Synthetic ribofuranose-containing polymers show catalytic activity in the hydrolysis of phosphodiesters

Article abstract of DOI:10.1039/a607522c

Synthetic polymers containing ribofuranose rings as pendent groups catalyse the cleavage of DNA and the hydrolysis of phosphodiesters with a rate acceleration of 10³ compared with that of the uncatalysed reactions.

Full text of DOI:10.1039/a607522c

View Article Online / Journal Homepage / Table of Contents for this issue
Synthetic ribofuranose-containing polymers show catalytic activity in the
hydrolysis of phosphodiesters
Man Jung Han,*a Kyung Soo Yoo,a Tae Joon Cho,a Ji Young Chang,a Yu Jin Chab and Seok Hyun Namb
a Department of Applied Chemistry, Ajou University, Suwon 442-749, Republic of Korea
b Department of Biological Science, Ajou University, Suwon 442-749, Republic of Korea
Synthetic polymers containing ribofuranose rings as pen-
dent groups catalyse the cleavage of DNA and the hydrolysis
of phosphodiesters with a rate acceleration of 103 compared
with that of the uncatalysed reactions.
C-3A and C-4A on the pyranose ring of 5 were in either the aeea
or eaae conformations. Approximately 30% of the 1A-OH
groups of 1 and 3 were in the cis-configuration with respect to
2A-OH on the same furanose rings.‡
Hydrolysis rates of ethyl p-nitrophenyl phosphate (substrate)
were measured in Tris buffers (pH = 7.4, ionic strength = 0.02,
KCl) via the UV absorption (400 nm) of the p-nitrophenol
evolved. To check whether any side reaction other than the
hydrolysis of the substrate occurred (Scheme 1), the reaction
mixtures in the presence of 1 or 3 ([substrate] = 4.67 3 1024
m, [1] = [3] = 1.62 3 1025 m, pH = 7.4 at 50 °C, 24 h) were
examined by 31P NMR. In both cases only two peaks, at d 2.69
for ethyl phosphate and d 25.97 for the substrate (relative to
phosphoric acid at d 0), were observed. The same result was
also obtained by liquid chromatography analysis, indicating that
the hydrolysis occurred exclusively.
By measuring the hydrolysis rates in the buffer solution alone
and in the presence of the monomers (succinic acid and
ribofuranose) and the polymers 1–5 at 50 °C, it was found that
polymers 4 and 5 and the monomers showed no acceleration of
the hydrolysis, while 1, 2 and 3 with vic-cis-diols on the
furanose rings exhibited catalytic activity. These results sug-
gested that the vic-cis-diols of furanose rings were responsible
for the catalytic activity. The vic-dicarboxyl groups of the
polymers were of little importance for the catalytic activity, as
seen in the results of the reactions of 3, 4 and 5.
In the past three decades there has been great interest in the
synthesis of enzyme-like polymers.1,2 A few synthetic polymers
have been found to show catalytic activity; for example,
imidazole-containing polymers are reported to catalyse the
hydrolysis of phenyl esters.3,4 While investigating poly-
nucleotide analogues,5–8 we have found that synthetic ribo-
furanose-containing polymers show catalytic activity for the
hydrolysis of phosphodiesters and the cleavage of oligodeoxy-
ribonucleotides. This is the first example of synthetic polymer
catalysis of phosphodiester hydrolysis.
The catalytic activity seemed to be caused by the hydroxy
groups on the furanose rings of the polymers. In order to
elucidate the structural requirements for the catalytic activity,
five polymers were synthesized.† Polymers 1–4 contained
ribofuranose derivatives, while polymer 5 had pyranose rings in
their polymer chains. The number-average molecular weights of
polymers 1–5 were measured to be 8.4, 13.0, 9.3, 9.5 and 17.0
3 103 by gel permeation chromatography, respectively. The
vic-OH groups at C-2A and C-3A on the furanose rings of 1–3
were in the cis-configuration, while the OH groups at C-1A, C-2A,
In the hydrolysis, the measured rate (vm) is the sum of the rate
of the catalysed reaction (vc) and the uncatalysed reaction (vb)
[eqn. (1)]. The value of vc was therefore obtained from eqn. (2).
O
O
O
OH
OMe
OH
vm = vc + vb
vc = vm 2 vb
(1)
(2)
OH OH
CO2H
OH OH
CO2H
OH OH
CO2Me
The initial vc values were obtained at constant concentrations of
1, 2 and 3 by changing the substrate concentrations. Michaelis–
Menten kinetics for 1, 2 and 3 were confirmed by performing
the double reciprocal plot of Lineweaver and Burk [v]21 (vs.
[substrate]21) (Fig. 1), which gave Km and Vmax. The kcat was
obtained from eqn. (3). We assumed that each polymer
CO2H
CO2H
CO2Me
n
n
n
1
2
3
O
HO
O
OH
OH
OH
OH
kcat = Vmax/[E]o
(3)
chain formed one active site, since no significant catalytic
activity for the polymers with Mn’s lower than 4000 (PD = 4)
was observed. The kcat values were found to be 4.22 3 1021 h21
for polymer 1, 1.65 3 1021 h21 for 2, and 9.04 3 1021 h21 for
3. The kcat of 3 was about 103 higher than that of the uncatalysed
reaction (9.12 3 1024 h21). Polymers 1 and 3 showed higher
catalytic activities than 2, probably because the former
polymers contained ca. 30% more vic-cis-diol groups than the
latter.
Noncompetitive inhibition was observed by addition of
phenylboronic acid (KI = 3.33 3 1024 m) and K2HPO4
(KI = 2.38 3 1024 m). Competitive inhibition was found in the
presence of acetate ions (KI = 6.02 3 1024 m). Both forms of
inhibition seemed to occur because the vic-cis-diols were
blocked by formation of hydrogen bonds with the inhibitors.
ssDNA of 30 bases was incubated in a buffer solution in the
presence of the polymers, and developed on acrylamide gel
O
O
CO2H
CO2H
CO2H
CO2H
n
n
4
5
O
H2O
RO
P
O–
O
NO2
OH
+
polymer
O
P
RO
+
HO
NO2
O–
Chem. Commun., 1997
163

View Article Online
(Fig. 2). The extent of ssDNA cleavage was observed in the
order of polymer 3 > polymer 1 > polymer 2, which was
coincident with the kcat of the polymers. Polymers 1, 2 and 3
containing vic-cis-diol groups of the furanose ring showed clear
DNase activity, while no cleavage was observed in the buffer
solution or in the presence of 4 or 5.
Since no activity was found for the monomer pair, the
polymers are likely to form the active sites with a specific
conformation. It seems possible that the furanose rings having
vic-cis-diol groups were located inside the active sites, where
the phosphodiester substrates were also accommodated. The
vic-cis-diol groups seem to form hydrogen bonds with the two
oxygen atoms of the phosphate so as to activate the phosphorus
atoms attacked by nucleophiles (H2O). Further investigation of
the mechanism is in progress.
This work was supported by the Korea Science and
Engineering Foundation and Korean Ministry of Education.
Footnotes
† Copolymerization of 1-O-acetyl-5-deoxy-2,3-isopropylidene-d-erythro-
pent-4-enofuranose with maleic anhydride (molar ratio 1:2) in bulk at
90 °C for 13 h in the presence of AIBN (2 mol%) resulted in the alternating
copolymer, which was hydrolysed to give 1 using aqueous HCl–dioxane at
97 °C for 24 h and to give 4 using 0.1 m NaOH at room temperature for 24
h. Polymer 1 was esterified with CH2N2 to give 3. Polymer 2 was obtained
by copolymerization of 1-O-methyl-5-deoxy-2,3,-O-isopropylidene-d-ery-
thro-pent-4-enofuranose with maleic anhydride under the same condition as
described above and subsequent hydrolysis of the polymer using formic
acid at 107 °C for 13 h. Polymer 5 was synthesized by copolymerization of
6-deoxy-1,2:3,4-di-O-isopropylidene-a-d-galacto-hex-5-enopyranose
with maleic anhydride under the same conditions described above and
subsequent hydrolysis in 68% formic acid at 100 °C for 13 h.
V
‡ To determine the configuration of the C-1 atoms of the monomers,
1,2,3-tri-O-acetyl-5-O-trityl-d-ribofuranose was prepared by tritylation and
subsequent acetylation of d-ribose, from which the monomers were also
prepared. The configuration of the C-1 atom remained intact during
polymerization, and the protection and deprotection reactions of the C-1
hydroxy group. In the a form, the C-1 proton is cis with respect to the C-2
proton, while in the b form, the C-1 proton is trans with respect to the C-2
proton. In the 1H NMR spectrum of 1,2,3-tri-O-acetyl-5-O-trityl-d-
ribofuranose in CDCl3, two peaks appeared at d 6.54 (d, J = 4 Hz) and 6.22
(s) from the C-1 protons of the a and b forms. The singlet peak at d 6.22 and
the doublet peak at d 6.54 were assigned to the proton of b form and the
proton of a form, respectively, since the angle between the C-1 proton of the
a form and the C-2 proton was nearly zero and thus a larger coupling
constant was expected. The ratio of the a and b forms was calculated from
the peak area ratio.
–1
3
3
–1
[substrate] / 10 dm mol
Fig. 1 The reciprocals of the initial rates as a function of the reciprocals of
the substrate concentrations for polymers (“) 1, (!) 2 and (5) 3:
[polymer] = 1.62 3 1025 m in Tris buffer at pH = 7.4, 50 °C, ionic
strength = 0.02 (KCl)
(e)
(d)
(c)
(b)
(a)
References
1 T. Kunitake and Y. Okahata, Adv. Polym. Sci., 1976, 20, 159.
2 T. Kunitake, Polymer-supported Reactions in Organic Synthesis, ed. P.
Hodge and D. C. Sherrington, Wiley, New York, 1980, p. 195.
3 C. G. Overberger, T. T. Pierre, N. Vorchheimer and S. Yaroslavsky,
J. Am. Chem. Soc., 1963, 85, 3513.
4 C. G. Overberger and T. W. Smith, Macromolecules, 1975, 8, 416.
5 M. J. Han, C. H. Lee, K. H. Kim and S. H. Lee, Macromolecules, 1992,
25, 3528.
6 M. J. Han, S. M. Park, J. Y. Park and S. H. Yoon, Macromolecules, 1992,
25, 3534.
7 M. J. Han, Y. S. Chang, J. Y. Park and K. H. Kim, Macromolecules, 1992,
25, 6574.
8 M. J. Han, K. S. Kim, T. J. Cho, K. H. Kim and J. Y. Chang,
Macromolecules, 1994, 27, 2896.
9 B. Maruer, H. Barnnert, G. Darai and R. M. Flu¨gel, J. Virol., 1988, 62,
1590.
Fig. 2 Autoradiogram of 7 m urea–8% acrylamide gel electrophoretic
analysis of the reaction mixtures. 32P-Labelled ssDNA of 30 bases,
d(CATGGCAAAGCCAGTATACAAATTGTAATA), corresponding to
the human foamy virus proviral DNA in position nt. 3634-3611 (ref. 9), was
incubated at 37 °C, ionic strength = 0.02 (KCl) and pH = 7.4 (Tris buffer),
for 12 h (a) with no additive, in the presence of (b) polymer 1, (c) polymer
3, (d) polymer 2 and (e) polymer 4. [DNA]
=
7.5 3 1024 m,
[polymer] = 7.3 3 1025 m. No DNA cleavage was observed in the buffer
or in the presence of polymer 4, while polymers 1, 2 and 3 catalysed
hydrolysis of DNA.
Received, 5th November 1996; Com. 6/07522C
164
Chem. Commun., 1997