Triple helix stabilization by covalently linked DNA-bisbenzimidazole conjugate synthesized by maleimide-thiol coupling chemistry

Article abstract of DOI:10.1016/j.bmc.2006.05.034

Tethering of BBZPNH₂, an analogue of the Hoechst 33258, with a 14 nucleotide long DNA sequence with the help of succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), a heterobifunctional crosslinking reagent, using DMF/ water as solvent yields a conjugate which effectively stabilizes the triple helix. The above conjugate was hybridized with 26 bp long double stranded (ds) DNA having 14 bp long polypurine-polypyrimidine stretch to form a pyrimidine motif triple helix. The above conjugate increases the thermal stability of both the transitions, that is, triple helix to double helix by 12 °C and double helix to single strand transition by 16 °C for the triple helix formed with conjugated TFO over the triple helix made from non-conjugated TFO. Fluorescence and circular dichroism spectra recorded at different temperatures confirm the presence of minor groove binding bisbenzimidazole in the AT-rich minor groove of dsDNA even after the major groove bound TFO separates out.

Full text of DOI:10.1016/j.bmc.2006.05.034

Bioorganic & Medicinal Chemistry 14 (2006) 6444–6452
Triple helix stabilization by covalently linked
DNA–bisbenzimidazole conjugate synthesized by
maleimide–thiol coupling chemistry
Akash K. Jain,a Satish Kumar Awasthib and Vibha Tandona,*
aDr. B. R. Ambedkar Center for Biomedical Research, University of Delhi, Delhi 110007, India
bChemical Biology Laboratory, Department of Chemistry, University of Delhi, Delhi 110007, India
Received 7 March 2006; revised 17 May 2006; accepted 18 May 2006
Available online 12 June 2006
Abstract—Tethering of BBZPNH2, an analogue of the Hoechst 33258, with a 14 nucleotide long DNA sequence with the help of
succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), a heterobifunctional crosslinking reagent, using DMF/
water as solvent yields a conjugate which effectively stabilizes the triple helix. The above conjugate was hybridized with 26 bp long
double stranded (ds) DNA having 14 bp long polypurine–polypyrimidine stretch to form a pyrimidine motif triple helix. The above
conjugate increases the thermal stability of both the transitions, that is, triple helix to double helix by 12 ꢀC and double helix to
single strand transition by 16 ꢀC for the triple helix formed with conjugated TFO over the triple helix made from non-conjugated
TFO. Fluorescence and circular dichroism spectra recorded at different temperatures confirm the presence of minor groove binding
bisbenzimidazole in the AT-rich minor groove of dsDNA even after the major groove bound TFO separates out.
ꢁ 2006 Elsevier Ltd. All rights reserved.
1. Introduction
reported to bind to triple helix more tightly than the
double helix.12 Another promising triplex stabilizing li-
gand is coralyne.13 DNA minor groove binding ligands
also interact with DNA triple helix, and some of them
can be used to induce the formation of triplex structures
that could not be formed otherwise.14 Berenil was found
to stabilize the DNA and RNA triplexes under certain
conditions.15 SN-18071 was also found to stabilize the
triple helix while the analogous compound SN-6999
was found to destabilize the triplexes.16 Generally minor
groove binding ligands tend to destabilize the DNA and
RNA triplexes in the non-conjugated state.17,18 Intermo-
lecular triplexes could be additionally stabilized if the
third strand is conjugated with a DNA binding ligand,
particularly at the 50-end of the TFO. Several intercala-
tors,19,20 polycations such as polyamides and poly-
amines,21,22 cholesterol,23 etc., have been tethered with
the DNA to stabilize the triplexes.
Triplex forming oligonucleotides (TFOs) have been
widely used for the sequence specific targeting of
dsDNA to regulate the gene expression of culprit gene
to control genetic diseases by antisense/antigene ap-
proach.1–4 In the antigene approach the TFO binds se-
quence selectively in the major groove of the target
duplex to form the pyrimidine motif or purine motif
triple helices,5,6 but the triple helices have the limited
stability under the physiological conditions.7 To circum-
vent this, several strategies have been proposed to
enhance the stability of the triple helical complexes,
for example, the use of polycations like spermine,8
bivalent cations9 and the use of chemically modified
nucleotides.10,11
Several DNA binding ligands have also been studied for
the triple helix stabilization. Benzopyridoindoles and
benzopyridoquinoxalines were the first molecules
Hoechst 33258 has been found to destabilize the triple
helix containing the T.A.T triplets at least under the
conditions examined,18 but it stabilizes the triple helix
when conjugated with the TFO at the 50-end.24 Recently
reported DNG-Hoechst 33258 conjugate was synthe-
sized and used to stabilize the triple helix.25 These con-
jugates have been synthesized by phosphoramidite
Keywords: Triple helix; Heterobifunctional; Crosslinking reagent;
Maleimide conjugate; Induced CD signal; Minor groove binders.
*
Corresponding author. Tel.: +91 11 27666272; fax: +91 11
27666248; e-mail: vibhadelhi@hotmail.com
0968-0896/$ - see front matter ꢁ 2006 Elsevier Ltd. All rights reserved.
doi:10.1016/j.bmc.2006.05.034

A. K. Jain et al. / Bioorg. Med. Chem. 14 (2006) 6444–6452
6445
chemistry using ‘postsynthetic protocol.’26,27 Phospho-
ramidites are moisture sensitive and hence their prep-
aration requires extremely dry conditions. The
heterobifunctional crosslinking reagents serve as alter-
nate for phosphoramidite chemistry for conjugating
two molecules having different chemical groups. The
term heterobifunctional derives from the fact that
the linkers possess functional groups capable of react-
ing with two distinct functional groups, for example,
amines and thiols.28 The linkers serve two purposes,
first one is to covalently bind two distinct chemical
entities which otherwise would remain unreactive to
each other and the other one is to act as a physical
spacer which provides greater accessibility and/or
freedom to each of the linked molecules. Succinim-
idyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate
(SMCC) provides an easy method to conjugate two
molecules one having a primary amino group and
other having a free –SH group in a one-pot Michael
addition reaction. It has been widely used to prepare
ricin-monoclonal antibody,29 DNA–enzyme,30 pep-
tide–DNA,31 and peptide–PNA32 conjugates, but it
was not used to prepare DNA–small molecule conju-
gates yet.
In the current study, we have synthesized an analogue of
Hoechst 33258 which has bisubstitution on the terminal
phenyl ring and a free primary amino group at the side
chain and conjugated this bisbenzimidazole with the free
–SH group of a 14mer DNA sequence with the help of
SMCC using solution-phase chemistry in DMF–water
by a unique methodology. This conjugate would have
better cell membrane permeability than the naked
DNA owing to the observation that Hoechst dyes can
cross the cell membrane and nuclear membrane.33 These
types of conjugates can also be promising for developing
transcription factor inhibitor34 owing to simultaneous
major and minor groove binding.
2. Results and discussion
TFO binds sequence specifically in the major groove
of target dsDNA by forming Hoogsteen or reverse
O
BOC anhydride,
dioxane
HO
N
OC(CH3)3
O
HO
NH2
H
(1)
CHO
OCH3
O
(1)
OHC
N
OC(CH3)3
H
DEAD, PPh3,
DCM
OCH3
OH
(2)
(3)
4-Hydroxy-3-methoxy
benzaldehyde (vanillin)
NH2
NH
NH2
H3C
N
N
N
Na2S2O5,
ethanol, reflux
+
(4)
OCH3
O
OHC
O
N
OC(CH3)3
H
(3)
H
N
2N-HCl, reflux
NH
(10 min)
N
N
O
N
H
N
OC(CH3)3
(5)
N
H3C
OCH3
O
H
N
NH
N
N
O
N
NH2
N
H3C
(6)
OCH3
5-(4-Methylpiperazin-1-yl)-2-[2'-(4-{3-aminopropyloxy}- 3-methoxyphenyl)-5'-
benzimidazol]benzimidazole
Scheme 1.

6446
A. K. Jain et al. / Bioorg. Med. Chem. 14 (2006) 6444–6452
Hoogsteen hydrogen bonds and form a local triple helix.
Since the TFO occupies the major groove, the minor
groove remains largely unoccupied. DNA minor groove
binding ligand Hoechst 33258 has been tethered to the
50-end of TFO to enhance the triple helix stability by
simultaneous minor groove binding.24 Generally ‘post-
synthetic’ protocols have been used to prepare such con-
jugates.35,36 McLaughlin and coworkers attempted to
prepare a phosphoramidite of the hexaethyleneglycol
derivative of Hoechst 33258.36 They found that the
phosphoramidite could not be prepared under a variety
of conditions and reasoned that the benzimidazole rings
were participating in a competing nucleophilic reaction
with the phosphochloridite used to prepare the phos-
phoramidite. So they have used the ‘reverse coupling’
protocol to give the final conjugates in 50–75% yield in
two successive coupling reactions.37 BBZPNH2–malei-
mide–DNA conjugate prepared in our laboratory has
synthetic and biological advantages over oligonucleo-
tide-minor groove binding drug conjugates reported till
date. It is very well known that the phosphoramidite and
phosphochloridite reagents are highly moisture sensi-
tive. Hence this method has two major disadvantages,
first the tedious synthesis of phosphoramidite and sec-
ond the conjugation between DNA and small molecule.
The approach adopted by us is relatively much simpler.
BBZPNH2 having a primary amino group on the side
chain was reacted with SMCC to form amide bond from
succinimidyl side. This amide having the reactive malei-
mide group was then reacted with the DNA having free
Figure 1. ESMS of bisbenzimidazole–maleimide–DNA conjugate (B).
Figure 2. HPLC analysis of 14mer DNA sequence having free thiol group at the 50-end used to make the conjugate (A) and the BBZPNH2–
malemide–DNA conjugate (B).

A. K. Jain et al. / Bioorg. Med. Chem. 14 (2006) 6444–6452
6447
–SH group at the 50-end to give the title conjugate in a
single step.
O
O
N
O
N
DIEA in DMF, rt,
1.5 h shaking
O
2.1. Synthesis of 5-(4-methylpiperazin-1-yl)-2-[20-(4-{3-
aminopropyloxy}-3-methoxyphenyl)-50-benzimidazolyl]-
benzimidazole (6)
O
O
Succinimidyl-4-[N-maleimidimethyl]-
cyclohexane-1-carboxylate (7)
+
H
N
3-N-(tert-Butyloxycarbonyl)-propan-1-ol 1 was reacted
with vanillin 2 using Mitsunobu protocol38 to generate
the aldehyde which was then reacted with the 2-amino-
4-[50-(400-methylpiperazin-100-yl)benzimidazol-20-yl]aniline
(4),39 to give the bisbenzimidazole 5 in which the amino
group of the linker was protected with the tert-butyloxy-
carbonyl group which was removed by refluxing the
solution in 2 N HCl40 to yield 6 (Scheme 1).
NH
N
N
O
N
NH2
(6)
N
H3
C
OCH3
5'-HS-TTCTTCTTTTTTCT-3'
+ TEA in water, pH 8,
Overnight shaking
O
O
N
HN
2.2. Synthesis of bisbenzimidazole–maleimide–DNA
conjugate
O
H3CO
N
CH3
(8)
N
N
N
O
N
Compound 6 was reacted with SMCC, a heterobifunc-
tional crosslinking reagent. It reacts with the com-
pounds having free primary amino groups from the
succinimide side by forming the amide bond and its
maleimide moiety reacts with the free –SH group of
the thiol compounds.28 SMCC was reacted with 6 in
DMF/water solution to give the bisbenzimidazole–
maleimide conjugate 8. Its molecular weight was found
to be 730 by ESMS and it was reacted with free thiol
group of the 14mer DNA sequence to give the final con-
jugate 9. The 14mer DNA sequence having free thiol
group at the 50-end used to make this conjugate had
shown a retention time of 11.64 min (Fig. 2A), while
the final conjugate has a retention time of 25.02 min
(Fig. 2B) under the same HPLC conditions. The molec-
ular weight of the final conjugate was 5077.5 as con-
firmed by ESMS (Fig. 1, [M]8ꢀ peak) and the purity
was confirmed by HPLC analysis (Scheme 2).
HN
H
O
O
N
HN
5'-TTCTTCTTTTTTCT-3'
(CH2
)
6
O
S
H3CO
N
CH3
(9)
N
N
N
O
N
HN
H
Scheme 2.
pounds,43 hence this conjugate may serve as better ther-
apeutical agents.
2.3. Thermal melting studies of bisbenzimidazole–malei-
mide–DNA–(DNA)2 triple helix complex
The duplex used in the study contains the AT-rich
stretch at the target site. The triple helix formed between
nonconjugated 14mer TTCTTCTTTTTTCT and 26mer
DNA duplex has two transition temperatures, the Tm
value for triplex to duplex transition was 32 ꢀC and
for duplex to coil transition 53 ꢀC. There is an increase
in Tm values of both transitions for the triple helix
formed between bisbenzimidazole–maleimide–DNA
conjugate and duplex DNA. Triplex to duplex transition
was stabilized by 12 ꢀC and duplex to coil transition was
stabilized by 16 ꢀC (Fig. 3). From these results, it is clear
that conjugate is stabilizing the triple helix by simulta-
neous major and minor groove binding. The binding site
in the duplex near the tethering end has d(50-AAGAA-30)/
d(30-TTCTT-50) sequence in the 14 triplets long triple
helix region and it can be d(50-TTAAGAA-30)/d(30-
AATTCTT-50) if the base pairs outside the triplex re-
gion were also considered. The minor groove binding
bisbenzimidazole can bind with both of these sites and
the linker used in the present study is comparable with
the hexaethyleneglycol linker in length used in a previ-
ous study25 and it provides the sufficient flexibility to
the bisbenzimidazole moiety to bind with this sequence.
The bisbenzimidazole remains bound with the duplex
DNA after the opening of triple helix and increases
the melting temperature of duplex to coil transition.
The synthesis of this conjugate was done in aqueous
conditions at room temperature unlike the phospho-
ramidite chemistry. Conjugate 9 was obtained in 70%
yield, as analyzed by HPLC in single pot synthesis using
SMCC, unlike the 50–70% yield in two repetitive reac-
tions in the case of phosphoramidite method.37 This
conjugate may serve as a better antigene therapeutical
agent because of the following properties: It has a 21
atom long linker between bisbenzimidazole and DNA
sequence. In a triple helix the third strand would be
located in the major groove and the tethered bisbenzim-
idazole would go and bind in the minor groove.24 This
linker is long enough to satisfy the conditions. The thi-
oether linkage used in conjugation is thermally stable.41
This conjugate is supposed to have better cell membrane
permeability than the naked DNA since it contains
bisbenzimidazole moiety, which is known for their cell
membrane and nuclear membrane permeability,32,42
and the linker used in the synthesis contains a peptide
bond, maleimide moiety, and a thioether linkage to
enhance the cell permeability of the conjugate. The
bisbenzimidazole dye used in the conjugate has the
bisubstitution on the terminal phenyl ring. In our previ-
ous work we have shown that bisubstitution on phenyl
ring makes it less cytotoxic than the parent com-

6448
A. K. Jain et al. / Bioorg. Med. Chem. 14 (2006) 6444–6452
Figure 3. Absorbance versus temperature curves of triple helices with unconjugated (broken lines) and conjugated (solid lines) TFO (A) and their
first derivatives (B). The triplex concn was 1 lM and the buffer used was 20 mM sodium cacodylate having 100 mM NaCl, pH 5.2.
2.4. Reduced emission intensities with increasing
temperature
decrease at 70 ꢀC, that is, near the duplex to coil transi-
tion temperature clearly indicating bisbenzimidazole is
free. From 20 ꢀC to 70 ꢀC the kem value is 474 nm, but
after 70 ꢀC this value increases to 490 nm that is the
value for free ligand. This is a clear indication that the
bisbenzimidazole remains bound with the duplex DNA
up to 70 ꢀC.
The free ligand used in this study (BBZPNH2) has
k
ex = 350 nm and kem = 490 nm and DNA bound ligand
has fluorescent maxima at 355 nm and 474 nm, respec-
tively. The fluorescence emission of BBZPNH2–male-
mide–DNA conjugate enhanced many fold upon
binding to target dsDNA. On excitation at 355 nm the
triple helix made from BBZPNH2–maleimide–DNA
conjugate and dsDNA emits broad signal centered at
474 nm. To determine the fluorescence properties of
the triple helix with conjugated TFO, the triple helix
solution (100 nM) was excited at 355 nm and emission
spectra were taken at different temperatures (5 ꢀC incre-
ments). There is a progressive decline in the intensity of
fluorescence signal with increase in temperature
(Fig. 4A). There is only a marginal decrease in the fluo-
rescence intensity after 44 ꢀC, the temperature at which
triplex to duplex transition occurs, that is, BBZPNH2 re-
mains bound with DNA duplex after the unwinding of
the third strand from the major groove. There is a sharp
2.5. Induced ellipticity with increasing temperature
Both double and triple helical DNA does not have any
CD signal after 300 nm and being achiral molecule, bis-
benzimidazole dyes (e.g., Hoechst 33258) do not show
any CD signal. After binding with DNA, BBZPNH2
show, induced signal near 375 nm (for Hoechst 33258
it is near 356 nm).18 Ellipticity versus wavelength plot
of 5 lM solution of triple helix formed by bisbenzimi-
dazole–maleimide–DNA conjugate and 26 bp long
DNA duplex at the increment of 5 ꢀC clearly indicates
an induced CD signal up to 70 ꢀC (Fig.4B). There is a
large decrease in the intensity of the CD signal at
75 ꢀC, which clearly indicates that the bisbenzimidazole
Figure 4. Change in fluorescence emission intensity with temperature of a 100 nM solution of triple helix (formed from BBZPNH2–malemide–DNA
conjugate and 26mer dsDNA) (A) and Change in circular dichroism spectrum with temperature of a 3 lM solution of triple helix (B). The buffer used
was 20 mM sodium cacodylate having 100 mM NaCl, pH 5.2.

A. K. Jain et al. / Bioorg. Med. Chem. 14 (2006) 6444–6452
6449
phoramidite chemistry are no longer required in the
present approach as aqueous solutions were used in
the synthesis. This conjugate was hybridized successfully
with the 26 base pairs long target duplex. The 14mer
DNA sequence of the conjugate binds in the major
groove of dsDNA and the dye BBZPNH2 binds in
the AT rich minor groove of the target duplex. The
conjugation enhances the stability of BBZPNH2–malei-
mide–DNA conjugate–(DNA)2 triple helix through
simultaneous major and minor groove binding.
BBZPNH2 remains bound in the minor groove of
dsDNA even after the separation of 14mer TFO from
the major groove. The 26 atom long linker present
between DNA sequence and dye provides sufficient
flexibility to the dye to bind in the minor groove of
the target duplex. The conjugate has shown enhanced
cellular and nuclear membrane permeability due to the
bisbenzimidazole dye covalently linked to SMCC. Cellu-
lar uptake experiment with U87 cells suggests that
BBZPNH2–maleimide–DNA conjugate has comparable
cell permeability with Hoechst 33342, BBZPNH2, and
BBZPNH2–maleimide.
4. Experimental
4.1. Materials
Figure 5. EMSA of triple helix. Gel was run in 50 mM Tris–acetate
having 10 mM MgCl2, pH 5.2, using 10% polyacrylamide gel, at 10 ꢀC.
Lanes 1 and 6, 26mer single strand CGAGTTA AGAAGAAAAAAG-
ATTGAGC (oligo-3); lane 2, 26 bp long target duplex; d(CGAGTT
AAGAAGAAAAAAGATTGAGC); lanes 3 and 4, triple helix made
from non-conjugated TFO TTCTTCTTTTTTCT (oligo-2) and duplex
d(CGAGTTAAGAAGA AAAAA GAT T GAGC); lane 5, triple helix
made from conjugated TFO and duplex d(CGAGTTAAG
AAGAAAAAAGATTGAGC).
All solvents and reagents were obtained from Sigma–Al-
drich Chemical Company, USA, and were used without
further purification. TLCs were carried out on commer-
cially available TLC silica gel (Silica gel 60 F254) plates
purchased from E Merck, Germany, and compounds on
TLC were visualized using short-wavelength UV light.
Silica gel (70–220 mesh size, E Merck, Germany) was
used for flash column chromatography. The purity of
all organic compounds was confirmed by TLC, NMR,
IR, etc. IR were recorded on FTIR 8300 Shimadzu
Spectrophotometer. NMR spectra were recorded on
Bruker 300 MHz NMR Instrument. Melting points were
taken on a Buchi Melting point B540 apparatus. Ele-
mental analysis was done on GmbH VarioeEL elemen-
tal analyser. The FAB Mass spectra were recorded on
JEOL SX 102/DA-6000 Mass spectrometer using m-
nitrobenzyl alcohol (NBA) as a matrix. The MALDI
mass spectra were obtained with a MALDI Kratos Ana-
lytical Kompact SEQ IV, UK, mass spectrometer using
a-cyano-4-hydroxycinnamic acid as a matrix. ESMS
analysis was performed on a Hewlett-Packard 1100
MSD electrospray mass spectrometer. Samples for
ESMS were prepared in 50% acetonitrile/water having
1% triethylamine and sample concentrations were 20–
50 pM. Deionized and nuclease, free water was used to
prepare all the buffers. PAGE, purified oligonucleotides
and 14mer HPLC purified oligonucleotide sequence
having free thiol group at 50-end linker were purchased
from Microsynth, Switzerland. Succinimidyl-4-(N-male-
imidomethyl)cyclohexane-1-carboxylate (SMCC) was
purchased from Pierce. NAP-10 (Sephadex G-25 DNA
grade) columns were purchased from Amersham Biosci-
ences. HPLC grade acetonitrile and water were pur-
chased from J.T. Baker, and triethylammonium
acetate (TEAA) was purchased from Sigma–Aldrich
moiety remains bound in the minor groove of duplex
DNA even after third strand separates from the major
groove (Tm = 44 ꢀC).
2.6. Gel mobility shifts
The triple helix formed with conjugated TFO has retard-
ed mobility than that formed with the normal TFO
(Fig. 5). Both triplexes have C+GC triplets and the net
negative charge of the helices is reduced and both the
triplexes have shown the retarded mobility. The
BBZPNH2 moiety present in conjugated TFO becomes
protonated at pH 5.2, hence there is further reduction
in the negative charge of the triple helix formed with
conjugated TFO and hence triple helix has the lower
mobility than the second triple helix.
3. Conclusions
An analogue of Hoechst 33258 having bisubstitution on
the terminal phenyl ring (BBZPNH2) has been synthe-
sized and reacted successfully with the free thiol group
present at 50-end of synthetic 14mer DNA sequence with
the help of SMCC, a heterobifunctional crosslinking re-
agent. The synthesis of the conjugate is simple and
extremely anhydrous conditions required in the phos-

6450
A. K. Jain et al. / Bioorg. Med. Chem. 14 (2006) 6444–6452
Chemical Company, USA. Reverse-phase HPLC was
performed on a LC-8A Shimadzu instrument equipped
with a quaternary solvent delivery system and a diode
array detector. YMC-Pack ODS-AQ (250 · 4.6 mm)
Reverse-phase column was used. UV detector was set
at 260 nm for DNA, and 260 and 343 nm for
BBZPNH2–malemide–DNA conjugate. A gradient from
5% to 30% of eluent B (50 mM TEAA buffer, pH 7, con-
taining 50% acetonitrile) eluent A (50 mM TEAA buffer,
pH 7) over 30 min with a flow rate of 1.0 mL/min was
used. The extinction coefficients of DNA were deter-
mined according to the nearest neighbor method at
260 nm and for the conjugate the extinction coefficient
of the BBZPNH2 at 260 nm (16,000 U mMꢀ1) was add-
ed to the calculated value of DNA. However, the con-
centrations of conjugate solutions were determined
using the extinction coefficient (25,000 e345 U Mꢀ1) of
BBZPNH2.
and DNA triple helix), the complementary oligonucleo-
tide strands were annealed in sodium cacodylate buffer
(20 mM sodium cacodylate containing 100 mM NaCl,
pH 5.2), prior to use. Spectra were scanned from 200
to 450 nm at different temperatures with a scan speed
of 50 nm/min.
4.5. Electrophoretic mobility shift assay
Nondenaturing PAGE is used for the separation and
purification of double stranded DNA. Oligonucleotides
were 50-end labeled with [c-32P] ATP and T4 polynucle-
otide kinase (MBI Fermentas) using the standard proto-
col given by the supplier, purified by phenol–chloroform
extraction and ethanol precipitation, and then made free
from unincorporated [c-32P] ATP by Sephadex G-25
according to the manual instructions. The labeled oligo-
nucleotide was hybridized with equimolar amount of
complementary strand to make the duplex. Triplex for-
mation was initiated by adding 3 lL of 3· buffer
(135 nM Tris–acetate, pH 5.2, having 30 mM MgCl2),
1.2 equiv of conjugated or non-conjugated TFO, and
1 equivalent of labeled duplex to a final 10 lL reaction
volume. Solutions were heated to 75 ꢀC in a heating
block then cooled slowly to room temperature followed
by addition of 3 lL 50% glycerol solution containing or-
ange-G. The samples were directly loaded onto a 10%
native polyacrylamide gel prepared in buffer (50 mM
Tris–acetate, pH 5.2, and 10 mM MgCl2). Electrophore-
sis was performed at 8 V/cm for 10 h at 10 ꢀC in buffer
(50 mM Tris–acetate, pH 5.2 and 10 mM MgCl2). The
dried gels were exposed to Kodak film at ꢀ80 ꢀC and
then developed.
4.2. Thermal melting studies
All Tm experiments were carried out in 20 mM sodium
cacodylate buffer having 100 mM NaCl at pH 5.2 hav-
ing oligomer concentrations of 1 lM for each strand.
The oligonucleotide solutions were annealed by heating
to 75 ꢀC using a heating block and allowing to cool
slowly to reach room temperature before being stored
at 4 ꢀC. Absorbance (260 nm) versus temperature values
were obtained on a Cary Varian 400 spectrophotometer
equipped with a temperature programmable cell block
using 1 cm path length quartz cell. Data points between
15 and 85 ꢀC were taken for every 1 ꢀC, with a temper-
ature ramp of 0.25 ꢀC/min. Tm values were calculated by
first-derivative analysis and also by direct graphical
analysis of the absorbance versus temperature plot to
determine the midpoint of the transition. Both tech-
niques gave values that were within the experimental er-
ror (1 ꢀC) for the analysis. The concentration-dependent
Tm study was also carried out to rule out the possibility
of intramolecular duplex formation.
4.6. Synthesis of 3-N-(tert-butyloxycarbonyl)-propan-1-ol
(1)
Di-tert-butyl dicarbonate (4.36 g, 20 mmol) dissolved in
dioxane (30 mL) was added dropwise to a solution of 3-
amino propanol (1.5 g, 20 mmol) in dioxane (70 mL)
with stirring at room temperature. Reaction mixture
was stirred for about 10 h and then dioxane was re-
moved under reduced pressure. Residue was dissolved
in water and the product was extracted with ethyl ace-
tate. Organic phase was evaporated to give yellowish
oil. Yield: 90%. IR: 3336, 2977, 2936, 1690, 1525,
4.3. Fluorescence spectroscopy
Fluorescence spectra were obtained on a Horiba, Jovin
Yvon FloroMax-3 spectrometer equipped with a ther-
mal programmer. All measurements were performed
with the following parameters: slit width, Ex/
Em = 10 nm/10 nm; high sensitivity; high speed
(500 nm/s). The components of triple helix were an-
nealed in sodium cacodylate buffer (20 mM sodium cac-
odylate containing 100 mM NaCl, pH 5.2), prior to use,
and solutions were introduced into 2.5 mL quartz cell
thermally insulated with a water jacket. The concentra-
tion of solutions was 100 nM. The solutions were excited
at 355 nm, and emissions were monitored between 360
and 600 nm at different temperatures.
1455, 1367, 1171 cmꢀ1 1H NMR (CDCl3) d: 1.45,
.
(s, 9H), 1.8 (m, 2H), 2.9 (t, 2H), 3.5 (t, 3H).
4.7. Synthesis of 4-[3-N-(tert-butyloxycarbonyl)-propyl-
oxy]-5-methoxybenzaldehyde (3)
4-Hydroxy-3-methoxy benzaldehyde (1.21 g, 8 mmol)
and alcohol (X) (1.272 g, 8 mmol) were taken in a
three-necked RB flask in DCM (40 mL). Triphenyl-
phosphine (3.4 g, 13.1 mmol) and diethylazodicarboxy-
late (DEAD) (2.3 g, 13.1 mmol) were added to it.
Reaction mixture was stirred under nitrogen at 0 ꢀC
for 30 min and then overnight at room temperature.
Reaction mixture was then concentrated to get an oily
residue. This oil was added to 50% ethyl acetate–petro-
leum ether to get solid oxytriphenylphosphine, which
was filtered out. Filtrate was concentrated and chro-
4.4. Circular dichroism spectroscopy
CD spectroscopy experiments were done on a Jasco-800
CD spectropolarimeter equipped with a temperature
programmable cell block in a 2 mm path length quartz
cell. To make different DNA structures (WC duplex

A. K. Jain et al. / Bioorg. Med. Chem. 14 (2006) 6444–6452
6451
matographed on silica gel using benzene–ethyl acetate
(10–12%) as eluent. Product was obtained as white
crystalline solid. Yield: 60%; mp: 66–70 ꢀC. IR: 3368,
dry diethyl ether (about 10 mL) was added to the reac-
tion solution to precipitate the BBZPNH2–maleimide
conjugate. This precipitate was washed five times with
cold diethyl ether containing 10% N-methyl morpho-
line (NMP) to remove excess SMCC and dried under
N2. The product was characterized by ESMS in posi-
tive ion mode m/z found 731.23 (M+1), calculated:
730. 1H NMR (DMSO-d6) d ppm: 1.42 (t, 4H,
J = 4.8 Hz), 1.77 (t, 4H, J = 5.0 Hz), 1.80 (m, 2H),
2.10 (t, 1H, J = 2.5 Hz), 2.33 (s, 3H), 2.4 (d, 1H,
J = 5.0 Hz), 3.5 (t, 4H, J = 4.8 Hz), 3.98 (t, 2H,
J = 5.0 Hz), 4.04 (s, 3H), 6.77 (d, 1H, J = 9.0 Hz), 7.0
(m, 2H), 7.13 (d, 2H, J = 9.0 Hz), 7.64 (d, 1H,
J = 9.0 Hz), 7.81 (d, 1H, J = 9.0 Hz), 8.03 (m, 1H),
8.17 (d, 2H, J = 9.0 Hz), 8.3 (s, 1H), 13.0 (br s, 2H);
13C NMR (70 MHz, DMSO-d6) d ppm: 31.1, 25.0,
25.8, 32.8, 40.9, 42.7, 45.0, 59.7, 100.0, 113.8, 115.7,
116.0, 120.0, 116.3, 121.4, 127.5, 129.1, 137.0, 139.0,
141.6, 144.6, 148.3; 165.0, 179.0.
2980, 2937, 1683.5, 1593.6, 1526 cmꢀ1
.
1H NMR
(300 MHz, CDCl3) d ppm: 1.46 (s, 9 H), 2.04 (m,
2H), 3.94 (s, 3H), 4.18 (d, 2H), 6.94 (d, 1H), 7.5 (d,
1H), 9.85 (s, 1H); m/z (FAB mass) found 310 (M+1),
calculated 309.
4.8. Synthesis of 5-(4-methylpiperazin-1-yl)-2-[20-(4-{3-
aminopropyloxy}-3-methoxyphenyl)-50-benzimidazolyl]-
benzimidazole (6)
Water (around 1 mL) and Na2S2O5 (141 mg) were add-
ed to a solution of 2-amino-4-[50-(400-methylpiperazin-
100-yl)benzimidazol-20-yl]aniline (4) and aldehyde (3)
(455 mg, 1.5 mmol) in ethanol (100 mL) and reaction
mixture was refluxed for 7 h, cooled, and filtered
through Celite. Filtrate was concentrated and purified
on silica column using methanol–ethyl acetate as eluent
to give 5. Mp: 265–270 ꢀC; Yield: 60%. IR: 3401, 2922,
4.10. Synthesis of BBZPNH2–maleimide–DNA conjugate
(9)
1683, 1635, 1497, 1446, 1371, 1281, 1131, 819 cmꢀ1
.
1H NMR (300 MHz, DMSO-d6)d ppm: 1.45 (s, 9H),
2.05 (m, 2H), 2.33 (s, 3H), 3.5 (t, 4H, J = 4.8 Hz), 3.98
(s, 3H), 4.12 (d, 2H, J = 7 Hz), 6.77 (d, 1H,
J = 9.0 Hz), 7.13 (d, 2H, J = 9.0 Hz), 7.64 (d, 1H,
J = 9.0 Hz), 7.81 (d, 1H, J = 9.0 Hz), 8.03 (m, 1H),
8.17 (d, 2H, J = 9.0 Hz), 8.3 (s, 1H), 13.0 (br s, 2H);
13C NMR (70 MHz, DMSO-d6) d ppm: 28.7, 32.0,
40.9, 42.7, 59.7, 70.8, 100.0, 113.8, 115.7, 116.0, 120.0,
116.3, 121.4, 127.5, 129.1, 139.0, 141.6, 144.6, 148.3,
158.0; m/z (FAB mass) found 612 (M+1), calculated
611. Anal. Calcd for C34H41N7O4: C, 66.78; H, 6.71;
N, 16.04. Found: C, 66.75; H, 6.70; N, 16.06. Com-
pound 5 (350 mg) was dissolved in 2 N HCl (80 ml)
and refluxed for 10 min, cooled and evaporated under
reduced pressure, and then purified on silica gel column
to give 6. Yield: 67%; mp: 280 ꢀC; IR: 3401, 2922, 1635,
Bisbenzimidazole–maleimide conjugate was dissolved
in 200 lL DMF and a solution of 14mer oligonucleo-
tide in water having free 50-SH group (500 lL of
100 lM solution, freshly made from lyophilized oligo-
nucleotides, total 50 nmol) was added to this solution.
The pH of reaction mixture was adjusted at 7.8 by
adding triethylamine and left for overnight shaking.
The reaction mixture was then loaded on a Sephadex
G-25 column pre-equilibrated with water and the re-
quired bisbenzimidazole–maleimide–DNA conjugate
free from unincorporated bisbenzimidazole–SMCC
was eluted under gravity. The product was lyophilized
and made up to 100 lL by water and purified by re-
verse phase HPLC. The product peak was collected
and quantitated by absorbance at 345 nm (A345) and
lyophilized (35 nmol, 70% isolated yield). The purity
of the product was confirmed by reinjecting an analyt-
ical amount of the conjugate on a reverse phase HPLC
column.
1497, 1446, 1371, 1281, 1131, 819 cmꢀ1 1H NMR
;
(DMSO-d6) d 1.90 (m, 2H), 2.33 (s, 3H), 3.5 (t, 4H),
3.98 (t, 2H), 4.04 (s, 3H), 6.77 (d, 1H, J = 9.0 Hz),
7.13 (d, 2H, J = 9.0 Hz), 7.64 (d, 1H, J = 9.0 Hz), 7.81
(d, 1H, J = 9.0 Hz), 8.03 (m, 1H), 8.17 (d, 2H,
J = 9.0 Hz), 8.3 (s, 1H), 13.0 (br s, 2H); 13C NMR
(70 MHz, DMSO-d6) d ppm: 34.8, 40.9, 42.7, 59.7,
100.0, 113.8, 115.7, 116.0, 120.0, 116.3, 121.4, 127.5,
129.1, 139.0, 141.6, 144.6, 148.3; m/z (FAB mass) found
512 (M+1), calculated 511. Anal. Calcd for
C29H33N7O2: C, 68.10; H, 6.46; N, 19.18. Found: C,
68.15; H, 6.42; N, 19.15.
Analytical reverse phase HPLC tR, 25.02 min (for 14mer
oligonucleotide having 50-free thiol tR, 11.64 min); m/z
(negative mode ESMS) mass found 5077.45, calculated
5077.5.
Acknowledgment
4.9. Introduction of maleimide moiety at the free NH2
group of BBZPNH2
A.K.J. is thankful to Council for Scientific and Industri-
al Research (CSIR), New Delhi, for financial support as
SRF.
A solution of bisbenzimidazole 5-(4-methylpiperazin-
1-yl)-2-[20-(4-{3-aminopropyloxy}-3-methoxyphenyl)-
50-benzimidazolyl] benzimidazole in DMF (60 lL of
10 mM solution, 60 nmol) was taken in the reaction
tube and volume was increased to 200 lL by DMF.
Now SMCC (3 lmol, dissolved in 20 lL DMF) was
added to this solution followed by addition of DIEA
(20 lL). The reaction solution was left at room temper-
ature for half an hour with gentle shaking. Now cold
Supplementary data
UV spectra, mass spectra of H-SMCC Conjugate, and
cellular uptake by U87 cells of the conjugate are given
in supporting information. Supplementary data associ-
ated with this article can be found, in the online version,
at doi:10.1016/j.bmc.2006.05.034.

6452
A. K. Jain et al. / Bioorg. Med. Chem. 14 (2006) 6444–6452
21. Tung, C. H.; Breslauer, K. J.; Stein, S. Nucleic Acids Res.
1993, 21, 5489.
References and notes
22. Szewcyk, J. W.; Baird, E. E.; Dervan, P. B. J. Am. Chem.
Soc. 1996, 118, 6778.
23. Gryaznov, S. M.; Lloyd, D. H. Nucleic Acids Res. 1993,
21, 5909.
1. Giovannongeli, C.; Perrouault, L.; Escude, C.; Thoung,
N.; Helene, C. Biochemistry 1996, 35, 10539.
2. Broitman, S.; Amosova, O.; Dolinnaya, N. G.; Fresco, J.
R. J. Biol. Chem. 1999, 274, 21763.
24. Robles, J.; McLaughlin, L. W. C. J. Am. Chem. Soc. 1997,
119, 6014.
3. Wang, G.; Levy, D. D.; Seidman, M. M.; Glazer, P. M.
Mol. Cell. Biol. 1995, 15, 1759.
25. Reddy, P. M.; Bruice, T. C. J. Am. Chem. Soc. 2004, 126,
3736.
4. Murry, J. A. H.; Crockett, N.. In Antisense RNA and
DNA; Murry, J. A. H., Ed.; John Wiley & Sons: New
York, 1992; Vol. II, pp 1–48.
5. Le Doan, T.; Perrouault, L.; Praueth, D.; Habhoub, N.;
Decout, J. L.; Thoung, N. T.; Lhomme, J.; Helene, C.
Nucleic Acids Res. 1987, 15, 7749.
26. Coiuzza, A. J. Tetrahedron Lett. 1989, 30, 6287.
27. Asselin, U.; Bonfils, E.; Kenfurst, R.; Chassignd, M.; Roij,
V.; Thung, N. T. Tetrahedron 1992, 48, 1233.
28. Brinkley, M. Bioconjugate Chem. 1992, 3, 2.
29. Youle, R. J.; Neville, D. M. Proc. Natl. Acad. Sci. U.S.A.
1980, 77, 5483.
6. Pilch, D. S.; Levenson, C.; Shafer, R. H. Biochemistry
1991, 30, 6081.
30. Ghosh, S. S.; Kao, P. N.; McCue, A. W.; Chappelle, H. L.
Bioconjugate Chem. 1990, 1, 71.
7. Svinarchuk, F.; Paoletti, J.; Malvy, C. J. Biol. Chem. 1995,
270, 14068.
31. Harrison, J. G.; Balasubramanian, S. Nucleic Acids Res.
1998, 26, 3136.
8. Singleton, S. F.; Dervan, P. B. Biochemistry 1993, 32,
13171.
32. Koppelhus, U.; Awasthi, S. K.; Zacher, V.; Holst, H. V.;
Ebbesen, P.; Nielsen, P. E. Antisense Nucleic Acid Drug
Dev. 2002, 12, 51.
33. Arndt-Jovin, D. J.; Jovin, T. M. Cytometry 1990, 11, 80.
34. Arya, D. P.; Willis, B. J. Am. Chem. Soc. 2003, 125, 12398.
35. Connolly, B. A.; Ridev, P. Nucleic Acids Res. 1985, 13,
4485.
36. Connolly, B. A. Nucleic Acids Res. 1987, 15, 3131.
37. Rajur, B. S.; Robles, J.; Wiederholt, K.; Kuimelis, R. G.;
McLaughlin, L. W. J. Org. Chem. 1997, 62, 523.
38. Staz, A. L.; Bruice, T. C. Bioorg. Med. Chem. 2000, 8,
1871.
9. Mallkov, V. A.; Voloshin, O. N.; Sayfer, V. N. Nucleic
Acids Res. 1993, 21, 585.
10. Uhlman, E.; Peyman, A. Chem. Rev. 1990, 90, 543.
11. Kurreck, J. Eur. J. Biochem. 2003, 270, 1628.
12. Mergny, J. L.; Duval-Velentin, G.; Nguyen, C. H.;
Perrouault, L.; Faucon, B.; Rougee, M.; Moutenay-
Garesteier, T. M.; Bisagaui, E.; Helene, C. Science 1992,
256, 1681.
13. Lee, J. S.; Latimer, L. J.; Hampel, K. J. Biochemistry 1993,
32, 5591.
14. Pilch, S. D.; Breslauer, K. J. Proc. Natl. Acad. Sci. U.S.A.
1994, 91, 9332.
39. Kelly, D. P.; Bateman, S. A.; Martin, R. F.; Reum, M. E.;
Rose, M.; Whittaker, A. R. D. Aust. J. Chem. 1994, 47,
247.
40. Behreus, C.; Harrit, N.; Nielsen, P. E. Bioconjugate Chem.
2001, 12, 1021.
41. Chrisey, U. A.; Lee, G. U.; Ferral, G. U. Nucleic Acids
Res. 1996, 24, 3031.
42. Lee, B. R.; Hasemm, D. B.; Reynolds, C. D. Cytometry
1989, 10, 256.
15. Pilch, D. S.; Kirolos, M. A.; Breslauer, K. J. Biochemistry
1995, 34, 16107.
16. Fortisch, I.; Birch-Hirschfeld, E.; Schutz, H.; Zinner, C.
J. Biomol. Struct. Dyn. 1996, 14, 317.
17. Durand, M.; Thoung, N. T.; Maurizot, J. C. J. Biol.
Chem. 1992, 267, 24394.
18. Durand, M.; Thoung, N. T.; Maurizot, J. C. Biochimie
1994, 76, 181.
19. Silver, G. C.; Sun, J. S.; Nauyae, C. H.; Boutorine, A. S.;
Helene, C. J. Am. Chem. Soc. 1997, 119, 263.
20. Stonehouse, T. J.; Fox, K. R. Biochim. Biophys. Acta
1994, 1218, 322.
43. Tawar, U.; Jain, A. K.; Dwarkanath, B. S.; Chandra, R.;
Singh, Y.; Chaudhary, N. K.; Tandon, V. J. Med. Chem.
2003, 46, 3785.