATP with the binding and release of polypep-
tide substrates and play vital roles in protein folding, degradation
and transport.5 Hsp40s interact with Hsp70 through a conserved,
four helix-bundle known as the ‘J domain’. J domain interactions
enhance Hsp70 ATPase activity; similar to Hsp70s, many Hsp40s
age that rises when cells are stressed (hence the ‘heat shock pro-
tein’ nomenclature).7
There are several reasons why P. falciparum might require the
function of Hsp70 and Hsp40 chaperones. First, this parasite, like
other members of the Apicomplexa, contains several endo-mem-
brane systems.8 Because Hsp70-Hsp40 pairs engineer protein
transport across membranes and are essential for membrane integ-
rity,9 each internal membrane might require its own set of chaper-
ones. In support of this hypothesis, it was recently shown that a J
domain-containing protein in P. falciparum (PF10_0381) is required
for ‘knob’ formation, a structure that helps the presentation of
PfEMP1 proteins on the red blood cell surface; this, in turn, leads
to the binding of parasitized red blood cells to the vascular endo-
thelium.10 Second, the parasite is exposed to radically different
environments during its life cycle. It is capable of thriving in the
mosquito, in the host liver, and in the highly oxidizing environ-
ment of the red blood cell.11 Thus, Hsp70s and Hsp40s might be
necessary to offset cellular stresses that are encountered during
the P. falciparum life cycle. Third, P. falciparum exhibits sudden
bursts of protein synthesis as it enters the trophozoite stage that
marks the initiation of several rounds of intracellular division.
* Corresponding author. Tel.: +1 412 624 4831; fax: +1 412 624 4759.
E-mail address: jbrodsky@pitt.edu (J.L. Brodsky).
0968-0896/$ - see front matter Ó 2009 Elsevier Ltd. All rights reserved.
doi:10.1016/j.bmc.2009.01.024

1528
A. N. Chiang et al. / Bioorg. Med. Chem. 17 (2009) 1527–1533
Molecular chaperones help retain newly synthesized polypeptides
in soluble conformations and facilitate folding.12 For example, an
inhibitor of the Hsp90 chaperone, which is required for folding se-
lect cellular proteins, was shown to inhibit the ‘ring’ to trophozoite
transition.13 Finally, it appears that the parasite contains extensive
chaperone networks that are involved in a multitude of cellular
activities.14 Based on these data, P. falciparum viability should be
exceptionally sensitive to Hsp70-Hsp40 inhibition. Indeed, parasite
growth is inhibited by 15-deoxyspergualin,15,16 a non-specific
chaperone modulator that binds to Hsp70 and to Hsp90 with a
value of ꢀ0.2
calculated to be ꢀ0.3
for CQ was 0.19 M (data not shown). From our initial analysis of
157 compounds, we identified nine molecules (Fig. 2; see Section
l
M.23,24 In this experiment, the IC50 for JAB75 was
M (Table 1, second column) and the IC50
l
l
3) with IC50 values between 30 nM and 1.6
column).
lM (Table 1, second
To ensure that the compounds were not generally cytotoxic, we
also determined the 50% growth inhibitory concentrations (GI50
)
for each of these nine agents in two human cell lines, HepG2 hepa-
tocellular carcinoma cells and WI-38 embryonic diploid lung cells,
as previously described.18 Based on this analysis, all GI50 values in
KD of ꢀ5
l
M.17
We previously reported the synthesis and characterization of
pyrimidinone-peptoid hybrid molecules that modulate Hsp70
activity in vitro and that, in some cases, prevent cancer cell prolif-
eration.18–21 These data indicate that specific Hsp70 modulators
can be identified and that at least a sub-group of these compounds
is membrane-permeable, as evidenced by their activity in a cellular
assay. To test whether molecules in this class also compromise P.
falciparum replication, we screened a small collection of pyrimidi-
nones and identified nine compounds that exhibited potent effects
on parasite metabolism. Some of these compounds inhibited P. fal-
ciparum viability with similar potencies to some established anti-
malarial drugs.22 We also developed new purification schemes
for Hsp70 proteins from Homo sapiens and P. falciparum and com-
pared the effects of these compounds on the ATPase activities of
the human, yeast, and parasite chaperones. Together, our data sup-
port the continued investigation of pyrimidinones as antimalarial
agents.
these cells were >10 lM, which is well above the concentration
needed to inhibit P. falciparum growth (Table 1). As a control for
this experiment, we found that the GI50 values for paclitaxel in
HepG2 and WI-38 cells were 1.0 0.6 nM and 13.7 0.2 nM,
respectively (data not shown).
We previously showed that a subset of pyrimidinones inhibit
the activity of Hsp70.18,19 Therefore, we next assessed the effects
of the nine compounds on Hsp70 ATPase activity. We first exam-
ined the ability of each pyrimidinone to modulate the ATP hydro-
lytic rate of
a purified yeast Hsp70, Ssa1, as previously
published.18–20 In addition, we wished to compare the effects of
these agents on human and P. falciparum Hsp70. The three chaper-
ones are 71–74% identical to one another at the amino acid level
and, not surprisingly, Hsp70s from different species have been re-
ported to substitute functionally for one another. For example, the
growth of bacteria containing a mutation in the gene encoding
DnaK, the Hsp70 homolog, can be rescued at high temperature
by expression of a P. falciparum Hsp70.25 One might also envision,
however, that a specific inhibitor could selectively target the P. fal-
ciparum chaperone but have no effect on Hsp70s from different
species.
2. Results and discussion
To assess whether pyrimidinones inhibit P. falciparum growth,
we examined the effects of 157 compounds in this class and re-
lated Biginelli and Ugi multicomponent condensation-derived
compounds on the uptake of [3H]hypoxanthine into infected hu-
man erythrocytes. The hypoxanthine assay provides a rapid, quan-
tifiable read-out of parasite viability, and the compounds assayed
included several recently described agents,18 as well as precursors
and structurally related analogs.
To compare the effects of the lead compounds on the ATPase
activities of the Hsp70s, we first modified purification schemes
for both the H. sapiens and P. falciparum chaperones (see Section
3). The peak fractions from the P. falciparum Hsp70 purification
are shown Figure 3A, and the single-turnover ATPase activities of
the enzyme in the absence and presence of a J domain chimera
(see below) are shown in Figure 3B.
Next, each of the nine compounds was incubated with the P. fal-
ciparum, yeast and human chaperones, and steady-state ATPase as-
says were performed. The results presented in Table 1, columns 3–
5, indicate that the compounds display a range of activities and al-
The impact of JAB75 (see Section 3) on [3H]hypoxanthine up-
take is shown in Figure 1. In this and all other assays, we used
the chloroquine (CQ)-resistant Dd2 clone and employed CQ as an
internal control because CQ is known to inhibit Dd2 with an IC50
Table 1
100
Effects of most potent P. falciparum inhibitors on the steady-state ATPase activities of
P. falciparum, yeast (Ssa1), and human (HsHsp70) Hsp70
Compound P. falciparum ICS0
M)
PfHsp70
(ATPase)
Ssal
(ATPase)
HsHsp70
(ATPase)
80
60
(l
DMSO
1
1
1
DMT3024
DMT2264
MAL2-29
MAL2-39
MAL2-61
MAL2-213
MAL2-215
MAL3-39
JAB75
0.2
1.1
1.6
0.2
0.1
0.03
0.05
0.8
0.3
0.73 0.003
0.74 0.002
1.01 0.1
0.92 0.05
0.99 0.07
1.02 0.11
1.01 0.08
0.72 0.08
1.0 0.06
1.0 0.004
0.74 0.003
0.97 0.004 0.95 0.002
0.93 0.007 0.85 0.06
0.95 0.004 0.80 0.08
1.1 0.003
0.89 0.016 0.80 0.06
1.2
0.75
1.2
40
0.74 0.07
0.72 0.09
0.82 0.05
0.70 0.06
20
0.0
0.0
The IC50 value for inhibition of [3H]hypoxanthine uptake is shown in the second
column. The three columns on the right depict the relative activities of each enzyme
(after standardization to the activity with an equal volume of DMSO, which was set
0.10
1.0
10
100
[JAB75] µM
to ‘1’) in the presence of a final concentration of 300 lM of the designated com-
Figure 1. JAB75 inhibits [3H]hypoxanthine uptake into red blood cells infected with
P. falciparum. The uptake of [3H]hypoxanthine into infected human erythrocytes
and the IC50 value were determined as described in Section 3. The raw data from a
single assay were standardized such that the inhibition of uptake in the absence of
JAB75 was set to 0%.
pound. The turnover numbers of each enzyme in the presence of DMSO were: P.
falciparum Hsp70: 0.020 minÀ1; Ssa1: 0.032 minÀ1; HsHsp70: 0.025 minÀ1. Stained
gels showing the enriched proteins used in this analysis are provided in a Supple-
mentary Figure (Fig. S1). Data represent the means of 6 independent experiments,
and where shown, SD.

A. N. Chiang et al. / Bioorg. Med. Chem. 17 (2009) 1527–1533
1529
O
-O
O
O
N
N+
N+
O-
O
O
O
O
NH
O
O
NH
O
NH
NH
N
O
O
NH
NH
O
N
O
O
N
N
O
O
N
MAL2-39
DMT3024
N
O
O
MAL2-29
DMT2264
OH
O
-
O
O
N+
O
-
-O
O
O
O
N+
N+
O
O
S
O
O
MAL2-215
O
O
NH
O
O
O
NH
N
O
O
NH
O
NH
N
O
MAL2-61
N
O
MAL2-213
N
O
MAL3-39
O
H
N
H
N
O
O
N
N
N
H
N
O
O
NH
O
O
O
O
N
HN
O
O
O
J AB 75
Figure 2. Select pyrimidinones inhibit hypoxanthine uptake into P. falciparum-infected red blood cells. The depicted compounds inhibited P. falciparum replication with IC50
values of 30 nM–1.6 M (see Table 1). The structures were drawn to maximize chemical similarity.
l
ter the activities of each chaperone distinctly. For example, JAB75,
MAL2-61, and MAL2-215 reduced the rate of ATP hydrolysis by the
human enzyme by 30%, but had no effect or stimulated the activi-
ties of the parasite and yeast enzymes. In contrast, MAL2-39 com-
promised the ATPase activities of all three enzymes, but mainly
HsHsp70. MAL3-39 inhibited all enzymes to a very similar extent.
Perhaps most intriguing, DMT2264 affected the ATPase activity of
P. falciparum Hsp70 significantly more than Ssa1 and HsHsp70.
These data indicate that the pyrimidinones can be classified based
on their in vitro effects on Hsp70s from different species. Neverthe-
less, it is important to note that these analyses were performed at a
of each pyrimidinone. We chose to use single-turnover conditions
for this analysis because the level of J domain-mediated stimula-
tion of Hsp70 ATPase activity is significantly greater for single-
turnover assays as compared to steady-state assays (see, e.g.,
Fig. 3B). Furthermore, the effects of compounds on enzyme kCAT
values can specifically be monitored and the fold change measured.
As shown in Table 2, these nine compounds exhibited a range of ef-
fects. First, relatively subtle changes were observed when the ef-
fects of the compounds were examined in the presence of the J
domain protein. For example, a <50% decrease (in the presence of
MAL2-213 or DMT2264) and a ꢀ40% increase (in the presence of
MAL2-61 or MAL3-39) was measured when the J domain was
added into the assay in the presence of these chemicals (Table 2,
‘fold change PfHsp70 kCAT + Hlj1’). In contrast, two of the com-
pounds induced a potent ‘burst’ of ATP hydrolysis in the single-
turnover assay in the absence of a J domain (‘fold change PfHsp70
kCAT’): Based on a fit of the data to a single exponential, MAL2-39
and MAL2-61 enhanced P. falciparum Hsp70 ATPase activity by
7.2 and 6.5-fold, respectively. Each of the other compounds also
enhanced ATP hydrolysis to varying extents, an effect that has been
previously noted for certain other pyrimidinones.18,19 Because the
cycle of Hsp70 ATP binding/hydrolysis is coupled with substrate
binding and release, altered rates of endogenous or J domain-stim-
ulated ATP hydrolysis will correspondingly alter the efficacy of
substrate binding. Therefore, enhanced rates of ATP hydrolysis
can lead to defects in the ability of Hsp70s to act as a molecular
chaperone, especially under stress conditions.27,28 Moreover, re-
cent data confirm that the individual chaperone cycles and confor-
mations have been tailored to match the folding of specific
substrates.29 In the future, it will be important to examine whether
these agents affect the binding of known Hsp70 substrates. More-
over, it is critical to note that effects on ATPase activity in steady-
state assays may result from alterations in any one of a number of
steps in the hydrolytic cycle, including the kCAT, ATP binding, and
inorganic phosphate and/or ADP release.
final concentration of 300 lM in order to maximize the effects. We
also selected this concentration because the action of pyrimidinon-
es was first studied under these conditions;18 however, when used
at concentrations that inhibited P. falciparum replication (Table 1),
the steady-state ATPase activity of Hsp70 was unaltered, suggest-
ing the possibility of secondary targets or other issues related to
compound metabolism or accumulation (see below).
The cellular activity of Hsp70 most often requires interaction
with J domain-containing Hsp40 partners.5,6 In fact, one of our
most potent pyrimidinone-based inhibitors of breast cancer cell
proliferation has no effect on endogenous ATPase activity but
compromises the ability of a J domain-containing co-chaperone
to enhance ATP hydrolysis.19,21 Therefore, it was possible that the
compounds might have greater effects on the J domain-stimulated
ATPase activity of the Hsp70s. Because the purification of a P. falci-
parum Hsp40 has not been reported, we instead chose to use a chi-
meric protein that contains the J domain from Hlj1, a yeast Hsp40,
fused to glutathione-S-transferase.26 Recent work indicates that
the chimera interacts promiscuously with a variety of Hsp70s
and augments their ATPase activities.36 For comparison, we also
used a full-length ‘type-I’ Hsp40 co-chaperone from yeast, Ydj1.
We added each of the nine P. falciparum inhibitors in single-
turnover ATPase reactions containing either the parasite (PfHsp70)
or yeast Hsp70 (Ssa1) in the presence or absence of the Hlj1 chi-
mera and Ydj1 (see Table 2). Furthermore, the activity of human
Hsp70 in the presence or absence of Ydj1 and one of its known
Hsp40 partners, Hdj1, was examined in the presence or absence
An examination of the endogenous and J domain-stimulated
ATPase activities of the yeast enzyme in the presence or absence
of the compounds yielded quite different results (Table 2, ‘fold

1530
A. N. Chiang et al. / Bioorg. Med. Chem. 17 (2009) 1527–1533
A
B
130
72
36
28
17
1
2
3
100
80
60
40
20
0
0
100
200
300
400
500
600
700
Time (sec)
Figure 3. Purification and analysis of P. falciparum Hsp70. (A) A Coomassie Brilliant
blue-stained gel summarizing individual steps during the P. falciparum Hsp70
purification is shown: lane 1: crude E. coli lysate from the P. falciparum Hsp70 over-
expressing strain; lane 2: pooled peak fractions after nickel-affinity resin chroma-
tography; lane 3: pooled peak fractions after Q-sepharose column chromatography.
The positions of molecular weight markers (Â10À3) are indicated to the left.
Densitometry analysis indicates >95% purity. (B) The single-turnover ATPase
activity of P. falciparum Hsp70 is stimulated by a J domain-containing hybrid
protein. ATPase assays were performed as described in Section 3 in the presence of
3 lg of the Hlj1 chimeric protein. Data represent the means of 6 independent
determinations, SD.
change Ssa1 kCAT’ and ‘fold change Ssa1 kCAT + Hlj1’). We found that
MAL2-215 exerted significant effects on both the endogenous and J
domain-stimulated activity of Ssa1, but the compounds with the
greatest impact on the P. falciparum enzyme (e.g., MAL2-39,
MAL2-61, and MAL2-213) only modestly altered the activity of
the yeast enzyme. Notably, the strongest effects of each pyrimidi-
none were observed when the activity of the human enzyme was
examined in the presence of its partner, Hdj1. At this point, the
substructure features that mediate these distinct phenomena re-
main to be elucidated. Our data nevertheless indicate that the con-
tinued examination of pyrimidinones with diverse Hsp70s will
prove worthwhile, especially if a specific binding site on the chap-
erone for this class of modulators can be identified. Efforts toward
this goal are underway.
It is important to note that the relative effects of the compounds
on the endogenous or J domain-stimulated P. falciparum ATPase
activities do not correlate with the IC50 values in the [3H]hypoxan-
thine uptake assay (compare Table 1 and Table 2). There are sev-
eral explanations for this fact. First, it is possible that some
compounds have secondary cellular targets, which may enhance
the antimalarial effects. Second, some of the compounds may be
metabolized when added to the infected erythrocytes to produce
derivatives that may be more or less potent, depending on the nat-
ure of the modification. Third, the less potent agents in the
[3H]hypoxanthine uptake assay might be actively excluded from

A. N. Chiang et al. / Bioorg. Med. Chem. 17 (2009) 1527–1533
1531
cells due to the action of multi-drug transporters or other gene
3.1.1. Synthesis of MAL2-29
TFA (50 L) was added to a mixture of 6-ureiadohexanoic acid
(100 mg, 0.57 mmol), 3-nitrobenzaldehyde (73 mg, 0.48 mmol),
and ethylacetate (61 L, 0.48 mmol) in dichloroethane (3 mL),
products that are known to mediate drug resistance in this para-
site.30 Assays with radiolabeled or fluorescently labeled com-
pounds will help clarify this possibility by enabling
measurements of compound accumulation in the parasite; how-
ever, these results are not yet available. Fourth, the bona fide
Hsp70 that is a target of the active compounds may be any one
of the other five Hsp70s that are encoded by the P. falciparum gen-
ome. It is striking how distinctly some compounds affect the activ-
ities of the yeast Ssa1 and human proteins and the P. falciparum
Hsp70 utilized in this study (PfHsp70-1; PF08_0054) even though
these proteins are >70% identical. Because Hsp70-1 and the mito-
chondrial Hsp70 in P. falciparum (PfHsp70-3; PF11_0351) are only
48% identical, the compounds are also expected to exhibit distinct
effects on parasitic Hsp70s. The problem of identifying the tar-
get(s) of these compounds could, in principle, be rectified by the
purification of each of the six P. falciparum Hsp70s and 43 P. falci-
parum J proteins so that each combination could be tested in ATP-
ase assays in the presence of the modulators. A streamlined
approach would be to prepare activated, affinity tagged derivatives
of our novel P. falciparum inhibitors and then identify potential cel-
lular target(s) using an unbiased screen. This experimental regi-
men would ideally isolate the ‘correct’ Hsp70 and/or Hsp40
chaperone target(s).
We note structural trends that relate to potency in the P. falci-
parum replication assay. Specifically, there are several common
and distinct features amongst the identified inhibitors depicted
in Figure 2. For example, all nine compounds share an ester pyrim-
idine core, substituted at C-4, and eight of the nine are alkylated at
N1. Among the compounds, DMT3024, DMT2264, and MAL3-39
are structurally closely related. They share a benzyl ester pyrimi-
dine core that is substituted at C-4 with an arene moiety, and an
N-alkylated amide side chain that is attached via a 3–5 carbon lin-
ker. They differ in their side chain lipophilicity and in the presence
of the morpholine moiety on DMT3024 and MAL3-39, which is ab-
sent in DMT2264. The most potent compounds, MAL2-215 and
MAL2-213, have a slightly different ester substitution on the
pyrimidine core, as well as a distinct tetrasubstituted pyrrole side
chain. This tetrasubstituted pyrrole appears to be an important
determinant of potency because modifications in ester identity
(Bn vs Et), N1 linker length (C-4 vs C-6), and C-4 aryl substitution
(Ph vs NO2) do not appear to affect activity. Finally, MAL2-61,
MAL2-39, and MAL2-29 are truncated derivatives that still have
the signature pyrimidine heterocycles but a minimal N1 side chain
substituent lacking an amide function, i.e. H or Bn (JAB75), butyl
(MAL2-39), and hexanoic acid (MAL2-29).
l
l
and the resulting mixture was heated to reflux under N2 for 12 h.
Next, dichloroethane was removed in vacuo, and the residue was
stirred in Et2O, filtered, and washed with hexane/acetone to afford
UPCMLD00WMAL2-29 (128.0 mg, 53%) as a white solid. 1H NMR
(300 MHz, DMSO-d6) d 11.96 (s, 1H), 8.12 (d, 1H, J = 3.8 Hz), 8.06
(s, 1H), 7.65–7.63 (m, 2H), 5.26 (d, 1H, J = 3.6 Hz), 4.02 (q, 2H,
J = 7.0 Hz), 3.87–3.83 (m, 1H), 3.48–3.42 (m, 1H), 3.33 (s, 1H),
2.49 (s, 3H), 2.09 (t, 2H, J = 7.2 Hz), 1.48–1.29 (m, 6H), 1.10 (t,
3H, J = 7.1 Hz); MS (API-ES) m/z (rel. intensity) 402.1 (MH+, 100);
purity determined by LC–UV at 254 nm: 94.9%.
3.1.2. Synthesis of MAL2-39
Benzyl acetoacetate (248
lL, 1.43 mmol) and para-anisalde-
hyde (175 L, 1.43 mmol) were added to a solution of butylurea
l
acid (200 mg, 1.72 mmol) in THF (3 mL). The solution was stirred
for 10 min followed by the addition of concentrated HCl (two
drops) and the resulting solution was stirred at ambient tempera-
ture for 48 h. The reaction mixture was concentrated to an oil,
which was then purified by chromatography on SiO2 with hex-
ane/EtOAc (2:1) and eluted with CHCl3 to afford UP-
CMLD00WMAL2-39 (502.9 mg, 86%). 1H NMR (300 MHz, CDCl3) d
7.22–7.17 (m, 3H), 7.08–7-05 (m, 2H), 7.01 (dd, 2H, J = 8.7,
2.0 Hz), 6.69 (dd, 2H, J = 8.8, 2.1 Hz), 5.40 (d, 1H, J = 2.7 Hz), 5.22
(d, 1H, J = 2.7 Hz), 4.98 (d, 2H, J = 2.6 Hz), 3.82–3.75 (m, 1H), 3.70
(s, 3H), 3.53–3.47 (m, 1H), 2.45 (s, 3H), 1.49–1.43 (m, 2H), 1.26–
1.19 (m, 2H), 0.84 (t, 3H, J = 7.2 Hz); MS (API-ES) m/z (rel. intensity)
409.1 (MH+, 100); purity determined by LC–UV at 254 nm: 92.2%.
3.1.3. Synthesis of MAL2-61
Ethyl acetoacetate (141 lL, 1.11 mmol) and 2-formylphenyl-2-
nitrobenzenesulfonate (341 mg, 1.11 mmol) were added to a solu-
tion of benzylurea acid (200 mg, 1.33 mmol) in THF (3 mL). The
solution was stirred for 10 min followed by the addition of concen-
trated HCl (two drops) and the resulting solution was stirred at
ambient temperature for 48 h. The reaction mixture was concen-
trated to a viscous oil, which was then purified by chromatography
on SiO2 and eluted with hexane/EtOAc (2:1) to afford UP-
CMLD00WMAL2-61 (488.3 mg, 80%) as a fine solid. 1H NMR
(300 MHz, CDCl3) d 8.07 (d, 1H, J = 7.5 Hz), 7.96–7.88 (m, 2H),
7.78 (ddd, 1H, J = 14.6, 7.2, 2.2 Hz), 7.39–7.17 (m, 8H), 6.97 (dd,
1H, J = 7.1, 2.2 Hz), 5.90 (s, 2H), 5.22 (d, 1H, J = 16.3 Hz), 4.94 (d,
1H, J = 16.3 Hz), 4.00–3.90 (m, 2H), 2.56 (s, 3H), 1.04 (t, 3H,
J = 7.1 Hz); 13C NMR (300 MHz, CDCl3) d 165.5, 152.7, 150.4,
148.7, 145.5, 137.9, 137.2, 135.8, 132.3, 132.1, 129.2, 129.1,
128.7, 128.6, 128.4, 127.4, 126.7, 125.2, 122.3, 102.8, 60.2, 48.3,
45.9, 16.3, 13.6; MS (API-ES) m/z (rel. intensity) 552.2 (MH+,
100); purity determined by LC–UV at 254 nm: 83.8%.
In summary, we describe the discovery of a novel class of anti-
malarial agents. In the future, second-generation chemical libraries
of these pyrimidinone sub-classes should be analyzed for their ef-
fects on P. falciparum, but already we have identified compounds
that have equal or greater potency in the [3H]hypoxanthine uptake
assay as established antimalarial agents and that are synthetically
readily modified.31 Based on the success of our initial efforts, re-
ported herein, we are confident that compounds with greater
potencies and improved pharmacological properties are within
reach.
3.1.4. Synthesis of MAL2-213
A stirred solution of dihydropyrimidinone (20 mg, 0.051 mmol)
in CH2Cl2 (1 mL) containing DMAP (10 mg, 0.082 mmol) was trea-
ted with EDCI (11 mg, 0.056 mmol) followed by methyl 1-(2-ami-
noethyl)-2-methyl-5-phenyl-1H-pyrrole-3-carboxylate
(15 mg,
0.051 mmol). The resulting solution was stirred/shaken at room
temperature for 18 h. The mixture was washed with water, dried
over MgSO4, and then purified by chromatography on SiO2 and
eluted with hexane/EtOAc (3:1) and CH3Cl/EtOAc (6:1) to afford
UPCMLD00WMAL2-213 (26 mg, 81%). 1H NMR (300 MHz, CDCl3)
d 8.18 (d, 2H, J = 6.8 Hz), 7.45–7.34 (m, 7H), 6.55 (s, 1H), 5.74 (br
s, 1H), 5.54 (br s, 1H), 5.47 (d, 1H, J = 3.1 Hz), 4.16–4.09 (m, 4H),
3.80 (s, 3H), 3.79–3.73 (m, 1H), 3.63–3.60 (m, 1H), 3.30–3.23 (m,
2H), 2.62 (s, 3H), 2.55 (s, 3H), 1.99 (t, 2H, J = 6.5 Hz), 1.83–1.72
3. Experimental
3.1. Synthesis of compounds using in this study
The synthesis of MAL3-39 and MAL2-215,19 DMT3024,18 and
DMT226431 has previously been reported. The following com-
pounds were synthesized as described.

1532
A. N. Chiang et al. / Bioorg. Med. Chem. 17 (2009) 1527–1533
(m, 2H), 1.20 (t, 3H, J = 7.1 Hz); MS (APCI) m/z (rel. intensity) 1285
(2MNa+, 60), 686 (100), 664 (40), 654 (MNa+, 40), 632 (MH+, 10);
purity determined by 1H NMR: >95%.
equilibrated with TMC50 buffer (20 mM Tris, pH 7.2, containing
5 mM MgCl2 and 50 mM NaCl). Bound proteins were eluted with
a step gradient of TMC50 and TMC100 (20 mM Tris, pH 7.2, contain-
ing 5 mM MgCl2 and 100 mM NaCl), and fractions containing
Hsp70, as assessed by SDS-PAGE, were pooled and loaded onto
an ATP-agarose column (Sigma-Aldrich), which was recirculated
for 4 h. The column was washed with TMC100 and the bound
Hsp70 was eluted with TMC100 containing 10% glycerol and
25 mM ATP, and then TMC100 containing glycerol, ATP, and 4 M
NaCl. Fractions containing the majority of the Hsp70 protein, as as-
sessed above, were pooled and dialyzed against 20 mM Tris, pH
7.2, containing 50 mM NaCl and 1 mM EDTA. The final dialysate
was loaded onto a Q-Sepharose column (Sigma–Aldrich) equili-
brated with TMC100, and the column was washed with TMC100
and the purified Hsp70 was eluted using a linear gradient of
TMC100 to TMC400. The purified Hsp70 was dialyzed against
50 mM Tris, pH 7.4, containing 50 mM NaCl, 0.8 mM DTT, 2 mM
MgCl2, and 5% glycerol, snap-frozen in liquid nitrogen, and stored
at À80 °C.
3.1.5. Synthesis of JAB75
In the presence of polyphosphate ester (PPE, 300.0 mg), a solu-
tion of methyl 3-oxo-4-phenylbutanoate (384.0 mg, 2.0 mmol), 2-
naphthaldehyde (312.0 mg, 2,0 mmol) and urea (180.0 mg,
3.0 mmol) in THF (40 mL) was heated at reflux for 15 h. The prod-
uct was extracted into EtOAc, and the combined EtOAc extracts
were dried (Na2SO4), concentrated, and purified by chromatogra-
phy on SiO2 with hexane/EtOAc (3:1) to afford 330 mg (44%) of UP-
CMLD00WJAB75. 1H NMR (300 MHz, DMSO-d6) d 9.43 (s, 1H),
7.91–7.75 (m, 4H), 7.58–7.24 (m, 8H), 5.35 (d, 1H, J = 3.3 Hz),
4.12, 4.08 (AB, 2H, J = 13.7 Hz), 3.52 (s, 3H); MS (API-ES) m/z (rel.
intensity) 373 ([M+H]+, 100), 395 ([M+Na]+, 15); HRMS (EI) m/z
calcd for C23H20N2O3 372.1474, found 372.1477; purity deter-
mined by LC–UV at 254 nm: 95%.
3.2. Protein purifications
Second, a hexastidine (His6)-tagged form of human Hsp70 was
constructed and purified, and significantly higher yields of protein
were obtained. To this end, plasmid DNA pMSHSP (see above) was
used as template in a polymerase chain reaction using oligonucleo-
tide primers with the following sequences: ACGATCGAAGAAGTGG
ACCACCATCACCATCACCATTAG (forward) and GTCCACTTCTTCGA
TCGTGGGGCCTGACCCAGACCCTCC (reverse), which replaced the
six C-terminal amino acids with a His6 polypeptide tag at the C-ter-
minus of the Hsp70 protein coding sequence. A ligation-indepen-
dent mutagenesis protocol was used to design these primers and
carry out the mutagenesis cloning.34 The sequence of the protein
coding region of the recombinant plasmid was confirmed by DNA
sequencing. For expression of recombinant Hsp70–His6, E. coli cul-
tures containing the recombinant plasmid (pMSHSP- His6) were
The yeast Hsp70, Ssa1, and a J domain-containing Hlj1-glutathi-
one-S-transferase protein chimera were purified as previously de-
scribed.26,32 Ydj1 was kindly provided by Dr. D. Cyr (University of
North Carolina School of Medicine), and Hdj1 was purchased from
StressGen/Assay Designs. The purification of a hexahistidine-
tagged version of P. falciparum Hsp70 (PF08_0054) was performed
as described33 with several modifications. The plasmid pQE30-P.
falciparum Hsp70 was introduced into chemically competent Esch-
erichia coli Rosetta 2 cells (Novagen), and transformed colonies
were selected on LB with ampicillin and chloramphenicol. Over-
night cultures were grown at 26 °C and diluted 1:10 into 1 L of
the same media, the cells were grown to mid-log phase, and IPTG
was added before growth was continued for another 5 h at 26 °C.
Cells were harvested and lysed, and the extract was loaded on a
nickel-chelating Sepharose column in lysis buffer (8 M urea,
300 mM NaCl, 10 mM Tris, pH 8.0, 10 mM imidazole, 1 mM PMSF,
2 mM leupeptin, 0.7 mM pepstatin A). The column was washed
with 10 mL of low imidazole buffer (10 mM Tris, pH 8.0, containing
300 mM NaCl and 10 mM imidazole), followed by 20 mM imidaz-
grown in LB containing 100 lg/ml ampicillin to O.D.600 = 0.8 at
37 °C, and induced at 25 °C for 18 h with 0.4 mM IPTG. Following
centrifugation, the cell pellets were lysed by a combination of son-
ication (model W-220F, Branson) and passing the cells through a
pressurized cell disruptor (Microfluidics) in 50 mM Tris, pH 8.0,
containing 500 mM NaCl, 10% glycerol, and 20 mM imidazole.
The Hsp70 was then purified at 4 °C using a standard purification
protocol recommended for use with Ni-NTA resin (QIAGEN), and
the recombinant Hsp70–His6 was eluted from the resin with
100 mM Tris, pH 8.0, containing 200 mM imidazole and 500 mM
NaCl,. Next, the protein was further purified by size exclusion chro-
matography using a preparative Superdex-200 gel filtration col-
umn equilibrated in 50 mM Tris, pH 8.0, containing 500 mM
NaCl. Fractions containing the purified protein were dialyzed over-
night in 10 mm Tris, pH 8.0, at 4 °C, and the dialyzed protein was
pooled, aliquoted, and stored at À70 °C.
ole buffer, and the bound proteins were eluted using
a
10 mL Â 10 mL linear gradient of 25 mM to 500 mM imidazole.
Samples from 1 mL fractions were analyzed by SDS–PAGE and peak
fractions were pooled and dialyzed against 50 mM Tris, pH 7.4,
containing 50 mM NaCl, 0.8 mM DTT, 2 mM MgCl2, and 5% glyc-
erol. The dialysate was then loaded onto a Q-Sepharose column
and washed, and the purified protein was eluted with 50 mM Tris,
pH 7.4, containing 200 mM NaCl, 0.8 mM DTT, 2 mM MgCl2, and 5%
glycerol. Peak fractions were identified and were dialyzed as above.
Protein aliquots were frozen in liquid nitrogen and stored at
À80 °C. The activity of the enzyme was comparable to that isolated
using previously described methods.33
3.3. In vitro and cell-based assays
Human Hsp70 (HSPA1A) was purified in one of two manners.
First, an untagged version was purified based on a protocol pro-
vided by R. Morimoto (Northwestern University). A 25 mL culture
of E. coli containing plasmid pMSHSP BL21 FS in LB-ampicillin
was used to inoculate a 1 L culture, and after 4 h at 37 °C protein
expression was induced with IPTG. After another 6 h, the cells were
harvested and washed, and the pellet was frozen in 50 mL of TEK50
buffer (20 mM Tris, pH 8.0, containing 0.1 mM EDTA and 50 mM
KCl). The thawed pellets were resuspended in TEK50 containing
Steady state and single turnover ATPase assays with the indicated
Hsp70 preparations were performed as previously described.18,19
Compounds were assessed for their ability to inhibit the growth
of P. falciparum asexual blood stages using [3H]hypoxanthine up-
take assays, involving exposure of parasites to drug for 72 h and
adding [3H]hypoxanthine for the last 24 h, as previously de-
scribed.35 Each compound was screened at final concentrations of
1
l
M and 5
[3H]hypoxanthine uptake by >50% at 5
as much inhibition at 1 M were selected and re-screened. The
l
M. Compounds that initially appeared to inhibit
l
M and displayed at least
1 mg/ml lysozyme, 0.5 mM PMSF, 1
lg/ml leupeptin, and 1
lg/ml
l
pepstatin A, and the cells were subjected to three freeze-thaw cy-
cles and lysed by sonication. Cell debris was removed by low-speed
centrifugation, and the supernatant was cleared by ultracentrifu-
gation and chromatographed on a DEAE column (Sigma-Aldrich)
group of nine compounds that passed this second test (Fig. 2) was
then subjected to dose-response analyses. IC50 values were calcu-
lated using a linear regression analysis based on the linear portions
of plotted values. The IC50 value for CQ was assessed as described.23

A. N. Chiang et al. / Bioorg. Med. Chem. 17 (2009) 1527–1533
1533
9. Fewell, S. W.; Travers, K. J.; Weissman, J. S.; Brodsky, J. L. Annu. Rev. Genet. 2001,
35, 149.
10. Maier, A. G.; Rug, M.; O’Neill, M. T.; Brown, M.; Chakravorty, S.; Szestak, T.;
Chesson, J.; Wu, Y.; Hughes, K.; Coppel, R. L.; Newbold, C.; Beeson, J. G.; Craig,
A.; Crabb, B. S.; Cowman, A. F. Cell 2008, 134, 48.
The effect of the compounds on the growth of HepG2 and WI-38
cells was assessed as previously described.18 Data are reported as
GI50 values and were calculated relative to a DMSO (negative)
control.
11. Hunt, N. H.; Stocker, R. Blood Cells 1990, 16, 499.
12. Frydman, J.; Nimmesgern, E.; Ohtsuka, K.; Hartl, F. U. Nature 1994, 370, 111.
13. Banumathy, G.; Singh, V.; Pavithra, S. R.; Tatu, U. J. Biol. Chem. 2003, 278, 18336.
14. Pavithra, S. R.; Kumar, R.; Tatu, U. PLoS Comput. Biol. 2007, 3, 1701.
15. Midorikawa, Y.; Haque, Q. M.; Nakazawa, S. Chemotherapy 1998, 44, 409.
16. Ramya, T. N.; Karmodiya, K.; Surolia, A.; Surolia, N. J. Biol. Chem. 2007, 282, 6388.
17. Nadeau, K.; Nadler, S. G.; Saulnier, M.; Tepper, M. A.; Walsh, C. T. Biochemistry
1994, 33, 2561.
18. Wright, C. M.; Chovatiya, R. J.; Jameson, N. E.; Turner, D. M.; Zhu, G.; Werner, S.;
Huryn, D. M.; Pipas, J. M.; Day, B. W.; Wipf, P.; Brodsky, J. L. Bioorg. Med. Chem.
2008, 16, 3291.
Acknowledgments
This work was supported in part by a pilot grant from the Uni-
versity of Pittsburgh Drug Discovery Institute to J.L.B. R.J.C. was
supported by a fellowship from the Beckman Foundation, and
S.B. received funding from a Howard Hughes Medical Institute
undergraduate research program. P.W. and D.M.H. thank the
NIH-NIGMS for Grant P50-GM067082 for support of the CMLD pro-
gram at the University of Pittsburgh. We also wish to thank Greg
Blatch, James Burden, Pete Chambers, Doug Cyr, Myriam Gorospe,
Michael Lyon, Richard Morimoto, Stephanie Nicolay, Bill Strieff,
David Turner, and Stefan Werner for technical assistance and/or
for providing reagents.
19. Fewell, S. W.; Smith, C. M.; Lyon, M. A.; Dumitrescu, T. P.; Wipf, P.; Day, B. W.;
Brodsky, J. L. J. Biol. Chem. 2004, 279, 51131.
20. Fewell, S. W.; Day, B. W.; Brodsky, J. L. J. Biol. Chem. 2001, 276, 910.
21. Rodina, A.; Vilenchik, M.; Moulick, K.; Aguirre, J.; Kim, J.; Chiang, A.; Litz, J.;
Clement, C. C.; Kang, Y.; She, Y.; Wu, N.; Felts, S.; Wipf, P.; Massague, J.;
Jiang, X.; Brodsky, J. L.; Krystal, G. W.; Chiosis, G. Nat. Chem. Biol. 2007, 3,
498.
22. Noedl, H.; Krudsood, S.; Leowattana, W.; Tangpukdee, N.; Thanachartwet, W.;
Looareesuwan, S.; Miller, R. S.; Fukuda, M.; Jongsakul, K.; Yingyuen, K.;
Sriwichai, S.; Ohrt, C.; Knirsch, C. Antimicrob. Agents Chemother. 2007, 51, 651.
23. Sidhu, A. B.; Verdier-Pinard, D.; Fidock, D. A. Science 2002, 298, 210.
24. Wellems, T. E.; Panton, L. J.; Gluzman, I. Y.; do Rosario, V. E.; Gwadz, R. W.;
Walker-Jonah, A.; Krogstad, D. J. Nature 1990, 345, 253.
Supplementary data
Supplementary data associated with this article can be found, in
the online version, at doi:10.1016/j.bmc.2009.01.024.
25. Shonhai, A.; Boshoff, A.; Blatch, G. L. Mol. Genet. Genom. 2005, 274, 70.
26. Youker, R. T.; Walsh, P.; Beilharz, T.; Lithgow, T.; Brodsky, J. L. Mol. Biol. Cell
2004, 15, 4787.
27. Fernandez-Saiz, V.; Moro, F.; Arizmendi, J. M.; Acebron, S. P.; Muga, A. J. Biol.
Chem. 2006, 281, 7479.
References and notes
28. Jiang, J.; Prasad, K.; Lafer, E. M.; Sousa, R. Mol. Cell 2005, 20, 513.
29. Tang, Y. C.; Chang, H. C.; Chakraborty, K.; Hartl, F. U.; Hayer-Hartl, M. EMBO J.
2008, 27, 1458.
1. McKerrow, J. H. PLoS Med. 2005, 2, e210.
2. Pecoul, B. PLoS Med. 2004, 1, e6.
3. Botha, M.; Pesce, E. R.; Blatch, G. L. Int. J. Biochem. Cell Biol. 2007, 39, 1781.
4. Shonhai, A.; Boshoff, A.; Blatch, G. L. Protein Sci. 2007, 16, 1803.
5. Mayer, M. P.; Bukau, B. Cell Mol. Life Sci. 2005, 62, 670.
6. Craig, E. A.; Huang, P.; Aron, R.; Andrew, A. Rev. Physiol. Biochem. Pharmacol.
2006, 156, 1.
30. Ekland, E. H.; Fidock, D. A. Curr. Opin. Microbiol. 2007, 10, 363.
31. Werner, S.; Turner, D. M.; Lyon, M. A.; Huryn, D. M.; Wipf, P. Synlett 2006, 2334.
32. McClellan, A. J.; Brodsky, J. L. Genetics 2000, 156, 501.
33. Matambo, T. S.; Odunuga, O. O.; Boshoff, A.; Blatch, G. L. Protein Exp. Purif. 2004,
33,
214.
34. Chiu, J.; March, P. E.; Lee, R.; Tillett, D. Nucleic Acids Res. 2004, 32, e174.
35. Fidock, D. A.; Nomura, T.; Wellems, T. E. Mol. Pharmacol. 1998, 54, 1140.
36. Vembar, S.S.; Jin, Y.; Brodsky, J.L.; Hendershot, L.M., in preparation.
7. Hartl, F. U. Nature 1996, 381, 571.
8. Tonkin, C. J.; Pearce, J. A.; McFadden, G. I.; Cowman, A. F. Curr. Opin. Microbiol.
2006, 9, 381.