Curcuminoid analogs inhibit nitric oxide production from LPS-activated microglial cells

Article abstract of DOI:10.1007/s11418-011-0599-6

The chemically modified analogs, the demethy-lated analogs 4-6, the tetrahydro analogs 7-9 and the hexahydro analogs 10-12, of curcumin (1), demethoxycurcumin (2) and bisdemethoxycurcumin (3) were evaluated for their inhibitory activity on lipopolysaccharide activated nitric oxide (NO) production in HAPI microglial cells. Di-O-demethylcurcumin (5) and O- demethyldemethoxycurcumin (6) are the two most potent compounds that inhibited NO production. The analogs 5 and 6 were twofold and almost twofold more active than the parent curcuminoids 1 and 2, respectively. Moreover, the mRNA expression level of inducible NO synthase was inhibited by these two compounds. The strong neuroprotective activity of analogs 5 and 6 provide potential alternative compounds to be developed as therapeutics for neurological disorders associated with activated microglia. The Japanese Society of Pharmacognosy and Springer 2011.

Full text of DOI:10.1007/s11418-011-0599-6

J Nat Med (2012) 66:400–405
DOI 10.1007/s11418-011-0599-6
NOTE
Curcuminoid analogs inhibit nitric oxide production
from LPS-activated microglial cells
•
Jiraporn Tocharus Sataporn Jamsuwan
•
•
•
Chainarong Tocharus Chatchawan Changtam
Apichart Suksamrarn
Received: 24 May 2011 / Accepted: 26 September 2011 / Published online: 13 October 2011
Ó The Japanese Society of Pharmacognosy and Springer 2011
Abstract The chemically modified analogs, the demethy-
lated analogs 4–6, the tetrahydro analogs 7–9 and the hexa-
hydro analogs 10–12, of curcumin (1), demethoxycurcumin
(2) and bisdemethoxycurcumin (3) were evaluated for their
inhibitory activity on lipopolysaccharide activated nitric
oxide (NO) production in HAPI microglial cells. Di-O-dem-
ethylcurcumin (5) and O-demethyldemethoxycurcumin (6)
are the two most potent compounds that inhibited NO pro-
duction. The analogs 5 and 6 weretwofold and almost twofold
more active than the parent curcuminoids 1 and 2, respec-
tively. Moreover, themRNA expressionlevelofinducibleNO
synthase was inhibited by these two compounds. The strong
neuroprotective activity of analogs 5 and 6 provide potential
alternative compounds to be developed as therapeutics for
neurological disorders associated with activated microglia.
Introduction
Microglia are the principal immune cells of the central
nervous system (CNS) [1]. They are activated in response
to brain injury from inflammation, damage, or disease, and
then release neurotoxic factors, including pro-inflammatory
cytokines such as tumor necrosis factor a (TNF a), inter-
leukin (IL)-1b, IL-6, as well as nitric oxide (NO) [2, 3].
Among these mediators, NO is the product of the inducible
isoforms of the inducible NO synthase (iNOS) enzyme that
is induced in response to proinflammatory cytokine and
bacterial lipopolysaccharide (LPS) [4, 5]. NO released
from microglia is known to induce neurotoxicity. iNOS
expression and NO generation by activated microglia have
been described in several brain pathologies including
multiple sclerosis, cerebral ischemia and Alzheimer’s dis-
ease [6, 7], while inhibition of NO production provides
significant neuroprotection [8].
Keywords Curcuminoid analog ꢀ HAPI microglia ꢀ
Inducible nitric oxide synthase ꢀ Di-O-demethylcurcumin ꢀ
O-Demethyldemethoxycurcumin
Curcumin (1) (Fig. 1) is a major chemical component of
curcuminoids, which in turn are isolated from turmeric
(Curcuma longa L.). Another two minor curcuminoids,
demethoxycurcumin (2) and bisdemethoxycurcumin (3),
are natural analogs of curcumin. Curcumin is metabolized
into dihydrocurcumin (DHC) and tetrahydrocurcumin
(THC), which are converted to monoglucuronide conju-
gates including curcumin glucuronide. Previous studies
have reported that curcumin and its natural analogs are
promising agents for the prevention and treatment of neu-
rodegenerative diseases via their inhibiting effect on
microglia activation [9–11]. Curcumin and its natural
analogs have a significantly inhibitory effect on NO pro-
duction by rat primary microglia induced by LPS through
inhibiting expression of iNOS at both the protein and
mRNA level [10, 12, 13]. Previous studies have reported
that analogs of curcumin exhibited higher physiological
J. Tocharus (&)
Department of Physiology, Faculty of Medicine,
Chiang Mai University, Chiang Mai 50200, Thailand
e-mail: sukbunteung@hotmail.com
S. Jamsuwan
Department of Anatomy, Faculty of Medical Science,
Naresuan University, Phitsanulok 65000, Thailand
C. Tocharus
Department of Anatomy, Faculty of Medicine,
Chiang Mai University, Chiang Mai 50200, Thailand
C. Changtam ꢀ A. Suksamrarn
Department of Chemistry, Faculty of Science,
Ramkhamhaeng University,
Bangkapi, Bangkok 10240, Thailand
123

J Nat Med (2012) 66:400–405
401
of compounds 4–12 was therefore selected for further
experiments (data not shown).
The curcuminoids 1–3 and their analogs 4–12 were
evaluated for their inhibitory effect on NO production in
LPS-activated HAPI microglial cells. The results from
previous studies indicated that the parent curcuminoids
curcumin (1), demethoxycurcumin (2) and bisdeme-
thoxycurcumin (3) have both NO scavenging and inhib-
itory NO production activity [14, 15]. Curcumin (1)
showed strong NO inhibitory potential in primary
microglia cells in LPS-mediated NO production via
inhibition of the activation of JNK, p38 and NF-jB [16].
In addition, demethoxycurcumin (2) and bisdemethoxy-
curcumin (3)—minor components of curcuminoids—also
exhibited strong inhibition of NO activity in LPS-acti-
vated microglial cells [10, 17, 18]. These results suggest
that curcuminoid analogs also exhibit an inhibitory effect
on NO production in LPS-activated microglia cells
similar to that of the parent compounds and S-meth-
ylisothiourea (S-MT), a selective iNOS inhibitor used as
a positive control in the evaluation of the inhibitory
effects on the NO production with IC50 values varying
from 5.14 to 10.94 lM (Table 1). Among these com-
pounds, the demethylated analogs, di-O-demethylcurcu-
min (5) and O-demethyldemethoxycurcumin (6) were
more effective than their parent compounds, with IC50
value of 5.14 and 6.12 lM, respectively. Analogs 5 and
6 were twofold and almost twofold more active than the
respective parent curcuminoids 1 and 2. At a concen-
tration of 2–8 lM, compounds 5 and 6 showed an NO
inhibitory effect in a dose-dependent manner (Fig. 2).
The significant inhibitory activity of the demethylated
analogs 5 and 6 could be the result of the presence of
two and one extra phenolic hydroxyl groups on the
phenyl rings. The enhanced inhibitory activity of these
compounds might also be due to the presence of the 1,2-
dihydroxy phenolic (catechol) system in the molecule,
since such a system has been reported to exhibit high
anti-oxidant activity [19].
Fig. 1 Chemical structures of parent curcuminoids 1–3 and modified
analogs 4–12
activities and pharmacological activities than the parent
curcumin itself by inhibiting NO and proinflammatory
cytokines [10–13]. It is therefore of interest to investigate
whether chemical modification of curcuminoids would
improve their neuroprotective properties. This study com-
pared the inhibitory effect on NO production from LPS-
activated microglia of synthetic curcuminoid analogs—the
demethylated analogs 4–6, the tetrahydro analogs 7–9, and
the hexahydro analogs 10–12 (Fig. 1).
Curcuminoid analogs 5 and 6 further downregulated the
expression of iNOS mRNA, indicating that the action of
these compounds occurred at the transcriptional level. A
similar result was also observed in cells treated with the
parent compounds (Fig. 3). The results showed that pre-
treated S-MT inhibited the expression of iNOS mRNA
caused by LPS in a concentration-dependent manner
(Fig. 3). The results further supported the notion that LPS
induces NO overexpression in microglia. Higher concen-
trations of S-MT inhibited the basal level of iNOS mRNA
expression.
Results and discussion
The cytotoxic effect of the curcuminoids 1–12 on HAPI
microglial cells was determined by MTT reduction assay.
The curcuminoids 1–3 and their analogs 4–12 at concen-
trations of 20–40 lM decreased cell viability significantly
in a concentration dependent manner. On the other hand,
cells treated with curcuminoids 1–3 and their analogs 4–12
at concentrations of 10 lM exhibited viability similar to
the control (untreated control). A concentration of\10 lM
The impairment of NO generation that led to decreased
nitrite production in this study might be due to both direct
NO scavenging activity of these two analogs and indirect
123

402
J Nat Med (2012) 66:400–405
120
100
80
60
40
20
0
Table 1 Inhibition of nitric oxide (NO) production by curcuminoids
1–3 and their synthetic analogs 4–12 in lipopolysaccharide (LPS)-
activated HAPI microglial cells
Compound
Inhibition of NO
production: IC50 (lM)
*
Curcumin (1)
10.94 1.11
10.32 1.52
9.46 1.3
Demethoxycurcumin (2)
*
*
Bisdemethoxycurcumin (3)
Mono-O-demethylcurcumin (4)
Di-O-demethylcurcumin (5)
O-demethyldemethoxycurcumin (6)
Tetrahydrocurcumin (7)
10.80 1.06
5.14 0.41
6.12 1.46
9.63 1.59
8.90 0.05
10.01 0.56
7.99 0.12
8.70 0.46
9.72 0.68
LPS
2
4
8
10
di -O -demethylcurcumin (5) (µM)
120
100
80
60
40
20
0
Tetrahydrodemethoxycurcumin (8)
Tetrahydrobisdemethoxycurcumin (9)
Hexahydrocurcumin (10)
Hexahydrodemethoxycurcumin (11)
Hexahydrobisdemethoxycurcumin (12)
*
Values represent the mean SEM of three separate determinations
*
*
blockade effects of NO-producing pathways by suppres-
sion of iNOS at the transcriptional and translational levels.
In conclusion, nine curcuminoid analogs were synthe-
sized and evaluated for their inhibitory NO production in
microglial cell activated by LPS in vitro. Among them, the
curcuminoid analogs 5 and 6 are more potent than the
parent curcuminoids. These two compounds may have
therapeutic potential in the treatment of neurodegenerative
diseases accompanied by microglial activation.
LPS
2
4
8
10
O -demethyldemethoxycurcumin (6) (µM)
120
100
80
60
40
20
0
*
*
Materials and methods
*
Chemicals
LPS
2
4
8
10
S -MT (µM)
Dulbecco’s modified Eagle’s medium (DMEM), fetal
bovine serum (FBS), trypsin, penicillin, and streptomycin
were purchased from GIBCO-BRL (Gaithersburg, MD).
Nitrite, phosphoric acid, N-(1-naphthyl)ethylenediamine
dihydrochloride, sulfanilamide, and 3-(4,5-dimethylthia-
zol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), LPS
(E. coli serotype 055:B5), and S-MT were obtained from
Sigma-Aldrich (St. Louis, MO).
Fig. 2 Effect of di-O-demethylcurcumin (5), O-demethyldemethox-
ycurcumin (6) and S-methylisothiourea (S-MT) on lipopolysaccharide
(LPS)-induced NO production in HAPI microglia cells. Cells were
treated with the analogs 5, 6 or S-MT (2–10 lM) in the presence or
absence of LPS (1 lg/ml) for 24 h. The culture supernatants were
collected and analyzed for nitrite production using Griess reagent.
The results were expressed as percentage values taking the LPS
treatment group as 100%. Data were represented as mean SEM of
three separate experiments. Significance compared with LPS-only
treatment group: *P \ 0.05, ***P \ 0.001
Cell culture
The immortalized rat microglial cell line HAPI was gen-
erously provided by J.R. Connor (Hershey Medical Center,
Hershey, PA). Microglial cells were maintained in DMEM
supplemented with FBS (10%, v/v), penicillin (100 IU/ml)
and streptomycin (100 lg/ml) at 37°C in a humidified 5%
CO2 and 95% air atmosphere.
Preparation of curcuminoid analogs
The parent curcuminoids 1–3 were isolated from the rhi-
zome of Curcuma longa L. The curcuminoids were mod-
ified chemically to the corresponding demethylated analogs
4–6, tetrahydro analogs 7–9, and hexahydro analogs 10–12.
123

J Nat Med (2012) 66:400–405
403
1.4
1.2
1
Fig. 3 Effect of di-O-
demethylcurcumin (5)
O-demethyldemethoxycurcumin
(6) and S-MT on iNOS
iNOS
406 bp
508 bp
*
0.8
0.6
0.4
0.2
0
GAPDH
expression in LPS-activated
HAPI microglia cells. Cells
(1.5 9 105 cells/well) were
pretreated with the analogs 5, 6
or S-MT (2–10 lM) for 2 h
before stimulating with 1 lg/ml
LPS for 6 h. Total RNA was
isolated and analyzed for
GAPDH and iNOS mRNA by
semi-quantitative RT-PCR.
GAPDH is used as a reference
to control for equal loading. The
level of iNOS was quantified as
the relative expression
*
*
**
LPS (1 µg/ml)
Curcumin (1) (µM)
-
-
+
-
+
4
+
8
+
10
0.8
0.7
0.6
0.5
0.4
0.3
0.2
0.1
0
iNOS
406 bp
508 bp
*
GAPDH
LPS (1 µg/ml)
-
-
+
-
+
4
+
8
+
10
di-O-demethylcurcumin (5) (µM)
normalized against GAPDH in
the same sample. Data were
derived from three independent
experiments. *P \ 0.05,
**P \ 0.01, ***P \ 0.001 as
compared with the LPS-only
group
0.7
0.6
0.5
0.4
0.3
0.2
0.1
0
406 bp
508 bp
iNOS
*
**
GAPDH
LPS (1 µg/ml)
-
O-demethyldemethoxycurcumin(6) -
(µM)
+
-
+
4
+
8
+
10
0.8
0.7
0.6
0.5
0.4
0.3
0.2
0.1
0
406 bp
508 bp
iNOS
*
GAPDH
**
LPS (1 µg/ml)
S-MT (µM)
-
-
+
-
+
4
+
8
+
10
The chemical structures of compounds 4–12 are shown in
Fig. 1. Thus, starting from curcumin, demethylation to the
corresponding mono-O-demethyl analog 4 and di-O-dem-
ethyl analog 5 were accomplished in yields of 42% and
33%, respectively, by treatment of curcumin with boron
tribromide in dry dichloromethane. Demethylation of the
demethoxycurcumin was similarly achieved to the corre-
sponding O-demethyl analog 6 in 64% yield. The spec-
troscopic (IR, 1H NMR and mass spectra) data of 4, 5 and 6
were consistent with reported values [19]. A number of
non-conjugated analogs of the parent curcuminoids 1–3
were also prepared for biological evaluation. Catalytic
hydrogenation of curcumin, with palladium on charcoal as
a catalyst, furnished THC (7) and hexahydrocurcumin (10)
in 68% and 18% yields, respectively. The spectroscopic
data of compounds 7 and 10 were consistent with reported
values [20, 21]. From the demethoxycurcumin, tetrahydro
analog 8 and hexahydro 11 were similarly prepared in 62%
and 15% yields, respectively. The spectroscopic data of
compound 8 were consistent with reported values, and
those of compound 11 revealed the existence of a 1:1
mixture of 11a and 11b [22]. From bisdemethoxycurcumin,
the tetrahydro analog 9 and hexahydro analog 12 were
similarly prepared at 65% and 12% yields, respectively.
The spectroscopic data of compounds 11 and 12 were
consistent with reported values [22]. The purity of all
synthesized compounds was verified by thin layer chro-
matography (TLC) using Merck’s precoated silica gel 60
F
254 plates, with dichloromethane–methanol and n-hexane–
ethyl acetate as two developing solvent systems. The spots
on TLC were detected under UV light and by spraying with
anisaldehyde–sulfuric acid reagent followed by heating.
The purity of the compounds was further confirmed by
NMR spectroscopy.
Cell viability assay
Cell viability was measured by quantitative colorimetric
assay with MTT. HAPI microglial cells were cultured at a
density of 1.5 9 104 cells/well in 96-well plate overnight.
Various concentrations of curcuminoids 1–3 and their
synthetic curcuminoid analogs 4–12 were added to HAPI
microglial cells. After 24 h, 10 mg/ml of MTT were added
to each well and further incubated for 4 h. Formazan was
123

404
J Nat Med (2012) 66:400–405
References
solubilized with dimethyl sulfoxide (DMSO) and was
determined by measuring the absorbance at 540 nm using a
microplate reader (Bio-Tek Instruments, Winooski, VT).
1. Gehrmann J, Matsumoto J, Kreutzberg GW (1995) Microglia:
intrinsic immuneffector cell of the brain. Brain Res Rev
20:269–287
Measurement of nitrite
2. Takeuchi H, Mizuno T, Zhang G, Wang J, Kawanokuchi J, Kuno
R, Suzumura A (2005) Neuritic beading induced by activated
microglia is an early feature of neuronal dysfunction toward
neuronal death by inhibition of mitochondrial respiration and
axonal transport. J Biol Chem 280:10444–10454
3. Liu B, Hang JS (2003) Role of microglia in inflammation-med-
iated neurodegenerative diseases: mechanisms and strategies for
therapeutic intervention. J Pharmacol Exp Ther 304:1–7
4. Simmons ML, Murphy S (1992) Induction of nitric oxide syn-
thase in glial cells. J Neurochem 59:897–905
5. Weldon DT, Rogers SD, Ghilardi JR, Finke MP, Cleary JP,
O’Hare E, Esler WP, Maggio JE, Mantyh PW (1998) Fibrillar
beta-amyloid induces microglial phagocytosis, expression of
inducible nitric oxide synthase, and loss of a select population of
neurons in the rat CNS in vivo. J Neurosci 18:333–335
6. Zhu DY, Deng Q, Yao HH, Wang DC, Deng Y, Liu GQ (2002)
Inducible nitric oxide synthase expression in the ischemic core
and penumbra after transient focal cerebral ischemia in mice. Life
Sci 71:1985–1996
HAPI microglial cells were plated onto a 96-well plate at a
density of 105 cells/well. Cells were pretreated with curc-
uminoids 1–3 and their synthetic curcuminoid analogs
4–12 for 2 h followed by LPS for 24 h. The supernatant
was mixed with an equal volume of Griess reagent [a
mixture of 0.1% N-(1-naphthyl)ethylenediamine dihydro-
chloride and 1% sulfanilamide in 5% phosphoric acid], and
the absorbance was measured in a microplate reader at
540 nm optical density, using sodium nitrite (NaNO2) at
known concentration as a standard curve.
Reverse transcription polymerase chain reaction
For semiquantitative reverse transcription polymerase
chain reaction (RT-PCR), microglial cells in a 96-well
plate were incubated with LPS (1 lg/ml) or test com-
pounds for 6 h. Total RNA was isolated using TRIzol
according to the manufacturer’s protocol. Then, random-
primed cDNA species were prepared from total RNA using
SuperScript III RNase H-reverse transcriptase. Specific
DNA sequences were amplified with a PCR mixture. Each
PCR primer used in this study was as follows: iNOS
(accession no. 010927), 50 TCACTGGGACAGCACAGA
AT (sense) and 50 TGTGTCTGCAGATGTGCTGA (anti-
sense) and GAPDH (accession no. 001473623), 50 TCCCT
CAAGATTGTGAGCAA (sense) and 50 AGATCCACAA
CGGATACATT (antisense). Amplification products were
resolved by 1.0% agarose gel electrophoresis, stained with
ethidium bromide, and photographed under ultraviolet
light. The level of transcript for the constitutive house-
keeping gene product, GAPDH, was measured quantita-
tively for each sample to control differences in RNA
concentration.
7. Liu B, Gao HM, Wang JY, Jeohn GH, Cooper CL, Hang JS
(2002) Role of nitric oxide in inflammation-mediated neurode-
generation. Ann N Y Acad Sci 962:318–331
8. Gahm C, Holmin S, Wiklund PN, Brundin L, Mathiesen T (2006)
Neuroprotection by selective inhibition of inducible nitric oxide
synthase after experimental brain contusion. J Neurotrauma
23:1343–1354
9. Jin CY, Lee JD, Park C, Choi YH, Kim GY (2007) Curcumin
attenuates the release of pro-inflammatory cytokines in lipopo-
lysaccharide-stimulated BV microglia. Acta Pharmacol Sin
28:1645–1651
10. Yang S, Zhang D, Yang Z, Hu X, Qian S, Liu J, Wilson B, Block
M, Hong JS (2008) Comparison of inhibitory potency of these
different curcuminoid pigments on nitric oxide and tumor
necrosis factor production of rat primary microglia induced by
lipopolysaccharide. Neurochem Res 33:2044–2053
11. Zhang L, Wu C, Zhao S, Yuan D, Lian G, Wang X, Wang L,
Yang J (2010) Demethoxycurcumin, a natural derivative of cur-
cumin attenuates LPS-induced pro-inflammatory responses
through down-regulation of intracellular ROS-related MAPK/NF-
jB signaling pathways in N9 microglia induced by lipopolysac-
charide. Int Immunopharmacol 10:331–338
12. Tham CL, Liew CY, Lam KW, Mohamad AS, Kim MK, Cheah
YK, Zakaria ZA, Sulaiman MR, Lajis NH, Israf DA (2010) A
synthetic curcuminoid derivative inhibits nitric oxide and proin-
flammatory cytokine synthesis. Eur J Pharmacol 628:247–254
13. Lee KH, Ab Aziz FH, Syahida A, Abas F, Shaari K, Israf DA,
Lajis NH (2009) Synthesis and biological evaluation of curcu-
min-like diarylpentanoid analogues for anti-inflammatory,
antioxidant and anti-tyrosinase activities. Eur J Med Chem
44:3195–3200
Statistical analysis
All data are shown as mean standard error of mean
(SEM). Statistical comparison between different treatments
results was analyzed by one-way ANOVA followed by the
Dunnett test. Differences with P value \0.05 were con-
sidered statistically significant.
14. Sreejayan N, Rao MN (1997) Nitric oxide scavenging by curc-
uminoids. J Pharm Pharmacol 49:105–107
15. Onoda M, Inano H (2000) Effect of curcumin on the production
of nitric oxide by cultured rat mammary gland. Nitric Oxide
4:505–515
16. Jung KK, Lee HS, Cho JY, Shin WC, Rhee MH, Kim TG, Kang
JH, Kim SH, Kang SY (2006) Inhibitory effect of curcumin on
nitric oxide production from lipopolysaccharide-activated pri-
mary microglia. Life Sci 79:2022–2031
Acknowledgments We would like to thank Associate Professor
Sukumal Chongthammakun, Department of Anatomy, Faculty of Sci-
ence, Mahidol University for her technical suggestions regarding the
maintenance of cell culture. This work was supported by the National
Research Council of Thailand and The Thailand Research Fund.
123

J Nat Med (2012) 66:400–405
405
17. Pan MH, Lin-Shiau SY, Lin JK (2000) Comparative studies on
the suppression of nitric oxide synthase by curcumin and its
hydrogenated metabolites through down-regulation of IkappaB
kinase and NFkappaB activation in macrophages. Biochem
Pharmacol 60:1665–1676
20. Ohtsu H, Xiao Z, Ishida J, Nagai M, Wang HK, Itokawa H, Su
CY, Shih C, Chiang T, Chang E, Lee Y, Tsai MY, Chang C, Lee
KH (2002) Antitumor agents. 217. Curcumin analogues as novel
androgen receptor antagonists with potential as anti-prostate
cancer agents. J Med Chem 45:5037–5042
18. Zhang LJ, Wu CF, Meng XL, Yuan D, Cai XD, Wang QL, Yang
JY (2008) Comparison of inhibitory potency of three different
curcuminoid pigments on nitric oxide and tumor necrosis factor
production of rat primary microglia induced by lipopolysaccha-
ride. Neurosci Lett 447:48–53
19. Venkateswarlu S, Ramachandra MS, Subbaraju GV (2005)
Synthesis and biological evaluation of polyhydroxycurcuminoids.
Bioorg Med Chem 78:6374–6380
21. Lee SL, Huang WJ, Lin WW, Lee SS, Chen CH (2005) Prepa-
ration and anti-inflammatory activities of diarylheptanoid and
diarylheptylamine analogs. Bioorg Med Chem 13:6175–6181
22. Portes E, Gardrat C, Castellan A (2007) A comparative study on
the antioxidant properties of tetrahydrocurcuminoids and curc-
uminoids. Tetrahedron 63:9092–9099
123