Aldose-6-phosphate reductase from apple leaves: Importance of the quaternary structure for enzyme activity

Article abstract of DOI:10.1016/j.biochi.2009.09.013

Aldose-6-phosphate reductase (A6PRase) is a key enzyme for glucitol biosynthesis in plants from the Rosaceae family. To gain on molecular tools for enzymological studies, we developed an accurate system for the heterologous expression of A6PRase from apple leaves. The recombinant enzyme was expressed with a His-tag alternatively placed in the N- or C-terminus, thus allowing the one-step protein purification by immobilized metal affinity chromatography. Both, the N- and the C-term tagged enzymes exhibited similar affinity toward substrates, although the k_cat of the latter enzyme was 80-fold lower than that having the His-tag in the N-term. Gel filtration chromatography showed different oligomeric structures arranged by the N- (dimer) and the C-term (monomer) tagged enzymes. These results, reinforced by homology modeling studies, point out the relevance of the C-term domain in the structure of A6PRase to conform an enzyme having optimal specific activity and the proper quaternary structure.

Full text of DOI:10.1016/j.biochi.2009.09.013

Biochimie 92 (2010) 81–88
Contents lists available at ScienceDirect
Biochimie
journal homepage: www.elsevier.com/locate/biochi
Research paper
Aldose-6-phosphate reductase from apple leaves: Importance
of the quaternary structure for enzyme activity
*
Carlos M. Figueroa, Alberto A. Iglesias
´
´
´
´
Laboratorio de Enzimologıa Molecular, Instituto de Agrobiotecnologıa del Litoral (UNL–CONICET), Facultad de Bioquımica y Ciencias Biologicas,
Paraje ‘‘El Pozo’’ CC 242, S3000ZAA Santa Fe, Argentina
a r t i c l e i n f o
a b s t r a c t
Article history:
Received 1 June 2009
Accepted 24 September 2009
Available online 30 September 2009
Aldose-6-phosphate reductase (A6PRase) is a key enzyme for glucitol biosynthesis in plants from the
Rosaceae family. To gain on molecular tools for enzymological studies, we developed an accurate system
for the heterologous expression of A6PRase from apple leaves. The recombinant enzyme was expressed
with a His-tag alternatively placed in the N- or C-terminus, thus allowing the one-step protein purifi-
cation by immobilized metal affinity chromatography. Both, the N- and the C-term tagged enzymes
exhibited similar affinity toward substrates, although the kcat of the latter enzyme was 80-fold lower than
that having the His-tag in the N-term. Gel filtration chromatography showed different oligomeric
structures arranged by the N- (dimer) and the C-term (monomer) tagged enzymes. These results,
reinforced by homology modeling studies, point out the relevance of the C-term domain in the structure
of A6PRase to conform an enzyme having optimal specific activity and the proper quaternary structure.
Ó 2009 Elsevier Masson SAS. All rights reserved.
Keywords:
Aldose-6-phosphate reductase
Apple
Carbohydrate metabolism
Glucitol
Sugar-alcohol
1. Introduction
(EC 3.1.3.50) [12]. Afterward, the sugar-alcohol is translocated to
sink tissues, such as fruits, where it can be metabolized into fruc-
Certain plants accumulate water-soluble compounds of low
molecular weight such as sugar-alcohols, quaternary amines and
amino acids [1–3]. These molecules, broadly named compatible
solutes, might allow organisms tolerate certain stress conditions by
maintaining osmotic balance with the surrounding environment.
Particularly, sugar-alcohols are molecules that increase tolerance to
oxidative stress [4] and micronutrient deficiency [5]. Glucitol, also
called sorbitol, is a sugar-alcohol representing a major photosyn-
thetic end-product in many economically important fruit-bearing
tree species from the Rosaceae family, including apple and peach
[6,7]. This polyol is the main carbohydrate present in peach leaves
[8] and it might serve as anosmoprotectant, as attributed to
mannitol in celery [9]. In cells of mature leaves, glucitol is synthe-
sized in the cytosol via reduction of glucose-6-phosphate (Glc6P) to
tose by a NAD-dependent glucitol dehydrogenase (EC 1.1.1.14) [13].
In plants accumulating sugar-alcohols, photoassimilates parti-
tioning is more complex than in those where sucrose and starch are
the two major photosynthetic products. In fact, in the former plants
a third compound (a sugar-alcohol) is mainly photosynthesized and
accumulated, also representing a major metabolite partitioned
within leaf cells as well as between the different non-photosyn-
thetic tissues. Relatively abundant literature is available concerning
sucrose and starch metabolism [14–16]; but the regulation of glu-
citol (and other sugar-alcohols) synthesis and partitioning has been
scarcely studied. However, it has been established that in apple leaf
discs the expression of the A6PRase gene is enhanced by abscisic
acid, low temperature and high salinity [17]. On the other hand,
transgenic apple plants with diminished expression of the A6PRase
gene showed a switch in leaf carbohydrate content, including
reduction of glucitol associated with up-regulation of sucrose
[18,19] and starch [19,20] synthesis. Also, tobacco [5] and
persimmon [21] plants (which normally do not synthesize polyols)
were engineered to produce glucitol by the introduction of the gene
coding for apple leaf A6PRase, thus confirming the key role of the
enzyme to produce glucitol in vivo.
glucitol-6-phosphate (Gol6P) by
a NADPH-dependent Glc6P
reductase (A6PRase, EC 1.1.1.200) [10,11], followed by hydrolysis
of the phosphate group catalyzed by a specific phosphatase
Abbreviations: A6PRase, aldose-6-phosphate reductase; CtXRase, Candida tenuis
xylose reductase; Glc6P, glucose-6-phosphate; Gol6P, glucitol-6-phosphate; HsAR-
ase, Homo sapiens aldose reductase; IMAC, immobilized metal affinity chromatog-
The regulation of glucitol synthesis and degradation is far from
being understood, as the enzymes involved in its metabolism have
been poorly characterized. Although A6PRases from apple and
loquat were purified and their kinetic parameters determined
raphy; IPTG, isopropyl
A6PRase.
b-D-1-thiogalactopyranoside; MdA6PRase, Malus domestica
* Corresponding author. Tel./fax: þ54 342 4575206x217.
E-mail address: iglesias@fbcb.unl.edu.ar (A.A. Iglesias).
0300-9084/$ – see front matter Ó 2009 Elsevier Masson SAS. All rights reserved.
doi:10.1016/j.biochi.2009.09.013

82
C.M. Figueroa, A.A. Iglesias / Biochimie 92 (2010) 81–88
[10,11,22,23], reports about their regulation and structural proper-
ties are limited. The absence of convenient systems/protocols
for the production of pure protein is a main barrier to advance in
the characterization of this plant enzyme. Herein, we report the
molecular cloning of the gene that encodes for MdA6PRase, its
heterologous expression in Escherichia coli cells and the simple
one-step purification of the recombinant enzyme. To the best of
our knowledge, this is the first time that an active A6PRase is
successfully expressed in a prokaryotic system.
sonication. The resultant suspension was centrifuged 15 min at
10 000 ꢂ g and the supernatant was loaded in a 5 ml Sepharose-
IDA-Ni2þ column previously equilibrated with Buffer A. The column
was washed with 10 bed volumes of Buffer A and then with
increasing concentrations of imidazole (20, 50, 100 and 250 mM) in
Buffer A (5 bed volumes each). The recombinant proteins were
usually recovered in the fraction containing 250 mM imidazole. The
samples were conveniently fractioned and stored at ꢀ80 ꢁC in
Buffer A supplemented with 1 mM EDTA and 0.5 mM DTT. Under
these conditions, the recombinant A6PRases were stable for, at
least, 6 months.
2. Materials and methods
2.1. Plant material, bacterial strains and media
2.4. Protein determination and SDS-PAGE
Fully developed leaves from apple (Malus domestica) were
obtained from a local farm. Freshly collected leaves were frozen in
liquid nitrogen and stored at ꢀ80 ꢁC until use. E. coli TOP10 (Invi-
trogen, Carlsbad, CA, USA) cells were used for cloning procedures
and plasmid maintenance. Protein expression was carried out with
E. coli BL21 Star (DE3) (Invitrogen). Cells were grown in LB medium
Protein concentration was determined after Bradford [27], with
BSA utilized as a standard.
Protein electrophoresis under denatured conditions was carried
out on discontinuous 12% polyacrylamide gels as described previ-
ously [28]. The purity of the enzymes was estimated by densitom-
etry of the stained gels using the program LabImage 2.7 (Kapelan).
supplemented with ampicillin (100
when necessary.
mg/ml) or kanamycin (50 mg/ml)
2.5. Native molecular mass determination
2.2. RNA extraction, RT-PCR and cloning
To determine the molecular mass of the native recombinant
proteins, the purified enzymes were subjected to gel filtration
chromatography. Samples were loaded in a Superdex 200 HR 10/30
column (Amersham Pharmacia Biotech, Uppsala, Sweden) previ-
ously equilibrated with Buffer B [25 mM Tris–HCl pH 8.0, 100 mM
NaCl and 0.1 mM DTT]. The molecular mass was calculated using
the calibration graphic constructed with protein standards.
Total RNA from apple leaves was isolated as described by Hall
et al. [24], and mRNA was purified with the PolyATtract mRNA
Isolation System IV (Promega, Madison, WI, USA). cDNA was
synthesized at 42 ꢁC for 1 h in a 25
0.25
m
l reaction mixture containing
m
g mRNA, 200 pmol oligo(dT) primer and 200 U of M-MLV
reverse transcriptase (USB, Cleveland, OH, USA). To amplify the
gene encoding for A6PRase from apple leaves, we used the specific
primers MdA6PRase_fw (CATATGTCCACCGTCACCCTGAGCAGTGGC,
NdeI restriction site is underlined) and MdA6PRase_rv (GTCGAC
TTATGCATACACGTCTAAGCC, SalI restriction site is underlined)
based in the sequence described by Kanayama et al. [25] (GenBank
2.6. Activity assay
Enzyme activity was assayed as described elsewhere [22] with
minor modifications. In the direction of Glc6P reduction the stan-
dard assay mixture contained 100 mM Tris–HCl pH 8.0, 0.2 mM
NADPH and 50 mM Glc6P. In the direction of Gol6P oxidation the
standard medium composition was 100 mM Tris–HCl pH 8.0, 1 mM
NADPþ and 20 mM Gol6P. Both assays were carried out in a final
accession no. D11080). The PCR reaction was performed in a 50
ml
reaction mixture containing 2 l cDNA solution, 100 pmol of each
m
primer and 2.5 U Taq DNA polymerase (Fermentas, Glen Burnie,
MD, USA). PCR conditions were one cycle of 5 min at 95 ꢁC, 30
cycles of 1 min at 95 ꢁC, 30 s at 50 ꢁC and 1 min at 72 ꢁC, followed by
a final cycle of 10 min at 72 ꢁC. The amplified gene was cloned into
the pGEM-T Easy vector (Promega) and its identity was confirmed
by automated sequencing (Macrogen, Seoul, Korea). Sequences
were analyzed using the BioEdit Sequence Alignment Editor
program [26].
volume of 50 m
l at 25 ꢁC and the oxidation/reduction of NADPH/
NADPþ followed using a Multiskan Ascent 384-microplate reader
(Thermo Electron Corporation, Waltham, MA, USA). One unit of
enzyme activity (U) is defined as the amount of enzyme catalyzing
the formation of 1 m
mol product (NADPþ or NADPH) in 1 min under
the specified assay conditions.
2.7. Kinetic studies
2.3. Protein expression and purification
Experimental data of enzyme activity were plotted against
variable substrate concentrations and fitted to Hill equation using
the program Origin 7.0 (OriginLab Corporation). S0.5 is the
concentration of substrate giving 50% of the maximal activity
(Vmax). Values of kcat were calculated using Vmax expressed in U/mg
and considering the molecular mass of the enzyme monomer
(35 kDa). In inhibition studies, the data were adjusted to a modified
Hill equation to obtain the inhibitor concentration which produces
50% of enzyme inhibition (I0.5). Kinetic constants (S0.5 and kcat) are
means of at least two independent sets of data, which were
reproducible within ꢃ10%.
The gene coding for MdA6PRase was subcloned in the expres-
sion vectors pET19b and pET24b (Novagen, Madison, WI, USA) to
respectively obtain recombinant proteins fused to a His-tag in the
N- or C-term. Removal of the stop codon from the gene was
necessary prior to subcloning into pET24b to obtain the protein
tagged at the C-term. For large scale production of the recombinant
enzymes, 1 l of LB medium supplemented with the appropriate
antibiotic was inoculated with a 1/100 dilution of an overnight
culture of transformed E. coli BL21 Star (DE3) cells. The cells were
grown at 37 ꢁC in an orbital shaker until OD w0.6 was reached and
then induced overnight with 0.2 mM IPTG at 25 ꢁC. The cells were
harvested by centrifugation 15 min at 5000 ꢂ g and the pellet was
frozen at ꢀ20 ꢁC until use.
2.8. Protein stability and activity with pH and temperature
To purify the recombinant proteins, the cells were resuspended
in Buffer A [25 mM Tris–HCl pH 8.0, 300 mM NaCl, 0.1 mM EDTA,
To evaluate protein stability, the recombinant enzymes were
incubated at 25 ꢁC for 10 min at pH values ranging from 6.0 to 10.0.
In addition, both enzymes were incubated at pH 8.0 for 10 min at
1 mMb-mercaptoethanol and 10% (v/v) glycerol] and disrupted by

C.M. Figueroa, A.A. Iglesias / Biochimie 92 (2010) 81–88
83
[32,33]. Figures were prepared with the Visual Molecular Dynamics
(VMD) software (http://www.ks.uiuc.edu/Research/vmd/).
3. Results
3.1. Expression and purification
The gene encoding for A6PRase from apple leaves was
successfully amplified and cloned, and the recombinant enzyme
was expressed with a His-tag at the N- or C-term using the
commercial vectors described under Materials and Methods.
SDS-PAGE analysis of crude extracts from the transformed E. coli
cells showed over-expression of proteins of w35 kDa (Fig. 1). The
A6PRase gene from apple leaves encodes for a putative protein of
310 amino acids (GenBank accession no. BAA01853) with a calcu-
lated molecular mass of 34.9 kDa, which is in good agreement with
the results showed in Fig. 1. Interestingly, the level of soluble
recombinant enzyme was much higher in the N-term tagged
protein (His-MdA6PRase) than in the C-term tagged one (MdA6P-
Rase-His); as in the latter the majority of the protein was found as
the insoluble form (Fig. 1). As shown in Fig. 1, the one-step purifi-
cation protocol allowed us to obtain His-MdA6PRase and MdA6P-
Rase-His with a level of purity greater than 95% and 75%,
respectively. Table 1 shows the results obtained during the purifi-
cation procedure of both recombinant enzymes. Due to its low
soluble expression, the activity of the C-term tagged enzyme was
undetectable in crude extracts and a 10-fold concentration was
necessary to measure the activity of the purified sample. Table 1
also reports that the amount (both, in terms of protein and activity)
of MdA6PRase-His obtained after the purification was significantly
lower than that of His-MdA6Prase. The latter agrees with the low
expression of soluble C-term tagged enzyme observed in Fig. 1; but
also is a consequence of the almost two order of magnitude
difference in specific activity exhibited by the purified recombinant
enzymes (see Table 1).
Fig. 1. Analysis of the recombinant proteins by SDS-PAGE. Insoluble and soluble
fractions of recombinant cells expressing His-MdA6PRase (lanes 1 and 2, respectively)
and MdA6PRase-His (lanes 4 and 5, respectively). His-MdA6PRase and MdA6PRase-His
purified by IMAC (lanes 3 and 6, respectively). Molecular mass markers (lane 7):
94.0 kDa: phosphorylase
carbonic anhydrase; 20.1 kDa: trypsin inhibitor; 14.4 kDa:
b
;
67.0 kDa: albumin; 43.0 kDa: ovalbumin; 30.0 kDa:
-lactalbumin.
a
temperatures ranging from 0 to 60 ꢁC. In both assays, an aliquot of
the mixture was taken after the treatment to assay enzyme activity
in the direction of Glc6P reduction under the standard conditions
described above.
The effect of pH and temperature was further evaluated by
measuring activity at different values of each of the variables. Thus,
the activity of both recombinant proteins was measured in the
directions of Glc6P reduction and Gol6P oxidation at pH values
ranging from 5.0 to 11.0 and 6.5 to 11.0, respectively. The buffers
used were: MES–NaOH (from 5.0 to 6.5), MOPS–NaOH (from 6.5 to
8.0), Tris–HCl (from 8.0 to 9.5) and CAPS–NaOH (from 9.5 to 11.0).
Also, activity of Glc6P reduction was measured at pH 8.0 at different
temperatures, as specified below.
2.9. Homology modeling
3.2. Structural and kinetic characterization
We built a 3D model for A6PRase from apple leaves with the
program Modeller 9v2 [29] using the known coordinates of Candida
tenuis xylose reductase (CtXRase) complexed with NADPH (1K8C)
and the crystal structure of Homo sapiens aldose reductase (HsAR-
ase) complexed with Glc6P and NADPþ (2ACQ), both available at
the Protein Data Bank server (http://www.rcsb.org/pdb/home/
home.do). CtXRase (AKR2B5) is a class 2 member of the aldo-keto
reductase (AKRase) superfamily [30,31] and its native conformation
is a dimer, while HsARase (AKR1B1) is a class 1 member of the
AKRase superfamily [30,31] and its native conformation is
a monomer. It has been reported that A6PRases purified from apple
seedlings and loquat leaves [10,22] are dimeric and the enzyme
from apple leaves has been classified as a class 2 member of the
AKRase superfamily (AKR2A1) [30,31]. Therefore, the protein was
modeled as a dimer. The accuracy of the model was checked using
the Verify3D server (http://nihserver.mbi.ucla.edu/Verify_3D/)
Seeking to characterize the MdA6PRase enzymes His-tagged at
the N- or C-term, we determined the kinetic parameters for
substrates (data shown in Table 2). The results obtained for His-
MdA6PRase are very similar to those previously reported for the
enzyme purified from apple leaves [11,23] and seedlings [22]. As
shown in Table 2, both forms of the recombinant apple enzyme
exhibited similar kinetic parameters in terms of S0.5 and nH values
for the substrates. However, the MdA6PRase-His enzyme showed
a remarkable low kcat (and consequently low kcat/S0.5 ratios) in both
directions of the reaction (Table 2). To find out about possible
causes for this unique kinetic difference between the recombinant
proteins, their respective quaternary structures were analyzed by
gel filtration chromatography. Fig. 2 illustrates that the His-
MdA6PRase eluted from the Superdex column as a 68 kDa protein,
while the MdA6PRase-His behaved as a protein of 39 kDa.
Considering the theoretical molecular mass of the apple enzyme
Table 1
Purification profiles of the recombinant enzymes.
Enzyme
Step
Volume (ml)
Protein (mg/ml)
Activity (U/ml)
Specific activity (U/mg)
Yield (%)
Purification
His-MdA6PRase
Crude extract
IMAC
27
9.0
0.6
8.70
2.50
3.09
1.18
3.13
0.053
0.136
1.25
0.017
100
88
1.0
9.2
nd
MdA6PRase-His
IMAC/Conca
ndb
Activity was measured in the reduction of Glc6P direction as described under Materials and methods.
a
IMAC/Conc.: The protein was concentrated after the purification procedure.
nd: not determined, since no activity was detected in the crude extract of the C-term tagged enzyme.
b

84
C.M. Figueroa, A.A. Iglesias / Biochimie 92 (2010) 81–88
Table 2
Substrate kinetic parameters for MdA6PRase tagged at the N- and C-terminus.
Reaction
Glc6P
Substrate Parameter
His-MdA6PRase MdA6PRase-His
a
kcat (sꢀ1
)
0.70 ꢃ 0.02
9.6 ꢃ 0.7
1.3
(9 ꢃ 1) ꢂ 10ꢀ3
reduction Glc6P
S0.5 (mM)
nH
8.1 ꢃ 0.6
1.1
kcat/S0.5 (Mꢀ1 sꢀ1
S0.5 (mM)
nH
)
)
73
1.1
NADPH
0.013 ꢃ 0.001 0.017 ꢃ 0.001
1.4
1.9
kcat/S0.5 (Mꢀ1 sꢀ1
5.4 ꢂ 104
5.3 ꢂ 102
Gol6P
oxidation Gol6P
kcat (sꢀ1
S0.5 (mM)
nH
)
0.222 ꢃ 0.006 (1.1 ꢃ 0.2) ꢂ 10ꢀ3
3.5 ꢃ 0.3
4.5 ꢃ 0.5
1.5
1.0
kcat/S0.5 (Mꢀ1 sꢀ1
S0.5 (mM)
nH
)
)
63
0.24
NADPþ
0.019 ꢃ 0.001 0.030 ꢃ 0.006
1.2
1.1
37
kcat/S0.5 (Mꢀ1 sꢀ1
1.2 ꢂ 104
a
kcat values were calculated using the molecular mass of the monomer (35 kDa).
(34.9 kDa) and our SDS-PAGE results (Fig. 1), it is concluded that the
His-MdA6PRase arranges as a dimeric protein; whereas MdA6P-
Rase-His seems to be a monomer. These results might explain the
difference in the kinetic behavior respect to a distinct specific
activity that each form of the recombinant enzyme is able to reach.
To evaluate if the tag position could differentially affect protein
stability, the recombinant enzymes were incubated for 10 min at
different pH values (from pH 6.0 to 10.0) and temperatures
(between 0 and 60 ꢁC). As shown in Fig. 3, both enzymes remained
fully active in the pH range analyzed; they were stable after incu-
bation below 30 ꢁC, and both similarly inactivated at higher
temperatures. Fig. 4 shows pH profiles for the activity determined
in both of the reaction directions catalyzed by MdA6PRase. Both
recombinant enzymes similarly showed optimal activity in a broad
pH range in the direction of Glc6P reduction (Fig. 4A), and a narrow
range (pH 9.0–10.0) in the opposite oxidative direction (Fig. 4B).
These results are similar to those reported for the enzyme purified
from apple seedlings [22].
Fig. 3. Analysis of stability for the recombinant proteins. His-MdA6PRase (filled
symbols) and MdA6PRase-His (empty symbols) were incubated 10 min at 25 ꢁC at
different pH values (squares) or 10 min at pH 8.0 at different temperatures (circles).
After the treatment, the remaining activity was measured in the direction of Glc6P
reduction under the standard conditions described in Materials and Methods.
both enzymes were stable (0–30 ꢁC). From the slopes of the lines in
Fig. 5, energy of activation (Ea) values of 42.8 kJ molꢀ1 and
12.7 kJ molꢀ1 were calculated for His-MdA6PRase and MdA6PRase-
His, respectively. It is worth considering that the lower Ea was
obtained with the form of the recombinant enzyme exhibiting the
lower specific activity; thus suggesting that the enzyme containing
the His-tag in the C-term thermodynamically favors the accurate
formation of the transient activated complex of the reaction [34],
even when it exhibits hindrance in promoting products formation.
Fig.
5 depicts Arrhenius plots [34] determined for both
recombinant enzymes from measurements of the activity in the
direction of Glc6P reduction in the range of temperatures where
3.3. Specificity and effectors
The specificity toward the substrates was evaluated using the
N-term tagged enzyme. No activity was observed when NADH or
NADþ was used with Glc6P or Gol6P, respectively. Also, the enzyme
utilized Glc6P with high specificity, as this substrate could not be
replaced by glucose-1-P, glucose-1,6-bisP, fructose-6-P, fructose-
1,6-bisP, fructose-2,6-bisP, mannose-1-P, glucose, galactose, xylose
nor by trehalose. Only mannose-6-P could be reduced with NADPH
with an enzymatic activity of about 3% of that obtained with Glc6P.
In addition, we analyzed the effect of different metabolites in
the activity of His-MdA6PRase in the physiological direction of
Glc6P reduction. No significant differences were observed when
ATP, ADP, AMP, ADP-glucose, UTP, UDP-glucose, Pi or PPi (5 mM
each) were added to the enzyme assay mixture. In addition, there
were no significant differences in the activity when 10% (v/v)
glycerol, 500 mM glucitol or 20% (w/v) sucrose were added to the
enzyme assay mixture. However, the inclusion of 200 mM NaCl
caused about 65% inhibition of the enzyme activity. A more detailed
study showed that different salts were inhibitory, with I0.5 values of
120 mM for NaCl, KCl, and NH4Cl; and of 50 mM for (NH4)2SO4. If
these results are analyzed in terms of the ionic strength, it is clear
that all of the salts exhibit a similar inhibitory pattern.
Fig. 2. Gel filtration chromatography in a Superdex 200 HR 10/30 column. Plot of
elution volume vs. log (molecular mass). (-) Standard proteins: CA (carbonic anhy-
drase), OA (ovalbumin), BSA and IgG (from equine serum). (C) His-MdA6PRase. (B)
MdA6PRase-His. All the standard proteins were from Sigma–Aldrich (St. Louis, MO,
USA), except for IgG that was purified in our laboratory.
To evaluate if the inhibition by ionic strength of the His-
MdA6PRase is caused by disruption of the enzyme quaternary
structure, its molecular mass was determined by gel filtration

C.M. Figueroa, A.A. Iglesias / Biochimie 92 (2010) 81–88
85
Fig. 4. Enzyme activity of His-MdA6PRase (filled symbols) and MdA6PRase-His (empty
symbols) in the direction of Glc6P reduction (A) and Gol6P oxidation (B) at different pH
values. The buffers used were MES-NaOH (down-triangles), MOPS-NaOH (squares),
Tris–HCl (circles) and CAPS-NaOH (up-triangles).
Fig. 5. Arrhenius plots determined for His-MdA6PRase (-) and MdA6PRase-His (C)
from measurements of the activity in the direction of Glc6P reduction in the range
were both enzymes were stable (0–30 ꢁC).
chromatography performed with NaCl 500 mM. Under the latter
condition, the elution profile of the protein was similar to that
obtained at lower levels of the salt (Fig. 2). On the other hand, NaCl
also inhibited the monomeric C-term tagged enzyme (see Fig. 2)
with an I0.5 of 86 mM, thus reinforcing the view that the inhibition
of MdA6PRase by salts is not forced by dissociation of the enzyme.
A further analysis of the inhibition by NaCl revealed that the salt
affected the kinetic parameters of the enzyme. Fig. 6 shows how the
inclusion of 200 mM NaCl in the assay medium modified the
enzyme saturation curves for Glc6P and NADPH. Thus, the salt
produced a 2-fold decrease in the Vmax, and decreased the affinity
toward the substrates by about 2.5-fold (Glc6P) and 5-fold (NADPH)
(Fig. 6).
Fig. 7. It can be observed that the protein folds into a (b/a)8 barrel,
which is the common folding pattern of proteins from the AKRase
superfamily [31]. Fig. 7 displays the enzyme complexed with
NADPH (inherited from CtXRase, 1K8C) and with Glc6P (inherited
from HsARase, 2ACQ). A detailed analysis of the model shows that
both substrates are close to residues Asp43, Tyr48, Lys77 and
His108, which are highly conserved among the enzymes of the
AKRase superfamily and might be involved in the catalytic mech-
anism [31,36].
3.4. Homology modeling
MdA6PRase shares sequence identity of nearly 35% with CtXRase
as well as with HsARase, which is a degree of identity above that
necessary to perform molecular modeling accurately [35]. We
constructed fifty models of A6PRase from apple leaves utilizing the
crystallographic structures of CtXRase and HsARase as templates
with the program Modeller 9v2. The models were evaluated and
those ten with the lower molpdf values [29] were submitted to the
Verify3D server. The model with the best 3D profile is shown in
Fig. 6. Effect of NaCl on His-MdA6PRase activity. (A) Glc6P curve and (B) NADPH curve
in the absence (-) or in the presence of 200 mM NaCl (C).

86
C.M. Figueroa, A.A. Iglesias / Biochimie 92 (2010) 81–88
maltose-binding protein [38]. However, it was only used for anti-
body production rather than been assayed as an active protein.
The enzyme from apple was expressed using two different
vectors, which fused a His-tag in the N- or C-term to the recombi-
nant protein, thus producing His-MdA6PRase or MdA6PRase-His,
respectively. The addition of the His-tag was useful for the ease one-
step purification by immobilized metal affinity chromatography of
the recombinant proteins. The kinetic parameters determined for
His-MdA6PRase are in good agreement with those reported for the
enzyme purified from apple leaves [11,23] and seedlings [22];
which suggest that this form of the enzyme is an accurate tool to be
utilized for studies on kinetics and regulation. The latter is not
applicable to the recombinant enzyme harboring the His-tag in the
C-term. Although both recombinant enzymes exhibited similar
apparent affinities for the substrates, they showed significantly
different kcat values (and concomitantly kcat/S0.5 ratios), being
MdA6PRase-His a form less active by about two orders of magni-
tude. Additionally, the latter enzyme was expressed at low levels as
a soluble form, which complicates its production in preparative
amounts. Altogether, results indicate that the enzyme tagged in the
C-term is not a convenient model to produce and characterize leaf
A6PRase.
The low specific activity exhibited by MdA6PRase-His would not
be attributed to affected stability or differences in optimal assay
conditions. In fact, the positioning of the His-tag in one or another
extreme of the protein caused no effect on enzyme stability in the
range of pH 6.0–10.0 and at temperatures below 30 ꢁC. In a same
way, both recombinant enzymes showed similar curves of optimal
pH in both directions of the catalyzed reaction. Interestingly,
measurements of the activity at different temperatures gave
Arrhenius plots where the energy of activation (Ea) for MdA6PRase-
His was lower than that calculated for His-MdA6PRase. It may be
speculated that the enzyme having a markedly low specific activity
(this is MdA6PRase-His) is able to efficiently bind substrates
(S0.5 values are not altered in this enzyme form) and to produce the
transient activated complex [34]. The kinetic deficiency for the
latter could be due to impediments to convert the activated inter-
mediates into the products or in releasing them to the medium. It
may be that this form of the enzyme has an active site with
a particular electrostatic and sterical arrangement, which could
determine specific dielectric and structural properties for the
solvent where the reaction is carried out [39]. A different structure
of the active site may induce a slower reaction because the tran-
sient activated complex could explore a wider region of phase space
that includes essentially nonreactive conformers [40]. The model of
a convenient formation of the transition activated complex with
a reduced capacity in forming or releasing the products suggests
that the enzyme tagged in the C-term would be a good tool to study
reaction mechanisms; since it is predicted that it will catalyze the
reaction with longer half-life for the activated intermediates, thus
with better feasibility for the isolation of them. Also, the kinetic
deficiency of MdA6PRase-His may be attributed to the fact that
a different step in the chemical mechanism of the reaction becomes
rate-limiting compared with the enzyme tagged in the N-term
[39,40].
Fig. 7. (A) Homology model of the A6PRase from apple leaves complexed with NADPH
(blue) and Glc6P (orange). (B) The model is rotated 90ꢁ upside-down. The black boxes
are indicating the C-term domain of both subunits (depicted in red).
It has been reported that CtXRase is composed of two subunits
that contact each other through residues located in a helix of one
chain with residues located at the C-term domain of the other chain
[37]. In a remarkable agreement with the latter, the model gener-
ated for MdA6PRase clearly shows that the C-term domain of each
subunit in the dimer is facing to the other one (Fig. 7), which
supports that the addition of the tag to this domain might be
affecting interactions between subunits, thus makingMdA6PRase-
His to be a monomer, when the recombinant enzyme His-tagged in
the N-term forms a dimeric quaternary structure. Remarkably,
when we attempted to model the enzyme having the His-tag at the
C-term, spatial impediments at the dimer interface were found,
resulting in ‘‘nonsense’’ models after inaccuracy for subunits
interaction. On the other hand, when the model of His-MdA6PRase
was built, the tag was oriented to the solvent, thus creating no
restriction for the dimer formation (data not shown).
4. Discussion
Several efforts have determined the key role played by A6PRase
for glucitol synthesis in plants [5,17–21]. However, little is known
about the regulation of this pathway, which is a consequence of the
scarce number of studies dedicated to the kinetic characterization
of the reductase [10,11,22,23]. In the present work, we have cloned
the gene encoding for A6PRase from apple leaves and expressed the
recombinant protein in E. coli cells to develop an appropriate
system for the production of the enzyme with purity required for
reliable kinetic and structural characterization. Although the gene
had been cloned previously [25], only a short communication
describes the recombinant expression of the enzyme fused to the
The main structural difference between His-MdA6PRase and
MdA6PRase-His was found to be related to the quaternary structure.
Thus, the former enzyme was characterized as a dimer (as it was
described for the enzyme purified from apple seedlings) [22];
whereas the reductase tagged in the C-term is monomeric. Results
support the view that disruption of the dimeric arrangement of
the protein affects catalysis, being the main reason for the above
discussed markedly distinct kcat exhibited by each recombinant
enzyme. These results are highly supported by molecular
modeling studies performed for A6PRase utilizing as templates

C.M. Figueroa, A.A. Iglesias / Biochimie 92 (2010) 81–88
87
[5] P.H. Brown, N. Bellaloui, H. Hu, A. Dandekar, Transgenically enhanced sorbitol
synthesis facilitates phloem boron transport and increases tolerance of
tobacco to boron deficiency. Plant Physiol. 119 (1999) 17–20.
[6] C.R. Grant, T. ap Rees, Sorbitol metabolism by apple seedlings. Phytochem-
istry 20 (1981) 1505–1511.
crystallographic structures of CtXRase and of HsARase. It has been
demonstrated for the resolved structure of the fungal reductase that
the C-domain is involved in the aggregation to form a dimer [37],
which is consistent with the structure modeled for the apple enzyme,
alsodisplayingakeyroleof theC-termfordimerization. Klimacekand
coworkers tried to alter dimer contacts in the fungal xylose reductase
by site-directed mutagenesis without success [41]. However, they
generated the R180A mutant enzyme, which exhibited a subtle
decrease in the kcat compared with that observed for the wild type
enzyme, suggesting that the alteration of the dimer interface might
have effects in the enzyme activity. The latter is easily associated with
the distinctive kinetic and structural properties found for the
MdA6PRaseharboringtheHis-tagintheC-term. Alsosupportivewere
the molecular models we obtained for the enzyme harboring the
C-term tag, which revealed 3D steric restrictions for the accurate
interaction between subunits.
[7] A. Moing, F. Carbonne, M.H. Rashad, J.P. Gaudillere, Carbon fluxes in mature
peach leaves. Plant Physiol. 100 (1992) 1878–1884.
[8] J. Nadwodnik, G. Lohaus, Subcellular concentrations of sugar alcohols and
sugars in relationtophloem translocation in Plantago major, Plantago maritima,
Prunus persica, and Apium graveolens. Planta 227 (2008) 1079–1089.
[9] D.M. Pharr, J.M.H. Stoop, J.D. Williamson, M.E.S. Feusi, M.O. Massel,
M.A. Conkling, The dual role of mannitol as osmoprotectant and photo-
assimilate in celery. HortScience 30 (1995) 1182–1188.
[10] M. Hirai, Purification and characteristics of sorbitol-6-phosphate dehydro-
genase from loquat leaves. Plant Physiol. 67 (1981) 221–224.
[11] F.B. Negm, W.H. Loescher, Characterization and partial purification of aldose-
6-phosphate reductase (alditol-6-phosphate:NADP 1-oxidoreductase) from
apple leaves. Plant Physiol. 67 (1981) 139–142.
[12] R. Zhou, L. Cheng, R. Wayne, Purification and characterization of sorbitol-6-
phosphate phosphatase from apple leaves. Plant Sci. 165 (2003) 227–232.
[13] J. Beru¨ter, M.E.S. Feusi, The effect of girdling on carbohydrate partitioning in
the growing apple fruit. J. Plant Physiol. 151 (1997) 277–285.
The N-term tagged enzyme exhibited a high specificity to
reversibly catalyze the reduction of Glc6P to Gol6P coupled to the
oxidation of NADPH to NADPþ; except for mannose-6-P, which is an
alternative substrate but the enzyme reaching only 3% of the
activity observed with Glc6P. These results are in good agreement
with the previously reported data for A6PRase purified from apple
and loquat [10,11,22]. On the other hand, the two forms of the
recombinant enzyme were inhibited by high ionic strength in
the assay medium. The inhibition was not caused by changes in the
quaternary structure, but high concentrations of salts provoked
a decrease in Vmax and an increase in the S0.5. The rationale for the
inhibitory effect seems to be that the increase of ionic strength
disrupts the conditions in the environment where the substrates
bind to the enzyme and where catalysis takes place. The fact that
the substrates are ionic molecules logically supports this view.
[14] M.A. Ballicora, A.A. Iglesias, J. Preiss, ADP-glucose pyrophosphorylase:
a regulatory enzyme for plant starch synthesis. Photosynth. Res. 79 (2004)
1–24.
´
[15] A.A. Iglesias, F.E. Podesta, Photosynthate formation and partitioning in crop
plants. in: M. Pessarakli (Ed.), Handbook of Photosynthesis. CRC Press, Boca
Raton, 2005, pp. 525–545.
[16] H. Winter, S.C. Huber, Regulation of sucrose metabolism in higher plants:
localization and regulation of activity of key enzymes. Crit. Rev. Biochem.
Mol. Biol. 35 (2000) 253–289.
[17] Y. Kanayama, M. Watanabe, R. Moriguchi, M. Deguchi, K. Kanahama,
S. Yamaki, Effects of low temperature and abscisic acid on the expression of
the sorbitol-6-phosphate dehydrogenase gene in apple leaves. J. Japan. Soc.
Hort. Sci. 75 (2006) 20–25.
[18] N. Kanamaru, Y. Ito, S. Komori, M. Saito, H. Kato, S. Takahashi, M. Omura,
J. Soejima, K. Shiratake, K. Yamada, S. Yamaki, Transgenic apple trans-
formed by sorbitol-6-phosphate dehydrogenase cDNA: switch between
sorbitol and sucrose supply due to its gene expression. Plant Sci. 167 (2004)
55–61.
[19] G. Teo, Y. Suzuki, S.L. Uratsu, B. Lampinen, N. Ormonde, W.K. Hu, T.M. DeJong,
A.M. Dandekar, Silencing leaf sorbitol synthesis alters long-distance parti-
tioning and apple fruit quality. Proc. Natl. Acad. Sci. U.S.A. 103 (2006)
18842–18847.
5. Concluding remarks
[20] L. Cheng, R. Zhou, E.J. Reidel, T.D. Sharkey, A.M. Dandekar, Antisense
inhibition of sorbitol synthesis leads to up-regulation of starch synthesis
without altering CO2 assimilation in apple leaves. Planta 220 (2005)
767–776.
[21] M. Gao, R. Tao, K. Miura, A.M. Dandekar, A. Sugiura, Transformation of
Japanese persimmon (Diospyros kaki Thunb.) with apple cDNA encoding
NADP-dependent sorbitol-6-phosphate dehydrogenase. Plant Sci. 160 (2001)
837–845.
[22] Y. Kanayama, S. Yamaki, Purification and properties of NADP-dependent
sorbitol-6-phosphate dehydrogenase from apple seedlings. Plant Cell Phys-
iol. 34 (1993) 819–823.
[23] R. Zhou, R.C. Sicher, L. Cheng, B. Quebedeaux, Regulation of apple leaf aldose-
6-phosphate reductase activity by inorganic phosphate and divalent cations.
Funct. Plant Biol. 30 (2003) 1037–1043.
We present, for the first time, the recombinant expression of an
active A6PRase in a prokaryotic system. The one-step purification
procedure of the N-term tagged enzyme seems to be an accurate
method for the production of preparative amounts of A6PRasefor
kinetic and structural analysis. Also, we provided evidence for the
importance of the recombinant A6PRase from apple leaves C-term
to obtain the optimal specific activity and the appropriate quater-
nary structure. Therefore, these results represent a promising tool
to advance in the characterization of structure to function rela-
tionships in A6PRase. Such work is currently in progress.
[24] T.C. Hall, Y. Ma, B.U. Buchbinder, J.W. Pyne, S.M. Sun, F.A. Bliss, Messenger
RNA for G1 protein of French bean seeds: cell-free translation and product
characterization. Proc. Natl. Acad. Sci. U.S.A. 75 (1978) 3196–3200.
[25] Y. Kanayama, H. Mori, H. Imaseki, S. Yamaki, Nucleotide sequence of a cDNA
encoding NADP-sorbitol-6-phosphate dehydrogenase from apple. Plant
Physiol. 100 (1992) 1607–1608.
[26] T.A. Hall, BioEdit: a user-friendly biological sequence alignment editor and
analysis program for Windows 95/98/NT. Nucl. Acids Symp. Ser. 41 (1999)
95–98.
Acknowledgments
This work was supported in part by Consejo Nacional de
Investigaciones Cientıficas y Tecnicas (CONICET, PIP 6358), Agencia
Nacional de Promocion Cientıfica y Tecnologica (ANPCyT, PICTO’05
15-36129) and Universidad Nacional del Litoral (UNL, CAIþD 2006).
C.M.F. is a Postdoctoral Fellow and A.A.I. is a member of the
Researcher Career from CONICET.
´
´
´
´
´
[27] M.M. Bradford, A rapid and sensitive method for the quantitation of micro-
gram quantities of protein utilizing the principle of protein-dye binding.
Anal. Biochem. 72 (1976) 248–254.
[28] U.K. Laemmli, Cleavage of structural proteins during the assembly of the
head of bacteriophage T4. Nature 227 (1970) 680–685.
[29] A. Sali, T.L. Blundell, Comparative protein modelling by satisfaction of spatial
restraints. J. Mol. Biol. 234 (1993) 779–815.
References
[1] H.J. Bohnert, R.G. Jensen, Strategies for engineering water-stress tolerance in
plants. Trends Biotechnol. 14 (1996) 89–97.
[2] N. Smirnoff, Plant resistance to environmental stress. Curr. Opin. Biotechnol.
9 (1998) 214–219.
[3] W. Loescher, J. Everard, Regulation of sugar alcohol biosynthesis. in:
R.C. Leegood, T.D. Sharkey, S. von Caemmerer (Eds.), Photosynthesis: Physi-
ology and Metabolism. Kluwer Academic Publishers, Dordrecht, 2000,
pp. 275–299.
[4] B. Shen, R.G. Jensen, H.J. Bohnert, Increased resistance to oxidative stress in
transgenic plants by targeting mannitol biosynthesis to chloroplasts. Plant
Physiol. 113 (1997) 1177–1183.
[30] D. Hyndman, D.R. Bauman, V.V. Heredia, T.M. Penning, The aldo-keto
reductase superfamily homepage. Chem. Biol. Interact. 143-144 (2003)
621–631.
[31] J.M. Jez, M.J. Bennett, B.P. Schlegel, M. Lewis, T.M. Penning, Comparative
anatomy of the aldo-keto reductase superfamily. Biochem. J. 326 (Pt 3)
(1997) 625–636.
[32] J.U. Bowie, R. Luthy, D. Eisenberg, A method to identify protein sequences
that fold into a known three-dimensional structure. Science 253 (1991)
164–170.
[33] R. Luthy, J.U. Bowie, D. Eisenberg, Assessment of protein models with three-
dimensional profiles. Nature 356 (1992) 83–85.

88
C.M. Figueroa, A.A. Iglesias / Biochimie 92 (2010) 81–88
[34] I.H. Segel, Enzyme Kinetics. Behavior and Analysis of Rapid Equilibrium and
Steady-State Enzyme Systems. Wiley-Interscience, New York, 1993.
[35] K. Ginalski, Comparative modeling for protein structure prediction. Curr.
Opin. Struct. Biol. 16 (2006) 172–177.
[36] R. Kratzer, D.K. Wilson, B. Nidetzky, Catalytic mechanism and substrate
selectivity of aldo-keto reductases: insights from structure-function
studies of Candida tenuis xylose reductase. IUBMB Life 58 (2006)
499–507.
[38] Y. Kanayama, K. Sakanishi, H. Mori, S. Yamaki, Expression of the gene for
NADP-dependent sorbitol-6-phosphate dehydrogenase in apple seedlings.
Plant Cell Physiol. 36 (1995) 1139–1141.
[39] T.C. Bruice, S.J. Benkovic, Chemical basis for enzyme catalysis. Biochemistry
39 (2000) 6267–6274.
[40] D. Truhlar, A. Kohen, Convex Arrhenius plots and their interpretation. Proc.
Natl. Acad. Sci. U.S.A. 98 (2001) 848–851.
[41] M. Klimacek, F. Wuhrer, K.L. Kavanagh, D.K. Wilson, B. Nidetzky, Altering
dimer contacts in xylose reductase from Candida tenuis by site-directed
mutagenesis: structural and functional properties of R180A mutant. Chem.
Biol. Interact. 143–144 (2003) 523–532.
[37] K.L. Kavanagh, M. Klimacek, B. Nidetzky, D.K. Wilson, The structure of apo
and holo forms of xylose reductase, a dimeric aldo-keto reductase from
Candida tenuis. Biochemistry 41 (2002) 8785–8795.