Increased single-nucleotide discrimination in allele-specific polymerase chain reactions through primer probes bearing nucleobase and 2′-deoxyribose modifications

Article abstract of DOI:10.1002/chem.200601627

The diagnosis of genetic dissimilarities between individuals is becoming increasingly important due to the discovery that these variations are related to complex phenotypes like the predisposition to certain diseases or compatibility with drugs. The most

Full text of DOI:10.1002/chem.200601627

FULL PAPER
DOI: 10.1002/chem.200601627
Increased Single-Nucleotide Discrimination in Allele-Specific Polymerase
Chain Reactions through Primer Probes Bearing Nucleobase and
2’-Deoxyribose Modifications
Ramon Kranaster and Andreas Marx*[a]
Abstract: The diagnosis of genetic dis-
similarities between individuals is be-
coming increasingly important due to
the discovery that these variations are
related to complex phenotypes like the
predisposition to certain diseases or
compatibility with drugs. The most
common among these sequence varia-
tions are single-nucleotide polymorph-
isms (SNPs). The availability of reliable
and efficient methods for the interroga-
tion of the respective genotypes is the
basis for any progress along these lines.
Many methods for the detection of nu-
cleotide variations in genes exist, in
which amplification of the target gene
is required before analysis can take
place. The allele-specific polymerase
chain reaction (asPCR) combines
target amplification and analysis in a
single step. The principle of asPCR is
based on the formation of matched or
mismatched primer–target complexes.
The most important parameter in
asPCR is the discrimination of these
matched or mismatched pairs. In recent
publications we have shown that the
reliability of SNP detection through
asPCR is increased by employing
chemically modified primer probes. In
particular, primer probes that bear a
polar 4’-C-methoxymethylene residue
at the 3’ end have superior properties
in discriminating single-nucleotide var-
iations by PCR. Here we describe the
synthesis of several primer probes that
bear nucleobase modifications in addi-
tion to the 4’-C-methoxymethylenated
2’-deoxyriboses. We studied the effects
of these alterations on single-nucleo-
tide discrimination in allele-specific
PCR promoted by a DNA polymerase
and completed these results with
single-nucleotide-incorporation kinetic
studies. Moreover, we investigated
thermal denaturing of the primer-
probe–template complexes and record-
ed circular dichroism (CD) spectra for
inspecting the thermodynamic and
photophysical duplex behaviour of the
introduced modifications. In short, we
found that primer probes bearing a 4’-
C-methoxymethylene residue at the 2’-
deoxyribose moiety in combination
with a thiolated thymidine moiety have
synergistic effects and display signifi-
cantly increased discrimination proper-
ties in asPCR.
Keywords:
polymerase
oligonucleotides
chain reaction
·
·
polymerases · thiothymidine
Introduction
different effects of drugs on different patients can also be
linked to SNPs.[3,5,6] Thus, considerable efforts have been fo-
cussed on finding new SNPs and elucidating connections be-
tween them and certain phenotypes. To date, almost two
million SNPs have been discovered and characterised with a
variety of methods. In a first step, methods are needed that
identify unknown nucleotide variations; this is followed by
an investigation of the medicinal relevance of the variations.
After assessment of the exact sequence context, other meth-
ods are needed for high-throughput screening of populations
in the search for known SNPs or to analyse individuals for
SNP patterns. Obviously, in the latter case, methods are es-
sential that allow time- and cost-effective verification of dis-
tinct nucleotide variations in daily laboratory practice.[7–16]
Most methods rely on amplification of the target gene
before analysis can take place. Methods that enable amplifi-
cation and analysis in a single step are desirable. In princi-
Within the human genome comprising approximately 3 bil-
lion nucleobase pairs, individuals differ in approximately
0.1 percent of the nucleotide sequence.[1,2] The most
common among these sequence variations are single-nucleo-
tide polymorphisms (SNPs).[3–5] SNPs are defined as sites in
which the less common variant has a frequency of at least
1% in a population. A direct linkage exists between some
of these dissimilarities and certain diseases. Additionally,
[a]Dipl.-Chem. R. Kranaster, Prof. Dr. A. Marx
Fachbereich Chemie
Universität Konstanz
Universitätsstrasse 10, 78457 Konstanz (Germany)
Fax : (+49)7531-88-5140
E-mail: andreas.marx@uni-konstanz.de
Chem. Eur. J. 2007, 13, 6115 – 6122
ꢀ 2007 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
6115

ple, allele-specific PCR (asPCR) comprises these fea-
tures.[17–24] The concept of the asPCR is based on the princi-
ple that a DNA polymerase catalyses DNA synthesis from a
matched 3’-primer terminus, while a mismatch due to hy-
bridisation of the primer probe to a different sequence var-
iant should obviate DNA synthesis and, thus, DNA amplifi-
cation should be abolished. This conceptually simple and
straightforward procedure is hampered somehow by the se-
quence dependency of the selectivity.[20–24] Thus, identifica-
tion of the appropriate reaction conditions requires tedious
optimisation. In earlier publications, we and others have
shown an essential improvement in this method by employ-
ing chemically modified primer probes.[25–30] The employ-
ment of primer probes bearing a 4’-C modification at the 3’
end allowed the selectivity of asPCR to be increased signifi-
cantly. These primer probes showed increased discrimination
properties between matched and mismatched cases in the
asPCR, as well as in primer extension. Additionally, these
beneficial properties of the modified primer probes were in-
dependent of buffer conditions and applicable in different
sequence contexts.[25–30] The combination of primer probes
bearing 4’-C-methoxymethylene residues at the 3’ end to-
gether with the commercially available 3’–5’-exonuclease-de-
ficient variant of a DNA polymerase from Thermococcus li-
toralis (Vent (exoÀ) DNA polymerase) was found to exhibit
superior performance in allele discrimination.[30] Encouraged
by these findings, we set out to study the effects of some nu-
cleobase modifications in conjunction with the previously
described 4’-C-methoxymethylenated 2’-deoxyribose resi-
dues with regard to discrimination in the asPCR. In order to
modify the size and hydrogen-bonding ability of the sub-
strates, we substituted the carbonyl functionalities in thymi-
dine for thiocarbonyl groups. Thiolated thymidines have an
enlarged steric demand, due to the 0.45 Š longer double-
bond length,[31] and additionally decreased H-bonding abili-
ties compared to the native carbonyl groups. We found that
primer probes bearing a 4’-C-methoxymethylene modifica-
tion and thio modification placed at the 3’-terminal nucleo-
tide displayed greatly increased discrimination properties in
allele-specific PCR.
Next, we synthesised the 4-thio-4’-C-methoxymethylene
thymidine bearing oligonucleotide 4STOMe. Our approach to
the synthesis of the 4’-C-modified 4-thiothymidine building
block makes use of the known 4’-C-methoxymethylene-
modified thymidine 1[30] as a starting point for further diver-
sification (Scheme 1).
Results and Discussion
Synthesis ofprimer probes : To explore the effects of 2-S
and 4-S substitutions in conjunction with 4’-C modification
on the allele-discrimination in PCRs, we set out to synthe-
sise the respective modified oligonucleotides.
The thiolated oligonucleotides 4ST and 2ST were synthes-
ised by employing commercially available 5’-O-protected
thiolated nucleosides that were coupled to a solid long-chain
amino alkyl modified controlled pore glass (LCAA-CPG)
support according to established protocols.[32] The solid sup-
ports were subsequently transferred into suitable cartridges
and employed in standard automated DNA synthesis to
yield the desired oligonucleotides 4ST and 2ST.
Scheme 1. a) (PhOCH2CO)2O, DMAP, pyridine, 95%; b) 1. TPSCl,
DIPEA, DMAP, CH2Cl2; 2. HSCH2CH2CN, N-methylpyrolidine, 45%;
c) aq NH3, CH3CN, 60%; d) EDC, DMAP, succinylated LCAA-CPG,
pyridine; then 4-nitrophenol; then piperidine; then acetic anhydride/pyri-
dine/THF (Cap A) and 1-methylimidazole/THF (Cap B); e) 1. oligonu-
cleotide synthesis; 2. 25% NH4OH, NaSH. DIPEA: N-ethyldiisopropyla-
mine; DMAP: 4-(N,N-dimethylamino)pyridine; DMT: 4,4’-dimethoxytri-
tyl; EDC: 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride;
LCAA-CPG: long-chain alkyl amine modified controlled pore glass;
THF: tetrahydrofuran; TPSCl: triisopropylbenzenesulfonyl chloride.
6116
www.chemeurj.org
ꢀ 2007 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Chem. Eur. J. 2007, 13, 6115 – 6122

Single-Nucleotide Discrimination
FULL PAPER
Protection of the 3’-OH group of 1 was achieved with
phenoxyacetic anhydride in very good yields.[33] Treatment
of 2 with 2,4,6-triisopropylbenzenesulfonyl chloride (TPSCl)
and subsequently with 3-mercaptopropionitrile derived from
freshly reduced 3,3’-dithiobis(propionitrile)[34] resulted in the
4-thiolated thymidine derivative 3. Treatment with ammonia
at room temperature resulted in the selective saponification
of the 3’-O-phenoxyacetate without cleavage of the thioeth-
er. The resulting alcohol 4 was coupled to a solid support by
using standard conditions to yield 5, which was used for
solid-support automated DNA synthesis.
For the synthesis of the 4’-C-methoxymethylen-2-thiothy-
midine containing oligonucleotide 2STOMe, we used 6 as the
starting point. Compound 6 is an intermediate in the synthe-
sis of
1 and is readily available in gram quantities
(Scheme 2).[30] For further diversification we needed to es-
tablish a protocol to selectively cleave the 3’-O-tert-butyldi-
methylsilylether of 6 in the presence of a 5’-O-tert-butyldi-
phenylsilylether. We found that this can be achieved by
treatment with BF3·Et2O in CH2Cl2 to afford 7 in very good
yields. Further protection-group manipulations resulted in 8.
Conversion of 8 into the 5’-O-triflate and subsequent treat-
ment with 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU) yielded
G
the desired 2,5’-anhydrothymidine derivative 9 in good
yields. It is noteworthy that other approaches that have
been reported to yield the corresponding 4’-C-unmodified
2,5’-anhydrothymidines, for example, through the Mitsunobu
reaction,[35] treatment of the 5’-iodothymidine derivative
with silver acetate,[36] or ring closure via the 5’-O-tosylate[37]
were not successful for the synthesis of the herein-depicted
4’-C-modified nucleoside. Opening of the ring system in 9
was achieved by treatment with H2S in pyridine, a process
resulting in moderate yields of 10. Subsequently, protection-
group manipulations yielded building block 11, which was
coupled to a solid support to form 12 for use in the auto-
Scheme 2. a) BF3·Et2O, CH2Cl2, 89%; b) 1. acetic anhydride, DMAP, pyr-
idine; 2. TBAF, THF, 92%; c) 1. 2,6-lutidine, Tf2O, DMF; 2. DBU,
CH3CN, 08C–RT; 75% over both steps; d) H2S, pyridine, 458C, 28%;
e) 1. DMTCl, DMAP, pyridine; 2. aq NH3, MeOH; 40% over both steps;
f) EDC, DMAP, succinylated LCAA-CPG, pyridine; then 4-nitrophenol;
then piperidine; then acetic anhydride/pyridine/THF (Cap A) and 1-
methylimidazole/THF (Cap B); g) 1. oligonucleotide synthesis; 2. 25%
mated synthesis of 2STOMe
.
NH4OH. DBU: 1,8-diazabicyclo[5.4.0]undec-7-ene; DMF: N,N-dimethyl-
formamide; TBAF: tetrabutylammonium fluoride; Tf2O: trifluoroacetic
anhydride.
A
Single-nucleotide discrimination in real-time PCR: For
proof of principle experiments, we decided to use a PCR
template (90-mer) within the human acid ceramidase and
the Farber disease[38] sequence context. We conducted two
reactions at a time in parallel. One PCR was conducted by
employing a template bearing a deoxyadenosine (dA) resi-
due opposite the respective 3’-terminal thymidine in the
primer probe. In the other experiment, the same primer
probe was combined with a template strand that had the
same sequence apart from a dA to deoxyguanosine (dG)
mutation opposite the 3’-terminal thymidine moiety. Both
setups used the same unmodified reverse primer. In this
study, we analyzed the PCRs by employing real-time
double-stranded DNA detection through SybrGreen I fluo-
rescence by using appropriate thermocycler equipment.[39]
We determined the threshold-crossing point (Ct) as a mea-
sure for amplification efficiency. This parameter is defined
as the point at which the reporterꢁs fluorescence exceeds the
background fluorescence significantly and crosses a thresh-
old. The difference in the threshold-crossing points (DCt) of
canonical versus non-canonical primer–template amplifica-
tion is a measure for single-nucleotide discrimination.
Amplification efficiency and the ability to discriminate
against single-nucleotide mismatches varied with the modifi-
cation employed (Figure 1, Table 1). Usage of the 2ST probe
introduced some degree of selectivity as compared to use of
the unmodified probe. Strikingly, these effects were signifi-
cantly enhanced when a 4’-C-methoxymethylene modifica-
tion was present in conjunction with a 2-thiolation. 2STOMe
has superior properties when compared with the unmodified
T, 2ST and TOMe probes. Different results were obtained
when the effects of 4-thiolation on asPCRs were investigat-
ed. The 4ST probe has no significant effect on the amplifica-
tion selectivity or the efficiency. When 4STOMe was used, the
amplification efficiency decreased significantly, as indicated
Chem. Eur. J. 2007, 13, 6115 – 6122
ꢀ 2007 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.chemeurj.org
6117

A. Marx and R. Kranaster
in melting points (Table 2). In-
terestingly, all duplexes contain-
ing modified strands have
slightly increased melting points
when compared to the native
duplexes, in both matched and
mismatched cases.
Thus, the influence of
a
single nucleotide at the primer
terminus that has been modi-
fied at the 4’-C-deoxyribose
and/or the nucleobase on the
intrinsic formation of aberrant
conformations or duplex stabili-
ty is small.
Steady-state kinetics ofsingle-
nucleotide incorporation: To
quantify the influence of the
depicted chemical modifications
Figure 1. Results of real-time PCR experiments obtained by using primer probes bearing 4’-C-methoxymethy-
lene residues at the 3’ end in combination with nucleobase thiomodifications. Results are shown with 2ST, 4ST,
TOMe 2STOMe 4STOMe or the unmodified primer T as indicated. PCR amplification in the presence of target tem-
, ,
plate FarA (solid line) or FarG (dashed line). All experiments were conducted under the same conditions (see
the Experimental Section).
Table 1. DCt values by using base- and/or 4’-C-methoxymethylene-modi-
fied primer probes and DNA templates FarA or FarG.
5’-AGGAT/T* (Primer probe, 20-mer)[a]
3’-TCCTNTCCA (Template, 90-mer)[b]
Ct (N: A)
DCt
T
2ST
4ST
5
5
5
6
6
0–0.5
3
1
9
12
19
TOMe
2STOMe
4STOMe
20
[a]T*: modified thymidine 2ST, 4ST, TOMe
,
2STOMe or 4STOMe, as described
above. [b] N: A or G for FarA or FarG, respectively.
by the Ct value of 20. Interestingly, this was combined with
an unprecedentedly high DCt value of 19 cycles! Agarose-
gel analysis of the formed reaction products revealed that,
when mismatched primer–template complexes containing
the 4STOMe probe were used, thermocycling resulted in am-
plification of non-specific PCR products (data not shown).
CD spectra and thermal-denaturing studies: To gain an in-
sight into the origin of the observed effects, we conducted
thermal-denaturing studies and recorded CD spectra. Du-
plexes between the respective primer strands (T, 2ST, 4ST,
Figure 2. Circular dichroism spectra of native and modified oligonucleo-
tides. Primer probes (20-mer) were hybridised with template (33-mer) in
matched (A–T/T*) and mismatched (G–T/T*) cases. A) T match, T mis-
match, 2ST match, 2ST mismatch, 4ST match and 4ST mismatch; B) TOMe
match, TOMe mismatch, 2STOMe match, 2STOMe mismatch, 4STOMe match and
TOMe 2STOMe and 4STOMe) and 33-mer templates correspond-
,
ing to matched (A–T/T*) and mismatched cases (G–T/T*)
resulted in nearly superimposable CD spectra, a result indi-
cating little, if any, dependence of the overall helix confor-
mation on the presence of a matched or mismatched case
and modifications at the nucleobase and/or 2’-deoxyribose
(see Figure 2).
Next, thermal-denaturing studies were conducted in order
to investigate the impact of chemical modification at the 3’-
terminus on duplex stability. We found only small variations
4STOMe mismatch. T*: modified thymidines 2ST, 4ST, TOMe
,
2STOMe or 4STOMe
as described above.
on enzyme action, we investigated the steady-state extension
efficiencies from the modified primer termini and deter-
mined the kinetic constants (kcat: first order rate of catalysis;
KM: Michaelis constant; kcat/KM: incorporation efficiency) of
single-nucleotide incorporation under single-completed-hit
6118
www.chemeurj.org
ꢀ 2007 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Chem. Eur. J. 2007, 13, 6115 – 6122

Single-Nucleotide Discrimination
FULL PAPER
Table 2. Thermal-denaturing experiments (melting temperature, Tm [8C],
values shown) of primer probes bearing 2-S/4-S-thio modification and/or
nificantly increased KM value (about 100-fold) and an ap-
proximately 5- to 10-fold decreased kcat value. This is in line
with earlier findings by us, although different enzymes and
modifications were used.[42] However, when single-complet-
ed hit conditions were used (>10-fold excess primer/tem-
plate over DNA polymerase concentration), no extension of
mismatched primer termini was observed. As demonstrated
by our results, these limitations can be overcome in PCRs in
which standard dNTP concentrations are employed that are
higher than the measured KM values, thereby resulting in an
efficient PCR when matched primer/templates are em-
ployed.
4’-C-methoxymethylene-modification (2ST, 4ST, TOMe 2STOMe 4STOMe) com-
, ,
pared to those of unmodified primer probe (T) in matched (A–T/T*) and
mismatched cases (G–T/T*). All experiments were conducted with the
same double-stranded DNA and buffer concentrations.
5’-AGGAT/T* (Primer probe, 20-mer)[a]
3’-TCCTNTCCA (Template, 33-mer)[b]
matched (A–T/T*)
mismatched (G–T/T*)
T
2ST
4ST
65.5
66.1
67.5
65.5
66.3
67.0
64.5
66.3
67.4
66.0
65.0
66.1
TOMe
2STOMe
4STOMe
[a]T*: modified thymidine 2ST, 4ST, TOMe
,
2STOMe or 4STOMe, as described
above. [b] N: A or G for match or mismatch, respectively.
Conclusion
Taken together, we show that primer probes that bear thio-
lated thymidines are able to increase single-nucleotide dis-
crimination in allele-specific PCRs. These modifications,
either at the 4’-C-deoxyribose or on the nucleobase of a
single-modified nucleotide at the primer terminus, do not
have any significant effect on duplex stability and the con-
formation of the respective primer–template complex.
Therefore the characterised dis-
and steady-state conditions, as previously described[40] (see
Table 3).
The best discrimination properties of the non-sugar-modi-
fied primer probes were shown by 2ST, which is coherent
with the results obtained in our real-time asPCR experi-
crimination properties must
Table 3. Kinetic studies of single-nucleotide insertion. Single-nucleotide extension of matched (A–T/T*) and
mismatched (G–T/T*) primer termini by Vent (exoÀ) DNA polymerase. The incorporation of dATP was stud-
result from the specific interac-
tion between the DNA poly-
merase, the template–primer-
probe duplex and the incoming
dNTPs.
Nucleobase thiolation in con-
junction with 4’-C-methoxy-
methylene modification at the
2’-deoxyribose exhibits the
most pronounced effects. These
compounds are readily avail-
ied with the different primer probes 2ST, 4ST, TOMe 2STOMe or 4STOMe in comparison to that with the unmodified
,
primer probe (T) in matched and mismatched cases with the respective template (33-mer).
match (A–T/T*)[a]
mismatch (G–T/T*)[a]
kcat [minÀ1
primer
KM [mm]
kcat [minÀ1
]
kcat/KM
KM [mm]
]
kcat/KM
[minÀ1 mmÀ1
]
[minÀ1 mmÀ1
]
T
0.23Æ0.02
0.26Æ0.06
0.26Æ0.08
33.6Æ4.2
30.2Æ1.3
26.5Æ2.4
1.11Æ0.1
4.8
3.3
4.2
0.004
0.007
0.004
51.8Æ6.0
89.7Æ30
33.7Æ9.2
n.a.
n.a.
n.a.
0.48Æ0.05
0.18Æ0.01
0.48Æ0.03
n.a.
n.a.
n.a.
0.009
0.002
0.014
n.a.
n.a.
n.a.
2ST
0.85Æ0.04
1.09Æ0.21
0.14Æ0.02
0.21Æ0.02
0.10Æ0.007
4ST
TOMe
2STOMe
4STOMe
[a]T*: modified thymidine 2ST, 4ST, TOMe 2STOMe or 4STOMe as described above. n.a.: not accessible; no nucleo- able and can be incorporated
,
tide insertions were observed when up to 8 nm of DNA polymerase, up to 1 h incubation time and up to
600mm of dATP (higher dATP concentrations caused inhibition of the reaction) were applied.
into DNA strands by using
standard oligonucleotide
chemistry. This real-time PCR
ments. Recently, similar results were obtained for the incor-
poration of the respective thiolated thymidine triphosphates
(TTPs).[41] The increased selectivity of the system comprising
2ST is mainly achieved by a decreased steady-state kcat value
in the mismatched case, in comparison to that of the un-
modified system. One can envision that DNA amplification
from matched versus mismatched DNA complexes under
PCR conditions (that is, 200 mm deoxynucleoside triphos-
phate (dNTP)) very much depends on the kcat value of the
proceeding nucleotide incorporation. In real-time PCR, the
signal generation is dependent on the formation of double-
stranded DNA. Thus, the reduced steady-state kcat value of
the 2ST-comprising system in the mismatched case might
well be the cause of the above-observed single-nucleotide
discrimination ability in allele-specific PCR.
system supersedes recently discovered approaches[30] by us
that use unmodified nucleobases. The described system with
the 2STOMe primer probe should be useful for the direct diag-
nosis of single-nucleotide variations within genes, such as
single-nucleotide polymorphisms or point mutations, directly
without the need for further time- and cost-intensive post-
PCR analysis.
Experimental Section
General: All temperatures quoted are uncorrected. All reagents are com-
mercially available and were used without further purification. Solvents
were purchased over molecular sieves (Fluka) and used directly without
further purification unless otherwise noted. 5’-O-(4,4’-Dimethoxytrityl)-
(3-N/4-O-toluoyl)-2-S-thiothymidine and 5’-O-(4,4’-dimethoxytrityl)-4-S-
(2-cyanoethyl)thiothymidine were purchased from Berry & Associates
(USA). All reactions were conducted under exclusion of air and mois-
4’-C-modification has significant effects on the extension
efficiency. The efficiency is greatly diminished due to a sig-
Chem. Eur. J. 2007, 13, 6115 – 6122
ꢀ 2007 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.chemeurj.org
6119

A. Marx and R. Kranaster
ture. NMR spectra were recorded on a Bruker DRX600 instrument, with
the solvent peak as an internal standard. MALDI-TOF mass spectra
were measured on a Bruker Biflex III instrument with 2,5-dihydroxyben-
zoic acid (DHB) as the matrix. ESI mass spectra were recorded on an
Esquire 3000 plus instrument from Bruker. Oligonucleotide samples
were dissolved in 2-propanol (20%) containing 0.5–1% triethylamine
(c=1–50 pmolmLÀ1). Flash chromatography was performed over Merck
silica gel 60 (230–400 mesh). MPLC was performed on Büchi apparatus,
with silica gel 60M. Thin-layer chromatography was performed on Merck
precoated plates (silica gel 60 F254). UV/Vis analysis was performed with
a Cary 100 Bio instrument from Varian. MS analysis of oligonucleotides
was conducted by Metabion (Germany, Martinsried, MALDI-TOF) or
by ESI.
4, Ar C, OCO); MALDI-TOF MS (DHB matrix): m/z: 815.0 [M+Na]+,
830.9 [M+K]+.
5’-O-(4,4’-Dimethoxytrityl)-4’-C-methoxymethylen-4-S-(2-cyanoethyl)-
thiothymidine (4): Concentrated NH4OH (450 mL, 25%) was added to a
solution of nucleoside 3 (43.8 mg, 0.055 mmol) in acetonitrile (2 mL).
After the reaction mixture had been stirred for 2 h, concentrated
NH4OH (140 mL, 25%) was again added. The reaction mixture was
stirred for 10 h. Concentrated NH4OH (45 mL, 25%) was again added
and the mixture was stirred for further 2 h. The solvent was evaporated
and the residue was purified by flash column chromatography (silica gel,
ethyl acetate/petroleum ether 3:1 with 1% NEt3). Nucleoside 4 was ob-
tained as a colourless foam (21.4 mg, 0.033 mmol, 60%); Rf =0.14 (ethyl
acetate/petroleum ether 3:1 with 1%NEt3); 1H NMR (600 MHz,
[D6]acetone): d=1.64 (d, 4J=1.0 Hz, 3H; CH3-5), 2.24 (ddd, 2J=13.8,
3J=3J=6.6 Hz, 1H; H-2’a), 2.61 (ddd, 2J=13.8, 3J=6.6, 4.2 Hz, 1H; H-
2’b), 2.95–3.00 (m, 2H; CH2CN), 3.29 (d, 2J=10.0 Hz, 1H; H-5’a), 3.31
(s, 3H; OCH3), 3.40 (d, 2J=10.0 Hz, 1H; H-5’b), 3.44 (m, 2H; SCH2),
5’-O-(4,4’-Dimethoxytrityl)-4’-C-methoxymethylen-3’-O-phenoxyacety-
lene thymidine (2): After co-evaporation and drying in vacuo, nucleoside
1 (45 mg, 0.085 mmol) was dissolved in dry pyridine (5 mL). Phenoxyace-
tic anhydride (29.2 mg, 0.1 mmol) was added and the reaction mixture
was stirred for 5 h. Phenoxyacetic anhydride (10 mg, 0.035 mmol) and a
catalytic amount of DMAP were then added and the solution was stirred
at room temperature for 48 h. The reaction was stopped by addition of
water (3 mL) and the solvent was removed in vacuo. The residue was dis-
solved in dichloromethane (5 mL, with 1% NEt3). Sodium bicarbonate
solution was added and the aqueous phase was extracted with dichloro-
methane (with 1% NEt3). The combined organic phases were dried
(MgSO4) and concentrated in vacuo. The obtained residue was purified
by flash column chromatography (silica gel, ethyl acetate/petroleum
ether 2:1 with 1% NEt3) and 2 was isolated as a colourless foam (60 mg,
0.08 mmol, 95%): Rf =0.57 (ethyl acetate/petroleum ether 3:1 with 1%
NEt3); 1H NMR (600 MHz, [D6]acetone); d=1.48 (s, 3H; 5-CH3), 2.48
(ddd, 2J=14.2, 3J=7.2, 3.5 Hz, 1H; H-2’a), 2.61 (ddd, 2J=14.2, 3J=3J=
2
2
À
À
3.62 (d, J=10.0 Hz, 1H; 4’-C CH2a), 3.67 (d, J=10.0 Hz, 1H; 4’-C
CH2b), 3.79 (s, 6H; OCH3), 4.63 (dd, J=3J=4.4 Hz, 1H; H-3’), 6.21 (dd,
3
3J=3J=6.6 Hz, 1H; H-1’), 6.90–7.50 (m, 13H; Ar H), 7.85 ppm (d, 4J=
1.0 Hz, 1H; H-6); 13C NMR (150.9 MHz, [D6]acetone): d=13.7 (CH3),
À
18.2 (CH2CN), 25.9 (SCH2), 42.9 (C-2’), 55.5 (Ar OCH3), 59.5 (OCH3),
À
65.7 (C-5’), 72.5 (C-3’), 73.6 (4’C CH2), 87.2, 89.6 (CAr3, C-4’), 87.5 (C-
1’), 111.2, 114.0, 119.2, 127.7, 128.7, 129.0 (Ar C), 131.0 (C-6), 136.4,
136.6, 139.6, 145.9, 153.3, 159.7, 176.0 ppm (C-2, C-4, Ar C); MALDI-
TOF MS (DHB matrix): m/z: 680.2 [M+Na]+, 696.1 [M+K]+.
5’-O-tert-Butyldiphenylsilyl-4’-C-methoxymethylene thymidine (7): Nu-
cleoside 6 (20 mg, 0.031 mmol) was dissolved in dry dichloromethane
(2 mL). BF3·OEt2 (4.43 mL, 0.035 mmol) was added and the reaction mix-
ture was stirred at room temperature for 4 h. After addition of saturated
sodium bicarbonate solution, the mixture was extracted with dichlorome-
thane. The organic phase was dried over MgSO4. The solvent was re-
moved in vacuo. The residue was purified by flash column chromatogra-
phy (silica gel, ethyl acetate/petroleum ether 1:2) to give nucleoside 7 as
7.2 Hz, 1H; H-2’b), 3.23 (s, 3H; OCH3), 3.27 (d, 2J=9.6 Hz, 1H; H-5’a),
2
3.4 (d, J=9.6 Hz, 1H; 4’-C CH2a), 3.43 (d, 2J=9.6 Hz, 1H; H-5’b), 3.50
À
(d, 2J=9.6 Hz, 1H; 4’-C CH2b), 3.77 (s, 6H; OCH3), 4.82 (d, 2J=
16.6 Hz, 1H; PhO CH2a), 4.86 (d, J=16.6 Hz, 1H; PhO CH2b), 5.79
(dd, 3J=3.5, 7.2 Hz, 1H; H-3’), 6.32 (dd, 3J = 3J = 7.2 Hz, 1H; H-1’),
6.80–7.50 (m, 19H; Ar H, H-6), 9.90 ppm (brs, 1H; NH); 13C NMR
À
2
À
À
a white foam (14.5 mg, 0.0276 mmol, 89%); Rf =0.23 (ethyl acetate/pe-
1
À
troleum ether 1:1); H NMR (600 MHz, CDCl3): d=1.10 (s, 9H; tBu Si),
À
(150.9 MHz, [D6]acetone): d=13.2 (CH3), 39.8 (C-2’), 56.5 (Ph OCH3),
2
3
1.56 (s, 3H; CH3-5), 2.31 (ddd, J=13.4, J=8.7, 6.6 Hz, 1H; H-2’a), 2.42
(ddd, 2J=13.4, 3J=5.6, 2.0 Hz, 1H; H-2’b), 3.33 (s, 3H; OCH3), 3.46 (d,
À
À
60.5 (OCH3), 66.7 (CH2 OPh), 67.1 (C-5’), 74.3 (4’-C CH2), 76.4 (C-3’),
86.0 (C-1’), 88.4 (C-4’), 88.8 (Ar3C), 112.2, 115.0, 116.4, 123.2, 128.8,
129.7, 130.0, 131.4, 132.03, 132.05, 137.3, 137.34, 137.5 (Ar C, C-5, C-6),
146.8 (C-2), 160.0, 160.76, 160.78 (C-4, Ar C), 169.8 ppm (OCO);
MALDI-TOF MS (DHB matrix): m/z: 745.3 [M+Na]+, 761.3 [M+K]+.
2J=9.5 Hz, 1H; H-5’a), 3.61 (d, 2J=9.5 Hz, 1H; H-5’b), 3.81 (d, 2J=
2
À
À
11.0 Hz, 1H; 4’C CH2a), 3.85 (d, J=11.0 Hz, 1H; 4’C CH2b), 4.6 (dd,
3J=2.0, 6.6 Hz, 1H; H-3’), 6.47 (dd, 3J=5.6, 8.7 Hz, 1H; H-1’), 7.37–7.70
(m, 11H; Ar H, H-6), 8.30 ppm (brs; NH); 13C NMR (150.9 MHz,
À
5’-O-(4,4’-Dimethoxytrityl)-4’-C-methoxymethylen-3’-phenoxyacetylen-4-
S-(2-cyanoethyl)thiothymidine (3): DIPEA (43 mL, 0.25 mmol), TPSCl
(50 mg, 0.163 mmol) and DMAP (1.2 mg, 10 mmol) were added to a solu-
tion of 2 (56 mg, 0.078 mmol) in dichloromethane (5 mL). After the mix-
ture had been stirred for 2 h, TPSCl (50 mg, 0.163 mmol) and DIPEA
were again added and stirring was continued for 3 h. 3-Mercaptopropio-
nitrile (43 mL, 0.543 mmol), derived from freshly reduced 3,3’-dithiobis-
(propionitrile),[33] and N-methylpyrrolidine (10 mL, 0.094 mmol) were
added to the reaction mixture. After stirring for 2 h, the reaction mixture
was diluted with dichloromethane and washed with sodium bicarbonate
solution and brine. The organic phase was evaporated in vacuo. Purifica-
tion of the residue by flash column chromatography (silica gel, ethyl ace-
tate/petroleum ether 1:3 with 1% NEt3) gave 3 (28 mg, 0.035 mmol,
45%) as a yellow oil; Rf =0.41 (ethyl acetate/petroleum ether 3:1 with
1% NEt3); 1H NMR (600 MHz, [D6]acetone): d=1.69 (s, 3H; CH3-5),
2.48 (ddd, 2J=14.0, 3J=3J=7.1 Hz, 1H; H-2’a), 2.69 (ddd, 2J=14.0, 3J=
[D6]acetone): d=12.0 (CH3), 19.4 (C (CH3)3), 27.0 (C-(CH3)3), 41.0 (C-
A
À
2’), 59.5 (OMe), 66.7 (4’C CH2), 73.2 (C-5’), 73.9 (C-3’), 84.5 (C-1’), 88.0
(C-4’), 111.2 (C-5), 127.9, 128, 130.1, 130.2, 132.2, 132.9, 135.2, 135.3,
135.5 (Ar C, C-6), 150.1 (C-2), 163.4 ppm (C-4); MALDI-TOF MS
(DHB matrix): m/z: 547.5 [M+Na]+.
3’-O-Acetyl-4’-C-methoxymethylene thymidine (8): A mixture of nucleo-
side 7 (1.56 g, 2.98 mmol), acetic anhydride (700 mL, 0.76 g, 7.5 mmol)
and DMAP (1.2 mg, 10 mmol) in dry pyridine (20 mL) was stirred over-
night at room temperature. The solvent was removed in vacuo. The dried
residue was dissolved in dry THF (20 mL) and TBAF solution (3.6 mL,
1m in THF) was added. After the mixture had been stirred for 3.5h, the
solvent was removed in vacuo and the residue was purified by flash
column chromatography (silica gel, ethyl acetate/petroleum ether 3:1–
5:1). Compound
8 was obtained as a colourless residue (904 mg,
1
2.75 mmol, 92%); Rf =0.15 (ethyl acetate/petroleum ether 2:1); H NMR
(600 MHz, CDCl3): d=1.90 (d, 4J=1.2 Hz, 3H; CH3-5), 2.10 (s, 3H;
OCH3), 2.43 (ddd, 2J=14.0, 3J=6.5, 3.5 Hz, 1H; H-2’a), 2.46–2.51 (ddd,
2J=14.0, 3J=3J=7.0 Hz, 1H; H-2’b), 3.35 (s, 3H; OCH3), 3.47 (d, 2J=
3.9, 6.4 Hz, 1H; H-2’b), 2.93–3.00 (m, 2H; CH2CN), 3.26 (s, 3H; OMe),
2
À
3.31 (d, J=10.0 Hz, 1H; H-5’a), 3.40–3.50 (m, 4H; 4’-C CH2a, H-5’b,
2
À
SCH2), 3.53 (d, J=10.0 Hz, 1H; 4’-C CH2b), 3.78 (s, 6H; OMe), 4.83 (d,
À
À
10.3 Hz, 1H; H-5’a), 3.48 (d, 2J=10.3 Hz, 1H; H-5’b), 3.78 (d, 2J=
2
2
J=16.4 Hz, 1H; PhO CH2a), 4.87 (d, J=16.4 Hz, 1H; PhO CH2b),
2
5.76 (dd, 3J=3.9, 7.1 Hz, 1H; H-3’), 6.20 (dd, 3J=3J=6.4 Hz, 1H; H-1’),
6.8–7.8 ppm (m, 19H; Ar H, H-6); 13C NMR (150.9 MHz, [D6]acetone):
d=14.7 (CH3), 19.2 (CH2CN), 26.9 (SCH2), 41.1 (C-2’), 56.5 (PhOCH3),
À
À
12.0 Hz, 1H; 4’C CH2a), 3.82 (d, J=12.0 Hz, 1H; 4’C CH2b), 5.55 (dd,
3J=3.5, 7.0 Hz, 1H; H-3’), 6.26 (dd, 3J=3J=6.5 Hz, 1H, H-1’), 7.51 (d,
4J=1.2 Hz, 1H; H-6), 8.97 ppm (brs, 1H; NH); 13C NMR (150.9 MHz,
CDCl3): d=12.5 (CH3-5), 20.8 (OCH3), 38.3 (C-2’), 59.6 (OCH3), 64.6
À
À
60.5 (CH2OCH3), 66.5 (CH2 OPh), 66.6 (C-5’), 74.0 (4’C CH2), 76.1 (C-
3’), 88.3 (C-1’), 88.8 (C-4’), 89.5 (CAr3), 112.5, 115.0, 116.4, 120.2, 123.2,
128.8, 129.8, 130.0, 130.3, 130.4, 131.4, 132.0, 133.6, 133.7, 137.2, 137.4,
140.4, 146.7, (Ar C, C5, C6), 154.1, 160.0, 160.8, 169.8, 177.6 ppm (C-2, C-
À
(4’C CH2), 72.7 (C-5’), 73.5 (C-3’), 85.3 (C-1’), 87.3 (C-4’), 111.3 (C-5),
136.3 (C-6), 150.5 (C-2), 163.8 (COCH3), 170.2 ppm (C-4); MALDI-TOF
MS (DHB matrix): m/z: 351.0 [M+Na]+.
6120
www.chemeurj.org
ꢀ 2007 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Chem. Eur. J. 2007, 13, 6115 – 6122

Single-Nucleotide Discrimination
FULL PAPER
2,5’-O-Cyclo-3’-O-acetyl-4’-C-methoxymethylene thymidine (9): 2,6-Luti-
dine (107 mL, 0.915 mmol) was added to a solution of nucleoside 8
(300 mg, 0.905 mmol) in dry dichloromethane (15 mL). The solution was
cooled to À508C and a solution of trifluoroacetic anhydride (200 mL,
0.915 mmol) in dry dichloromethane (4 mL) was added dropwise. After
addition, the reaction mixture was allowed to warm up to room tempera-
ture. A saturated solution of sodium bicarbonate was added and the mix-
ture was extracted with dichloromethane. The organic solution was con-
centrated and the residue was purified with a short silica-gel column
(ethyl acetate/petroleum ether 2:1). The crude triflate was dissolved in
dry acetonitrile (20 mL) and cooled to 08C. DBU (152 mL, 0.112 mmol)
was added dropwise. During stirring of the reaction mixture for 3 h at
room temperature, a white solid precipitated. The reaction mixture was
kept at À208C for 14 h. The precipitate was filtered off and washed with
acetonitrile. The filtrate was concentrated in vacuo. The residue was puri-
fied by flash column chromatography (silica gel, dichloromethane with
5% methanol). Nucleoside 9 was obtained as a white foam (213 mg,
0.69 mmol, 75%); Rf =0.33 (dichloromethane with 10% methanol);
1H NMR (600 MHz, CDCl3): d=1.92 (s, 3H; CH3-5), 2.06 (s, 3H;
6), 11.1 ppm (brs, 1H; NH); 13C NMR (150.9 MHz, CDCl3): d=12.4
(CH3-5), 41.9 (C-2’), 55.5 (ArOMe), 59.5 (OMe), 65.9 (C-5’), 72.7(C-3’),
G
À
73.7 (4’-C CH2), 87.7, 89.6 (C-4’, CAr3), 90.2 (C-1’), 114.0 (Ar C), 116.6
(C-5), 127.8, 128.8, 129.1, 131.1, 136.8 (Ar C), 136.4, 136.6, 145.8 (Ar C,
C-6), 159.7, 159.8 (Ar C), 175.8 ppm (C-2); MALDI-TOF MS (DHB
matrix): m/z: 627.3 [M+Na]+, 643.4 [M+K]+.
General procedure for coupling of 5’-O-protected nucleosides to succiny-
lated LCAA-CPG: Compounds 1, 4, 11, 5’-O-(4,4’-dimethoxytrityl)-(3-N/
4-O-toluoyl)-2-S-thiothymidine and 5’-O-(4,4’-dimethoxytrityl)-4-S-(2-cy-
anoethyl)thiothymidine were coupled to succinylated LCAA-CPG by fol-
lowing standard protocols.[32] Briefly, succinylated LCAA-CPG, the re-
spective nucleosides, DMAP (0.1 mmol of each per 1.0 g of CPG) and
EDC (1.0 mmol per 1.0 g of CPG) were combined. Pyridine (10 mL per
1.0 g of CPG) and NEt3 (80 mL per 1.0 g of CPG) were added and the re-
action mixture was shaken under argon overnight. Afterwards, 4-nitro-
phenol (0.5 mmol per 1.0 g of CPG) was added and shaking was contin-
ued for an additional 24 h. Piperidine (5 mL per 1.0 g of CPG) was subse-
quently added and shaking was continued for 5 min. The beads were
then filtered off and washed successively with pyridine, methanol and fi-
nally dichloromethane. After drying, the beads were suspended in equal
amounts of acetic anhydride/pyridine/THF (Cap A) and 1-methylimida-
zole/THF (Cap B) capping reagents. After being shaken for 2 h, the
beads were filtered off and intensively washed as described above. After
drying, the loading was determined by trityl analysis of a small portion of
the collected beads by known methods (loading range 12.7–
44.8 mmolgÀ1).[32]
2
3
3
2
OCH3), 2.49 (ddd, J=15.7, J=8.2, J<1 Hz, 1H; H-2’a), 2.80 (ddd, J=
15.7, 3J=7.3, 3J<1 Hz, 1H; H-2’b), 3.31 (s, 3H; OCH3), 3.53 (d, 2J=
2
À
À
10.2 Hz, 1H; 4’C CH2a), 3.60 (d, J=10.2 Hz, 1H; 4’C CH2b), 4.15 (d,
2J=13.2 Hz, 1H; H-5’a), 4.53 (d, 2J=13.2 Hz, 1H; H-5’b), 5.57 (dd, 3J=
3
3
3
7.3, J<1 Hz, 1H; H-3’), 5.73 (dd, J=8.2, J<1 Hz, 1H; H-1’), 7.27 ppm
(s, 1H; H-6); 13C NMR (150.9 MHz, CDCl3): d=13.2 (CH3-5), 20.7
À
(COCH3), 42.1 (C-2’), 59.8 (OCH3), 70.5 (4’-C CH2), 74.4 (C-3’), 76.9
(CH2-5’), 88.7 (C-4’), 92.7 (C-1’), 120.3 (C-5), 138.9 (C-6), 158 (C-2),
170.8 (COCH3), 172.6 ppm (C-4); MALDI-TOF MS (DHB matrix): m/z:
311.0 [M+H]+, 333.0 [M+Na]+, 349.0 [M+K]+.
Synthesis ofmodiifed oligonucleotides : The synthesis of oligonucleotides
was carried out on a 0.2 mmol scale on an Applied Biosystems 392 DNA
synthesiser with commercially available 2-(cyanoethyl)phosphoramidites.
A standard method for 2-(cyanoethyl)phosphoramidites was used, with
the exception that the coupling times for the synthesis from the solid-
phase bound modified nucleotides were extended to 10 min. Yields for
modified oligonucleotides are similar to those obtained for unmodified
oligonucleotides. After synthesis (trityl off), the oligonucleotides were
cleaved from the support by treatment with concentrated NH4OH at
room temperature for 24 h. For the primer probes bearing 4ST and 4STOMe
at the 3’ end, NaSH hydrate (ꢀ8–10 mg) was added into the concentrat-
ed NH4OH. After removal of NH4OH, the residue was purified by prepa-
rative gel electrophoresis on a 12% polyacrylamide gel containing 8m
urea. The DNA oligonucleotides were recovered by standard precipita-
tion with ethanol in the presence of 0.3m sodium acetate. The oligonucle-
otides were purified a second time by using HPLC with 0.1m triethylam-
monium acetate buffer (pH 7). After removal of the solvent, the oligonu-
cleotides were dissolved in water and quantified by absorption measure-
ments at 260 nm. The total yields of purified oligonucleotides were in the
range of 20–33%. The integrity of all modified oligonucleotides was con-
firmed by MALDI-TOF (Metabion GmbH) or ESI-MS. The presence of
all thio modifications was also verified spectroscopically by their charac-
teristic absorption bands at 335 and 277 nm, respectively, during HPLC
purification.
2-Thio-3’-O-acetyl-4’-C-methoxymethylene thymidine (10): Nucleoside 9
(118 mg, 0.38 mmol) was dissolved in pyridine (5 mL) in an autoclave.
The solution was cooled to À688C and condensated H2S (ꢀ10 mL) was
subsequently added. The autoclave was immediately closed and the reac-
tion mixture was stirred at 458C for 12 days under pressure (23 bar). The
autoclave was then slowly opened, the remaining H2S in the mixture was
purged with N2 gas for 30 min and the solvent was removed in vacuo.
The residue was purified by flash column chromatography (silica gel, di-
chloromethane with 2% methanol) to give nucleoside 10 as a colourless
foam (37 mg, 0.107 mmol, 28%); Rf =0.42 (dichloromethane with 10%
methanol); 1H NMR (600 MHz, [D6]acetone): d=1.87 (d, 4J=1.1 Hz,
3H; CH3-5), 2.09 (s, 3H; OAc), 2.45 (ddd, 2J=14.0, 3J=3J=7.0 Hz, 1H;
H-2’a), 2.56 (ddd, 3J=3.7, 6.5, 2J=14.0 Hz, 1H; H-2’b), 3.33 (s, 3H;
2
2
À
À
OMe), 3.51 (d, J=9.9 Hz, 1H; 4’C CH2a), 3.53 (d, J=9.9 Hz, 1H; 4’C
CH2b), 3.84 (m, 2H; H-5’), 4.62 (dd, 3J=3J=4.8 Hz, 1H, HO-5’), 5.56
(dd, 3J=3.7, 3J=7.0 Hz, 1H, H-3’), 7.0 (dd, 3J=3J=6.7 Hz, 1H; H-1’),
8.19 (d, 4J=1.1 Hz, 1H; H-6), 11.1 ppm (brs, 1H; NH); 13C NMR
(150.9 MHz, CDCl3): d=13.9 (CH3-5), 21.8 (OCOCH3), 40.6 (C-2’), 60.6
À
(OMe), 65.2 (C-5’), 74.1 (4’C CH2), 74.9 (C-3’), 89.3 (C-1’), 90.4 (C-4’),
117.5 (C-5), 138.4 (C-6), 162 (C-4), 171.2 (OCOCH3), 176.9 ppm (C-2);
MALDI-TOF MS (DHB matrix): m/z: 344.7.0 [M+H]+, 366.7 [M+Na]+.
2-Thio-5’-O-(4,4’-dimethoxytrityl)-4’-C-methoxymethylene
thymidine
Real-time PCR experiments: Real-time PCR was performed as described
by using an iCycler system (BIORAD). In brief, the reactions were per-
formed in an overall volume of 20 mL containing 400 pm of the respective
templates, in the appropriate buffer provided by the supplier for Vent
(exoÀ) DNA polymerase (20 mm tris(hydroxymethyl)aminomethane-HCl
(Tris-HCl; pH 8.8), 10 mm KCl, 10 mm (NH4)SO4, 2 mm MgSO4, 0.1%
Triton-X100). The final mixtures contained dNTPs (200 mm each of deox-
yadenosine triphosphate (dATP), deoxyguanosine triphosphate (dGTP),
deoxycytidine triphosphate (dCTP), and TTP), primers (0.5 mm each of
the respective primer probe and reverse primer), 0.4 units Vent (exoÀ)
DNA polymerase (New England Biolabs; units defined by the supplier)
and a 1/50000 aqueous dilution of a SybrGreenI 10000” solution in di-
methylsulfoxide (DMSO; Molecular Probes). All PCR amplifications
were performed by employing the following program: initial denaturation
at 958C for 3 min, followed by 40 cycles of denaturation at 958C for 30 s,
primer annealing at 558C for 35 s and extension at 728C for 40 s. The
presented results are from at least three repeated independent measure-
ments of duplicates that originated from one master mix. Identical tem-
(11): 4,4’-Dimethoxytritylchloride (33.3 mg, 0.11 mmol) and DMAP
(1.2 mg, 10 mmol) were added to a solution of nucleoside 10 (26 mg,
0.0756 mmol) in dry pyridine (1 mL). After the reaction mixture had
been stirred at room temperature for 15 h, MeOH (200 mL) was added.
The solvent was removed in vacuo and the residue was dissolved in
EtOH (0.5 mL), pyridine (0.5 mL) and concentrated NH4OH (25%,
750 mL). After the reaction mixture had been stirred for 48 h, the solvent
was removed and the residue was purified by MPLC (ethyl acetate/petro-
leum ether 1:3 with 1% NEt3). Nucleoside 11 was obtained as a white
foam (18.3 mg, 0.03 mmol, 40%); Rf =0.41 (ethyl acetate/petroleum
ether 1:1 with 1% NEt3); 1H NMR (600 MHz, [D6]acetone): d=1.45 (d,
4J=1.1 Hz, 3H; CH3-5), 2.32 (ddd, 2J=13.3, 3J=3J=6.5 Hz, 1H; H-2’a),
2.61 (ddd, 2J=13.3, 3J=4.5, 6.5 Hz, 1H; H-2’b), 3.30 (s, 3H; OMe), 3.36
2
2
À
À
(d, J=10.1 Hz, 1H; 4’C CH2a), 3.43 (d, J=10.1 Hz, 1H; 4’C CH2b),
2
2
3.58 (d, J=10.0 Hz, 1H; H-5’a), 3.64 (d, J=10.0 Hz, 1H; H-5’b), 3.80 (s,
6H; ArOMe), 4.37 (d, 3J=4.7 Hz, 1H; HO-3’), 4.70 (m, 1H; H-3’), 6.92
(m, 4H; Ar), 7.01 (dd, 3J=3J=6.5 Hz, 1H; H-1’), 7.30 (m, 1H; Ar H),
7.33–7.38 (m, 6H; Ar H), 7.50 (m, 2H; Ar), 7.82 (d, 4J=1.1 Hz, 1H; H-
Chem. Eur. J. 2007, 13, 6115 – 6122
ꢀ 2007 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.chemeurj.org
6121

A. Marx and R. Kranaster
plate-target, primer-probe and reverse-primer DNA sequences were used
to those employed in earlier studies for comparison. Sequences in the
Farber disease[38] context: primer probes: 5’-d(CGTTGGTCCTGAAG-
[7]M. V. Relling, T. Dervieux, Nat. Rev. Cancer 2001, 1, 99–108.
[8]M. Chicurel, Nature 2001, 412, 580–582.
[9]P. Y. Kwok, Annu. Rev. Genomics Hum. Genet. 2001, 2, 235–258.
[10]B. W. Kirk, M. Feinsod, R. Favis, R. M. Kliman, F. Barany, Nucleic
Acids Res. 2002, 30, 3295–3311.
[11]A. C. Syvänen, Nat. Rev. Genet. 2001, 2, 930–942.
[12]M. M. Shi, Clin. Chem. 2001, 47, 164–172.
[13]R. M. Twyman, S. B. Primrose, Pharmacogenomics 2003, 4, 67–79.
[14]P. Y. Kwok, X. Chen, Curr. Issues Mol. Biol. 2003, 5, 43–60.
[15]P. Y. Kwok, Single Nucleotide Polymorphisms—Methods and Proto-
cols, Humana Press, Totowa, 2003.
[16]M. Strerath, A. Marx, Angew. Chem. 2005, 117, 8052–8060; Angew.
Chem. Int. Ed. 2005, 44, 7842–7849.
[17]C. R. Newton, A. Graham, L. E. Heptinstall, S. J. Powell, C. Summ-
ers, N. Kalsheker, J. C. Smith, A. F. Markham, Nucleic Acids Res.
1989, 17, 2503–2516.
[18]R. A. Gibbs, P. N. Nguyen, C. T. Caskey, Nucleic Acids Res. 1989, 17,
2437–2448.
[19]S. Germer, M. J. Holland, R. Higuchi, Genome Res. 2000, 10, 258–
266.
[20]D. Y. Wu, L. Ugozzoli, B. K. Pal, R. B. Wallace, Proc. Natl. Acad.
Sci. USA 1989, 86, 2757–2760.
[21]L. Shively, L. Chang, J. M. LeBon, Q. Liu, A. D. Riggs, J. Singer-
Sam, Biotechniques 2003, 34, 498–502.
[22]Z. Guo, Q. H. Liu, L. M. Smith, Nat. Biotechnol. 1997, 15, 331–335.
[23]Y. Ishikawa, K. Tokunaga, K. Kashiwase, T. Akaza, K. Tadokoro, T.
Juji, Hum. Immunol. 1995, 42, 315–318.
[24]J. Wilhelm, H. Reuter, B. Tews, A. Pingoud, M. Hahn, Biol. Chem.
2002, 383, 1423–1433.
[25]M. Strerath, A. Marx, Angew. Chem. 2002, 114, 4961–4963; Angew.
Chem. Int. Ed. 2002, 41, 4766–4769.
[26]M. Strerath, J. Gaster, D. Summerer, A. Marx, ChemBioChem 2004,
5, 333–339.
GAGGAT*) with T*: T, 2ST, 4ST, TOMe 2STOMe or 4STOMe; reverse primer:
,
5’-d(CGCGCAGCACGCGCCGCCGT); target template FarX: 5’-
d(CCGTCAGCTGTGCCGTCGCGCAGCACGCGCCGCCGTGGA
CAGAGGACTGCAGAAAATCAACCTNTCCTCCTTCAGGAC
CAACGTACAGAG) where N: A, FarA; G, FarG.
DNA thermal-denaturation studies: Melting curves were recorded on a
Cary 100 bio UV/Vis instrument with temperature controller. Data were
obtained from three individual cooling/heating cycles. Melting tempera-
tures (Tm values in 8C) were obtained from the maximum of the first de-
rivative of the melting curves (absorbance at 260 nm versus temperature).
Measurements were conducted in the appropriate Vent (exoÀ) DNA
polymerase buffer (ThermoPol, New England BioLabs) without Triton-
X100 (20 mm Tris-HCl (pH 8.8), 10 mm KCl, 10 mm (NH4)SO4, 2 mm
MgSO4) and contained 4.75 mm duplex DNA. The mixtures were heated
to 958C for 5 min and slowly cooled to room temperature prior to the
melting curve measurements. A measurement of the buffer was conduct-
ed separately and subtracted from the spectra resulting from the sample.
Template (33-mer): 5’-d(AAATCAACCTA/GTCCTCCTTCAGGAC-
CAACGTAC)-3’; primer probe containing T, 2ST, 4ST, TOMe
,
2STOMe or
4STOMe: as above.
Circular dichroism spectra: CD spectra were recorded on a Jasco 720 in-
strument in ThermoPol buffer (New England Biolabs; 20 mm Tris-HCl
(pH 8.8), 10 mm KCl, 10 mm (NH4)SO4, 2 mm MgSO4, 0.1% Triton-X100)
at room temperature. The samples contained 4.75mm duplex DNA. The
mixtures were heated to 958C for 5 min and allowed to cool slowly to
room temperature prior to measurements. A spectrum of the buffer was
measured separately and subtracted from the spectra resulting from the
samples. An average of 12 spectra were recorded in each experiment.
The sequences were as described in the previous section.
Single-nucleotide incorporation studies: The reactions contained varying
enzyme amounts (0.8–8 nm) and primer (150 nm)–template (300 nm) com-
plex in ThermoPol buffer. Primer–template complexes were annealed
and the reaction was initiated by addition of different concentrations of
dATP in solution. After incubation for different times at 728C, reactions
were quenched by addition of two reaction volumes of gel-loading buffer
(80% formamide, 20 mm ethylenediamine tetraacetate (EDTA)) and the
product mixtures were analysed by 12% denaturating PAGE. Incorpora-
tion quantities were measured by quantifying the intensity of each band
produced by the DNA polymerase by using a Phosphorimager. From this
quantification, the amount of incorporated nucleotide was calculated.
The intensity of the background was subtracted from each band. The re-
action conditions were adjusted for different reactions to allow 20% or
less of primer extension, thereby ensuring single-completed-hit conditions
according to published procedures.[40] Steady-state KM and kcat values
were obtained by fitting with the Hanes–Woolf equation. The presented
results are from measurements that were repeated independently at least
three times.
[27]M. Strerath, J. Gaster, A. Marx, ChemBioChem 2004, 5, 1585–1588.
[28]B. Tews, J. Wilhelm, D. Summerer, M. Strerath, A. Marx, P. Friedh-
off, A. Pingoud, M. Hahn, Biol. Chem. 2003, 384, 1533–1541.
[29]D. Latorra, K. Campbell, A. Wolter, J. M. Hurley, Hum. Mutat.
2003, 22, 79–85.
[30]J. Gaster, A. Marx, Chem. Eur. J. 2005, 11, 1861–1870.
[31]M. Biedermann, H. Hartung, W. Dolling, P. Verjus, Acta Crystallogr.
Sect. C 1998, 54, 507–509.
[32]R. T. Pon in Current Protocols in Nucleic Acids Chemistry (Eds.:
S. L. Beaucage, D. E. Bergstrom, G. D. Glick, R. A. Jones), Wiley,
New York, 2000.
[33]T. T. Nikiforov, B. A. Connolly, Tetrahedron Lett. 1992, 33, 2379–
2382.
[34]J. Klose, C. B. Reese, Q. Song, Tetrahedron 1997, 53, 14411–14416.
[35]B. A. Connolly, P. C. Newman, Nucleic Acids Res. 1989, 17, 4957–
4974.
[36]K. A. Watanabe, C. K. Chu, U. Reichman, J. J. Fox in Nucleic Acid
Chemistry, Vol. 1 (Ed.: L. B. Townsend), Wiley, New York, 1978,
p. 343.
[37]K. A. Watanabe, U. Reichman, C. K. Chu, J. J. Fox in Nucleic Acid
Chemistry, Vol. 1 (Ed.: L. B. Townsend) Wiley, New York, 1978,
p. 273.
Acknowledgement
[38]Primer and template sequences are in the context of human acid ce-
ramidase comprising the A107 mutation see: J. Bär, T. Linke, K.
Ferlinz, U. Neumann, E. H. Schuchman, K. Sandhoff, Hum. Mutat.
2001, 17, 199–209.
[39]J. Wilhelm, A. Pingoud, ChemBioChem 2003, 4, 1120–1128.
[40]S. Creighton, L. B. Bloom, M. F. Goodman, Methods Enzymol. 1995,
262, 232–256.
We wish to thank N. Z. Rudinger and C. Glçckner for expert support
and Dr. K.-H. Jung for his comments on the manuscript. Financial sup-
port by the Deutsche Forschungsgemeinschaft is gratefully acknowl-
edged.
[41]H. O. Sintim, E. T. Kool, J. Am. Chem. Soc. 2006, 128, 396–397.
[42]D. Summerer, A. Marx, J. Am. Chem. Soc. 2002, 124, 910–911.
[1]Homepage of the SNP Consortium: http://snp.cshl.org/
[2]D. R. Bentley, Nature 2004, 429, 440–445.
[3]W. E. Evans, M. V. Relling, Nature 2004, 429, 464–468.
[4]J. Bell, Nature 2004, 429, 453–456.
[5]L. Licinio, M. Wong, Pharmacogenomics, Wiley-VCH, Weinheim,
2002.
Received: November 14, 2006
Revised: March 3, 2007
[6]J. J. McCarthy, R. Hilfiker, Nat. Biotechnol. 2000, 18, 505–508.
Published online: April 26, 2007
6122
www.chemeurj.org
ꢀ 2007 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Chem. Eur. J. 2007, 13, 6115 – 6122