Activation and Signaling Mechanism Revealed by Cannabinoid Receptor-Gi Complex Structures

Article abstract of DOI:10.1016/j.cell.2020.01.008

Human endocannabinoid systems modulate multiple physiological processes mainly through the activation of cannabinoid receptors CB1 and CB2. Their high sequence similarity, low agonist selectivity, and lack of activation and G protein-coupling knowledge have hindered the development of therapeutic applications. Importantly, missing structural information has significantly held back the development of promising CB2-selective agonist drugs for treating inflammatory and neuropathic pain without the psychoactivity of CB1. Here, we report the cryoelectron microscopy structures of synthetic cannabinoid-bound CB2 and CB1 in complex with G_i, as well as agonist-bound CB2 crystal structure. Of important scientific and therapeutic benefit, our results reveal a diverse activation and signaling mechanism, the structural basis of CB2-selective agonists design, and the unexpected interaction of cholesterol with CB1, suggestive of its endogenous allosteric modulating role. Structure and simulations of cannabinoid receptors CB2 and CB1 in their inactive, active-like, and activated signaling states reveal residue differences that may provide G protein selectivity, the distinct binding behavior of CB2 agonists in CB2 and CB1, as well as evidence for modulation of CB1 by cholesterol binding.

Full text of DOI:10.1016/j.cell.2020.01.008

Article
Activation and Signaling Mechanism Revealed by
Cannabinoid Receptor-Gi Complex Structures
Graphical Abstract
Authors
Tian Hua, Xiaoting Li, Lijie Wu, ...,
Laura M. Bohn, Alexandros Makriyannis,
Zhi-Jie Liu
Correspondence
huatian@shanghaitech.edu.cn (T.H.),
liuzhj@shanghaitech.edu.cn (Z.-J.L.)
In Brief
Structure and simulations of cannabinoid
receptors CB2 and CB1 in their inactive,
active-like, and activated signaling states
reveal residue differences that may
provide G protein selectivity, the distinct
binding behavior of CB2 agonists in CB2
and CB1, as well as evidence for
modulation of CB1 by cholesterol
binding.
Highlights
Data Resources
d
d
d
d
3D structures of CB2-AM12033-Gi, CB1-AM841-Gi, and
CB2-AM12033 are determined
6KPC
6KPF
6KPG
Structural evidence of G protein selectivity by CB1 and CB2
is identified
MD simulations reveal the distinct binding behavior of HU308
in CB2 and CB1
Cholesterol molecule as an endogenous allosteric modulator
of CB1 is uncovered
Hua et al., 2020, Cell 180, 1–11
February 20, 2020 ª 2020 Elsevier Inc.
https://doi.org/10.1016/j.cell.2020.01.008

Please cite this article in press as: Hua et al., Activation and Signaling Mechanism Revealed by Cannabinoid Receptor-Gi Complex Structures,
Cell (2020), https://doi.org/10.1016/j.cell.2020.01.008
Article
Activation and Signaling Mechanism Revealed
by Cannabinoid Receptor-Gi Complex Structures
Tian Hua,1,9, Xiaoting Li,1,9 Lijie Wu,1,9 Christos Iliopoulos-Tsoutsouvas,2 Yuxia Wang,1 Meng Wu,1,3 Ling Shen,1,3
*
Christina A. Johnston,4 Spyros P. Nikas,2 Feng Song,5 Xiyong Song,6 Shuguang Yuan,7 Qianqian Sun,1 Yiran Wu,1
Shan Jiang,2 Travis W. Grim,4 Othman Benchama,2 Edward L. Stahl,4 Nikolai Zvonok,2 Suwen Zhao,1,3 Laura M. Bohn,4
Alexandros Makriyannis,2,8 and Zhi-Jie Liu1,3,6,10,
*
1iHuman Institute, ShanghaiTech University, Shanghai 201210, China
2Center for Drug Discovery and Department of Pharmaceutical Sciences, Northeastern University, Boston, MA 02115, USA
3School of Life Science and Technology, ShanghaiTech University, Shanghai 201210, China
4Departments of Molecular Medicine and Neuroscience, Scripps Research, Jupiter, FL 33458, USA
5School of Life Science, Dezhou University, Dezhou 253023, Shandong Province, China
6Institute of Molecular and Clinical Medicine, Kunming Medical University, Kunming 650500, Yunnan Province, China
7The Research Center for Computer-aided Drug Discovery, Shenzhen Institutes of Advanced Technology, Chinese Academy of Sciences,
Shenzhen 518055, China
8Center for Drug Discovery and Departments of Chemistry and Chemical Biology, Northeastern University, Boston, MA 02115, USA
9These authors contributed equally
10Lead Contact
*Correspondence: huatian@shanghaitech.edu.cn (T.H.), liuzhj@shanghaitech.edu.cn (Z.-J.L.)
https://doi.org/10.1016/j.cell.2020.01.008
SUMMARY
tity and 68% sequence similarity in the transmembrane regions
(Munro et al., 1993). However, they differ in their tissue distribu-
Human endocannabinoid systems modulate multiple tion and exert distinct functions in endocannabinoid system,
where CB1 and CB2 are expressed predominantly in the central
nervous system and the immune system, respectively.
physiological processes mainly through the activa-
tion of cannabinoid receptors CB1 and CB2. Their
high sequence similarity, low agonist selectivity,
and lack of activation and G protein-coupling knowl-
edge have hindered the development of therapeutic
applications. Importantly, missing structural infor-
mation has significantly held back the development
of promising CB2-selective agonist drugs for treating
So far, several crystal structures of cannabinoid receptors
have been determined, including antagonist-bound (Hua et al.,
2016; Shao et al., 2016) and agonist-bound CB1 (Hua
et al., 2017) as well as antagonist-bound CB2 structures (Li
et al., 2019). While these structures have enhanced our under-
standing of the ligand induced inactive or active-like states, there
are a number of important challenges that remain. First, the
development of therapeutic applications has been hindered by
difficulty in specifically modulating the individual cannabinoid re-
inflammatory and neuropathic pain without the psy-
choactivity of CB1. Here, we report the cryoelectron
microscopy structures of synthetic cannabinoid- ceptors due to their high sequence similarity. Also, the absence
of the agonist-bound CB2 structure has held back the develop-
ment of CB2-selective agonists as high potential drug candi-
bound CB2 and CB1 in complex with Gi, as well as
agonist-bound CB2 crystal structure. Of important
scientific and therapeutic benefit, our results reveal
a diverse activation and signaling mechanism, the
structural basis of CB2-selective agonists design,
and the unexpected interaction of cholesterol with
CB1, suggestive of its endogenous allosteric modu-
dates for treating inflammatory and neuropathic pain without
the psychoactivity of CB1 (Contino et al., 2017; Lunn et al., 2008).
Finally, CB2 and CB1 elicit their physiological responses by
coupling primarily to Gi/o proteins to inhibit adenylate cyclase
and cyclic AMP signaling, yet CB1 also couples with Gs (G pro-
tein-stimulating adenylate cyclase) or Gq/11 (G protein-activating
phospholipase C and G protein-increasing cytosolic Ca2+) to
instigate signaling under special circumstances (Glass and
Felder, 1997; Lauckner et al., 2005). Although an indole-based
synthetic cannabinoid MDMB-Fubinaca (FUB)-bound CB1-Gi
lating role.
INTRODUCTION
Cannabinoid receptors CB1 and CB2 serve as key components structure was determined recently (Krishna Kumar et al., 2019),
of the endocannabinoid system and are the principal targets of the activation and G protein-coupling mechanism underlying
D9-tetrahydrocannabinol (D9-THC), a psychoactive chemical the two cannabinoid receptors CB2 and CB1 is still elusive.
from Cannabis sativa with a wide range of therapeutic applica-
Here, we have used single-particle cryoelectron microscopy
tions (Lemberger, 1980). CB1 and CB2 play crucial roles in a (cryo-EM) and obtained the structures of agonist-bound CB2
variety of physiological processes, including appetite, pain and CB1 in complex with the heterotrimeric protein Gi as well
´
sensation, memory, and immunomodulation (Guzman, 2003).
as the crystal structure of agonist-bound CB2 by X-ray crystal-
The two cannabinoid receptors share 44% total sequence iden- lography method. Together with our previously reported crystal
Cell 180, 1–11, February 20, 2020 ª 2020 Elsevier Inc.
1

Please cite this article in press as: Hua et al., Activation and Signaling Mechanism Revealed by Cannabinoid Receptor-Gi Complex Structures,
Cell (2020), https://doi.org/10.1016/j.cell.2020.01.008
Figure 1. Cryo-EM Structures of the CB1-Gi
and CB2-Gi Complexes
(A) Cryo-EM density maps of the CB1-Gi and
CB2-Gi complexes, with colored subunits. Color
code for the proteins is as follows: CB1, orange;
CB2, green; Gai in CB1, slate; Gai in CB2, yellow;
Gb, cyan; Gg, magenta.
(B and C) Cryo-EM structures of CB1-Gi (B) and
CB2-Gi (C) complexes using same color code as in
(A), with AM841 and AM10233 shown as yellow and
orange sticks, respectively.
See also Figure S2 and Table S1.
(Ki = 0.37 nM for CB2) agonist AM12033
(Figure S1). The CB2-Gi complex was
further stabilized by the addition of
scFv16 (Koehl et al., 2018). Single-particle
cryo-EM analysis of the frozen sample
enabled us to obtain nominal global
˚
A resolution for CB2-
maps at 2.9
AM12033-Gi-scFv16 (Figure 1; Figure S2;
Table S1). The ligand, receptor, and Gi in
the isolated complex are clearly visible in
the EM maps (Figure S2). Side chains of
the majority of amino acid residues are
well defined in all protein components
(Figures S2C and S2D). Thus, the structure
provides an accurate model of intermolec-
ular interactions of CB2 with the agonist
and Gi.
The same method was applied in ob-
taining the CB1-AM841-Gi-scFv16 com-
˚
plex cryo-EM structure at 3.0 A resolution
and the only differences is that the CB1-Gi
complex was constituted in vitro from pu-
rified protein components using the THC-
structures of CB1 and CB2, we have, so far, determined struc- like cannabinoid agonist AM841(Hua et al., 2017) instead of
tures of CB1 and CB2 in their inactive, active-like, and active in vivo co-expression for CB2-Gi complex. In addition, the
states. Comparing the six cannabinoid receptor structures agonist AM12033-bound CB2 crystal structure was also deter-
˚
together with several other solved G protein-coupled receptor mined at 3.2 A resolution (Table S2).
(GPCR) structures in complex with Gi/o, Gs, or G11 proteins,
this study provides comprehensive insights into the diverse acti- Overall Structure of CB2 Signaling Complex and Its
vation and means by which cannabinoid receptors couple to Comparison with CB1-Gi Complex
G proteins and opens up avenues for the rational design of The overall structure of the active CB2-Gi complex is similar to
new selective ligands, especially agonists, to precisely modulate that of the active conformation of the CB1-Gi complex (Fig-
the endocannabinoid systems.
ure 2A), with root mean square deviation (RMSD) values of
˚
1.65 A for the whole complex, 1.26 A for the receptors alone,
˚
˚
and 0.41 A for the Gi proteins. The N termini of both receptors
RESULTS
adopt identical conformations, forming a short helix over the
binding pocket. The binding poses of AM12033 in CB2 and
AM841 in CB1 are superimposable. When comparing inactive
Solution of CB2-Gi Cryo-EM Structure and Agonist-
Bound CB2 Crystal Structure
To prepare the stable CB2-Gi (Gaibg) complexes for cryo-EM and active states of CB2, we observe an outward movement of
studies, we tried different modifications and ligands. Eventually, TM6 that is characteristic of receptor activation and an extension
the expression level of CB2 receptor was improved by the inser- of TM5 that resulted in new interactions with Gai (Figure 2B).
tion of BRIL protein at CB2’s N terminus. The stability of the Similar conformational changes are also observed in CB1-Gi
CB2-Gi complex was achieved by co-expression of the receptor complex structure (Figures S3A and S3B). These structural
with the heterotrimeric Gi protein and the designed high-affinity changes allow the G protein to engage with the receptor core.
2
Cell 180, 1–11, February 20, 2020

Please cite this article in press as: Hua et al., Activation and Signaling Mechanism Revealed by Cannabinoid Receptor-Gi Complex Structures,
Cell (2020), https://doi.org/10.1016/j.cell.2020.01.008
Figure 2. Comparison of Cannabinoid Receptor Structures
(A) Comparison of active CB1, orange; and CB2, green.
(B–D) Side (B), extracellular (C), and intracellular (D) comparison views of active, green; and inactive, sky blue (PDB: 5ZTY) CB2 structures. Conformational
changes are indicated with blue arrows.
See also Figure S3.
In addition, the conformations of critical residues for the receptor ceptor (Figure 3B). However, compared to the mOR-, A1-,
activation, such as D3.49R3.50Y3.51 and N7.49P7.50xxY7.53 motifs 5HT1B-, and M2-Gi complexes (Draper-Joyce et al., 2018; Gar-
(superscripts indicate Ballesteros-Weinstein numbering for cı´a-Nafrı´a et al., 2018; Koehl et al., 2018; Maeda et al., 2019), the
GPCRs [Ballesteros and Weinstein, 1995]), are almost identical Gi proteins in CB2- and CB1-Gi complexes are observed to have
between the active conformations of CB2 and CB1 (Figures a ꢀ20ꢁ anticlockwise rotation (if viewed from intracellular to
S3C and S3D). Different from the large conformational changes extracellular direction) when aligning all available receptor-G
of both extracellular and intracellular domains occurring from protein complex structures using CB2 structure as reference
inactive to active states in CB1 (Figure S3B), the extracellular re- (Figures S4A and S4B). The orientation difference of the Gi pro-
gion, including the N terminus of CB2, undergoes very minor teins from CB2 and CB1 complexes may be attributed to the
changes during its activation (Figures 2C and 2D).
more extended TM5 of CB2 or CB1 where additional interactions
The overall structure of the Gi heterotrimers in CB2 and CB1 with the a5 helix of Gai are observed (Figure 3B). Specifically,
complex structures is similar to those previously solved residues Ser2225.71 and His2265.75 from CB2 or R3115.75 from
GPCR-Gi complexes (Figure S4). No electron density for gua- CB1 formed new interactions with D337 and Q333 in a5 helix
nosine diphosphate (GDP) is observed in the GDP-binding of Gai. We hypothesize that the extra pulling force may serve
pocket, which is mainly formed by the b1-a1 loop (P loop) to twist Gi into a more energy-favorable orientation in the CB2-
and the b6-a5 loop, suggesting that Gi is nucleotide-free in and CB1-Gi complexes.
both receptor-Gi complex structures. The antibody scFv16
While CB1 and CB2 signal through Gi, CB1 is also known to
binds at a similar interface comprising of the aN helix of Gai couple with Gs or Gq. After careful inspection of the residues
and the b-propeller of Gb, as previously reported (Koehl that are involved in the receptor-Gi interactions, L222ICL2 in
et al., 2018).
CB1 is found in the proximity of L194 in the b2-b3 loop, as well
as I344 in a5 helix of Gai, which established weak interactions
between CB1 and Gi (Figure 3C). In contrast, equivalent residue
to L222ICL2 in CB2 is P139ICL2, which is unique in class A GPCRs
and not involved in the interaction with Gi (Figure 3C). Previous
studies have shown that the P139ICL2 mutation of P139F,
P139M, or P139L enabled CB2 to couple with Gs protein (Zheng
et al., 2013). In addition, the L222ICL2 (CB1) equivalent residue
F139ICL2 in the b2AR-Gs structure forms extensive hydrophobic
interactions with a pocket consisting of a5 helix, b2-b3 loop,
and b1 strand in Gas (Figures S4E and S4F) (Maeda et al.,
2019). In agreement, L222F mutation in CB1 has been shown
to increase CB1-Gs basal activity (Chen et al., 2010b; Krishna
Kumar et al., 2019). Thus, we speculate that the residue
The Interactions between CB2 and Gi
The structure of the CB2-Gi complex reveals a similar mode of
interaction when compared with the CB1-Gi complex. The con-
tacts between CB2 and Gi are extensively mediated through the
Gai subunit. The primary interaction interface is composed of
TM3, TM5, TM6, and ICL2 of the receptor and the a5 helix, aN
helix, and aN-b1 loop of the Gai subunit (Figure 3A). Similar to
other Gi-bound GPCRs, the two large hydrophobic side chains
L353 and L348 of the a5 helix from Gai are directed toward the
hydrophobic pocket. For example, the hydrophobic pocket is
formed by Val2125.61, Leu2436.33, Leu2476.37, Leu2396.29, and
Leu1353.54 from the cytosolic ends of TM5, TM6, and TM3 of re-
Cell 180, 1–11, February 20, 2020
3

Please cite this article in press as: Hua et al., Activation and Signaling Mechanism Revealed by Cannabinoid Receptor-Gi Complex Structures,
Cell (2020), https://doi.org/10.1016/j.cell.2020.01.008
Figure 3. Comparison of CB1-Gi and CB2-Gi
Binding Interfaces
(A) Conformation comparison of the a5 helices
(CB1-Gi, blue; CB2-Gi, yellow) in Gai and receptors
(CB1, orange; CB2, green) in CB1-Gi and CB2-Gi
complexes when aligned on the receptors.
(B) Interactions between the a5 helix in Gai and
TM3, TM5, and TM6 in CB1 or CB2 (same color
code).
(C) Interactions between Gai and ICL2 of CB1 and
CB2 (colors as in A).
See also Figure S4.
(Figure S5A). Notably, the binding pockets
of agonist AM12033 and antagonist
AM10257 in CB2 share a high degree of
similarity, as speculated in our previous
report (Li et al., 2019) (Figure 4C), while
the inward movements of extracellular parts
of TM1, TM4, and TM7 produce a more
compact agonist-binding pocket in CB2.
Diverse Activation Processes of CB2
and CB1
In the AM12033-Gi-bound CB2 structure,
the side chain of ‘‘toggle switch’’ residue
Trp2586.48 experiences an expected major
L222ICL2 in CB1 facilitates its coupling with Gs, and likely Gq conformational change (Figure 4D) and a large outward move-
˚
as well.
ment of the intracellular part of TM6 by 11 A (Arg238 as refer-
Concerning the interactions between ICL1, helix8 from CB2 ence) to accommodate the mounting of a5 from the Gai protein
and Gai, we identified that Ser69 and Tyr70 in ICL1 form polar in- (Figure 5A). Moreover, the cytoplasmic portion of TM5 extended
˚
teractions with D305 in Gai, which constrain the conformation of and moved outward by about 6 A (V220 as reference) to form
ICL1. In addition, ICL1 and helix8 of CB2 are in close proximity to extensive interactions with the a5 of the Gai, as discussed
the Gb subunit, and the presence of multiple polar and charged above. However, the cytoplasmic region of TM5 in CB1 is simply
amino acids at this interface suggests potential interactions.
extended during activation (Figure 5B). The larger movement of
TM5 in CB2 may be attributed to Gly2105.59 (Met2955.59 in
CB1) that provides extra bending flexibility of TM5 (Figure 5C).
Additionally, the classical activation features in class A GPCRs
AM12033-CB2 Interactions Unveiled by Cryo-EM and
Crystal Structures
In the CB2-Gi complex, the agonist AM12033 adopts an L-shape are also observed here, including the rearrangement of ‘‘micro-
conformation in the orthosteric binding pocket. The interactions switches’’ DRY and NPxxY motifs (Figures S3C and S3D) (Er-
between AM12033 and CB2 are mainly hydrophobic and landson et al., 2018). The ‘‘ionic lock’’ between Arg1313.50 and
aromatic, including residues from ECL2, TM3, TM5, TM6, and Asp2406.30, which is important for maintaining the ground state
TM7 (Figure 4). The tricyclic tetrahydrocannabinol system of of the receptor (Savinainen et al., 2003), is broken, and
AM12033 forms p-p interactions with Phe183ECL2, Phe2817.35 Arg1313.50 in the DRY motif extends toward TM7 and forms a
and Phe942.64, and the phenolic hydroxyl at C1 forms a hydrogen hydrogen bond with G352 from the a5-helix of Gai. A 4 A inward
˚
bond with Ser2857.39. The alkyl chain of AM12033 extends into the displacement of the NPxxY motif (N2957.49, P2967.50, and
long channel and forms hydrophobic interactions with residues Y2997.52) in TM7 induces the conformational change of helix 8
from TM3, TM5, and TM6. Prior to solving cryo-EM CB2-Gi com- and ICL1, eventually leading to the closer interaction between
plex structure, we have already determined the AM12033-bound the receptor and Gi.
˚
CB2 crystal structure at 3.2 A resolution (Figure 4A) where the
The overall structure of AM841-CB1-Gi is similar to our previ-
binding pose of AM12033 can be unambiguously defined, owing ously solved AM841-bound CB1 crystal structure (Hua et al.,
to the clear electron density in the orthosteric ligand-binding 2017). The main differences occur in the CB1-G protein interface
pocket. The competitive binding of AM12033 is in agreement where the interacting residues are stabilized by Gi. In addition,
with cyclic adenosine monophosphate (cAMP) functional assay elongation of TM5 and inward movement of TM5, TM6, ICL1,
(Figures S3E and S3F). The agonist AM12033 in both cryo-EM and ICL2 in the intracellular region resulted in more polar and hy-
and crystal structures shares almost identical binding poses, drophobic interactions with a5 of the Gai protein (Figure S5D).
and the surrounding residues take similar conformations as well The binding poses of AM841 in the two structures are almost
4
Cell 180, 1–11, February 20, 2020

Please cite this article in press as: Hua et al., Activation and Signaling Mechanism Revealed by Cannabinoid Receptor-Gi Complex Structures,
Cell (2020), https://doi.org/10.1016/j.cell.2020.01.008
Figure 4. AM12033-Bound CB2 Crystal Structure and Interactions between AM12033 and CB2
(A) Crystal structure of AM12033, yellow sticks; bound CB2, light blue cartoon.
(B) Key residues, green sticks, involved in AM12033, yellow sticks, binding in CB2-Gi complex structure, green cartoon.
(C) Binding poses comparison of AM12033, yellow sticks; and AM10257, magenta sticks in CB2.
(D) Comparison of the ‘‘toggle switch’’ residue conformation in active, green cartoon; and inactive, sky blue cartoon, CB2.
See also Figures S1 and S5 and Table S2.
indistinguishable in the orthosteric binding pocket along with the Phe3.36 and Trp6.48, to unleash the large conformational
key interacting residues. The ‘‘twin toggle switch’’ residues changes and induce the G protein-coupling. Yet in CB2, the sin-
Phe2003.36 and Trp3566.48 adopt similar conformation in the two gle ‘‘toggle switch,’’ Trp6.48, is enough to trigger the activation
structures(Figure S5E), confirming their important role in CB1 acti- and the downstream signaling.
vation. The DRY and NPxxY motifs show similar rearrangements
Additionally, there is an atypical polar amino acid residue
(Figure S5F), indicating that the AM841-bound CB1 crystal struc- (Thr3.46) in both CB2 and CB1 compared with a conserved
ture is close to the active state. In contrast to the agonist-bound non-polar (I/L/M/V) residue in most (95%) class A GPCRs. Previ-
CB1 structures, the intracellular regions of TM5, TM6, and TM7 ous studies (D’Antona et al., 2006) and our own data (Hua et al.,
adopt a more converged conformation in AM12033-bound CB2 2017) showed that T3.46A mutation disables CB2 or CB1 in
crystal structure, and its overall Ca RMSD with antagonist coupling Gi protein. Based on our receptor-Gi complex struc-
˚
AM10257-bound CB2 is only 0.86 A (Figure S5C), compared tures, we found that upon activation in both CB2 or CB1,
with CB2-Gi complex structure (Figure S5B). In our previous study, Tyr7.53 establishes new contacts with Thr3.46, Leu3.43, and
we haveshown that class A GPCRs exhibit very diverse conforma- Arg3.50 (Figures S5G and S5H). Meanwhile, Asp6.30 in TM6 in-
tional changes in the intracellular region in responding to agonist terrupts its salt-bridge interaction with Arg3.50 (Figure S3D). This
binding (Hua et al., 2017). CB2 behaves as most solved class A strengthens the interaction of TM3 and TM7, weakens the
GPCRs, which only experience minor conformational changes constraint on TM6 from TM3, and unlocks the outward move-
upon agonist binding, while CB1 is exceptional and displays larger ment of TM6. Therefore, T3.46A mutation in cannabinoid recep-
conformational changes when modulated by agonists.
The structures (inactive, agonist-bound, and active states) movement of TM6 and inactivation of the receptor.
of CB2 and CB1 we have obtained so far reveal intriguing Furthermore, previous studies have shown that a contact
tors or some other class A GPCRs may lead to restriction of the
conformational diversities (Figures 5A and 5B) and provide us between residues 2.42 and 3.46 is important for GPCR folding
the structural basis for deciphering the activation and signaling (Venkatakrishnan et al., 2013). In CB2, the side chain of
mechanism of cannabinoid receptors. First, the balloon-like Phe722.42 adopts similar rotamer conformations in all three
plasticity of CB1 during the transitions between different states states, and the contacts between TM2 and TM3 are maintained.
facilitates its inherent ability to respond to a diverse array of However, in CB1, the side chain of Phe1552.42 adopts different
ligands compared to CB2. More interestingly, the two closely conformations in the three states, which facilitate the conforma-
related receptors experience quite different activation pro- tional flexibility of ICL1 and the cytoplastic end of TM2. This
cesses. The more complicated activation of CB1 assumes the feature may indicate that these regions in CB1 may potentially
synergistic conformational change of the ‘‘twin toggle switch,’’ be allosteric modulation sites. Of note, the cholesterol that we
Cell 180, 1–11, February 20, 2020
5

Please cite this article in press as: Hua et al., Activation and Signaling Mechanism Revealed by Cannabinoid Receptor-Gi Complex Structures,
Cell (2020), https://doi.org/10.1016/j.cell.2020.01.008
Figure 5. Comparison of CB1 and CB2 in Different States
(A) Comparison of the intracellular parts of CB2 in different states. Color code is as follows: CB2-Gi, green; CB2-AM12033, light blue; and CB2-AM10257, blue.
(B) Comparison of the intracellular parts of CB1 in different states. Color code is as follows: CB1-Gi, orange; CB1-AM841, olive; and CB1-AM6538, cyan.
(C) Conformation comparison of TM5 and TM6 in CB1 and CB2 between inactive and active states with color code as above.
(D) Conformational changes of F1552.42 and F2374.46 in cholesterol, slate sticks, binding sites of CB1.
See also Figure S5.
observed in the agonists-bound (AM11542 and AM841) CB1 The antagonist-binding pockets in both receptors are quite
crystal structures disappeared in the CB1-Gi complex distinct, which is consistent with their high degree of antagonist
structure. Comparing with the cholesterol-binding pocket in selectivity (Hua et al., 2016; Li et al., 2019). However, the agonist-
agonist AM841 or AM11542 bound structures, the side chains binding pockets in CB1 and CB2 and even the side-chain
of Phe1552.42 and Phe2374.46 undergo large conformational rotamers of the key residues involved with ligands interactions
changes in CB1-Gi structure and occupy the same position are almost identical (Figure 6A). Such structural observations
that cholesterol had in the agonist-bound crystal structures (Fig- may explain the low level of CB1 and CB2 selectivity found in
ure 5D). Also, the key residues involved in cholesterol binding are the classical cannabinoids and their synthetic analogs.
not conserved in CB1 and CB2. To our knowledge, Phe4.46 is In this study, to further explore the structural basis of agonist
unique to CB1 in class A GPCRs, and the cholesterol is not selectivity in CB1 and CB2, two highly CB2-selective agonists,
observed in either state of CB2 complex structures.
HU-308 and L-759,656, were chosen as model ligands to probe
the problems. The binding affinity of HU-308 for CB2 (Ki is
22.7 nM) is about 5,000 times higher than that of CB1 (almost
no measurable Ki) (Hanus et al., 1999), while L-759,656 shows
Structural Basis and Implications of CB1 and CB2
Agonist Selectivity
The structures we obtained so far reveal the similarity and diver- a binding affinity more than 406 times higher on CB2 (Ki is
sity of antagonist- and agonist-binding modes in CB1 and CB2. 11.8 nM) than that of CB1 (Ki is 4.8 mM) (Ross et al., 1999). The
6
Cell 180, 1–11, February 20, 2020

Please cite this article in press as: Hua et al., Activation and Signaling Mechanism Revealed by Cannabinoid Receptor-Gi Complex Structures,
Cell (2020), https://doi.org/10.1016/j.cell.2020.01.008
Figure 6. Docking Poses of HU-308 in CB1 and CB2 and MD Simulations
(A) Binding pocket comparison of AM841-bound CB1-Gi complex and AM12033-bound CB2-Gi complex.
(B)TheinitialdockingposeofHU-308, graysticks,inCB1, graycartoon.After2msMDsimulation, HU-308isshownascyansticksandCB1isshownasorangecartoon.
(C) The initial docking poseof HU-308, gray sticks, inCB2, gray cartoon. After 2 ms MDsimulation, HU-308is shown ascyansticks and CB2 is shown asgreen cartoon.
(D) RMSD of AM841, HU-308, and L-759,656 in CB1 or CB2 during 2 ms MD simulation.
(E) RMSD of key residues involved in the binding of AM841, HU-308, or L-759,656 in CB1 or CB2 during 2 ms MD simulation.
See also Figure S5.
ligand binding to a target protein is a dynamic process which (Barducci et al., 2011, 2008), to sample ligand-binding paths.
involves synergetic conformational changes of both protein MetaMD is a reliable method and has been widely used for
and ligand. Thus, we decided to employ the molecular dynamic many rare biological event samplings (Barducci et al., 2011;
(MD) simulations and meta dynamics (metaMD) simulations to Bonomi et al., 2009; Yuan et al., 2014). Since the N termini in
study the ligand-binding process into CB1 and CB2 structures both CB1 and CB2 cover the orthosteric sites, the ligand entry
(Figures 6B, 6C, S5I, and S5J) (Barducci et al., 2011, 2008). process may be influenced. Thus, we selected two collective vari-
For quality-control purpose, the non-selective agonists AM841 ables for our simulations: distance between the mass center of a
and AM12033 were used as positive controls.
In order to characterize the different binding processes of HU- mass center of N terminus and that of ECL2 loop.
308, L-759,656 and AM841 in CB1 and CB2, we calculated the In the case of HU-308, the binding processes are composed of
ligand and that of the binding pocket and distance between the
RMSDs of ligands (RMSDligand) and key residues which are three different stages in both CB1 and CB2 (Figure 7). Initially,
involved with ligand binding (RMSDmolecule) during each simula- HU-308 fluctuated in the bulk environment at the extracellular
tion course. The calculation results are shown in Figures 6D and region in the vicinity of position P1. At a certain stage, the N ter-
6E. The RMSD values represent the conformation fluctuations minus overcame energy barriers and opened an empty space
for ligands or key residues during the 2 ms simulation process. to accommodate initial ligand binding. The free energy surface
Thus, the smaller RMSD value denotes more stable ligand- (FES) plot indicated that the energy barriers were similar
receptor binding. Not surprisingly, the RMSDAM841 in both CB1 for CB1 and CB2, i.e., approximately 3.5 kcal/mol and
and CB2, RMSDCB1, and RMSDCB2 all kept almost constant 3.0 kcal/mol, respectively. However, when HU-308 diffused
similar values (Figures 6D and 6E). These results indicate that into a deeper space toward the orthosteric site, the energy bar-
our evaluation strategy is valid. Fortunately, the RMSD values rier increased noticeably. It was about 10.5 kcal/mol for CB1,
for HU-308 or L-759,656 in CB1 are obviously larger than those whereas it was about 5.0 kcal/mol for CB2 (Figures 7C and
of CB2. Similarly, the RMSD values for key residues in HU-308- 7D). Such an obvious difference should explain why HU-308 is
or L-759,656-bound CB1 are clearly bigger than those of CB2 much more potent against CB2.
(Figures 6D and 6E). Therefore, the MD simulation results agree
with the different ligand-binding affinities with CB1 and CB2.
To dig further into the understanding of the principle of agonist
DISCUSSION
selectivity in CB1 and CB2, we introduced an advanced free en- In this study, we compared and analyzed the structure snap-
ergy sampling method, the well-tempered metaMD simulations shots of CB2 and CB1 in their inactive, active-like, and activated
Cell 180, 1–11, February 20, 2020
7

Please cite this article in press as: Hua et al., Activation and Signaling Mechanism Revealed by Cannabinoid Receptor-Gi Complex Structures,
Cell (2020), https://doi.org/10.1016/j.cell.2020.01.008
Figure 7. MetaMD Simulations of HU-308 in CB1 and CB2
(A) The mass center, blue sphere, of HU-308 in metaMD simulation against CB1. Three typical positions P1-P3 were labeled in red. P1: bulk environment in the
extracellular region. P2: initial ligand-binding position when N-terminal opened. P3: fully ligand-binding position in the orthosteric site.
(B) The mass center, blue sphere of HU-308 in metaMD simulation against CB2. Three typical positions P1-P3 are labeled in red.
(C and D) The free energy surface (FES) of metaMD simulations for systems CB1-HU-308 (C) and for that of CB2-HU-308 (D).
See also Videos S1 and S2.
signaling states and deciphered their activation and signaling bind to the same cholesterol-binding region in CB1 owing to their
mechanism. Although the overall architecture is similar between similar structural scaffolds. In summary, our findings uncovered
CB2-AM12033-Gi and CB1-AM841-Gi, CB2 and CB1 exhibit new clues in understanding the activation and signaling mecha-
distinct characters in terms of ligand and G protein selectivity nism of cannabinoid receptors and will help the precise modula-
and activation process. The single reside difference in ICL2 tion of endocannabinoid systems for therapeutic benefit.
(L222 in CB1 and P139 in CB2) may contribute to the G pro-
tein-coupling diversity of cannabinoid receptors, where CB2 is
specific to Gi only while CB1 can couple with Gi, Gs, and Gq.
The high degree of structural similarity in the orthosteric
STAR+METHODS
Detailed methods are provided in the online version of this paper
binding pockets between agonist-bound CB2 and CB1 imposes
and include the following:
substantial challenges for high-selective agonist design. The MD
and metaMD simulation analysis on the selectivity of HU-308 and
L-759,656 implied the possible connection between agonist
selectivity and agonist entry path into CB2 or CB1.
d KEY RESOURCES TABLE
d LEAD CONTACT AND MATERIALS AVAILABILITY
d EXPERIMENTAL MODEL AND SUBJECT DETAILS
B Cell lines
The other interesting finding of this study is the cholesterol-
binding behavior with CB1. Our collective experimental evidence
encourages us to speculate that cholesterol or other steroids
may be the endogenous allosteric modulator of CB1. This idea
is supported by previous data which showed that pregnenolone,
a derivative of cholesterol, acts as a CB1 allosteric modulator
d METHOD DETAILS
B Synthesis and Characterization of AM12033
B Protein Engineering and Expression of CB2 for Crystal-
lography Study
B CB2-AM12033 Complex Purification for Co-
crystallization
´
(Vallee et al., 2014). We believe that pregnenolone may also
8
Cell 180, 1–11, February 20, 2020

Please cite this article in press as: Hua et al., Activation and Signaling Mechanism Revealed by Cannabinoid Receptor-Gi Complex Structures,
Cell (2020), https://doi.org/10.1016/j.cell.2020.01.008
B Crystallization of CB2-AM12033 in Lipidic Cubic Phase
B Data Collection and Structure Determination of CB2-
AM12033
through multi-level parallelism from laptops to supercomputers. SoftwareX,
1–2, 19–25.
Adams, P.D., Afonine, P.V., Bunko´ czi, G., Chen, V.B., Davis, I.W., Echols, N.,
Headd, J.J., Hung, L.W., Kapral, G.J., Grosse-Kunstleve, R.W., et al. (2010).
PHENIX: a comprehensive Python-based system for macromolecular struc-
ture solution. Acta Crystallogr. D Biol. Crystallogr. 66, 213–221.
B Constructs and Expression of CB2 and Gi Heterotrimer
B Constructs, Expression, and Purification of scFv16
B CB2-Gi-scFv16 Complex Formation and Purification
B CB1-Gi-scFv16 Complex Expression, Formation, and
Purification
Ballesteros, J.A., and Weinstein, H. (1995). Integrated methods for the
construction of three-dimensional models and computational probing of struc-
ture-function relations in G protein-coupled receptors. Methods in Neurosci-
ences 25, 366–428.
B Cryo-EM Sample Preparation and Image Acquisition
B Image Processing and 3D Reconstruction
B Model Building and Refinement
Barducci, A., Bussi, G., and Parrinello, M. (2008). Well-tempered metadynam-
ics: a smoothly converging and tunable free-energy method. Phys. Rev. Lett.
100, 020603.
B Molecular Docking
B Molecular Dynamics Simulation of CB1/CB2 in Com-
plex with Agonists
Barducci, A., Bonomi, M., and Parrinello, M. (2011). Metadynamics. WIREs
Comput. Mol. Sci. 1, 826–843.
Bonomi, M., Barducci, A., and Parrinello, M. (2009). Reconstructing the equi-
librium Boltzmann distribution from well-tempered metadynamics. J. Comput.
Chem. 30, 1615–1621.
B Metadynamics Simulations
B Cyclic AMP Accumulation Assay
d QUANTIFICATION AND STATISTICAL ANALYSIS
d DATA AND CODE AVAILABILITY
Caffrey, M., and Cherezov, V. (2009). Crystallizing membrane proteins using
lipidic mesophases. Nat. Protoc. 4, 706–731.
B Data Resources
Chan, H.C.S., Wang, J., Palczewski, K., Filipek, S., Vogel, H., Liu, Z.J., and
Yuan, S. (2018). Exploring a new ligand binding site of G protein-coupled re-
ceptors. Chem. Sci. (Camb.) 9, 6480–6489.
SUPPLEMENTAL INFORMATION
Chen, V.B., Arendall, W.B., 3rd, Headd, J.J., Keedy, D.A., Immormino, R.M.,
Kapral, G.J., Murray, L.W., Richardson, J.S., and Richardson, D.C. (2010a).
MolProbity: all-atom structure validation for macromolecular crystallography.
Acta Crystallogr. D Biol. Crystallogr. 66, 12–21.
Supplemental Information can be found online at https://doi.org/10.1016/j.
cell.2020.01.008.
ACKNOWLEDGMENTS
Chen, X.P., Yang, W., Fan, Y., Luo, J.S., Hong, K., Wang, Z., Yan, J.F.,
Chen, X., Lu, J.X., Benovic, J.L., and Zhou, N.M. (2010b). Structural de-
terminants in the second intracellular loop of the human cannabinoid
CB1 receptor mediate selective coupling to G(s) and G(i). Br. J. Pharma-
col. 161, 1817–1834.
This work was supported by the National Natural Science Foundation of China
grant 31870744 (T.H.); National Key Research and Development Program of
China grant 2018YFA0507000 (T.H.); NIH grants R01DA045020 (A.M. and
L.-M.B.), R01DA041435 (A.M.), and P01DA009158 (A.M. and L.-M.B.). We
thank the Shanghai Municipal Government and ShanghaiTech University for
financial support. The cryo-EM data were collected at the Bio-Electron Micro-
scopy Facility of ShanghaiTech University with the assistance of D. Liu. The
synchrotron radiation experiments were performed at the BL41XU of Spring-
8 with approval of the Japan Synchrotron Radiation Research Institute (JASRI)
(proposal no. 2019A2520 and 2019A2721). We thank J. Liu and N. Chen from
Cell Expression Core, as well as the Cloning, Protein Purification, and Assay
Cores of iHuman Institute for their support. We thank Julie Liu and Vera Naz-
arenko for graphical abstract design.
Cherezov, V., Hanson, M.A., Griffith, M.T., Hilgart, M.C., Sanishvili, R., Nagar-
ajan, V., Stepanov, S., Fischetti, R.F., Kuhn, P., and Stevens, R.C. (2009). Ras-
tering strategy for screening and centring of microcrystal samples of human
membrane proteins with a sub-10 microm size X-ray synchrotron beam.
J. R. Soc. Interface 6 (Suppl 5), S587–S597.
Contino, M., Capparelli, E., Colabufo, N.A., and Bush, A.I. (2017). Editorial: The
CB2 Cannabinoid System: A New Strategy in Neurodegenerative Disorder and
Neuroinflammation. Front. Neurosci. 11, 196.
D’Antona, A.M., Ahn, K.H., and Kendall, D.A. (2006). Mutations of CB1 T210
produce active and inactive receptor forms: correlations with ligand affinity,
receptor stability, and cellular localization. Biochemistry 45, 5606–5617.
AUTHOR CONTRIBUTIONS
Darden, T., York, D., and Pedersen, L. (1993). Particle mesh Ewald: An
Nlog(N) method for Ewald sums in large systems. J. Chem. Phys. 98,
10089–10092.
Conceptualization, T.H., A.M., and Z.-J.L.; Methodology, T.H., X.L., L.W.,
C.I.T., Y.W., L.S., C.A.J., S.P.N., X.S., Q.S., S.J., T.W.G., O.B., E.L.S., and
N.Z.; Validation, M.W., Y.W., L.W., and F.S.; Formal Analysis, T.H., X.L.,
S.Y., S.Z., L.M.B., A.M., and Z.-J.L.; Investigation, T.H. and X.L.; Writing –
Original Draft, T.H. and X.L.; Writing – Review & Editing, T.H., X.L., S.P.N.,
M.W., S.Y., S.Z., L.M.B., A.M., and Z.-J.L.; Visualization, T.H., X.L., S.P.N.,
and M.W.; Supervision, A.M. and Z.-J.L.
Draper-Joyce, C.J., Khoshouei, M., Thal, D.M., Liang, Y.L., Nguyen, A.T.N.,
Furness, S.G.B., Venugopal, H., Baltos, J.A., Plitzko, J.M., Danev, R., et al.
(2018). Structure of the adenosine-bound human adenosine A1 receptor-Gi
complex. Nature 558, 559–563.
Emsley, P., Lohkamp, B., Scott, W.G., and Cowtan, K. (2010). Features
DECLARATION OF INTERESTS
and development of Coot. Acta Crystallogr.
486–501.
D Biol. Crystallogr. 66,
The authors declare no competing interests.
Erlandson, S.C., McMahon, C., and Kruse, A.C. (2018). Structural Basis for G
Protein-Coupled Receptor Signaling. Annu. Rev. Biophys. Published online
March 2, 2018. https://doi.org/10.1146/annurev-biophys-070317-032931.
Received: August 16, 2019
Revised: October 31, 2019
Accepted: January 2, 2020
Published: January 30, 2020
Fernandez-Leiro, R., and Scheres, S.H.W. (2017). A pipeline approach to sin-
gle-particle processing in RELION. Acta. Crystallogr. D. Struct. Biol. 73,
496–502.
REFERENCES
Friesner, R.A., Banks, J.L., Murphy, R.B., Halgren, T.A., Klicic, J.J., Mainz,
D.T., Repasky, M.P., Knoll, E.H., Shelley, M., Perry, J.K., et al. (2004). Glide:
a new approach for rapid, accurate docking and scoring. 1. Method and
assessment of docking accuracy. J. Med. Chem. 47, 1739–1749.
´
Abraham, M.J., Murtola, T., Schulz, R., Pall, S., Smith, J.C., Hess, B., and
Lindahl, E. (2015). GROMACS: High performance molecular simulations
Cell 180, 1–11, February 20, 2020
9

Please cite this article in press as: Hua et al., Activation and Signaling Mechanism Revealed by Cannabinoid Receptor-Gi Complex Structures,
Cell (2020), https://doi.org/10.1016/j.cell.2020.01.008
Friesner, R.A., Murphy, R.B., Repasky, M.P., Frye, L.L., Greenwood, J.R.,
Halgren, T.A., Sanschagrin, P.C., and Mainz, D.T. (2006). Extra precision glide:
docking and scoring incorporating a model of hydrophobic enclosure for pro-
tein-ligand complexes. J. Med. Chem. 49, 6177–6196.
Makriyannis, A., D’Souza, M.R., Sharma, R., Nikas, S.P., and Thakur, G.A.
(2014). 2-cycloalkyl resorcinol cannabinergic ligands. Northeastern University
patent application WO2014062965 A1, filed October 17, 2013, and published
April 24, 2014.
´
Garcı´a-Nafrı´a, J., Nehme, R., Edwards, P.C., and Tate, C.G. (2018). Cryo-EM
Makriyannis, A., Nikas, S.P., Khanolkar, A., and Thakur, G.A. (2007). Methods
of preparation and use of novel bicyclic cannabinoids. University of Connect-
icut patent application US20070135388 A1, filed December 12, 2006, and
published June 14, 2007.
structure of the serotonin 5-HT1B receptor coupled to heterotrimeric Go.
Nature 558, 620–623.
Glass, M., and Felder, C.C. (1997). Concurrent stimulation of cannabinoid
CB1 and dopamine D2 receptors augments cAMP accumulation in striatal
neurons: evidence for a Gs linkage to the CB1 receptor. J. Neurosci. 17,
5327–5333.
Mastronarde, D.N. (2005). Automated electron microscope tomography using
robust prediction of specimen movements. J. Struct. Biol. 152, 36–51.
McCoy, A.J., Grosse-Kunstleve, R.W., Adams, P.D., Winn, M.D., Storoni, L.C.,
and Read, R.J. (2007). Phaser crystallographic software. J. Appl. Cryst. 40,
658–674.
Grant, T., Rohou, A., and Grigorieff, N. (2018). cisTEM: user-friendly software
for single-particle image processing. eLife 7, e14874.
Guzma´ n, M. (2003). Cannabinoids: potential anticancer agents. Nat. Rev.
Munro, S., Thomas, K.L., and Abu-Shaar, M. (1993). Molecular characteriza-
Cancer 3, 745–755.
tion of a peripheral receptor for cannabinoids. Nature 365, 61–65.
Hanus, L., Breuer, A., Tchilibon, S., Shiloah, S., Goldenberg, D., Horowitz, M.,
Pertwee, R.G., Ross, R.A., Mechoulam, R., and Fride, E. (1999). HU-308: a
specific agonist for CB(2), a peripheral cannabinoid receptor. Proc. Natl.
Acad. Sci. USA 96, 14228–14233.
Nikas, S.P., Thakur, G.A., Parrish, D., Alapafuja, S.O., Huestis, M.A., and
Makriyannis, A. (2007). A concise methodology for the synthesis of (ꢂ)-D
9-tetrahydrocannabinol and (ꢂ)-D 9-tetrahydrocannabivarin metabolites
and their regiospecifically deuterated analogs. Tetrahedron 63,
8112–8123.
Heymann, J.B. (2001). Bsoft: image and molecular processing in electron
microscopy. J. Struct. Biol. 133, 156–169.
Nikas, S.P., Alapafuja, S.O., Papanastasiou, I., Paronis, C.A., Shukla,
V.G., Papahatjis, D.P., Bowman, A.L., Halikhedkar, A., Han, X., and Mak-
riyannis, A. (2010). Novel 10,10-chain substituted hexahydrocannabinols:
Hua, T., Vemuri, K., Pu, M., Qu, L., Han, G.W., Wu, Y., Zhao, S., Shui, W., Li, S.,
Korde, A., et al. (2016). Crystal Structure of the Human Cannabinoid Receptor
CB1. Cell 167, 750–762.14.
9b-hydroxy-3-(1-hexyl-cyclobut-1-yl)-hexahydrocannabinol (AM2389)
a
highly potent cannabinoid receptor 1 (CB1) agonist. J. Med. Chem. 53,
Hua, T., Vemuri, K., Nikas, S.P., Laprairie, R.B., Wu, Y., Qu, L., Pu, M., Korde,
A., Jiang, S., Ho, J.H., et al. (2017). Crystal structures of agonist-bound human
cannabinoid receptor CB1. Nature 547, 468–471.
6996–7010.
Nikas, S.P., Sharma, R., Paronis, C.A., Kulkarni, S., Thakur, G.A., Hurst, D.,
Wood, J.T., Gifford, R.S., Rajarshi, G., Liu, Y., et al. (2015). Probing the carbox-
yester side chain in controlled deactivation (-)-d(8)-tetrahydrocannabinols.
J. Med. Chem. 58, 665–681.
Huang, J., Rauscher, S., Nawrocki, G., Ran, T., Feig, M., de Groot, B.L.,
Grubmu¨ ller, H., and MacKerell, A.D., Jr. (2017). CHARMM36m: an improved
force field for folded and intrinsically disordered proteins. Nat. Methods
14, 71–73.
Pettersen, E.F., Goddard, T.D., Huang, C.C., Couch, G.S., Greenblatt,
D.M., Meng, E.C., and Ferrin, T.E. (2004). UCSF Chimera–a visualization
system for exploratory research and analysis. J. Comput. Chem. 25,
1605–1612.
Jo, S., Kim, T., Iyer, V.G., and Im, W. (2008). CHARMM-GUI: a web-based
graphical user interface for CHARMM. J. Comput. Chem. 29, 1859–1865.
Kabsch, W. (2010). Integration, scaling, space-group assignment and post-
Ranganathan, A., Dror, R.O., and Carlsson, J. (2014). Insights into the role of
Asp79(2.50) in b2 adrenergic receptor activation from molecular dynamics
simulations. Biochemistry 53, 7283–7296.
refinement. Acta Crystallogr. D Biol. Crystallogr. 66, 133–144.
Koehl, A., Hu, H., Maeda, S., Zhang, Y., Qu, Q., Paggi, J.M., Latorraca, N.R.,
Hilger, D., Dawson, R., Matile, H., et al. (2018). Structure of the m-opioid recep-
tor-Gi protein complex. Nature 558, 547–552.
Rohou, A., and Grigorieff, N. (2015). CTFFIND4: fast and accurate defocus
estimation from electron micrographs. J. Struct. Biol. 192, 216–221.
Krishna Kumar, K., Shalev-Benami, M., Robertson, M.J., Hu, H., Banister,
S.D., Hollingsworth, S.A., Latorraca, N.R., Kato, H.E., Hilger, D., Maeda, S.,
et al. (2019). Structure of a Signaling Cannabinoid Receptor 1-G Protein Com-
plex. Cell 176, 448–458.e12.
Ross, R.A., Brockie, H.C., Stevenson, L.A., Murphy, V.L., Templeton, F., Mak-
riyannis, A., and Pertwee, R.G. (1999). Agonist-inverse agonist characteriza-
tion at CB1 and CB2 cannabinoid receptors of L759633, L759656, and
AM630. Br. J. Pharmacol. 126, 665–672.
Lauckner, J.E., Hille, B., and Mackie, K. (2005). The cannabinoid agonist
WIN55,212-2 increases intracellular calcium via CB1 receptor coupling to
Gq/11 G proteins. Proc. Natl. Acad. Sci. USA 102, 19144–19149.
Ryckaert, J.P.C., Ciccotti, G., and Berendsen, H.J.C. (1977). Numerical
integration of the cartesian equations of motion of
a system with
constrains: Molecular dynamics of n-alkanes. J. Comp. Physiol. 23,
Lemberger, L. (1980). Potential therapeutic usefulness of marijuana. Annu.
327–341.
Rev. Pharmacol. Toxicol. 20, 151–172.
Sastry, G.M., Adzhigirey, M., Day, T., Annabhimoju, R., and Sherman, W.
(2013). Protein and ligand preparation: parameters, protocols, and influ-
ence on virtual screening enrichments. J. Comput. Aided Mol. Des. 27,
221–234.
Li, X., Hua, T., Vemuri, K., Ho, J.H., Wu, Y., Wu, L., Popov, P., Benchama, O.,
Zvonok, N., Locke, K., et al. (2019). Crystal Structure of the Human Cannabi-
noid Receptor CB2. Cell 176, 459–467.e13.
Liu, Y., Ji, L., Eno, M., Kudalkar, S., Li, A.L., Schimpgen, M., Benchama, O.,
Morales, P., Xu, S., Hurst, D., et al. (2018). ( R)- N-(1-Methyl-2-hydrox-
Savinainen, J.R., Saario, S.M., Niemi, R., Ja¨ rvinen, T., and Laitinen, J.T. (2003).
An optimized approach to study endocannabinoid signaling: evidence against
constitutive activity of rat brain adenosine A1 and cannabinoid CB1 receptors.
Br. J. Pharmacol. 140, 1451–1459.
yethyl)-13-( S)-methyl-arachidonamide (AMG315):
A Novel Chiral Potent
Endocannabinoid Ligand with Stability to Metabolizing Enzymes. J. Med.
Chem. 61, 8639–8657.
Scheres, S.H. (2012). RELION: implementation of a Bayesian approach to
Lunn, C.A., Reich, E.P., Fine, J.S., Lavey, B., Kozlowski, J.A., Hipkin,
R.W., Lundell, D.J., and Bober, L. (2008). Biology and therapeutic poten-
tial of cannabinoid CB2 receptor inverse agonists. Br. J. Pharmacol. 153,
226–239.
cryo-EM structure determination. J. Struct. Biol. 180, 519–530.
Shao, Z., Yin, J., Chapman, K., Grzemska, M., Clark, L., Wang, J., and Rose-
nbaum, D.M. (2016). High-resolution crystal structure of the human CB1
cannabinoid receptor. Nature 540, 602–606.
Maeda, S., Qu, Q., Robertson, M.J., Skiniotis, G., and Kobilka, B.K. (2019).
Structures of the M1 and M2 muscarinic acetylcholine receptor/G-protein
complexes. Science 364, 552–557.
Sharma, R., Nikas, S.P., Paronis, C.A., Wood, J.T., Halikhedkar, A., Guo, J.J.,
Thakur, G.A., Kulkarni, S., Benchama, O., Raghav, J.G., et al. (2013).
10 Cell 180, 1–11, February 20, 2020

Please cite this article in press as: Hua et al., Activation and Signaling Mechanism Revealed by Cannabinoid Receptor-Gi Complex Structures,
Cell (2020), https://doi.org/10.1016/j.cell.2020.01.008
Controlled-deactivation cannabinergic ligands. J. Med. Chem. 56,
Yuan, S., Filipek, S., and Vogel, H. (2016). A Gating Mechanism of the Seroto-
10142–10157.
nin 5-HT3 Receptor. Structure 24, 816–825.
Smart, O.S., Womack, T.O., Flensburg, C., Keller, P., Paciorek, W., Sharff, A.,
Vonrhein, C., and Bricogne, G. (2012). Exploiting structure similarity in refine-
ment: automated NCS and target-structure restraints in BUSTER. Acta
Crystallogr. D Biol. Crystallogr. 68, 368–380.
Zhang, K. (2016). Gctf: Real-time CTF determination and correction. J. Struct.
Biol. 193, 1–12.
Zheng, C., Chen, L., Chen, X., He, X., Yang, J., Shi, Y., and Zhou, N. (2013). The
second intracellular loop of the human cannabinoid CB2 receptor governs G
protein coupling in coordination with the carboxyl terminal domain. PLoS
ONE 8, e63262.
´
´
Vallee, M., Vitiello, S., Bellocchio, L., Hebert-Chatelain, E., Monlezun, S., Mar-
tin-Garcia, E., Kasanetz, F., Baillie, G.L., Panin, F., Cathala, A., et al. (2014).
Pregnenolone can protect the brain from cannabis intoxication. Science
343, 94–98.
Zheng, S.Q., Palovcak, E., Armache, J.P., Verba, K.A., Cheng, Y., and
Agard, D.A. (2017). MotionCor2: anisotropic correction of beam-induced
motion for improved cryo-electron microscopy. Nat. Methods 14,
331–332.
Venkatakrishnan, A.J., Deupi, X., Lebon, G., Tate, C.G., Schertler, G.F., and
Babu, M.M. (2013). Molecular signatures of G-protein-coupled receptors.
Nature 494, 185–194.
Yuan, S., Filipek, S., Palczewski, K., and Vogel, H. (2014). Activation of
G-protein-coupled receptors correlates with the formation of a continuous in-
ternal water pathway. Nat. Commun. 5, 4733.
Zoete, V., Cuendet, M.A., Grosdidier, A., and Michielin, O. (2011). Swiss-
Param: a fast force field generation tool for small organic molecules. J. Com-
put. Chem. 32, 2,359–2,368.
Cell 180, 1–11, February 20, 2020 11

Please cite this article in press as: Hua et al., Activation and Signaling Mechanism Revealed by Cannabinoid Receptor-Gi Complex Structures,
Cell (2020), https://doi.org/10.1016/j.cell.2020.01.008
STAR+METHODS
KEY RESOURCES TABLE
REAGENT or RESOURCE
SOURCE
Roche
IDENTIFIER
Chemicals, Peptides, and Recombinant Proteins
EDTA-free complete protease inhibitor
cocktail tablets
Cat#5056489001
Iodoacetamide
Sigma
Cat#I1149
Lauryl Maltose Neopentyl Glycerol (LMNG)
Anatrace
Cat#4216588
Cat#C6512
Cat#77720
Cholesterol hemisucinate (CHS)
Sigma
TCEP
Thermo Fisher Scientific
New England Biolabs
Anatrace
Apyrase
Cat#M0398S
Cat#GDN101
GDN (glycol-diosgenin): Synthetic Digitonin
Substitute
Ethylenediamine Tetraacetic Acid (EDTA)
Fisher Scientific
Invitrogen
Cat#S311-500
Cat#D10251
N-[4-(7-diethylamino-4-methyl-3-
coumarinyl)phenyl]maleimide (CPM)
TALON IMAC resin
1-Oleoyl-rac-glycerol (monoolein)
Magnesium Chloride
Protein Assay Dye
Cholesterol
Clontech
Sigma
Cat#635507
Cat#M7765
Cat#BP214-500
5000006
Fisher Scientific
Biorad
Sigma
Cat#C8667
Cat#0949
N/A
CP55,940
Tocris
AM12033
This paper
This paper
AM841
[3H]CP55,940
N/A
NIDA Drug Supply
Program
NOCD-092
SR144528
NIDA Drug Supply
Program
NOCD-085
4-methyl-5-phenyl-1H-pyrazole-3-carboxylic acid
ChemBridge
Sigma-Aldrich
Sigma-Aldrich
4036397
138576
12806
1-adamantylamine
O-(benzotriazol-1-yl)-N,N,N’,N’-tetramethyluronium
tetrafluoroborate
Hu¨ nig’s base
Sigma-Aldrich
Sigma-Aldrich
Sigma-Aldrich
Sigma-Aldrich
Sigma-Aldrich
Sigma-Aldrich
Biotage
D125806
452912
Sodium Hydride
5-Bromo-1-pentanol
N,N-Dimethylformamide
dichloromethane
sodium sulfate
670855
227056
D65100
239313
silica gel columns
FSUL-0442
Critical Commercial Assays
HTRF HiRange cAMP Assay Kit
PathHunter Detection Kit
CISBIO
DiscoveRx
NEB
Cat# 62AM6PEC
Cat#93-0001
Cat#E0554S
Cat#639684
Q5 site directed mutagenesis kit
In-Fusionꢀ HD EcoDryTM Cloning System
Clontech
Deposited Data
CB2_AM12033 complex structure
CB2-Gi EM map
This paper
This paper
This paper
PDB: 6KPC
PDB: 6KPF
PDB: 6KPG
CB1-Gi EM map
(Continued on next page)
e1 Cell 180, 1–11.e1–e13, February 20, 2020

Please cite this article in press as: Hua et al., Activation and Signaling Mechanism Revealed by Cannabinoid Receptor-Gi Complex Structures,
Cell (2020), https://doi.org/10.1016/j.cell.2020.01.008
Continued
REAGENT or RESOURCE
SOURCE
IDENTIFIER
Experimental Models: Cell Lines
Spodoptera frugiperda (Sf9)
HEK293F human cell line
Expression Systems
Expression Systems
N/A
CRL-1573
Primers for Site-Direct Mutagenesis
G78L_forward:TTGGCTCTGGCTGACTTC
G78L_reverse:GCTGCCAATGAACAGGTATG
T127A_forward:GCTGGCCGCCATTGA
T127A_reverse:AGGAGGCTACCCACAGA
T153L_forward:GGTGCTCCTGGGCATC
T153L_reverse:AGTGCCCTTCCACGG
This paper
This paper
This paper
This paper
This paper
This paper
This paper
N/A
N/A
N/A
N/A
N/A
N/A
N/A
G210A_forward: ATCATCTACACCTATGCCCAC
GTGCTCTGGAAG
G210A_reverse: CTTCCAGAGCACGTGGGCATA
GGTGTAGATGAT
This paper
N/A
R242E_forward:GATGTGGAGTTGGCCAAGAC
R242E_reverse:CAGCCTCATTCGGGCC
This paper
This paper
This paper
This paper
N/A
N/A
N/A
N/A
G304E_forward:GAGTGAAGAGATCCGCTCC
G304E_reverse:CGTAGAGCATAGATGACAGGG
Recombinant DNA
pFastBac1-CB2
pTT5-CB1
This paper
This paper
This paper
This paper
This paper
N/A
N/A
N/A
N/A
N/A
pFastBac1-Ga
pFastBacDual-Gbg
pFastBac1-scFv16
Software and Algorithms
¨
Schrodinger Suite 2015-4
¨
Schrodinger
https://www.schrodinger.com
www.gromacs.org
GROMACS 5.1.2
SwissParam
XDS
Abraham et al., 2015
Zoete et al., 2011
Kabsch, 2010
www.swissparam.ch
Xds.mpimf-heidelberg.mpg.de
www.ccp4.ac.uk/html/scala.html
SCALA
Phaser
Phenix
Buster
COOT
McCoy et al., 2007
Adams et al., 2010
Smart et al., 2012
Emsley et al., 2010
www.phenix-online.org
www.phenix-online.org
www.globalphasing.com/buster
https://www2.mrc-lmb.cam.ac.uk/personal/
pemsley/coot
SerialEM
MotionCor2
CTFFIND4
Relion
Mastronarde, 2005
http://bio3d.colorado.edu/SerialEM/
https://emcore.ucsf.edu/ucsf-motioncor2
https://grigoriefflab.janelia.org/ctffind4
Zheng et al., 2017
Rohou and Grigorieff, 2015
https://www2.mrc-lmb.cam.ac.uk/relion/index.php?
title = Download_&_install
Fernandez-Leiro and
Scheres, 2017
CisTEM
Grant et al., 2018
https://cistem.org/
N/A
Prism v.7.0
GraphPad Software
Other
Solid white 384-well assay plates
Low-volume (20 mL) 384-well assay plates
DMEM/F-12 (1:1) cell culture media
VWR
Cat#82051-278 (CS)
Cat#784080
VWR
Invitrogen
Cat#11330-057
(Continued on next page)
Cell 180, 1–11.e1–e13, February 20, 2020 e2

Please cite this article in press as: Hua et al., Activation and Signaling Mechanism Revealed by Cannabinoid Receptor-Gi Complex Structures,
Cell (2020), https://doi.org/10.1016/j.cell.2020.01.008
Continued
REAGENT or RESOURCE
Opti-MEM cell culture media
FreeStyleTM 293 Expression Medium
DMEM
SOURCE
IDENTIFIER
Invitrogen
Cat#11058-021
Cat#12338-026
Cat#11965-118
Cat#11095-098
N/A
Life Technologies
Invitrogen
MEM
Invitrogen
Phoenix package system
Penicillin/Streptomycin
Puromycin
Stanford University
Invitrogen
Cat#15140-122
Cat#A11138-03
Cat#10687-010
Cat#10131-035
Cat#BP1605100
Invitrogen
Hygromycin B
Life Technologies
Life Technologies
Fisher Scientific
Geneticin
Bovine Serum Albumin, Fraction V, Cold-ethanol
Precipitated
Trypsin 0.5% EDTA
Invitrogen
Invitrogen
Sigma
Cat#25300-120
Cat#14190250
Cat#D8417
Dulbecco’s phosphate-buffered saline (DPBS)
4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI)
Fetal Bovine Serum (FBS)
Life Technologies
MatTek
Cat#16140089
Cat#P35G-10-14-C
Cat#CB40231
Cat#VS0642
Glass bottom dishes-uncoated (confocal plates)
Collagen I
Fisher
100kDa cutoff concentrators
Sartorius
PD Minitrap G-25 coulmn
GE Healthcare
NOVA
Cat#28-9180-07
Cat#NOA90020
11668027
96-well glass sandwich plates for LCP crystallization
Lipofectamineꢀ 2000
Thermo Scientific
PerkinElmer
Corning
96-well white microplate with bonded GF/B filter
500 cm2 Square Cell Culture Dish
Cat#6005177
Cat#431110
LEAD CONTACT AND MATERIALS AVAILABILITY
Further information and requests for reagents may be directed to, and will be fulfilled by the Lead Contact, Zhi-Jie Liu (liuzhj@
shanghaitech.edu.cn). All unique/stable reagents generated in this study will be made available on request but we may require a
payment and a completed Materials Transfer Agreement if there is potential for commercial application.
EXPERIMENTAL MODEL AND SUBJECT DETAILS
Cell lines
Spodoptera frugiperda (Sf9) cells were used for CB2 expression, crystallization, and co-expression of G protein for cryo-EM study.
Sf9 cells were grown in ESF 921 medium (Expression systems) at 27ꢁC and 125 rpm. Binding and functional experiments were
performed with either CHO-K1 cell lines (ATCC, female) or U2OS cell lines (PathHunter EA Parental Cell lines, female, DiscoveRx).
CHO-K1 cells were maintained in DMEM/F12 media supplemented with 10% fetal bovine serum (FBS), 1% penicillin/streptomycin,
and 5 mg/mL puromycin for stable cell line selection (Invitrogen, Waltham, MA). U2OS cells were selected by geneticin selection
(500 mg/mL) in MEM media supplemented with 10% FBS, 1% penicillin/streptomycin and 250 mg/mL hygromycin.
METHOD DETAILS
Synthesis and Characterization of AM12033
All reagents and solvents were purchased from Sigma-Aldrich Chemicals company, unless otherwise specified, and used without
further purification. All anhydrous reactions were performed under a static argon atmosphere in flame-dried glassware using scru-
pulously dry solvents. Flash column chromatography employed silica gel 60 (230-400 mesh). All compounds were demonstrated to
be homogeneous by analytical TLC on pre-coated silica gel TLC plates (Merck, 60 F245 on glass, layer thickness 250 mm), and chro-
matograms were visualized by phosphomolybdic acid staining. Melting points were determined on a micro-melting point apparatus
and are uncorrected. IR spectra were recorded on a Perkin Elmer Spectrum One FT-IR spectrometer. Peak strength is indicated as br
(broad), w (weak), and s (strong). NMR spectra were recorded in CDCl3, unless otherwise stated, on a Bruker Ultra Shield 400 WB plus
(1H at 400 MHz, 13C at 100 MHz) or on a Varian INOVA-500 (1H at 500 MHz, 13C at 125 MHz) spectrometers and chemical shifts are
reported in units of d relative to internal TMS. Multiplicities are indicated as br (broadened), s (singlet), d (doublet), t (triplet), q (quartet),
e3 Cell 180, 1–11.e1–e13, February 20, 2020

Please cite this article in press as: Hua et al., Activation and Signaling Mechanism Revealed by Cannabinoid Receptor-Gi Complex Structures,
Cell (2020), https://doi.org/10.1016/j.cell.2020.01.008
qt (quintet) or m (multiplet). Coupling constants (J) are reported in hertz (Hz). Low and high-resolution mass spectra were performed in
School of Chemical Sciences, University of Illinois at Urbana-Champaign. Mass spectral data are reported in the form of m/z (intensity
relative to base = 100). LC/MS analysis was performed by using a Waters MicroMass ZQ system [electrospray-ionization (ESI) with
Waters-2525 binary gradient module coupled to a Photodiode Array Detector (Waters-2996) and ELS detector (Waters-2424) using a
XTerra MS C18, 5 mm, 4.6 mm x 50 mm column and acetonitrile/water].
2-(3,5-Dimethoxyphenyl)-2-methylpropanenitrile (2) (Sharma et al., 2013)
To a stirred suspension of sodium hydride (3.09 g, 128.6 mmol) in dry DMF (80 mL) at 0ꢁC under an argon atmosphere was added
dropwise a mixture of 1 (7.08 g, 40.0 mmol) and iodomethane (8.0 mL, 128.6 mmol) in dry DMF (4.2 mL). The reaction temperature
was rose to 25ꢁC over a 15 min period and stirring was continued for 2 h. The reaction mixture was quenched with saturated aqueous
NH4Cl solution and diluted with diethyl ether. The organic layer was separated and the aqueous layer was extracted with diethyl ether.
The combined organic layer was washed with water and brine, dried (MgSO4), and concentrated in vacuo. Purification by flash
column chromatography on silica gel (25% ethyl acetate in hexane) gave the title compound (7.86 g, 96% yield) as a colorless oil.
IR (neat) 2950, 2840, 2234 (w, CN), 1532, 1438, 1319, 1204, 788 cm-1. 1H NMR (500 MHz, CDCl3) d 6.61 (d, J = 2.0 Hz, 2H, Ar-H),
6.40 (t, J = 2.0 Hz, 1 H, Ar-H), 3.81 (s, 6 H, -OCH3), 1.71 (s, 6 H, -C(CH3)2-); Mass spectrum (ESI) m/z (relative intensity) 206
(M++H, 100).
2-(3,5-Dimethoxyphenyl)-2-methylpropanal (3)(Nikas et al., 2015)
To a stirred solution of 2 (6.46 g, 31.5 mmol) in anhydrous CH2Cl2 (220 mL) at –78ꢁC, under an argon atmosphere was added 1 M
solution of DIBAL-H in Hexane (94 mL) dropwise and the reaction mixture was stirred for additional 30 min. The reaction mixture was
then quenched by dropwise addition of potassium sodium tartrate (10% w/w solution in water) at – 78ꢁC. Following the addition, the
mixture was warmed to room temperature, stirred for an additional 50 min and then diluted with ethyl acetate. The organic phase was
separated, and the aqueous phase was extracted with ethyl acetate. The combined organic layer was washed with brine, dried
(MgSO4), and the solvent was evaporated under reduced pressure. The crude product was purified by flash chromatography on silica
gel (10%–35% ethyl acetate in hexane) to give 6.03 g of 3 as colorless oil in 92% yield. IR (neat) 2938, 2838, 2705 (w, CHO), 1725 (s, >
C = O), 1595, 1457, 1424, 1314, 1205, 1156, 1066, 835 cm-1. 1H NMR (500 MHz, CDCl3) d 9.46 (s, 1H, -CHO), 6.40 (d, J = 2.0 Hz, 2H,
2-H, 6-H), 6.39 (t, J = 2.0 Hz, 1H, 4-H), 3.78 (s, 6H, -OMe), 1.43 (s, 6H, -C(CH3)2-). 13C NMR (100 MHz CDCl3) d 201.6 (-CHO), 161.1
(ArC), 143.6 (ArC), 105.1 (ArC), 98.6 (ArC), 65.7 (> (C)CHO), 55.2 (-OCH3), 50.5, 22.3. Mass spectrum (EI) m/z (relative intensity) 208
(M+, 25), 196 (16), 179 (M+-CHO), 165 (25), 151 (14), 139 (39), 91 (20), 77 (20). Exact mass (EI) calculated for C12H16O3 (M+), 208.10995;
found, 208.11077.
(Z)-1,3-Dimethoxy-5-(2-methyl-7-phenoxyhept-3-en-2-yl)benzene (4)(Makriyannis et al., 2014)
To a stirred suspension of (4-phenoxybutyl)triphenylphosphonium bromide (15)(Nikas et al., 2010) (43.32 g, 88.4 mmol) in dry THF
(540 mL) at 0ꢁC, under an argon atmosphere was added potassium bis(trimethylsilyl)amide (17.40 g, 87.1 mmol). The mixture was
stirred for 30 min at 10ꢁC to ensure complete formation of the orange phosphorane. A solution of aldehyde 3 (6.82 g, 32.8 mmol)
in 8.6 mL THF was added dropwise to the resulting slurry, at 0ꢁC. The reaction was stirred for 20 min at room temperature and
upon completion was quenched by the addition of saturated aqueous NH4Cl solution. The organic layer was separated and the
aqueous phase was extracted with diethyl ether. The combined organic layer was washed with brine and dried (MgSO4) and the sol-
vent was evaporated under reduced pressure. The residue was purified on a silica gel (5%–15% diethyl ether in hexanes) to give
10.68 g of compound 4 as colorless oil in 96% yield. IR (neat) 2960, 2836, 1595, 1422, 1244, 1204, 1153, 1051, 753, 692 cm-1. 1H
NMR (500 MHz, CDCl3) d 7.29-7.21 (m, 2H, 3-H, 5-H of -OPh), 6.91 (t, J = 7.3 Hz, 1H, 4-H of -OPh), 6.81 (d, J = 7.3 Hz, 2H, 2-H,
6-H of -OPh), 6.56 (d, J = 2.2 Hz, 2H, 2-H, 6-H), 6.28 (t, J = 2.2 Hz, 1H, 4-H), 5.69 (dt, J = 11.4, 1.7 Hz, 1H, 20-H), 5.31 (dt, J =
11.4, 7.4 Hz, 1H, 30-H), 3.77 (s, 6H, -OMe), 3.69 (t, J = 6.7 Hz, 2H, 60-H), 1.83 (qd, J = 7.4, 1.7 Hz, 2H, 40-H), 1.63 (qt, J = 7.0 Hz,
Cell 180, 1–11.e1–e13, February 20, 2020 e4

Please cite this article in press as: Hua et al., Activation and Signaling Mechanism Revealed by Cannabinoid Receptor-Gi Complex Structures,
Cell (2020), https://doi.org/10.1016/j.cell.2020.01.008
2H, 50-H), 1.40 (s, 6H, -C(CH3)2-). 13C NMR (100 MHz CDCl3) d 160.6 (ArC), 159.1 (ArC), 153.3 (ArC), 140.4 (> C = C < ), 130.3 (> C =
C < ), 129.4 (ArC), 120.5 (ArC), 114.6 (ArC), 105.0 (ArC), 97.0 (ArC), 67.3 (C-60), 55.3 (-OCH3), 40.4, 31.4, 29.0, 24.9. Mass spectrum
(ESI) m/z (relative intensity) 341 (M++H, 100), 247 (M++H-OPh, 30). LC/MS analysis (Waters MicroMass ZQ system) showed retention
time of 5.6 min for the title compound.
1,3-Dimethoxy-5-(2-methyl-7-phenoxyheptan-2-yl)benzene (5)(Makriyannis et al., 2014)
To a solution of 4 (6.85 g, 20.2 mmol) in ethyl acetate (200 mL) was added 10% w/w Pd/C (690 mg) and the resulting suspension
stirred vigorously for 2.5 h under hydrogen atmosphere at room temperature. The catalyst was removed by filtration through celite,
and the filtrate was evaporated under reduced pressure to afford 6.77 g of the crude product 5 as colorless oil, in 98% yield which was
used in the next step without further purification. IR (neat) 2936, 2861, 1598, 1497, 1457, 1422, 1244, 1204, 1155, 1053, 832, 754,
692 cm-1. 1H NMR (400 MHz, CDCl3) d 7.28-7.21 (m, 2H, 3-H, 5-H of -OPh), 6.99-6.88 (m, 1H, 4-H of -OPh), 6.87-6.83 (m, 2H,
2-H, 6-H of -OPh), 6.49 (d, J = 2.3 Hz, 2H, 2-H, 6-H), 6.30 (t, J = 2.3 Hz, 1H, 4-H), 3.87 (t, J = 6.5 Hz, 2H, 60-H), 3.78
(s, 6H, -OMe), 1.74-1.65 (m, 2H, -CH2- of the side chain), 1.63-1.56 (m, 2H, -CH2- of the side chain), 1.41-1.32 (m, 2H, -CH2- of
the side chain), 1.30-1.22 (s, 6H, -C(CH3)2-), 1.18-1.09 (m, 2H, -CH2- of the side chain); 13C NMR (100 MHz CDCl3) d 160.6 (ArC),
159.2 (ArC), 152.5 (ArC), 129.5 (ArC), 120.6 (ArC), 114.6 (ArC), 104.8 (ArC), 96.8 (ArC), 67.9 (C-60), 55.3 (-OCH3), 44.5, 38.1, 29.3,
29.1, 26.8, 24.6. Mass spectrum (ESI) m/z (relative intensity) 343 (M++H, 100). LC/MS analysis (Waters MicroMass ZQ system)
showed retention time of 5.7 min for the title compound.
5-(7-Bromo-2-methylheptan-2-yl)benzene-1,3-diol (6)(Makriyannis et al., 2007; Makriyannis et al., 2014)
To a stirred solution of 5 (4.60 g, 13.4 mmol) in dry CH2Cl2 (75 mL), at ꢂ78ꢁC, under an argon atmosphere, was added 1M boron
tribromide solution in CH2Cl2 (59.1 mL, 59.1 mmol) dropwise. Following the addition, the reaction mixture was gradually warmed to
room temperature and the stirring was continued at that temperature until completion of the reaction (3 h). The reaction mixture was
quenched by the addition of MeOH (75 mL), warmed to room temperature and volatiles were removed in vacuo. The residue was
diluted with ethyl acetate and washed sequentially with saturated aqueous NaHCO3 solution, water and brine. The organic layer
was dried over MgSO4, filtered and concentrated under reduced pressure. Purification by flash column chromatography on silica
gel (10%–35% ethyl acetate in hexanes) afforded 3.98 g of 6 as a white foam in 99% yield. IR (neat) 3323 (br, OH), 2934, 2860,
1599, 1507, 1461, 1438, 1330, 1150, 992, 842, 698 cm-1; 1H NMR (500 MHz, CDCl3) d 6.37 (s, J = 2.0 Hz, 2H, 2-H, 6-H) 6.17
(t, J = 2.0 Hz, 1H, 4-H), 4.80 (br s, 2H, -OH), 3.34 (t, J = 7.0 Hz, 2H, 60-H), 1.78 (qt, J = 6.9 Hz, 2H, -CH2- of the side chain), 1.58-
1.49 (m, 2H, -CH2- of the side chain), 1.38-1.28 (m, 2H, -CH2- of the side chain), 1.23 (s, 6H, -C(CH3)2-), 1.12-1.02 (m, 2H, -CH2-
13
of the side chain); C NMR (100 MHz CDCl3) d 156.2 (ArC), 153.4 (ArC), 106.1 (ArC), 100.3 (ArC), 66.2 (C-60), 44.2, 37.8, 34.3,
32.7, 28.9, 23.9, 15.0. Mass spectrum (ESI) m/z (relative intensity) 301 (M++H, 100). LC/MS analysis (Waters MicroMass ZQ system)
showed retention time of 4.6 min for the title compound.
(1R,4R,5R)-4-[4-(7-Bromo-2-methylheptan-2-yl)-2,6-dihydroxyphenyl]-6,6-dimethylbicyclo[3.1.1]heptan-2-one
(7)(Makriyannis et al., 2007)
To a degassed solution of 6 (4.71 g, 15.7 mmol) and p-toluenesulfonic acid monohydrate (4.79 g, 25.1 mmol) in wet CHCl3 (250 mL)
diacetates 18 (6.51 g, ca. 90% pure by 1H NMR, 25.1 mmol(Nikas et al., 2007) was added at 0ꢁC, under an argon atmosphere. The
mixture was warmed to room temperature and stirred for 4 d to ensure complete formation of the product. The reaction mixture was
diluted with diethyl ether and washed sequentially with water, saturated aqueous NaHCO3 solution, and brine. The organic phase
was dried over MgSO4 and the solvent was removed under reduced pressure. The residue was chromatographed on silica gel
(15%–50% diethyl ether in hexane) and fractions containing almost pure product (TLC) were combined and evaporated. Further pu-
rification by recrystallization from CHCl3 and hexane gave 7 as a white crystalline solid (4.03 g, 59% yield), mp 82-85ꢁC; IR (neat) 3350
e5 Cell 180, 1–11.e1–e13, February 20, 2020

Please cite this article in press as: Hua et al., Activation and Signaling Mechanism Revealed by Cannabinoid Receptor-Gi Complex Structures,
Cell (2020), https://doi.org/10.1016/j.cell.2020.01.008
(br, OH), 2933, 2868, 1683 (s, > C = O), 1621, 1586, 1419, 1266, 1021, 837, 739, 672 cm-1. 1H NMR (500 MHz, CDCl3) d 6.28 (s, 2H,
Ar-H), 5.34 (br s, 2H, OH), 3.95 (t, J = 8.2 Hz, 1H, 4-H), 3.52 (dd, J = 18.8, 7.7 Hz, 1H, 3a-H), 3.35 (t, J = 6.8 Hz, 2H, 60-H), 2.67-2.58
(m, 2H, 3b-H, 1-H), 2.55-2.44 (m, 2H, 7a-H, 7b-H), 2.32 (t, J = 5.5 Hz, 1H, 5-H), 1.78 (qt, J = 6.9 Hz, 2H, -CH2- of the side chain),
1.53-1.47 (m, 2H, -CH2- the side chain group), 1.37-1.30 (s and m overlapping, 5H, 6-Me, -CH2- of the side chain, especially
1.36, s, 3H, 6-Me), 1.20 (s, 6H, -C(CH3)2-), 1.13-1.04 (m, 2H, -CH2- of the side chain), 0.99 (s, 3H, 6-Me). 13C NMR (100 MHz
CDCl3) d 217.3 (> C = O), 155.0 (ArC), 149.7 (ArC), 113.8 (ArC), 106.7 (ArC), 58.1, 46.9, 44.3, 42.3, 38.1, 37.4, 34.1, 32.8, 29.7,
29.0, 28.8, 26.3, 24.6, 24.0, 22.3. Mass spectrum (ESI) m/z (relative intensity) 437 (M++H, 100), 367 (30). LC/MS analysis (Waters
MicroMass ZQ system) showed retention time of 5.1 min for the title compound.
(6aR,10aR)-3-(7-Bromo-2-methylheptan-2-yl)-1-hydroxy-6,6-dimethyl-6,6a,7,8,10,10a-hexahydro-9H-benzo[c]
chromen-9-one (8)
To a stirred solution of 7 (2.04 g, 4.68 mmol) in anhydrous CH2Cl2/CH3NO2 (3:1 mixture, 156 mL) at 0ꢁC, under an argon atmo-
sphere was added trimethylsilyl trifluoromethanesulfonate (4.68 mL, 0.3 M solution in CH3NO2, 1.56 mmol). Stirring was continued
for 3 h after the temperature allowed to rise to 25ꢁC. The reaction was quenched with a mixture of saturated aqueous NaHCO3/brine
(1:1), and diethyl ether was added. The organic phase was separated, the aqueous phase was extracted with diethyl ether, and the
combined organic phase was washed with brine and dried over MgSO4. Solvent evaporation and purification by flash column chro-
matography on silica gel (15%–30% ethyl acetate-hexane) afforded 1.43 g (75% yield) of the title compound 8 as white foam. IR (neat)
3306 (br, OH), 2935, 2871, 1695 (s, > C = O), 1621, 1576, 1416, 1337, 1139, 1094, 1040, 970, 839 cm-1. 1H NMR (500 MHz, CDCl3)
d 6.37 (d, J = 1.9 Hz, 1H, Ar-H), 6.28 (d, J = 1.9 Hz, 1H, Ar-H), 6.17 (br s, 1H, OH), 4.00 (m as br d, J = 15.1 Hz, 1H, 10eq-H), 3.34 (t, J =
6.9 Hz, 2H, 60-H), 2.89 (m as td, J = 12.9, 3.5 Hz, 1H, 10a-H), 2.65-2.58 (m, 1H, 8eq-H), 2.50-2.41 (m, 1H, 8ax-H), 2.20-2.12 (m, 2H,
10ax-H, 7eq-H), 1.97 (m as td, J = 11.8, 2.5 Hz, 1H, 6a-H), 1.79 (qt, J = 7.0 Hz, 2H of -CH2- of the side chain), 1.55-1.44 (m and s
overlapping, 6H, 7ax-H, -CH2- of the side chain, 6-Me, especially 1.48, s, 3H, 6-Me), 1.33 (qt, J = 7.5 Hz, 2H, -CH2- of the side chain),
1.21 (s, 6H, -C(CH3)2-), 1.13 (s, 3H, 6-Me), 1.12-1.04 (m, 2H, -CH2- of the side chain). 13C NMR (100 MHz CDCl3) d 214.6 (> C = O),
155.2 (ArC), 154.4 (ArC), 150.5 (ArC), 107.9 (ArC), 107.2 (ArC), 105.6 (ArC), 47.5, 45.1, 44.2, 40.9, 37.5, 34.9, 34.1, 32.8, 28.9, 29.0,
28.9, 28.0, 27.0, 26.9, 19.0. Mass spectrum (ESI) m/z (relative intensity) 437 (M++H, 100). LC/MS analysis (Waters MicroMass ZQ
system) showed retention time of 5.3 min for the title compound.
(6aR,10aR)-3-(7-Bromo-2-methylheptan-2-yl)-1-[(tert-butyldimethylsilyl)oxy]-6,6-dimethyl-6,6a,7,8,10,10a-
hexahydro-9H-benzo[c]chromen-9-one (9)
To a solution of 8 (2.52 g, 5.8 mmol) in anhydrous CH2Cl2 (12 mL) under an argon atmosphere were added sequentially, imidazole
(395 g, 5.8 mmol), DMAP (73 mg, 0.6 mmol) and TBDMSCl (870 mg, 5.8 mmol). The reaction mixture was stirred room temperature for
12 h. The reaction mixture was diluted with diethyl ether and washed sequentially with 1M aqueous HCl solution, saturated aqueous
NaHCO3 solution, water and brine. The organic phase was dried over MgSO4 and the solvent was removed under reduced pressure.
Purification by flash column chromatography on silica gel (10%–30% diethyl ether in hexane) afforded 2.65 g (83% yield) of 9 as a
colorless oil. IR (neat) 2931, 2859, 1713(s, > C = O), 1613, 1564, 1412, 1332, 1254, 1137, 1096, 1055, 980, 839 cm-1; 1H NMR (500
MHz,CDCl3) d 6.41 (d, J = 1.9 Hz, 1H, Ar-H), 6.33 (d, J = 1.9 Hz, 1H, Ar-H), 3.77 (ddd, J = 14.9, 3.4, 2.0 Hz, 1H, 10eq-H), 3.33 (t, J =
6.9 Hz, 2H, 60-H), 2.72 (m as td, J = 12.8, 3.4 Hz, 1H, 10a-H), 2.59-2.52 (m, 1H, 8eq-H), 2.46-2.35 (m, 1H, 8ax-H), 2.2-2.07 (m, 2H,
10ax-H, 7eq-H), 1.95 (m as td, J = 12.5, 3.4 Hz, 1H, 6a-H), 1.78 (qt, J = 6.8 Hz, 2H of -CH2- of the side chain), 1.55-1.44 (m and s
overlapping, 6H, 6-Me, 7ax-H, -CH2- of the side chain and especially 1.47, s, 3H, 6-Me), 1.33 (qt, J = 6.8 Hz, 2H, -CH2- of the
side chain), 1.21 (s, 3H, -C(CH3)2-), 1.20 (s, 3H, -C(CH3)2-), 1.10-1.03 (m, 2H, -CH2- of the side chain and s, 3H, 6-Me), 1.00
(s, 9H, Si(Me)2CMe3), 0.24 (s, 3H, Si(Me)2CMe3), 0.16 (s, 3H, Si(Me)2CMe3). 13C NMR (100 MHz CDCl3) d 210.4 (> C = O), 154.8
(ArC-1 or ArC-5), 154.3 (ArC-5 or ArC-1), 149.8 (tertiary aromatic), 112.2 (tertiary aromatic), 109.9 (ArC-2 or ArC-4), 108.5 (ArC-4
or ArC-2), 47.9, 45.7, 44.4, 40.9, 37.5, 35.3, 34.0, 32.9, 29.0, 28.9, 28.8, 28.6, 27.9, 26.2, 25.8, 24.1, 18.8, 18.5, ꢂ3.5, ꢂ3.9. Mass
spectrum (ESI) m/z (relative intensity) 551 (M++H, 100). LC/MS analysis (Waters MicroMass ZQ system) showed retention time of
6.6 min for the title compound.
Cell 180, 1–11.e1–e13, February 20, 2020 e6

Please cite this article in press as: Hua et al., Activation and Signaling Mechanism Revealed by Cannabinoid Receptor-Gi Complex Structures,
Cell (2020), https://doi.org/10.1016/j.cell.2020.01.008
{[(6aR,10aR)-3-(7-Bromo-2-methylheptan-2-yl)-9-(methoxymethylene)-6,6-dimethyl-6a,7,8,9,10,10a-hexahydro-6H-
benzo[c]chromen-1-yl]oxy}. (tert-butyl)dimethylsilane (10)
(Methoxymethyl)triphenyl phosphonium chloride (4.31 g, 12.6 mmol) was suspended in 21 mL of dry THF. Potassium bis(trimethyl-
silyl)amide (2.42 g, 12.2 mmol) was then added at 0ꢁC, and the reaction mixture was stirred for 20 min at 0ꢁC and for 15 min at room
temperature. Intermediate 9 (1.16 g, 2.1 mmol) was dissolved in 5 mL of dry THF and added dropwise to the solution of the red ylide at
0ꢁC. The reaction mixture was stirred at 0ꢁC to room temperature for 1.5 h, and then quenched with saturated aqueous NH4Cl so-
lution at 0ꢁC and diluted with diethyl ether. The organic layer was separated and the aqueous layer was extracted with diethyl ether.
The combined organic layer was washed with brine, dried (MgSO4), and concentrated in vacuo. The residue was chromatographed
on silica gel (0%–10% diehtyl ether in hexane) to give a mixture (10) of two geometrical isomers 10a and 10b (1.71 g, 71% yield) as a
colorless oil in the ratio of 2:1 respectivelly as determined by 1H NMR analysis. IR (neat) 2931, 2859, 1684, 1611, 1561, 1411, 1251,
1120, 1097, 1053, 980, 836, 779, 742, 695 cm-1. 1H NMR (400 MHz, CDCl3) 6.37 (d, J = 1.9 Hz, 1H, Ar-H, 10a), 6.36 (d, J = 1.9 Hz, 1H,
Ar-H, 10b), 6.32 (d, J = 1.9 Hz, 1H, Ar-H, 10b), 6.31 (d, J = 1.9 Hz, 1H, Ar-H, 10a), 5.86 (s, 1H, = CHOMe, 10a), 5.81 (s, 1H, = CHOMe,
10b), 4.22-4.15 (m as dd, J = 13.6, 3.4 Hz, 1H, C-ring, 10b), 3.55 (s, 3H, OMe, 10a), 3.52 (s, 3H, OMe, 10b), 3.46-3.42 (m as dd, J =
13.6, 3.4 Hz, 1H, C-ring, 10a), 3.32 (t, J = 6.9 Hz, 2H, 60-H for 10a and 2H, 60-H for 10b), 2.96-2.88 (m as br d, J = 13.6 Hz, 1H, C-ring,
10a), 2.35-2.26 (m, 1H, C-ring of 10a and 1H, C-ring of 10b), 2.22-2.15 (m, 1H, C-ring, 10b), 2.09-1.99 (m, 1H, C-ring, 10b), 1.92-1.84
(m, 1H, C-ring of 10a and 1H, C-ring of 10b), 1.83-1.72 (m, 1H, C-ring, 10a), 1.69-1.55 (m, 2H, -CH2- of the side chain of 10a,
2H, -CH2- of the side chain of 10b, 2H, C-ring of 10a, and 2H, C-ring of 10b), 1.55-1.46 (m, 2H, -CH2- of the side chain of 10a,
2H, -CH2- of the side chain of 10b), 1.39 (s, 3H, 6-Me, 10a), 1.38 (s, 3H, 6-Me, 10b), 1.32 (qt, J = 7.2 Hz, 2H, -CH2- of the side chain
of 10a, 2H, -CH2- of the side chain of 10b), 1.20 (s, 6H, -C(CH3)2- of 10a), 1.19 (s, 6H, -C(CH3)2- of 10b), 1.12-0.97 (m, s, s, s, and s,
overlapping, 1H, C-ring of 10a, 1H, C-ring of 10b, 2H, -CH2- of the side chain of 10a, 2H, -CH2- of the side chain of 10b, 3H, 6-Me of
10a, 3H, 6-Me of 10b, 9H, -Si(Me)2CMe3, of 10a, 9H, -Si(Me)2CMe3, of 10b, especially 1.03, s, -Si(Me)2CMe3, of 10a and 1.00, s,
-Si(Me)2CMe3, of 10b), 0.24 (s, 3H, -Si(Me)2CMe3, 10a), 0.23 (s, 3H, -Si(Me)2CMe3, 10b), 0.19 (s, 3H, -Si(Me)2CMe3, 10b), 0.15
(s, 3H, -Si(Me)2CMe3, 10a). Mass spectrum (ESI) m/z (relative intensity) 579 (M++H, 100). LC/MS analysis (Waters MicroMass ZQ
system) showed retention time of 7.2 min for the title compound.
(6aR,10aR)-3-(7-Bromo-2-methylheptan-2-yl)-1-[(tert-butyldimethylsilyl)oxy]-6,6-dimethyl-6a,7,8,9,10,10a-
hexahydro-6H-benzo[c]chromene-9-carbaldehyde (11)
To a stirred solution of 10 (2.50 g, 4.3 mmol) in CH2Cl2 (144 mL) under an argon atmosphere, was added wet trichloroacetic acid
(3.51 g, 21.6 mmol). The reaction mixture was stirred at room temperature for 50 min and then quenched with saturated aqueous
NaHCO3 solution and diluted with diethyl ether. The organic layer was separated and the aqueous layer was extracted with diethyl
ether. The combined organic phase was washed with water and brine, dried (MgSO4) and evaporated under reduced pressure. The
residue consisted of a mixture of epimeric aldehydes 12 and 11a (2.26 g, 93% yield) in the ratio of 2:1 respectivelly as determined by
1H NMR analysis, and it was used into the next step as such. 1H NMR (500 MHz, CDCl3) d 9.89 (d, J = 1.5 Hz, 1H, 9a-CHO, 11a), 9.63
(d, J = 1.5 Hz, 1H, 9b-CHO, 12), 6.38 (d, J = 1.9 Hz, 1H, Ar-H, 12), 6.36 (d, J = 1.9 Hz, 1H, Ar-H, 11a), 6.33 (d, J = 1.9 Hz, 1H, Ar-H, 11a),
6.32 (d, J = 1.9 Hz, 1H, Ar-H, 12), 3.69-3.62 (m as br d, J = 14.0 Hz, 1H, C-ring, 11a), 3.52-3.44 (m, 1H, C-ring, 12), 3.33 (t, J = 6.5 Hz,
2H, -CH2Br for 12 and 2H, -CH2Br for 11a), 2.65-2.60 (m, 1H, C-ring, 11a), 2.45-2.33 (m, 2H, C-ring, 12 and 2H, C-ring, 11a), 2.31-2.24
(m, 1H, C-ring, 11a), 2.14-2.07 (m, 1H, C- ring, 12), 2.03-1.96 (m, 1H, C-ring, 12), 1.80-1.71 (m, 2H, -CH2- of the side chain 1H of 12,
2H, -CH2- of the side chain of 11a),1.65-1.60 (m, 1H, C-ring, 12, 1H, C-ring, 11a), 1.58-1.42 (m, 2H, -CH2- of the side chain of 12, 2H,
-CH2- of the side chain of 11a, 1H, C-ring of 12, 1H, C-ring of 11a), 1.39 (s, 3H, 6-Me of 12), 1.35 (s, 3H, 6-Me of 11a), 1.33 (qt, J =
7.5 Hz, 2H, -CH2- of the side chain of 12 and 2H, -CH2- of the side chain of 11a), 1.25-1.11 (m, 2H, C-ring of 12, 1H, C-ring of 11a, 6H,
-C(CH3)2- of 11a, 6H, -C(CH3)2- of 12), 1.09-1.03 (m and s, overlapping, 2H, -CH2- of the side chain of 12, 2H, -CH2- of the side chain
e7 Cell 180, 1–11.e1–e13, February 20, 2020

Please cite this article in press as: Hua et al., Activation and Signaling Mechanism Revealed by Cannabinoid Receptor-Gi Complex Structures,
Cell (2020), https://doi.org/10.1016/j.cell.2020.01.008
of 11a, 1.07, s, 3H, 6-Me, 12), 1.02-1.00 (s and s overlapping, 3H, 6-Me of 11a and 9H, -Si(Me)2CMe3 of 12), 0.97 (s, 9H, -Si(Me)2-
CMe3, 11a), 0.28 (s, 3H, -Si(Me)2CMe3, 11a), 0.26 (s, 3H, Si(Me)2CMe3, 12), 0.25 (s, 3H, Si(Me)2CMe3, 11a), 0.15 (s, 3H,
Si(Me)2CMe3, 12).
(6aR,9R,10aR)-3-(7-Bromo-2-methylheptan-2-yl)-1-[(tert-butyldimethylsilyl)oxy]-6,6-dimethyl-6a,7,8,9,10,10a-
hexahydro-6H-benzo[c]chromene-9-carbaldehyde (12)
To a mixture of 11a and 12 (2.20 g, 3.9 mmol) in ethanol (77 mL) under an argon atmosphere, was added potassium carbonate
powder (2.68 g, 19.4 mmol) and the mixture was stirred at room temperature for 3 h. The reaction mixture was quenched by the dro-
pewise addition of 1M aqueous acetic acid solution (until pH of 5). The volatiles were evaporated under reduced pressure. The water
layer was extracted with diethyl ether. The organic layer was washed with brine, dried (MgSO4), and concentrated under reduced
presure. Purification by flash column chromatography on silica gel (5%–25% diethyl ether in hexane) gave 12 (1.78 g, 81% yield)
as a colorless oil. IR (neat) 2934, 2860, 2713 (w, CHO), 1728 (s, > C = O), 1613, 1560, 1413, 1331, 1253, 1066, 982, 838,
780 cm-1. 1H NMR (500 MHz, CDCl3) d 9.63 (d, J = 1.5 Hz, 1H, 9b-CHO), 6.38 (d, J = 1.9 Hz, 1H, Ar-H), 6.32 (d, J = 1.9 Hz, 1H,
Ar-H), 3.52-3.44 (m, 1H, C-ring), 3.33 (t, J = 6.9 Hz, 2H, 60-H), 2.45-2.36 (m as td, J = 11.0, 2.6 Hz, 2H, C-ring), 2.14-2.06 (m, 1H,
C-ring), 2.03-1.95 (m, 1H, C-ring), 1.77 (qt, J = 7.2 Hz, 2H, -CH2- of the side chain), 1.64-1.60 (m, 1H, C-ring), 1.54-1.46
(m, 3H, -CH2- of the side chain, C-ring), 1.39 (s, 3H, 6-Me), 1.32 (qt, J = 7.5 Hz, 2H, -CH2- of the side chain), 1.26-1.18 (m, 2H,
C-ring, and 6H, -C(CH3)2-), 1.09-0.99 (m, s, and s, overlapping, 14H as follows: 2H, -CH2- of the side chain, 1.08, s, 3H, 6-Me,
1.01, s, 9H, -Si(Me)2CMe3), 0.26 (s, 3H, Si(Me)2CMe3), 0.15 (s, 3H, Si(Me)2CMe3). 13C NMR (100 MHz CDCl3) d 203.6 (-CHO),
154.6 (ArC-1 or ArC-5), 154.3 (ArC-5 or ArC-1), 149.3 (tertiary aromatic), 112.6 (tertiary aromatic), 109.6 (ArC-2 or ArC-4), 108.5
(ArC-4 or ArC-2), 50.6, 49.1, 44.3, 37.4, 37.3, 35.5, 33.9, 32.8, 30.2, 28.9, 28.8, 28.7, 27.6, 26.9, 26.0, 25.9, 23.9, 18.8, 18.2, ꢂ3.6,
ꢂ4.2. Mass spectrum (ESI) m/z (relative intensity) 565 (M++H, 100). LC/MS analysis (Waters MicroMass ZQ system) showed retention
time of 6.8 min for the title compound.
{(6aR,9R,10aR)-3-(7-Bromo-2-methylheptan-2-yl)-1-[(tert-butyldimethylsilyl)oxy]-6,6-dimethyl-6a,7,8,9,10,10a-
hexahydro-6H-benzo[c]chromen-9-yl}methanol (13)
Sodium borohydride (394 mg, 10.5 mmol) was added to a stirred solution of aldehyde 12 (740 mg, 1.31 mmol) in ethanol (32 mL) at
0ꢁC under argon. After 30 min, the reaction was quenched with the addition of saturated aqueous NH4Cl solution and volatiles were
removed in vacuo. The residue was dissolved in ethyl acetate and water was added. The organic layer was separated and the
aqueous layer was extracted with ethyl acetate. The combined organic phase was washed with water and brine, dried (MgSO4),
and evaporated. Purification by flash column chromatography on silica gel (15%–50% diethyl ether in hexane) gave 13 (712 mg,
96% yield) as a colorless viscous oil. IR (neat) 3360 (br, OH), 2935, 2869, 1743, 1621, 1560, 1415, 1364, 1217, 1139, 1038, 971,
837, 748 cm-1; 1H NMR (400 MHz, CDCl3) d 6.37 (d, J = 1.9 Hz, 1H, Ar-H), 6.30 (d, J = 1.9 Hz, 1H, Ar-H), 3.54 (dd, J = 10.6,
5.6 Hz, half of an AB system, 1H, -CH2OH), 3.50-3.43 (m as dd, J = 10.6, 6.5 Hz, half of an AB system, 1H, -CH2OH), 3.32 (t, J =
6.9 Hz, 2H, 6’-H), 3.19-3.13 (m as br d, J = 12.8 Hz, 1H, C-ring), 2.40-2.32 (m as td, J = 11.0, 2.6 Hz, 1H, C-ring), 2.04-1.88
(m, 2H, C-ring), 1.81-1.59 (m, 3H as follows 1H of C-ring, 2H, -CH2- of the side chain), 1.54-1.43 (m, 3H, -CH2- of the side chain,
C-ring), 1.38 (s, 3H, 6-Me), 1.35-1.27 (m, 3H, -CH2- of the side chain, C-ring) 1.20 (s, 3H, -C(CH3)2-), 1.19 (s, 3H, -C(CH3)2-), 1.17-
1.10 (m, 3H, -CH2- of the side chain, C-ring), 1.06 (s, 3H, 6-Me), 1.00 (s, 9H, Si(Me)2CMe3), 0.77 (q, J = 11.9 Hz, 1H, C-ring), 0.23
(s, 3H, Si(Me)2CMe3), 0.13 (s, 3H, Si(Me)2CMe3). 13C NMR (100 MHz CDCl3) d 154.7 (ArC-1 or ArC-5), 154.4 (ArC-5 or ArC-1),
149.0 (tertiary aromatic), 113.8 (tertiary aromatic), 109.8 (ArC-2 or ArC-4), 108.6 (ArC-4 or ArC-2), 68.6 (-CH2OH), 49.8, 44.5,
41.9, 40.7, 37.4, 35.7, 33.4, 32.7, 29.9, 29.5, 29.0, 28.9, 27.8, 27.7, 26.1, 24.1, 19.0, 18.4, ꢂ3.4, ꢂ4.1. Mass spectrum (ESI) m/z (rela-
tive intensity) 567 (M++H, 100). LC/MS analysis (Waters MicroMass ZQ system) showed retention time of 6.5 min for the title
compound.
Cell 180, 1–11.e1–e13, February 20, 2020 e8

Please cite this article in press as: Hua et al., Activation and Signaling Mechanism Revealed by Cannabinoid Receptor-Gi Complex Structures,
Cell (2020), https://doi.org/10.1016/j.cell.2020.01.008
7-[(6aR,9R,10aR)-1-Hydroxy-9-(hydroxymethyl)-6,6-dimethyl-6a,7,8,9,10,10a-hexahydro-6H-benzo[c]chromen-3-yl]-
7-methyloctanenitrile (AM12033)
To a solution of 13 (120 mg, 0.21 mmol) in anhydrous DMSO (4.2 mL), under an argon atmosphere, was added NaCN (103.1 mg,
2.1 mmol). The reaction mixture was stirred for 9 h at room temperature, and then quenched with the addition of ice. Extractive isola-
tion with diethyl ether, and purification by flash column chromatography on silica gel (20%–50% ethyl acetate in hexane) gave
AM12033 (66 mg, 79% yield) as a white solid. Melting point = 73ꢁC. IR (neat) 3382 (br, OH), 2932, 2864, 2252 (w, CN), 1621,
1
1574, 1461, 1414, 1333, 1271, 1139, 1038, 971, 839, 736 cm-1; H NMR (400 MHz, CDCl3) d 6.33 (d, J = 1.9 Hz, 1H, Ar-H), 6.20
(d, J = 1.9 Hz, 1H, Ar-H), 5.25 (br s, 1H, OH), 3.53 (d, J = 6.3 Hz, 2H, -CH2OH), 3.24-3.17 (m as br d, J = 12.8 Hz, 1H, C-ring),
2.48 (td, J = 11.1, 2.8 Hz, 1H, C-ring), 2.26 (t, J = 7.1 Hz, 2H, 6’-H), 2.00-1.89 (m, 2H, C-ring), 1.84-1.72 (m, 1H, C-ring), 1.61-1.55
(m, 3H, -CH2- of the side chain, C-ring), 1.54-1.48 (m, 3H, -CH2- of the side chain, C-ring), 1.40-1.30 (s and qt overlapping,
2H, -CH2- of the side chain, especially 1.38, s, 3H, 6Me), 1.20 (s, 6H, -C(CH3)2-), 1.18-1.03 (s and m overlapping, 2H, -CH2- of the
side chain, 1H, C-ring, especially, 1.08, s, 3H, 6-Me), 0.83 (q, J = 11.9 Hz, 1H, C-ring); 13C NMR (100 MHz CDCl3) d 154.9 (ArC-1
or ArC-5), 154.8 (ArC-5 or ArC-1), 149.4 (tertiary aromatic), 120.0 (-CN), 109.9 (tertiary aromatic), 108.0 (ArC-2 or ArC-4), 105.5
(ArC-4 or ArC-2), 68.7 (-CH2OH), 49.5, 44.1, 40.6, 37.4, 35.1, 33.3, 29.9, 29.3, 28.9, 28.8, 27.9, 27.6, 25.3, 23.9, 19.2, 17.2
(-CH2CN). Exact mass (ESI) calculated for C25H38NO3 (M+ + H), 400.2852; found 400.2853. LC/MS analysis (Waters MicroMass
ZQ system) showed retention time of 5.2 min for the title compound.
Protein Engineering and Expression of CB2 for Crystallography Study
CB2-T4L construction and expression for crystallization were performed using the similar procedure as described before(Li et al.,
2019). In brief, the construct has truncations of residues 1-20, 223-234 and 326-360; the T4L fusion protein was fused to the trun-
cated third intracellular loop of the human CB2 gene. Six mutations (Gly782.48Leu, Thr1273.46Ala, Thr1534.45Leu, Gly2105.59Ala,
Arg2426.32Glu and Gly3048.48Glu) were introduced into the CB2-T4L gene for further modification. The optimized construct was
cloned into a modified pFastBac1 vector with the haemagglutinin (HA) signal sequence at the N terminus and a 10 3 His-tag followed
by a Flag-tag at the C terminus. The modified CB2–T4L protein was expressed in Spodoptera frugiperda (Sf9) insect cells using the
Bac-to-Bac Baculovirus Expression System (Invitrogen). Sf9 cells were infected at a cell density of 2-2.5 3 106 cells per ml with high-
titer viral stock MOI (multiplicity of infection) of 5.0. Cells were harvested by centrifugation for 48 h post-infection and stored at ꢂ80ꢁC
for future use.
CB2-AM12033 Complex Purification for Co-crystallization
Frozen cell pellets were thawed and lysed by repeated washing and centrifugation in the hypotonic buffer of 10 mM HEPES (pH 7.5),
10 mM MgCl2, 20 mM KCl, and the high osmotic buffer of 10 mM HEPES (pH 7.5), 1.0 M NaCl, 10 mM MgCl2, 20 mM KCl, with EDTA-
free complete protease inhibitor cocktail tablets (Roche). Purified membranes were thawed at room temperature and incubated with
20 mM AM12033 and inhibitor cocktail at 4ꢁC for 3 h. The membranes were further incubated with 1.0 mg/mL iodoacetamide (Sigma)
for 1 h and were solubilized in the buffer containing 50 mM HEPES (pH 7.5), 500 mM NaCl, 0.75% (w/v) lauryl maltose neopentyl glycol
(LMNG, Anatrace) and 0.15% (w/v) cholesterol hemisucinate (CHS, Sigma-Aldrich) at 4ꢁC for 2.5-3 h. The supernatant was isolated
by ultracentrifugation, and then incubated with TALON IMAC resin (Clontech) and 20 mM imidazole, at 4ꢁC overnight. The resin was
washed with 15 column volumes (CV) of washing buffer I containing 25 mM HEPES (pH 7.5), 500 mM NaCl, 10% (v/v) glycerol, 0.1%
(w/v) LMNG, 0.02% (w/v) CHS, 30 mM imidazole and 20 mM AM12033, and 10 CV of washing buffer II containing 25 mM HEPES
(pH 7.5), 500 mM NaCl, 10% (v/v) glycerol, 0.03% (w/v) LMNG, 0.006% (w/v) CHS, 50mM imidazole and 20 mM AM12033. The protein
was eluted using 3 CV of elution buffer containing 25 mM HEPES (pH7.5), 500 mM NaCl, 10% (v/v) glycerol, 0.01% (w/v) LMNG,
0.002% (w/v) CHS, 250 mM imidazole and 25 mM AM12033. The purified receptor was then concentrated to 20 mg/mL for crystal-
lization trials.
Crystallization of CB2-AM12033 in Lipidic Cubic Phase
Crystallization was performed using the lipidic cubic phase (LCP) method as described before(Caffrey and Cherezov, 2009). The
concentrated CB2 protein in complex with AM12033 was reconstituted into LCP by mixing with molten lipid (90% (w/v) monoolein
and 10% (w/v) cholesterol at volume ratio of 2:3 using a syringe mixer. LCP crystallization trials were performed using an NT8-LCP
crystallization robot (Formulatrix). 96-well sandwich plates were incubated and imaged at 20ꢁC using an automated incubator/
imager (RockImager, Formulatrix). Crystals grew in the condition of 100 mM HEPES pH 7.0, 25% PEG 400, 220 mM Sodium sulfate
e9 Cell 180, 1–11.e1–e13, February 20, 2020

Please cite this article in press as: Hua et al., Activation and Signaling Mechanism Revealed by Cannabinoid Receptor-Gi Complex Structures,
Cell (2020), https://doi.org/10.1016/j.cell.2020.01.008
decahydrate, and reached a full size of 40 mm 3 20 mm after 2 weeks. The crystals were harvested from the LCP matrix using micro-
mounts (MiTeGen) and immediately flash frozen in liquid nitrogen.
Data Collection and Structure Determination of CB2-AM12033
X-ray diffraction data were collected at the Spring-8 beamline 41XU, using a Pilatus3 6M detector (X-ray wavelength 1.0000 A). A
˚
rastering and data-collection strategy was followed as previously described (Cherezov et al., 2009). Diffraction images were indexed,
integrated, and scaled using XDS (Kabsch, 2010) and merged using XPREP. Initial phases were obtained by molecular replacement
(MR) with Phaser (McCoy et al., 2007) using the antagonist AM10257 bound CB2 structure (PDB: 5ZTY) as search model. The struc-
ture determination was completed by manually modeling the CB2 and T4L in the program COOT (Emsley et al., 2010) using both |
2Fo|-|Fc| and |Fo|-|Fc| maps and refined with Phenix (Adams et al., 2010) and Buster (Smart et al., 2012).
Constructs and Expression of CB2 and Gi Heterotrimer
The N-BRIL fused wild type human CB2 construct was cloned into a modified pFastBac1 vector with the HA signal sequence at the N
terminus followed by a 10 3 His-tag and a Flag-tag. Human Gai1 and Gb1g2 subunits were cloned into pFastbac1 and pFastDual vec-
tor individually. The CB2 and Gi heterotrimer were co-expressed in Sf9 insect cells using the Bac-to-Bac Baculovirus Expression Sys-
tem (Invitrogen). Sf9 cells were infected at a cell density of 2-2.5 3 106 cells per ml with three separate virus preparations for CB2, Gai1
and Gb1g2 at a ratio of 1:2:2. The infected cells were cultured at 27ꢁC for 48 h before collection by centrifugation and the cell pellets
were stored at ꢂ80ꢁC for future use.
Constructs, Expression, and Purification of scFv16
ScFv16 was cloned into a modified pFastBac1 vector containing a GP67 secretion signal before the amino terminus of the scFv16
and 10 3 His tag at C terminus. ScFv16 expressed in secreted form from Trichuplusia ni Hi5 insect cells using the Bac-to-Bac Ba-
culovirus Expression System, and purified by Ni-NTA chromatography. Supernatant was pH balanced by addition of 1M Tris pH 8.0,
and then was loaded onto Ni-NTA resin. The column was washed with 6 CV wash buffer I 20 mM HEPES pH 7.5, 100 mM NaCl, and
10 mM imidazole followed by 4 CV wash II 20 mM HEPES pH 7.5, 100 mM NaCl, and 30 mM imidazole. The protein was eluted with
the same buffer supplemented with 250 mM imidazole, the C-terminal 10 3 His tag was cleaved by incubation with human rhinovirus
3C protease, and the protein was dialyzed into a buffer consisting of 20 mM HEPES pH 7.5 and 100 mM NaCl. Cleaved scFv16 was
further purified by reloading over Ni-NTA resin. The flowthrough was collected and purified over gel filtration chromatography using a
Hiload Superdex 7510/300 column. Monomeric fractions were pooled, concentrated, and flash frozen in liquid nitrogen, then stored
at ꢂ80ꢁC for further use.
CB2-Gi-scFv16 Complex Formation and Purification
The cell pellets corresponding to 1L CB2-Gi co-expression culture were thawed and lysed in the hypotonic buffer of 10mM HEPES,
pH7.5, 10 mM MgCl2, 20 mM KCl with EDTA-free complete protease inhibitor cocktail tablets (Roche). The CB2-Gi complex was
formed in membranes by addition of 20 mM AM12033 and 2 units of apyrase (NEB) in the presence 500 ug scFv16. The lysate
was incubated for overnight at 4ꢁC and discard the supernatant by centrifugation at 40,000 3 rpm for 30min. The complex from mem-
branes was solubilized in the buffer containing 50 mM HEPES (pH 7.5), 100 mM NaCl, 0.75% (w/v) lauryl maltose neopentyl glycol
(LMNG, Anatrace), 0.15% (w/v) cholesterol hemisucinate (CHS, Sigma-Aldrich), 20 mM AM12033 and 2 units of apyrase (NEB) at 4ꢁC
for 2 h. The supernatant was isolated by ultracentrifugation, and then incubated with TALON IMAC resin (Clontech) and 20 mM imid-
azole over 6 h at 4ꢁC. The resin was washed with 15 CV (column volumes) of washing buffer I containing 25 mM HEPES (pH 7.5),
100 mM NaCl, 10% (v/v) glycerol, 0.1% (w/v) LMNG, 0.02% (w/v) CHS, 30 mM imidazole and 20 mM AM12033, and 15 column vol-
umes of washing buffer II containing 25 mM HEPES (pH 7.5), 100 mM NaCl, 10% (v/v) glycerol, 0.03% (w/v) LMNG, 0.006% (w/v)
CHS, 50mM imidazole and 20 mM AM12033. The protein was eluted using 3 column volumes of elution buffer containing 25mM
HEPES (pH 7.5), 100 mM NaCl, 10% (v/v) glycerol, 0.01% (w/v) LMNG, 0.002% (w/v) CHS, 250 mM imidazole and 25 mM
AM12033. The purified CB2-Gi complex was concentrated, then injected onto a Superdex200 10/300 GL column (GE
Healthcare) equilibrated in the buffer containing 20 mM HEPES, pH 7.5, 100 mM NaCl, 0.00075% (w/v) LMNG, 0.00025% GDN,
0.0001% (w/v) CHS, 100 mM TCEP. The complex peak fractions were collected and concentrated individually to 0.8-1.0 mg/mL
for electron microscopy experiments.
CB1-Gi-scFv16 Complex Expression, Formation, and Purification
Wild type human CB1 was subcloned into a modified mammalian expression pTT5 vector, which contains a haemagglutinin (HA)
signal sequence, a FLAG tag and 10 3 His tag, followed by a tobacco etch virus (TEV) protease cleavage site. In order to improve
the protein expression, the construct was further modified by the truncations of the CB1 residues 1-70, and 426-472, and the BRIL
(PDB: 1M6T, MW 10.9kDa) fusion protein was fused to the N terminus. Glu2735.37Lys, Thr2835.47Val and Arg3406.32Glu, which do not
affect the G protein-coupling were introduced (Hua et al., 2017). The protein expression and membrane preparation were performed
using the same procedure as described before (Hua et al., 2017). Purified membranes were thawed at room temperature and then
incubated with 25 mM AM841 in the presence of 1.0 mg/mL iodoacetamide (Sigma) and EDTA-free protease inhibitor cocktail (Roche)
at 4ꢁC for 2 h. The membranes were then solubilized with 50 mM HEPES (pH 7.5), 100 mM NaCl, 1% (w/v) LMNG, 0.2% (w/v) CHS at
Cell 180, 1–11.e1–e13, February 20, 2020 e10

Please cite this article in press as: Hua et al., Activation and Signaling Mechanism Revealed by Cannabinoid Receptor-Gi Complex Structures,
Cell (2020), https://doi.org/10.1016/j.cell.2020.01.008
4ꢁC for 2.5-3 h. The supernatants were isolated by high-speed centrifugation, and then incubated with TALON IMAC resin and 20 mM
imidazole, at 4ꢁC overnight. The resin was washed with 15 column volumes of washing buffer I containing 25 mM HEPES (pH 7.5),
100 mM NaCl, 10% (v/v) glycerol, 0.1% (w/v) LMNG, 0.02% (w/v) CHS, 30 mM imidazole and 20 uM AM841, and 5 column volumes of
washing buffer II containing 25 mM HEPES (pH 7.5), 100 mM NaCl, 10% (v/v) glycerol, 0.03% (w/v) LMNG, 0.006% (w/v) CHS, 50mM
imidazole and 20 uM AM841. The proteins were eluted by 2.5 column volumes of eluting buffer containing 25 mM HEPES (pH 7.5),
100 mM NaCl, 10% (v/v) glycerol, 0.01% (w/v) LMNG, 0.001% (w/v) CHS, 250 mM imidazole and 20 uM AM841. PD MiniTrap G-25
column was used to remove imidazole and the protein was used for the complex formation.
Heterotrimeric G-proteins were expressed and purified as follows: Human Gai1 and Gb1g2 subunits were cloned into pFastbac1 and
pFastDual vector individually. Sf9 insect cells were coinfected with viruses encoding Gai1 and Gb1g2 subunits. In order to facilitate the
purification, His-tag with TEV cleavable site is attached at the amino terminus of the Gg subunit. Cells were harvested 48 h post infec-
tion, lysed in hypotonic buffer containing 50 mM HEPES (pH 7.5), 100 mM NaCl, protease inhibitor, 5 mM imidazole, 5 mM MgCl2,
1mM DTT. The supernatant was purified by nickel affinity chromatography, followed by size-exclusion chromatography using a
Superdex 75 column. Monomeric fractions were pooled, concentrated for complex formation.
CB1-Gi-scFv16 complex formation: purified receptors and excess molar ratio of G-protein were mixed together. The coupling re-
action was allowed to proceed at 24ꢁC for 1 h and was followed by addition of apyrase to catalyze hydrolysis of unbound GDP. And
then the incubated at 25ꢁC for another 2 h. Finally, a 1.2 molar excess of scFv16 was added to the complex and incubated at 4ꢁC
overnight. The CB1-Gi-scFv16 complex was purified by size exclusion chromatography on a superdex 200 10/300 GL column in
20 mM HEPES, pH 7.5, 100 mM NaCl, 0.00075% (w/v) LMNG, 0.00025% GDN, 0.0001% (w/v) CHS, 100 mM TCEP and 5 mM
AM841. Peak fractions were concentrated to 1 mg/mL for electron microscopy studies.
Cryo-EM Sample Preparation and Image Acquisition
Three microliters of purified CB1-Gi-scFv16 or CB2-Gi-scFv16 complexes was applied to a glow-discharged holey carbon grid
(CryoMatrix Amorphous alloy film R1.2/1.3, 300 mesh), and subsequently vitrified using a Vitrobot Mark IV (Thermo Fisher Scientific).
The chamber of Vitrobot was set to 100% humidity at 4ꢁC. The sample was blotted for 2.5 s with blot force 2. Cryo-EM images were
collected on a Titan Krios microscope operated at 300 kV equipped with a Gatan Quantum energy filter, with a slit width of 20 eV, a
Gatan K2 summit direct electron camera (Gatan). Movies were taken in EFTEM nanoprobe mode, with 50 mm C2 aperture, at a cali-
brated magnification of 130,000 corresponding to a magnified pixel size of 1.04 E. Each movie comprises 45 frames with a total dose
2
-
2
˚
of 60 electrons per E , exposure time was 8.1 s with the dose rate of 8e / A /s. Data acquisition was done using SerialEM software
(Mastronarde, 2005) with a defocus range of ꢂ0.8 to ꢂ2.0 mm.
Image Processing and 3D Reconstruction
For CB1-Gi-scFv16 complex, a total of 5577 movies were collected and subjected for motion correction using MotionCor2 (Zheng
et al., 2017). Contrast transfer function (CTF) parameters for each non-dose weighted micrography were estimated by Gctf (Zhang,
˚
2016). Particles selection, 2D and 3D classifications were performed on a binned dataset with a pixel size of 2.08 A using RELION
2.1.0 (Scheres, 2012). To generate CB1-Gi-scFv16 complex template for automatic picking, around 2,186,340 particles were auto-
matically picked with manual guidence and classified by 2D classification in RELION. After auto-picking in RELION, the low-quality
images and false-positive particles were removed manually. About 1,385,539 particles were extracted for subsequent processing.
We used the cryo-EM structure of CB1-FUB-Gi complex (Electron Microscopy Data Bank code EMD-0339), low-pass-filtered to
˚
60 A, as the initial model for 3D classification in RELION. The model of the best class after 3D classification was used as the initial
model for the final 3D classification and 3D auto-refinement. Further Baycsian polishing of these particles was performed in
˚
RELION3.0, followed by another round of auto-refinement, which generated a final 3.0 A map determined by gold standard Fourier
shell correlation using the 0.143 criterion. Local resolution estimation was performed with the Bsoft package (Heymann, 2001) using
the two unfiltered half maps.
For CB2-Gi-scFv16 complex, a total of 3894 images were collected. The dataset was subjected to motion correction, CTF estima-
tion, autopicking, 2D classification and 3D classification in RELION 2.1.0. About 1,248,405 particles were extracted for further 3D
˚
processing. We used our cryo-EM structure of CB1-AM841-Gi complex, low-pass-filtered to 60 A, as the initial model for 3D clas-
sification in RELION. After auto-refinement and further Baycsian polishing applied to these particles in RELION3.0 improved the
˚
density map with nominal resolution of 2.9 A. Local resolution estimation was also performed with the Bsoft package.
Model Building and Refinement
For CB1-Gi-scFv16 complex, the cryo-EM structure of CB1-FUB-Gi complex (PDB code 6N4B) was used as the starting model for
model building and refinement against the electron density map. For CB2-Gi-scFv16 complex, the CB2-AM12033 crystal structure
and Gi protein in CB1 were used as the starting model. The model was docked into the EM density map using Chimera (Pettersen
et al., 2004), followed by iterative manual adjustment and rebuilding in COOT (Emsley et al., 2010) and phenix.real_space_refine in
Phenix (Adams et al., 2010). The model statistics were validates using MolProbity (Chen et al., 2010a). Structural figures were pre-
pared in Chimera and PyMOL (https://pymol.org/2/). The final refinement statistics are provided in Table S1. The extent of any model
overfitting during refinement was measured by refining the final model against one of the half-maps and by comparing the resulting
map versus model FSC curves with the two half-maps and full model.
e11 Cell 180, 1–11.e1–e13, February 20, 2020

Please cite this article in press as: Hua et al., Activation and Signaling Mechanism Revealed by Cannabinoid Receptor-Gi Complex Structures,
Cell (2020), https://doi.org/10.1016/j.cell.2020.01.008
Molecular Docking
The Schrodinger Suite 2018-4 (Schrӧdinger) was used to predict the ligand-binding poses for CB1 or CB2. The structures of the two
receptors were processed by using the ‘Protein Preparation Wizard’ (Sastry et al., 2013) and converting of ligands from 2D to 3D
structures was carried out using ‘LigPrep’ (Schrӧdinger). The ‘Glide’ SP was used in molecular docking (Friesner et al., 2004; Friesner
et al., 2006).
Molecular Dynamics Simulation of CB1/CB2 in Complex with Agonists
The CB1 and CB2 structures were isolated from their cryo-EM complex structures and Prime (Schrӧdinger) was used to add missing
side chains, hydrogens and cap the termini of the receptors. The residues D1632.50, D2133.49 in CB1, D802.50, D1303.49 in CB2 were
manually protonated to simulate the protonation upon GPCR activation (Ranganathan et al., 2014). Then the processed CB1 or CB2
in complex with agonists (AM841, HU-308 or L-759,656) was embedded in a bilayer composed of 140 1-palmitoyl-2-oleoyl-sn-glyc-
ero-3-phosphocholine (POPC) lipids using the CHARMM-GUI Membrane Builder (23, 24). The orientation of CB1 or CB2 in the mem-
brane is referenced to the CB1 structure (PDB: 5TGZ) in the Orientations of Proteins in Membranes (OPM) database (25). Each re-
˚
ceptor-agonist-membrane system was solvated in a periodic 0.15 M NaCl TIP3P water box with a minimum water height of 20.0 A on
top and bottom of the system.
All simulations were performed on a GPU cluster using the CUDA version of PMEMD (Particle Mesh Ewald Molecular Dynamics) in
Amber18 (AMBER 2018, University of California, San Francisco). The protein was modeled with the ff14SB protein force field (26),
ligands with the GAFF2 force field (24) and lipids with the AMBER Lipid17 force field. The constructed system was first energy mini-
mized for 10,000 steps, of which the first 5,000 steps were performed using the steepest descent method and the remaining
5,000 steps used the conjugate gradient method. Then the simulation system was heated from 0 to 100 K using Langevin dynamics
2
with a constant box volume. Restraints were applied to protein, ligands, and lipids with a constant force of 10 kcal/mol/A . Subse-
˚
quently, the temperature was increased to 310 K, where the periodic box was coupled accordingly using anisotropic Berendsen
control in order to maintain the pressure at around 1 atm. These restraints were then removed from lipids and the system was equil-
ibrated for another 10 ns at the constant pressure and temperature ensemble (NPT). Further equilibration was then carried out at
2
˚
310 K with harmonic restraints applied to the protein starting at 5 kcal/mol/A and reduced in a stepwise fashion every 2 ns for
2
10 ns, followed by 0.1 kcal/mol/A restraints for 20 ns for a total of 30 ns of equilibration. Then 2 ms production simulations with
˚
no restraints were performed at 310 K and 1 bar in the NPT ensemble for each system. The Particle mesh Ewald (PME) method
˚
(Darden et al., 1993) was used to treat all electrostatic interactions beyond a cutoff of 9 A. The SHAKE algorithm (Ryckaert et al.,
1977) was used for recording the length of bonds involving hydrogen during the simulation with an integration time step of 2 fs.
Snapshots from each trajectory were saved every 40 ps during the production runs and these trajectories were used for analysis
with Visual Molecular Dynamics (VMD) (27) and CPPTRAJ (28).
Metadynamics Simulations
To investigate the ligand-binding processes and ligand selectivity, we introduced well-tempered metaMD simulations. We choose
two collective variables for our simulations: (1) distance between the mass center of a ligand and that of the binding pocket; (2) dis-
tance between the mass center of N-terminal and that of ECL2 loop. All membrane systems were built in CHARMM-GUI (Jo et al.,
2008), under Charmm36m force field (Huang et al., 2017). Each system contains 132 POPC lipids, 14400 water molecules as well as
0.15 M NaCl. For the details of metaMD simulations, please see our previously published work (Chan et al., 2018; Yuan et al., 2016).
Cyclic AMP Accumulation Assay
Inhibition of forskolin-stimulated cAMP production was measured using the CISBIOꢀ cAMP Homogeneous Time-Resolved Fluores-
cence Resonance Energy Transfer (HTRF) (FRET) HiRange assay kit according to the manufacturers protocol (Cisbio Assays, Bed-
ford, MA). CHO-hCB2 cells were plated in low-volume 384-well plates (4000/well) using Opti-MEM supplemented with 1% FBS
following suspension in 5mM EDTA/PBS. Cells were treated for 30 min with 25mM of phosphodiesterase inhibitor (RO-20-1724),
20mM forskolin, and test compounds. Compounds were dissolved and diluted in DMSO to a final concentration of 1%. Plates
were developed by adding the cAMP-d2 antibody and the cryptate solution in lysis buffer for 60 min at room temperature. Fluorescent
measures were acquired at 620/665 nm using a Perkin-Elmer EnVision plate reader (Weltham, MA) and FRET was calculated as the
665/620 ratio. In all experiments, 1% DMSO was used as the vehicle and the response was normalized to the percent of response
produced by the full agonist CP55,940. Agonist and antagonist drug additions were made at the same time.
QUANTIFICATION AND STATISTICAL ANALYSIS
The determination of agonist potency and relative efficacy was determined by 3 parameter nonlinear regression with responses
normalized to the Emax produced by CP55,940 in each individual experiment (N = 7 individual assays performed in duplicate) to
generate the % CP55,940 graphed in the figure. The determination of antagonist affinity was calculated using a modified version
of Schild’s method of dose-ratio comparison. At concentrations higher than 10 nM, SR144528 caused a decrease in the baseline
activity of the system. It was therefore necessary to include this effect when analyzing the antagonist-mediated shift in the agonist
EC50. Specifically, the bottom of the curve was permitted to float freely and the x-value of each response curve was interpolated
Cell 180, 1–11.e1–e13, February 20, 2020 e12

Please cite this article in press as: Hua et al., Activation and Signaling Mechanism Revealed by Cannabinoid Receptor-Gi Complex Structures,
Cell (2020), https://doi.org/10.1016/j.cell.2020.01.008
where 50% of the maximum response was achieved. The dose-ratio of these interpolated values was used to produce the lineari-
zation and estimates of antagonist affinity. All analyses were performed using Prism 8.1 (GraphPad).
DATA AND CODE AVAILABILITY
Data Resources
Coordinates and structures factors have been deposited in the Protein Data Bank for CB2-AM12033 (PDB: 6KPC), CB2-AM12033-
Gi-scFv16 (PDB: 6KPF) and CB1-AM841-Gi-scFv16 (PDB: 6KPG).
e13 Cell 180, 1–11.e1–e13, February 20, 2020

Supplemental Figures
Figure S1. Synthesis of AM12033 and Radioligand Binding Affinities of AM12033 and AM841 against [3H]CP55,940, Related to Figures 1, 2, and 4
(A) Synthesis of AM12033. Reagents and Conditions: (a) CH3I, NaH, DMF, 0ꢁC to rt, 2 h, 96%; (b) DIBAL-H, CH2Cl2, -78ꢁC, 30 min, 92%; (c) 15, (Me3Si)2NK, THF, 0 to
10ꢁC, 30 min, then addition to 3, 0ꢁC to rt, 20 min, 96%; (d) H2, 10% Pd/C, AcOEt, rt, 2.5 h, 98%; (e) BBr3, CH2Cl2, -78ꢁC to rt, 3 h, 99%; (f) 18, p-TSA, CHCl3, 0ꢁC to rt,
4 d, 59%; (g) TMSOTf, CH2Cl2/MeNO2, 0ꢁC to rt, 3 h, 75%; (h) TBDMSCl, imidazole, DMAP, CH2Cl2, rt, 12 h, 83%; (i) Cl-Ph3P+CH2OMe, (Me3Si)2NK, THF, 0ꢁC to rt,
30 min, then addition to 9, 0ꢁC to rt, 1.5 h, 71%; (j) Cl3CCOOH, CH2Cl2, rt, 50 min, 93%; (k) K2CO3, EtOH, rt, 3 h, 81%; (l) NaBH4, EtOH, 0ꢁC, 30 min, 96%. (m) NaCN,
DMSO, rt, 9 h 79%;(n) PPh3, benzene, reflux, 48h, 85%;(o)isopropenylacetate, p-Toluenesulfonic acid, reflux, 6 h, 97%;(p)Pb(OAc)4, benzene, 78–80ꢁC, 3.5 h; 90%.
(B) Structures and radioligand-binding affinities of AM12033 and AM841 against [3H]CP55,940. The assays were performed according to standard procedures
(Hua et al., 2016; Li et al., 2019; Liu et al., 2018).

Figure S2. Flowchart of Cryo-EM Data Analysis of the CB1-Gi-scFv16 and CB2-Gi-scFv16 Complexes, Related to Figure 1
(A) CB1-AM841-Gi-scFv complex data processing and refinement, ‘Gold-standard’ Fourier shell correlation curves indicating the resolution at the FSC = 0.143
˚
is 3.0 A.
(B) CB2-AM12033-Gi-scFv complex data processing and refinement, ‘Gold-standard’ Fourier shell correlation curves indicating the resolution at the FSC = 0.143
˚
is 2.9 A.
(C and D) EM density map and model are shown for all CB1 (C) and CB2 (D) transmembrane helices, helix VIII, and ligands.

Figure S3. Conformational Changes of DRY and NPxxY Motifs between Inactive and Active CB1 and CB2, Related to Figures 2, 4, and 5
(A) Comparison of CB1 between active and inactive (PDB: 5TGZ) from side view.
(B) Extracellular and intracellular views of superimposed CB1. Active and inactive CB1 are colored in orange and gray, respectively.
(C–D) Comparison of NPxxY (C) and DRY (D) motifs between inactive and active CB1 and CB2.
(E–F) SR144528 is competitive against CP55,940 and AM12033 in the forskolin-stimulated adenylyl cyclase assay (E). Agonist potency and antagonist affinity
estimates are provided in (F) (with the KB derived using Schild Dose-ratio linearization). Since the antagonist displays significant inverse agonism, we also show
the linear regression of the Log [dose ratio- 1] using the interpolated 50% of maximum effect and presents the linear fit accounting for the change in baseline. (E)
Data points are presented at the mean with SEM for 7 experiments performed in duplicate or triplicate as previously described (Li et al., 2019). The summarized
data in (F) are presented as the mean with 95% confidence intervals.

Figure S4. Comparison of the G Protein Orientations between CB2-Gi and GPCR-Gi Complexes, Related to Figure 3
(A) Structure of each GPCR-Gi complex was superimposed onto CB2-Gi based on the receptor component. MOR (PDB: 6DDE).
(B) A1 adenosine (PDB: 6D9H).
(C) 5HT1B (PDB: 6G79).
(D) M2 (PDB: 6OIK).
(E–F) Comparison of the G protein orientation and ICL2 interactions between CB2-Gi (E) and CB1-Gi (F) and b2AR -Gs complexes.

Figure S5. Comparison of the Antagonist, Agonist-Bound, and Active States of CB1 and CB2, and Docking and MD Simulations of L-759,656
in CB1 and CB2, Related to Figures 5 and 6
(A) Binding pose comparison of AM12033 (yellow sticks) in AM12033-bound, light blue; and AM12033-Gi-CB2, green, structures.
(B) Comparison of CB2 between active, green cartoon; and agonist-bound, sky blue cartoon, states from the side view.
(C) Comparison of CB2 between agonist-bound, light blue cartoon; and inactive (PDB: 5ZTY), sky blue cartoon, from the side view.
(D) Comparison of CB1 between active, orange cartoon; and agonist-bound, olive cartoon, states from the side view.
(E) Comparison of ‘‘twin toggle switch’’ between active, orange cartoon; and agonist-bound, olive cartoon, CB1.
(F) Comparison of NPxxY and DRY motifs between active, orange cartoon; and agonist-bound, olive cartoon CB1.
(G and H) The conformational rearrangement around Thr3.46 in CB2 (G) and CB1 (H).
(I) The initial docking pose of L-759,656, gray sticks, in CB1, gray cartoon. After 2 ms MD simulation, L-759,656 is shown as slate sticks and CB1 is shown as
orange cartoon.
(J) The initial docking pose of L-759,656, gray sticks, in CB2, gray cartoon. After 2 ms MD simulation, L-759,656 is shown as slate sticks and CB2 is shown as green
cartoon.