Molecular Characterization and Potential Synthetic Applications of GH1 β-Glucosidase from Higher Termite Microcerotermes annandalei

Appl Biochem Biotechnol

https://doi.org/10.1007/s12010-018-2781-8

Molecular Characterization and Potential Synthetic

Applications of GH1 β-Glucosidase from Higher Termite

Microcerotermes annandalei

1

Siriphan Arthornthurasuk & Wantha Jenkhetkan

&

2

3

Eukote Suwan & Daranee Chokchaichamnankit

Chantragan Srisomsap & Pakorn Wattana-Amorn

Jisnuson Svasti & Prachumporn T. Kongsaeree

&

3

4

&

3

,5

1,2

Received: 1 March 2018 /Accepted: 8 May 2018

#

Springer Science+Business Media, LLC, part of Springer Nature 2018

Abstract A novel β-glucosidase from higher termite Microcerotermes annandalei (MaBG)

was obtained via a screening method targeting β-glucosidases with increased activities in the

presence of glucose. The purified natural MaBG showed a subunit molecular weight of 55 kDa

and existed in a native form as a dimer without any glycosylation. Gene-specific primers

designed from its partial amino acid sequences were used to amplify the corresponding 1,419-

bp coding sequence of MaBG which encodes a 472-amino acid glycoside hydrolase family 1

(GH1) β-glucosidase. When expressed in Komagataella pastoris, the recombinant MaBG

appeared as a ~ 55-kDa protein without glycosylation modifications. Kinetic parameters as

well as the lack of secretion signal suggested that MaBG is an intracellular enzyme and not

involved in cellulolysis. The hydrolytic activities of MaBG were enhanced in the presence of

Electronic supplementary material The online version of this article (https://doi.org/10.1007/s12010-018-

2781-8) contains supplementary material, which is available to authorized users.

*

Prachumporn T. Kongsaeree

fscippt@ku.ac.th

1

2

Department of Biochemistry, Faculty of Science, and Center for Advanced Studies in Tropical

Natural Resources, NRU-KU, Kasetsart University, 50 Paholyotin Road, Chatuchak, Bangkok 10900,

Thailand

Interdisciplinary Graduate Program in Genetic Engineering, Faculty of Graduate School, Kasetsart

University, Bangkok 10900, Thailand

3

4

Laboratory of Biochemistry, Chulabhorn Research Institute, Bangkok 10210, Thailand

Department of Chemistry, Center of Excellence for Innovation in Chemistry and Special Research

Unit for Advanced Magnetic Resonance, Faculty of Science, Kasetsart University, Bangkok 10900,

Thailand

5

Department of Biochemistry and Center for Excellence in Protein and Enzyme Technology, Faculty

of Science, Mahidol University, Bangkok 10400, Thailand

Appl Biochem Biotechnol

up to 3.5-4.5 M glucose, partly due to its strong transglucosylation activity, which suggests its

applicability in biosynthetic processes. The potential synthetic activities of the recombinant

MaBG were demonstrated in the synthesis of para-nitrophenyl-β-D-gentiobioside via

transglucosylation and octyl glucoside via reverse hydrolysis. The information obtained from

this study has broadened our insight into the functional characteristics of this variant of termite

GH1 β-glucosidase and its applications in bioconversion and biotechnology.

.

Keywords β-Glucosidase Glycoside hydrolase family 1 Higher termite Microcerotermes

.

annandalei Reverse hydrolysis Transglucosylation

Introduction

β-Glucosidases (E.C. 3.2.1.21) are glycoside hydrolases that cleave the β-glucosidic linkage, from

the nonreducing end, between two glucose molecules (e.g., β1 → 4 in cellobiose) or glucose-

substituted molecules. β-Glucosidases belong to glycoside hydrolase (GH) families 1, 3, 5, 9, 30,

and 116 [1, 2]. Under specified conditions, some β-glucosidases also exhibit synthetic activities via

reverse hydrolysis or transglucosylation reactions [2]. Industrial applications of both hydrolytic and

synthetic activities of β-glucosidases are growing considerably, including conversion of lignocellu-

losic biomass into bioethanol and other useful biomaterials, improvement of nutritional and

organoleptic qualities in food and fruit juice products, production of aromatic compounds from

flavorless precursors, and synthesis of oligosaccharides and alkyl-glucosides [3–8].

However, one of the major hindrances of employing the hydrolytic activities of β-glucosidases in

biotechnological processes is product inhibition, by which high concentrations of glucose inhibit the

hydrolytic activities. Thus, glucose tolerance is a desirable quality in β-glucosidases, and many

glucose-tolerant β-glucosidases from various sources have been reported, including bacteria [9–11],

fungi [12–20], plants [21], metagenomic libraries [22–25], and insects [26–29]. However, many of

the glucose tolerant, and even glucose-enhanced, activities were shown to result from the

transglucosylation activity of the enzymes, and potential synthetic activities have only been

investigated in terms of the synthesis of glucodisaccharides (such as laminaribiose, cellobiose,

sophorose, and gentiobiose) from glucose [29].

Among xylophagous insects, termites (order Isoptera) are known to be the most efficient

cellulose decomposers [30], which makes them a good source to screen for valuable glycoside

hydrolase enzymes. Recent studies revealed that glycoside hydrolase activities residing in

termite body are not solely from gut symbionts but also from endogenous enzymes [31].

Information regarding termite β-glucosidase genes and enzymatic characterizations has been

growing markedly [27–29, 32–37]. All of the reported termite β-glucosidases were identified

as GH1. Among these, three termite β-glucosidases, from Nasutitermes takasagoensis,

Neotermes koshunensis, and Coptotermes formosanus, were reported to be glucose-tolerant

[27–29, 37], and only the activity of Neotermes koshunensis β-glucosidase was found to be

stimulated by glucose [27].

Our study here reports a screening method directly targeting β-glucosidases with a glucose-

enhanced activity from termite samples, which has successfully identified a GH1 β-

glucosidase from higher termite Microcerotermes annandalei (MaBG). The corresponding

MaBG cDNA was cloned, expressed as a recombinant enzyme, and characterized. The

recombinant MaBG exhibited synthetic activities via both reverse hydrolysis and

transglucosylation reactions. Our data presented here has helped to shed light on the functional

Appl Biochem Biotechnol

characteristics of the termite GH1 β-glucosidase and its applications in bioconversion and

biotechnology.

Materials and Methods

Materials

Worker termites were obtained from various provinces of Thailand, namely Bangkok (2

samples), Karnchanaburi (10 samples), Rachaburi (2 samples), and Uthaithani (5 samples).

All chromatographic columns, gel filtration calibration kit (high molecular weight), and Blue

Dextran 2000 were purchased from GE Healthcare (Buckinghamshire, UK). The recombinant

Dalbergia nigrescens β-glucosidase, Dnbglu2, was expressed and purified as described

previously [38]. All aryl glycosides and disaccharides were purchased from Sigma (St. Louis,

MO, USA). Other chemicals were of analytical grade.

Screening for Glucose-Enhanced β-Glucosidase Activities from Termite Crude

Extracts

Thirty worker termites from each source were ground in a mortar, in 0.1 M sodium acetate, pH

5

.5, containing 1 mM phenylmethylsulfonyl fluoride (PMSF) as a protease inhibitor. The

ground termites were sonicated for 30 min and centrifuged at 20,100×g for 30 min. The

supernatant was collected and incubated with 1 mM para-nitrophenyl-β-D-glucopyranoside

(pNP-Glc) in 0.1 M sodium acetate, pH 5.5, in the presence of 1.55 M glucose at 30 and 50 °C

for 30 min, and then the reaction was stopped with 2 M Na CO . The absorbance of para-

2

3

nitrophenol (pNP) released from the reaction was measured at 405 nm and compared to a

standard curve of pNP. One unit of enzyme activity was defined as the amount of enzyme used

to release 1 μmol of pNP in 1 min. The protein content was measured by using the Bio-Rad

protein assay reagent kit (Hercules, CA, USA) and compared to a standard curve of bovine

serum albumin.

Purification and Characterization of the Natural MaBG

A crude enzyme extract was prepared from approximately 16 g of M. annandalei worker

termites (approximately 4600 insects) as described above. The extract was fractionated by 30–

7

6

0% (w/v) ammonium sulfate. The precipitate was redissolved in 0.1 M sodium phosphate, pH

.0, containing 0.1 M NaCl. The crude enzyme was subjected to gel filtration chromatography

on a Sephacryl S-300 column, which was pre-equilibrated with 0.1 M sodium phosphate, pH

−1

6

.0, containing 0.1 M NaCl, and eluted with the same buffer, at a flow rate of 1 mL min .

Active fractions were pooled, concentrated by using centrifugal ultrafiltration, and then

subjected to anion exchange chromatography on a Hitrap Q HP column, which was pre-

equilibrated with 10 mM sodium phosphate, pH 6.0, and washed with the same buffer. The

target protein then was eluted with 10 mM sodium phosphate, pH 6.0, containing 1 M NaCl at

−1

a flow rate of 1 mL min . The active fractions were then pooled, concentrated, and further

purified by isoelectric chromatofocusing on a Mono P HR column, which was pre-equilibrated

with 10 mM sodium phosphate, pH 7.0. The protein was eluted with 1/10 dilution of

−1

polybuffer, pH 4.0, at a flow rate of 0.5 mL min . The protein content and β-glucosidase

Appl Biochem Biotechnol

activity in the presence of 1.55 M glucose at 50 °C were measured in each fraction before and

after loading into each column as described above.

The purity and subunit molecular weight of MaBG was determined by 10% SDS-PAGE. To

determine the native molecular weight, the purified MaBG was applied to a Sephacryl S-300

column that was pre-equilibrated with 50 mM sodium phosphate, pH 6.0, 150 mM NaCl, and

−1

eluted with the same buffer at a flow rate of 1 mL min . The native molecular weight of

MaBG was calculated by comparing its retention time with those of the standard proteins in

the gel filtration calibration kit, comprising ferritin (440 kDa), aldolase (158 kDa), conalbumin

(75 kDa), and ovalbumin (43 kDa), that were applied to the same column under the same

condition. Void volume was determined by using Blue Dextran 2000. Analysis of glycosyl-

ation was done by treating the purified MaBG with endoglycosidase H (New England

f

Biolabs, Ipswich, MA, USA) at 37 °C for 2 h under denaturing conditions according to the

manufacturer’s instructions, and cleavage products were examined by 10% SDS-PAGE. The

internal amino acid sequence of the MaBG was determined by nanoLC/MS/MS methods.

Briefly, a piece of SDS-PAGE gel containing the purified MaBG was digested with trypsin as

described previously [39]. The tryptic peptides were fractionated and their mass analyzed by

nanoflow liquid chromatography coupled with electrospray ionization (nano ESI MS/MS)

quadrupole time-of-flight tandem mass spectrometry (Q-ToF micro; Micromass, UK). The

obtained micromass (.pkl) output file was analyzed by Mascot program [40].

Molecular Cloning of the Complete Coding Sequence of MaBG

Total mRNAwas extracted from 20 mg of M. annandalei worker termites by using RNeasy kit

(Qiagen, Hilden, Germany). First-strand cDNAs were synthesized by using SMARTer RACE

Ready Amplification kit (Clontech, Mountain View, CA, USA). The first round of 5′ and 3′

RACE-PCR was performed by using the degenerate primers, Reverse GSP1 and Forward

GSP2 (Table 1), respectively, designed based on the conserved nucleotide sequences of other

reported β-glucosidases from higher termites, and the Advantage 2 Polymerase Mix

(Clontech, Mountain View, CA, USA). Then, specific primers, F1, F2, and R1 (Table 1),

designed based on the sequences of the first-round RACE-PCR products, were used in the

second round of 5′ and 3′ RACE-PCR. Then, cloning primers, MaBG Forward1 and MaBG

Reverse1 (Table 1), designed based on the sequences of the second-round RACE-PCR

products, were used to amplify the complete coding sequence of MaBG, which was then

ligated into pZErO™-2 cloning vector (Invitrogen, Carlsbad, CA, USA) at the EcoRV site,

transformed into Escherichia coli Top10, and sequenced.

The physical and chemical parameters of the deduced amino acid sequence were analyzed

using ProtParam program [41]. The presence of the signal peptide and glycosylation sites was

predicted by SignalP 4.1 [42], NetNGlyc 1.0 [43], and NetOGlyc 4.0 [44]. The deduced amino

acid sequence was blasted against the NCBI database using BLASTp algorithms to search for

its homologs [45]. The phylogenetic tree was generated by using MEGA6 [46] with the

maximum-likelihood method based on the Poisson correction model [47].

Expression and Purification of the Recombinant MaBG

For expression in E. coli, the MaBG gene was subcloned into the NdeI site of the pET15b

expression vector (Novagen, Madison, WI, USA), which was then transformed into the

expression host, E. coli BL21 DE3. For protein expression, the bacterial culture (O.D.₆₀₀

Appl Biochem Biotechnol

Table 1 Nucleotide sequences of the cloning primers

Primer names

Oligonucleotide sequences (5′ → 3′)

Reverse GSP1

Forward GSP2

F1

F2

R1

NTANNCNTTNGCNATCCAGTTCAG

CAAGATCTNGGNGGATGGNCNAAT

CGTCTTAGCGTGATGGCTGCTCTCG

TGCCACAGCCTCTACAAGATCTTGG

CTCCTCCTTGGTGAAACTGGGCAG

a

MaBG Forward1

MaBG Reverse1

MaBG Forward2

MaBG Reverse2

TTTGTACATATGGCTGCTCTCGAATTCC

a

AAAAAACATATGTCAACCCTCAGCAAATTC

a

TAAAAACTGCAGCTGCTCTCGAATTCCC

a

AAAAACTCTAGATCAACCCTCAGCAAATTC

a

The underlined sequences are restriction sites of NdeI in MaBG Forward1 and MaBG Reverse1, PstI in MaBG

Forward2, and XbaI in MaBG Reverse2

0

.8) grown in LB broth containing 50 μg mL⁻¹ampicillin, at 37 °C, 220 rpm, was induced

with 1 mM isopropyl-β-D-1-thiogalactopyranoside for 2 h. The cell pellet was harvested by

centrifugation, resuspended in lysis buffer [20 mM Tris-HCl, pH 8.0, 50 mM KCl, 0.5% (v/v)

Tween20, 0.1% (v/v) Triton-X 100, 1 mM ethylenediaminetetraacetic acid, and 1 mM PMSF],

and disrupted by sonication. The soluble and insoluble fractions were separated by centrifu-

gation, and then subjected to 10% SDS-PAGE analysis. β-Glucosidase activity assay was

measured against 1 mM pNP-Glc in the presence of 1.55 M glucose at 50 °C as described

above.

For expression in Komagataella pastoris, the MaBG gene was amplified from the pZErO-

MaBG plasmid by using the primer pair, MaBG Forward2 and MaBG Reverse2 (Table 1), and

subcloned into the pPICZαBNH8 expression vector [48]. The pPICZαB-MaBG vector was

then transformed into K. pastoris Y11430. A single yeast colony harboring pPICZαB-MaBG

−5

was grown in BMGH supplemented with 4 × 10 % (w/v) biotin, at 30 °C, 200 rpm, overnight,

−5

and changed into BMMH supplemented with 4 × 10 % (w/v) biotin and 0.5% (w/v) casamino

acid, at 30 °C, 200 rpm. Methanol 0.5% (v/v) was added daily to maintain the inducing

condition for 1 week. The recombinant MaBG was purified from culture media by hydropho-

bic interaction chromatography followed by immobilized metal-ion affinity chromatography

as described previously [48]. Protein content and β-glucosidase activity toward 1 mM pNP-

Glc in the presence of 1.55 M glucose at 50 °C were measured in each fraction before and after

loading into each column as described above.

Effects of Temperature, pH, and Glucose Concentrations on the Activities

of the Natural and Recombinant MaBG

The standard assay for measuring enzyme activity was performed by incubating the purified

natural or recombinant MaBG (3 mU) with 15 mM pNP-Glc in 0.1 M sodium phosphate, pH

6

.0, in the presence of 1.55 M glucose, at 50 °C for 5 min, and stopped with 2 M Na CO . The

2 3

absorbance of pNP released from the reaction was measured at 405 nm and compared to a

standard curve of pNP. To determine the optimal temperature, the reactions were incubated at

temperatures of 30–90 °C. To determine the optimal pH, the reactions were incubated in either 0.1 M

sodium citrate or 0.1 M sodium phosphate, at pH 3–8 . To determine the thermal stability, the

enzyme was preincubated in 0.1 M sodium acetate, pH 5.0, at temperatures of 4–90 °C for 30 min,

before its activity was measured at its optimal temperature and pH. To determine pH stability, the

Appl Biochem Biotechnol

enzyme was preincubated in 50 mM sodium citrate, pH 3–6, or 50 mM sodium phosphate, pH 6–8,

at 4 °C for 30 min, before its activity was measured at its optimal temperature and pH.

The purified enzyme (3 mU) was reacted with 3, 6, and 9 mM pNP-Glc in the presence of

0–4.8 M glucose in 50 mM sodium phosphate, pH 6.0, at 50 °C for 5 min. The reaction was

stopped by adding 2 M Na CO . The absorbance of pNP released from the reaction was

2

3

measured at 405 nm and compared to a standard curve of pNP.

Kinetic Analysis of the Recombinant MaBG

The purified enzyme (3 mU) was reacted with various concentrations of substrates in 0.1 M

sodium phosphate, pH 6.0, at 50 °C for 5 min. The reactions with aryl glycosides, namely

pNP-Glc, para-nitrophenyl-β-D-fucopyranoside (pNP-Fuc), para-nitrophenyl-β-D-

galactopyranoside (pNP-Gal), para-nitrophenyl-β-D-mannopyranoside (pNP-Man), and pa-

ra-nitrophenyl-β-D-xylopyranoside (pNP-Xyl), were stopped by adding 2 M Na CO . The

2

3

absorbance of pNP released from the reaction was measured at 405 nm and compared to a

standard curve of pNP. The reactions with lactose, sucrose, cellobiose, gentiobiose, and

laminaribiose were stopped by heating at 100 °C for 5 min, and the released glucose was

then reacted with 50 μL of 2 mg mL⁻2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)

1

(Roche, Indianapolis, IN, USA) and 100 μL of glucose oxidase reagent (Sigma, St. Louis,

MO, USA) at 37 °C for 15 min. The absorbance was measured at 405 nm and compared to a

standard curve of glucose. Kinetic parameters were determined from the Michaelis-Menten

equation by using KaleidaGraph program (Synergy Software). In cases where the concentra-

tions of the substrate were low compared with the K_mvalue, the Lineweaver-Burk equation

was used.

Synthetic Activities of the Recombinant MaBG

The transglucosylation reaction was performed by reacting the recombinant MaBG (3 mU)

with 50 mM pNP-Glc in 0.1 M sodium phosphate, pH 6.0, at 30 °C for 24 h. Aliquots (3 μL)

of the reaction mixture and the glucoside standards were spotted on a TLC plate (Silica gel 60

F254, Merck, Darmstadt, Germany), which was then developed twice with a mixture of n-

butanol:acetic acid:water (8:2:1) for 5.5 cm. Then, the TLC plate was dipped into 20% sulfuric

acid in ethanol and charred at 120 °C. To isolate the reaction products, the reaction mixture

was then lyophilized, resuspended in methanol, and separated by RP-HPLC. The fractions

containing the compound of interest were then lyophilized and resuspended in methanol for

mass spectrometric analysis, or in 50 mM sodium phosphate, pH 6.0, for treatment with 0.5 U

of Dnbglu2 enzyme [38] at 30 °C for 1 h to release the disaccharide moiety. The samples and

the standard commercial reagents were analyzed by TLC as described above.

The reverse hydrolysis reaction was performed by reacting the recombinant MaBG (0.1 U)

with 250 mM glucose in buffer-saturated octanol at 30 °C [49]. Aliquots (3 μL) of the reaction

mixture and the glucoside standards were spotted on TLC plate, which was developed twice

the mixture of chloroform:ethanol (3:1) for 5 cm and then twice with a mixture of iso-

propanol:ethanol:water (5:1:2) for 2 cm, and visualized as described above.

Accession Number of MaBG

The coding sequence of MaBG was deposited to GenBank with accession no. KU170546.

Appl Biochem Biotechnol

Results

Screening for Glucose-Enhanced β-Glucosidase Activities from Termite Crude

Extracts

Seven species of termite samples were collected, namely Coptotermes anandalei (three

samples), C. gestroi (one sample), Globitermes sulphureus (one sample), Hypotermes sp.

(two samples), Microcerotermes sp. (seven samples), M. annandalei (four samples), and

M. crassus (one sample). The activity screening revealed that, in the presence of 1.55 M

glucose, the crude extracts of C. gestroi and G. sulphureus had relatively low β-glucosidase

−1

activities (lower than 0.5 U mg ), whereas the crude extracts of Hypotermes sp., C. anandalei,

−1

and M. crassus had intermediate levels of β-glucosidase activities (0.5–1.0 U mg ). High

−1

levels of β-glucosidase activities (higher than 1.0 U mg ) were found in the crude extracts of

M. annandalei and Microcerotermes sp. The β-glucosidase activities at 50 °C were higher than

those at 30 °C for all species. Thus, M. annandalei, which is a higher termite, was chosen to be

the source of the potentially glucose-tolerant β-glucosidase, namely MaBG.

Purification and Characterization of the Natural MaBG

MaBG in the crude extract of M. annandalei was precipitated with 30–70% ammonium

sulfate and purified to homogeneity by gel filtration, anion exchange chromatography,

and isoelectric chromatofocusing. Purification fold (4.4-fold) and percent recovery (1%)

−

1

were rather low with a specific activity of 2.4 U mg (Table 2). The obtained MaBG

appeared as a single protein band of approximately 55 kDa on a 10% SDS-PAGE (Fig. 1),

which was similar to other termite β-glucosidases previously reported (52–60 kDa) [37].

It probably existed as a dimer with a native molecular weight of approximately 81.5 kDa

as judged by gel filtration (Fig. S1). Treatment with endoglycosidase H indicated that

f

the natural MaBG possessed no glycosylation modification (Fig. 2a).

Determination of the Primary Sequence of MaBG and Bioinformatic Analysis

The internal amino acid sequences of the purified MaBG, determined by LC/MS/MS

analysis, matched with four regions of a GH1 β-glucosidase from a higher termite

Odontotermes formosanus (GenBank accession ADD92156.1) (results not shown). Fol-

lowing the cloning procedures, a full-length, 1,419-bp MaBG cDNA was obtained. An

open reading frame of MaBG encodes a polypeptide of 472 amino acids with a calculated

MW of 54,135.2 Da and pI of 5.69. (Fig. S2). A homology model of MaBG, based on

the template structure of N. koshunensis β-glucosidase (PDB code 3VIF), exhibited the

expected (α/β)₈barrel structure (not shown) [50]. The catalytic acid/base and the

catalytic nucleophile of MaBG are likely to be E168 and E375 in the NE/DP and I/

VTENG motifs, respectively, that are conserved in all GH1 β-glucosidases [2].

Peptide analysis predicted the absence of both the signal peptide cleavage site and the N-

linked and O-linked glycosylation sites on the MaBG, which is consistent with the result from

the endoglycosidase H treatment of the natural MaBG (Fig. 2a). Based on BLASTp analysis,

f

the deduced amino acid sequence of MaBG is most similar to β-glucosidase from

O. formosanus (GenBank accession ADD92156.1) with 81% identity and 91% homology

and CfGlu1C from Coptotermes formosanus (GenBank accession AEW67361.1) with 80%

Appl Biochem Biotechnol

Table 2 Summary of purification steps of the natural MaBG

Purification step

Total volume

mL)

Activity

(U)

Protein

(mg)

Specific activity (U

mg )

Recovery

(%)

Fold

a

−1

(

Crude enzyme

39.0

12.0

80.1

74.0

147.5

46.9

0.5

1.6

100

92

1.0

3.2

3

0–70%

NH

Sephacryl S-300 64.0

(

4 2 4

) SO

67.7

31.8

1.2

30.4

9.8

0.5

2.2

3.2

2.4

85

40

1

4.4

6.4

4.4

Hitrap Q HP

Mono P

17.0

3.5

a

The β-glucosidase activity was determined against 1 mM pNP-Glc in 0.1 M sodium acetate, pH 5.5, in the

presence of 1.55 M glucose at 50 °C for 30 min

identity and 89% homology [51], whose sequences contain no obvious signal peptide or

glycosylation sites. On the other hand, MaBG is distantly similar (33–57% identity) to termite

β-glucosidases exhibiting high cellobiase activity, such as that from Neotermes koshunensis

(

PDB code 3AHZ_A) [33]. Available full-length amino acid sequences of termite β-

glucosidases at the time were retrieved for multiple sequence alignment and phylogenetic

analysis. Phylogenetic analysis confirmed that MaBG is more related to O. formosanus β-

glucosidase and C. formosanus CfGlu1C, than those other secretory termite β-glucosidases

which are glycosylated and show obvious cellobiase activity (Fig. S3).

Expression and Purification of the Recombinant MaBG

The ORF of MaBG gene was firstly expressed in E. coli BL21 DE3 as a recombinant MaBG

with an N-terminal His tag that appeared as a 55-kDa protein band on a 10% SDS-PAGE.

6

Fig. 1 Purification of MaBG from

the crude extract of M. annandalei.

The purification steps are indicated

above the lanes. Lane M is protein

size markers

Appl Biochem Biotechnol

However, the bacterially expressed recombinant MaBG mostly formed an inclusion body,

which was not well solubilized (Fig. S4), and had no detectable β-glucosidase activity.

Therefore, the MaBG cDNA was expressed in yeast K. pastoris, which yielded an active

enzyme of approximately 55 kDa (Fig. 2b). The recombinant MaBG was then purified from

the culture broth, with a purification fold of 19.0, percent recovery at 4.3%, and a specific

activity of 6.3 U mg⁻(Table 3). Treatment with endoglycosidase H also showed no

1

f

glycosylation modification on the recombinant MaBG, consistent with the result from the

natural MaBG (Fig. 2b, compared with Fig. 2a) and the glycosylation prediction.

Effects of Temperature, pH, and Glucose Concentrations on the Activities

of the Natural and Recombinant MaBG

The optimal temperature and pH for the natural and recombinant MaBG in the

hydrolysis of pNP-Glc in the presence of 1.55 M glucose were 50–55 °C (Fig. 3a)

and pH 5–6 (Fig. 3b). Both enzymes were stable between 0 and 40 °C and at pH 4–8,

with approximately 70% activity remaining after incubation at these temperatures and

pH, respectively, for 30 min, but completely lost its activity after incubation at 60 °C or

below pH 4. The thermostability of MaBG was much lower in the absence of glucose

(

Fig. 3a).

The activities of the natural and recombinant MaBG toward pNP-Glc were determined

in the presence of 0–4.8 M glucose (Fig. 4). The results showed that the activities of both

MaBG forms were enhanced in the presence of up to 3.5–4.5 M glucose, depending on

the starting concentration of pNP-Glc, compared with the activity in the absence of

added glucose. Further increase in glucose concentration resulted in decreased pNP-Glc

hydrolyzing activities.

Fig. 2 Glycosylation analysis of the natural MaBG (a) and recombinant MaBG (b). The protein samples were

treated with endoglycosidase H (Endo H ) as indicated above the lanes. Lane M is protein size markers

f f

Appl Biochem Biotechnol

Table 3 Summary of purification steps of the recombinant MaBG

Purification step

Total volume

mL)

Activity

(U)

Protein

(mg)

Specific activity (U

mg )

Recovery

(%)

Fold

a

−1

(

Culture media

Ultrafiltration

Adding 1 M

600

30.0

29.5

12.2

7.2

6.5

36.5

17.1

13.9

0.3

0.4

0.5

100

59.3

53.4

1.0

1.3

1.4

(

4 2 4

NH ) SO

Phenyl sepharose

Ni -sepharose

Ultrafiltration

4.5

2.0

0.5

3.8

0.9

0.5

3.2

0.1

1.2

6.4

6.3

31.6

7.5

4.3

3.6

19.1

19.0

2

+

a

The β-glucosidase activity was determined against 1 mM pNP-Glc in 0.1 M sodium acetate, pH 5.5, in the

presence of 1.55 M glucose at 50 °C for 30 min

Kinetic Analysis of the Recombinant MaBG

Kinetic parameters of the recombinant MaBG for hydrolysis of various aryl glycosides

and disaccharides were determined at 50 °C and pH 6 (Table 4). The k_c_a_tvalues were

calculated per subunit rather than per native molecule. The kinetic parameters of the

natural MaBG were not determined due to limited amounts of the purified enzyme.

Compared with the results from previous studies, the K_mvalue of the recombinant

MaBG toward pNP-Glc was within the range of 0.12–1.66 mM reported for other

termite β-glucosidases [27, 28, 33–35, 52]. The recombinant MaBG showed higher

efficiency in hydrolyzing pNP-Fuc than other pNP glycosides tested, which is consis-

tent with some other GH1 β-glucosidases from termites [27, 28, 36, 53, 54], but is

contrary to that from Reticulitermes flavipes [34]. Among the disaccharides tested, the

recombinant MaBG could hydrolyze laminaribiose and gentiobiose, with relatively high

K_m(14.9 ± 1.2 and 38.7 ± 5.30 mM, respectively), but not cellobiose or lactose or

sucrose at all. Notably, among all the substrates tested, MaBG showed the highest k_c_a_t

value toward laminaribiose (69.3 ± 2.4 s−1), which is about 8-fold higher than that

−

1

toward pNP-Glc (8.98 ± 1.00 s ).

Fig. 3 Effects of temperature (a) and pH (b) on the activity of MaBG. The optimal condition and stability are

shown as squares and circles, respectively. The activities of the natural and recombinant MaBG are shown as

closed symbols with solid lines and open symbols with dashed lines, respectively. The temperature stability of the

recombinant MaBG in the absence of glucose is shown as open circles with a dotted line

Appl Biochem Biotechnol

Fig. 4 Effect of glucose concentrations on the activity of MaBG. The activities of the natural (closed symbols)

and recombinant (open symbols) MaBG were determined toward 3, 6, and 9 mM pNP-Glc (represented by

circles, triangles, and squares, respectively) in 0.1 M sodium phosphate, pH 6.0, in the presence of 0–4.8 M

glucose, at 50 °C for 5 min

Synthetic Activities of the Recombinant MaBG

The transglucosylation activity of the recombinant MaBG in the presence of 50 mM pNP-Glc was

observed by TLC. Between 10 and 120 min of incubation, pNP-Glc (the remaining starting material)

and two unknown products were present as the major constituents, while, surprisingly, glucose (the

hydrolysis product) could not be observed in the reactions at all (Fig. 5a). The major unknown

product, pX, whose bands were between those of para-nitrophenyl-β-D-cellobioside (pNP-Cel) and

glucose, was isolated by HPLC (Fig. S5), and its molecular mass was found to be 498 m/z, which

35

−

was equivalent to the mass of pNP-diglucoside [Mass+ Cl] (result not shown). It was later

identified as para-nitrophenyl-β-D-gentiobioside (pNP-Gen), after treating it with Dnbglu2, which

is capable of hydrolyzing disaccharides (Fig. 5b). After 24 h, the reaction was found to contain pNP-

Glc (the remaining starting material), glucose (the hydrolysis product), pNP-Gen (the

transglucosylation product), as well as a small amount of the second unknown product, whose

bands were between those of pNP-Glc and pNP-Cel.

The reverse hydrolysis activity of the recombinant MaBG was also investigated in the

reaction between free glucose and buffer-saturated octanol [49]. TLC analysis of the reaction

products showed the presence of octyl glucoside from day 2 of the reaction (Fig. 6), indicating

that a long-chain alkyl alcohol could also act as a glucosyl acceptor.

Table 4 Kinetic parameters of the recombinant MaBG

cat (s⁻

1

)

m

kcat/K )

(s⁻¹mM⁻¹

Substrate

K

m

(mM)

k

pNP-Glc

pNP-Fuc

pNP-Gal

pNP-Man

pNP-Xyl

1.47 ± 0.05

0.49 ± 0.04

4.64 ± 0.45

0.43 ± 0.08

2.48 ± 0.21

38.7 ± 5.3

14.9 ± 1.2

8.98 ± 1.00

8.71 ± 0.13

1.09 ± 0.04

0.10 ± 0.004

0.18 ± 0.003

0.83 ± 0.11

69.3 ± 2.4

6.12 ± 0.76

17.7 ± 1.5

0.24 ± 0.02

0.23 ± 0.04

0.07 ± 0.01

0.02 ± 0.004

4.64 ± 0.39

Gentiobiose

Laminaribiose

Appl Biochem Biotechnol

Fig. 5 TLC analysis of the transglucosylation products of the recombinant MaBG. a The reaction was

performed between 3 mU enzyme and 50 mM pNP-Glc at 30 °C for 24 h and analyzed in a time-course manner.

The commercial standards were 20 nmol pNP-Glc (pG), 10 nmol pNP-Cel (pCel), and 20 nmol glucose (Glc),

and the in-house standard is pNP-Gen (pX). b Comparison of the HPLC-isolated pX, before and after treatment

with Dnbglu2, as well as 20 nmol of each commercial standard: pNP-Glc, pNP-Cel, glucose, cellobiose (Cel),

and gentiobiose (Gen)

Discussion

Termites are important decomposers of cellulose in tropical and subtropical regions, harboring

both cellulase and β-glucosidase activities. While the glycoside hydrolase activities were

thought to be mainly attributed to their gut symbionts, endogenous enzymes have recently

been discovered. Furthermore, at least three termite β-glucosidases were reported to be

glucose-tolerant [27–29, 37], which were likely due to the transglucosylation activity of the

enzymes, and yet their synthetic applications have never been explored. Many termite β-

glucosidases have been reported in the past, but they often lack information on the kinetic

Fig. 6 TLC analysis of the reverse hydrolysis products of the recombinant MaBG. The reaction was performed

between 0.1 U enzyme and 250 mM glucose in buffer-saturated octanol at 30 °C for 6 days and analyzed in a

time-course manner. The commercial standards were 10 and 40 nmol of glucose (Glc) and hexyl glucoside

(

Hexyl Glc). The spots of octyl glucoside (Octyl Glc) are indicated by an arrow

Appl Biochem Biotechnol

parameters or the coding sequences. So, in this study, we have characterized MaBG, a

glycoside hydrolase family 1 β-glucosidase from a higher termite M. annandalei, in full

details, including isolation of the natural enzyme, delineating its complete coding sequence,

examining its hydrolytic properties, as well as investigating its potential biosynthetic applica-

bility via transglucosylation and reverse hydrolysis.

Most of the other reported termite β-glucosidases appeared to have the signal peptide

cleavage site and at least one position of N-linked glycosylation, which supports their

functions as secretory enzymes participating in cellulose degradation. However, our

phylogenic analysis found MaBG to be distantly similar (33–56% identity) to those

termite β-glucosidases with obviously high cellobiase activity [27, 28, 34, 55], while the

peptide analysis predicted the absence of both the signal peptide cleavage site and the N-

linked and O-linked glycosylation sites on the MaBG sequence. Furthermore, the lack of

cellobiase activity of MaBG was shown experimentally by kinetic analysis (Table 4) and

the lack of the N-glycosylation by treatment with endoglycosidase H (Fig. 2a). Even

f

when expressed as a recombinant enzyme in K. pastoris, MaBG did not appear to

contain any glycosylation modifications (Fig. 2b). The lack of hydrolytic activities of

MaBG toward cellobiose was in contrast with the reported 72.5–638 μmol/min/mg

cellobiase activities of other termite β-glucosidases, which suggested their roles in

cellulose degradation in the digestive system. Together, these results suggested that

MaBG is an intracellular enzyme, not involved in cellulolysis. Accordingly, the sequence

of MaBG is highly similar to β-glucosidase from O. formosanus (GenBank accession

ADD92156.1) and CfGlu1C from C. formosanus (GenBank accession AEW67361.1),

which also lack both signal peptide and glycosylation sites. While the functional char-

acterization of the O. formosanus β-glucosidase has not been reported, CfGlu1C was

shown to exhibit a synergistic effect with two other C. formosanus β-glucosidases

(

CfGlu1B and CfGlu1D) in lactose hydrolysis, but by itself hydrolyzed lactose, sucrose,

and cellobiose with lower activities when compared with CfGlu1B [32]. Furthermore,

MaBG also shares moderate similarity with a myrosinase 1-like protein and lactase-

phlorizin hydrolase-like proteins from the termite Zootermopsis nevadensis, which might

be involved in plant defense against herbivores [56] and the production of some

pheromonal compounds in insects [57], respectively (Fig. S3). Intracellular β-

glucosidases are believed to exhibit broad specificities and have multiple functions inside

eukaryotic cells such as in plants and in porcine species, or play a role in the regulation

of cellulase gene expression in Trichoderma ressei and Penicillium decumbens [58–61].

Despite our attempt to report the novel characteristics of an intracellular β-glucosidase

from termites, the exact biological roles of this group of enzymes have yet to be clarified.

While MaBG appeared to lack glycosylation modification, it seemed to require other

cytosolic chaperone machinery found only in eukaryotic cells [62] to assume proper folding

and activity. The failure to express MaBG as an active recombinant protein in E. coli, despite

the lack of glycosylation modification, was in contrast with some previously reported termite

β-glucosidases that were fully active when expressed in E. coli [33, 35–37, 50, 53, 55]. The

temperature and pH conditions for activity and stability of MaBG were similar to those

reported for other termite β-glucosidases [27, 33–35, 37, 52, 53]. However, when compared

with the glucose-tolerant β-glucosidase from N. takasagoensis [28], MaBG displayed a lower

optimal temperature and temperature stability. Nonetheless, glucose was found to exert a

stabilizing effect on MaBG, presumably by its occupation in the substrate-binding pocket that

helped to stabilize the enzyme structure.

Appl Biochem Biotechnol

MaBG exhibited a high transglucosylation activity, as evidenced by the glucose-

stimulating effect on its pNP-Glc hydrolyzing activity (Fig. 4). When glucose was present

up to 3.5–4.5 M in the reaction, MaBG appeared to preferentially utilize glucose, rather

than water, as an acceptor for the glycosyl moiety from the glucosyl-enzyme intermediate

[

63, 64]. However, pNP-Glc hydrolyzing activities were decreased when the glucose

concentrations were higher than 3.5 M, which was probably due to the competitive

inhibition effect of glucose. Similarly, a glucose-stimulating effect was also found, but

in a lower extent, in a termite β-glucosidase from Neotermes koshunensis [27]. Further-

more, in the presence of high pNP-Glc concentration (50 mM), MaBG displayed synthetic

activity of the β1 → 6 bond formation (in pNP-Gen) (Fig. 5), as the first pNP-Glc

molecule acted as a glucosyl donor and the second pNP-Glc molecule acted as a glucosyl

acceptor that outcompeted a water molecule for the glucosyl moiety covalently bound to

the enzyme. The formation of the β1 → 6 glucosidic bond in transglucosylation is

consistent with the observed hydrolytic activity toward gentiobiose. Only when pNP-

Glc was depleted in later hours of the transglucosylation reaction (due to being used up as

the glucosyl donor and glucosyl acceptor), the water molecule could then compete with

pNP-Glc in taking up the glucosyl moiety from the glucosyl-enzyme intermediate, pro-

ducing glucose as a hydrolysis product. On the other hand, high concentrations of both

glucose and octanol led to a thermodynamically driven reversal of hydrolysis, producing

octyl glucoside as a product (Fig. 6). Note that more enzyme was needed to drive the

reverse hydrolysis reactions than the hydrolysis or transglucosylation reactions, due to a

lower reverse hydrolysis activity. It is possible that a large amount of enzyme could cause

a secondary hydrolysis reaction, in which some of octyl glucoside (produced in the reverse

hydrolysis reaction) was hydrolyzed back to octanol and glucose. Nonetheless, the pres-

ence of octyl glucoside from the reverse hydrolysis reaction indicated that the reverse

hydrolysis activity was dominant than the hydrolysis activity under the assay conditions.

Transglucosylation and reverse hydrolysis activities have been reported for many GH1

enzymes [58, 65–68]. However, this is the first report of transglucosylation and reverse

hydrolysis activities of an intracellular GH1 β-glucosidase from termite and suggests its

potential applications in enzymatic synthesis of useful glucoside products. In particular,

synthetic reactions can be achieved via reverse hydrolysis without the need of an expen-

sive glucosyl donor such as pNP-Glc.

In conclusion, a novel GH1 β-glucosidase with a potential synthetic activity, MaBG, was

successfully isolated from M. annandalei, expressed recombinantly in yeast K. pastoris, and

enzymatically characterized. MaBG seemed to be an intracellular enzyme due to the lack of

both the signal peptide cleavage site and glycosylation modifications. Its actual physiological

role is still unknown, but unlikely to be participating in lignocellulose digestion. It displayed a

broad specificity characteristic and a capability in catalyzing transglucosylation and reverse

hydrolysis reactions with various types of glucosyl acceptors. Further studies would be of

interest in exploring the synthetic activities of MaBG for possible industrial applications. Also,

further study in terms of the active site structure in relation with substrate specificity and

catalytic capabilities will help improve our insight in exploiting GH1 enzymes in both

hydrolytic and synthetic manners.

Acknowledgements The authors especially thank Dr. Nonlawat Boonyalai, Kasetsart University, Thailand, for

kindly providing the gel filtration calibration kit and Blue Dextran 2000 and Dr. Suraphon Visetson, Kasetsart

University, Thailand, for helpful advice.

Appl Biochem Biotechnol

Funding Information The project was partly supported by grants from the Thailand Research Fund (MRG-

WII525S034), the Higher Education Research Promotion and National Research University Project of Thailand,

Kasetsart University Research and Development Institute (V-T(D)47.53), and the Faculty of Science, Kasetsart

University (ScRF-S11/2553). W.J. and E.S. are recipients of the MAG Window II scholarship from the Thailand

Research Fund and the Ph.D. scholarship from the Graduate School, Kasetsart University, respectively.

Compliance with Ethical Standards

Conflict of Interest The authors declare that they have no conflicts of interest.

Ethical Statement This article does not describe any studies on human participants or animals performed by

any of the authors.

References

1

. Ferrara, M. C., Cobucci-Ponzano, B., Carpentieri, A., Henrissat, B., Rossi, M., Amoresano, A., & Moracci,

M. (2014). The identification and molecular characterization of the first archaeal bifunctional exo-β-

glucosidase/N-acetyl-β-glucosaminidase demonstrate that family GH116 is made of three functionally

distinct subfamilies. Biochimica et Biophysica Acta - General Subjects, 1840(1), 367–377.

2

3

4

. Ketudat Cairns, J. R., & Esen, A. (2010). β-Glucosidases. Cellular and Molecular Life Sciences, 67(20),

3389–3405.

. Kumar, R., Singh, S., & Singh, O. V. (2008). Bioconversion of lignocellulosic biomass: biochemical and

molecular perspectives. Journal of Industrial Microbiology and Biotechnology, 35(5), 377–391.

. Singhania, R. R., Patel, A. K., Sukumaran, R. K., Larroche, C., & Pandey, A. (2013). Role and significance

of beta-glucosidases in the hydrolysis of cellulose for bioethanol production. Bioresource Technology, 127,

500–507.

5. Muraki, E., Chiba, H., Taketani, K., Hoshino, S., Tsuge, N., Tsunoda, N., & Kasono, K. (2012). Fenugreek with

reduced bitterness prevents diet-induced metabolic disorders in rats. Lipids in Health and Disease, 11(1), 58.

6. Ni, H., Chen, F., Cai, H., Xiao, A., You, Q., & Lu, Y. (2012). Characterization and preparation of

Aspergillus niger naringinase for debittering citrus juice. Journal of Food Science, 77(1), C1–C7.

7. Gueguen, Y., Chemardin, P., Janbon, G., Arnaud, A., & Galzy, P. (1996). A very efficient β-glucosidase

catalyst for the hydrolysis of flavor precursors of wines and fruit juices. Journal of Agricultural and Food

Chemistry, 44(8), 2336–2340.

8. Bhatia, Y., Mishra, S., & Bisaria, V. S. (2002). Microbial beta-glucosidases: cloning, properties, and

applications. Critical Reviews in Biotechnology, 22(4), 375–407.

9. Jabbour, D., Klippel, B., & Antranikian, G. (2011). A novel thermostable and glucose-tolerant β-glucosi-

dase from Fervidobacterium islandicum. Applied Microbiology and Biotechnology, 93, 1947–1956.

10. Pei, J., Pang, Q., Zhao, L., Fan, S., & Shi, H. (2012). Thermoanaerobacterium thermosaccharolyticum β-

glucosidase: a glucose-tolerant enzyme with high specific activity for cellobiose. Biotechnology for Biofuels,

5(1), 31.

11. Zhao, L., Xie, J., Zhang, X., Cao, F., & Pei, J. (2013). Overexpression and characterization of a glucose-

tolerant β-glucosidase from Thermotoga thermarum DSM 5069T with high catalytic efficiency of

ginsenoside Rb1 to Rd. Journal of Molecular Catalysis B: Enzymatic, 95, 62–69.

2. Beitel, S. M., & Knob, A. (2013). Penicillium miczynskii β-glucosidase: a glucose-tolerant enzyme

produced using pineapple peel as substrate. Industrial Biotechnology, 9(5), 293–300.

1

3. Benoliel, B., Poças-Fonseca, M. J., Torres, F. A. G., & de Moraes, L. M. P. (2009). Expression of a glucose-

tolerant β-glucosidase from Humicola grisea var. thermoidea in Saccharomyces cerevisiae. Applied

Biochemistry and Biotechnology, 160, 2036–2044.

14. Günata, Z., & Vallier, M.-J. (1999). Production of a highly glucose-tolerant extracellular β-glucosidase by

three Aspergillus strains. Biotechnology Letters, 21(3), 219–223.

1

5. Oriente, A., Tramontina, R., de Andrades, D., Henn, C., Silva, J. L. C., Simão, R. C. G., Maller, A., Polizeli,

M. D. L. T. M., & Kadowaki, M. K. (2015). Characterization of a novel Aspergillus niger beta-glucosidase

tolerant to saccharification of lignocellulosic biomass products and fermentation inhibitors. Chemical

Papers, 69, 1050–1057.

1

6. Ramani, G., Meera, B., Vanitha, C., Rajendhran, J., & Gunasekaran, P. (2015). Molecular cloning and

expression of thermostable glucose-tolerant β-glucosidase of Penicillium funiculosum NCL1 in Pichia

pastoris and its characterization. Journal of Industrial Microbiology and Biotechnology, 42(4), 553–565.

Appl Biochem Biotechnol

1

7. Riou, C., Salmon, J. M., Vallier, M. J., Gunata, Z., & Barre, P. (1998). Purification, characterization, and

substrate specificity of a novel highly glucose-tolerant beta-glucosidase from Aspergillus oryzae. Applied

and Environmental Microbiology, 64(10), 3607–3614.

18. Saha, B. C., & Bothast, R. J. (1996). Production, purification, and characterization of a highly glucose-

tolerant novel beta-glucosidase from Candida peltata. Applied and Environmental Microbiology, 62(9),

3165–3170.

1

9. Yan, T. R., & Lin, C. L. (1997). Purification and characterization of a glucose-tolerant beta-glucosidase from

Aspergillus niger CCRC 31494. Bioscience Biotechnology and Biochemistry, 61(6), 965–970.

0. Zanoelo, F. F., Polizeli Mde, L., Terenzi, H. F., & Jorge, J. A. (2004). Beta-glucosidase activity from the

thermophilic fungus Scytalidium thermophilum is stimulated by glucose and xylose. FEMS Microbiology

Letters, 240(2), 137–143.

2

21. Chen, L., Li, N., & Zong, M.-H. (2012). A glucose-tolerant β-glucosidase from Prunus domestica seeds:

purification and characterization. Process Biochemistry, 47(1), 127–132.

2

2. Cao, L.-C., Wang, Z.-J., Ren, G.-H., Kong, W., Li, L., Xie, W., & Liu, Y.-H. (2015). Engineering a novel

glucose-tolerant β-glucosidase as supplementation to enhance the hydrolysis of sugarcane bagasse at high

glucose concentration. Biotechnology for Biofuels, 8(1), 202.

2

3. Fang, Z., Fang, W., Liu, J., Hong, Y., Peng, H., Zhang, X., Sun, B., & Xiao, Y. (2010). Cloning and

characterization of a beta-glucosidase from marine microbial metagenome with excellent glucose tolerance.

Journal of Microbiology and Biotechnology, 20(9), 1351–1358.

4. Li, G., Jiang, Y., Fan, X.-J., & Liu, Y.-H. (2012). Molecular cloning and characterization of a novel β-

glucosidase with high hydrolyzing ability for soybean isoflavone glycosides and glucose-tolerance from soil

metagenomic library. Bioresource Technology, 123, 15–22.

5. Lu, J., Du, L., Wei, Y., Hu, Y., & Huang, R. (2013). Expression and characterization of a novel highly

glucose-tolerant β-glucosidase from a soil metagenome. Acta Biochimica et Biophysica Sinica, 45(8), 664–

673.

6. Kara, H. E., Turan, Y., Er, A., Acar, M., Tumay, S., & Sinan, S. (2014). Purification and characterization of

beta-glucosidase from greater wax moth Galleria mellonella L. (Lepidoptera: Pyralidae). Archives of Insect

Biochemistry and Physiology, 86(4), 209–219.

7. Uchima, C. A., Tokuda, G., Watanabe, H., Kitamoto, K., & Arioka, M. (2011). Heterologous expression and

characterization of a glucose-stimulated β-glucosidase from the termite Neotermes koshunensis in

Aspergillus oryzae. Applied Microbiology and Biotechnology, 89(6), 1761–1771.

8. Uchima, C. A., Tokuda, G., Watanabe, H., Kitamoto, K., & Arioka, M. (2012). Heterologous expression in

Pichia pastoris and characterization of an endogenous thermostable and high-glucose-tolerant beta-

glucosidase from the termite Nasutitermes takasagoensis. Applied and Environmental Microbiology,

78(12), 4288–4293.

2

9. Uchima, C. A., Gaku, T., Hirofumi, W., Katsuhiko, K., & Manabu, A. (2013). A novel glucose-tolerant β-

glucosidase from the salivary gland of the termite Nasutitermes takasagoensis. Journal of General and

Applied Microbiology, 59(2), 141–145.

30. Ohkuma, M. (2003). Termite symbiotic systems: efficient bio-recycling of lignocellulose. Applied

Microbiology and Biotechnology, 61(1), 1–9.

3

1. Bignell, D. E., Slaytor, M., Veivers, P. C., Muhlemann, R., & Leuthold, R. H. (1994). Functions of

symbiotic fungus gardens in higher termites of the genus Macrotermes: evidence against the acquired

enzyme hypothesis. Acta Microbiologica et Immunologica Hungarica, 41(4), 391–401.

2. Feng, T., Liu, H., Xu, Q., Sun, J., & Shi, H. (2015). Identification and characterization of two endogenous

β-glucosidases from the termite Coptotermes formosanus. Applied Biochemistry and Biotechnology, 176(7),

3

2039–2052.

3

3. Jeng, W.-Y., Wang, N.-C., Lin, M.-H., Lin, C.-T., Liaw, Y.-C., Chang, W.-J., Liu, C. I., Liang, P. H., &

Wang, A. H. (2011). Structural and functional analysis of three β-glucosidases from bacterium Clostridium

cellulovorans, fungus Trichoderma reesei and termite Neotermes koshunensis. Journal of Structural

Biology, 173(1), 46–56.

3

4. Scharf, M. E., Kovaleva, E. S., Jadhao, S., Campbell, J. H., Buchman, G. W., & Boucias, D. G. (2010).

Functional and translational analyses of a beta-glucosidase gene (glycosyl hydrolase family 1) isolated from

the gut of the lower termite Reticulitermes flavipes. Insect Biochemistry and Molecular Biology, 40(8), 611–

620.

35. Wang, Q., Qian, C., Zhang, X.-Z., Liu, N., Yan, X., & Zhou, Z. (2012). Characterization of a novel

thermostable β-glucosidase from a metagenomic library of termite gut. Enzyme and Microbial Technology,

51(6-7), 319–324.

3

6. Wu, Y., Chi, S., Yun, C., Shen, Y., Tokuda, G., & Ni, J. (2012). Molecular cloning and characterization of an

endogenous digestive beta-glucosidase from the midgut of the fungus-growing termite Macrotermes

barneyi. Insect Molecular Biology, 21(6), 604–614.

Appl Biochem Biotechnol

3

7. Zhang, D., Allen, A. B., & Lax, A. R. (2012). Functional analyses of the digestive beta-glucosidase of

Formosan subterranean termites (Coptotermes formosanus). Journal of Insect Physiology, 58(1), 205–210.

8. Chuankhayan, P., Rimlumduan, T., Tantanuch, W., Mothong, N., Kongsaeree, P. T., Metheenukul, P., Svasti,

J., Jensen, O. N., & Cairns, J. R. K. (2007). Functional and structural differences between isoflavonoid β-

glycosidases from Dalbergia sp. Archives of Biochemistry and Biophysics, 468(2), 205–216.

3

4

9. Srisomsap, C., Sawangareetrakul, P., Subhasitanont, P., Chokchaichamnankit, D., Chiablaem, K.,

Bhudhisawasdi, V., Wongkham, S., & Svasti, J. (2010). Proteomic studies of cholangiocarcinoma and

hepatocellular carcinoma cell secretomes. Journal of Biomedicine and Biotechnology, 2010, 437143.

0. Perkins, D. N., Pappin, D. J. C., Creasy, D. M., & Cottrell, J. S. (1999). Probability-based protein

identification by searching sequence databases using mass spectrometry data. Electrophoresis, 20(18),

3551–3567.

1. Gasteiger, E., Hoogland, C., Gattiker, A., Duvaud, S., Wilkins, M. R., Appel, R. D., & Bairoch, A. (2005).

Protein identification and analysis tools on the ExPASy server. In J. M. Walker (Ed.), The proteomics

protocols handbook (pp. 571–607). New York: Humana.

4

2. Petersen, T. N., Brunak, S., von Heijne, G., & Nielsen, H. (2011). SignalP 4.0: discriminating signal

peptides from transmembrane regions. Nature Methods, 8(10), 785–786.

3. Gupta, R., Jung, E., & Brunak, S. (2004) Prediction of N-glycosylation sites in human proteins. Available

from: http://www.cbs.dtu.dk/services/NetNGlyc/. Accessed February 24, 2017.

4. Steentoft, C., Vakhrushev, S. Y., Joshi, H. J., Kong, Y., Vester-Christensen, M. B., Schjoldager, K. T.,

Lavrsen, K., Dabelsteen, S., Pedersen, N. B., Marcos-Silva, L., Gupta, R., Bennett, E. P., Mandel, U.,

Brunak, S., Wandall, H. H., Levery, S. B., & Clausen, H. (2013). Precision mapping of the human O-

GalNAc glycoproteome through SimpleCell technology. EMBO Journal, 32(10), 1478–1488.

5. Altschul, S. F., Wootton, J. C., Gertz, E. M., Agarwala, R., Morgulis, A., Schaffer, A. A., & Yu, Y. K.

4

(2005). Protein database searches using compositionally adjusted substitution matrices. FEBS Journal,

2

72(20), 5101–5109.

4

6. Tamura, K., Stecher, G., Peterson, D., Filipski, A., & Kumar, S. (2013). MEGA6: molecular evolutionary

genetics analysis version 6.0. Molecular Biology and Evolution, 30(12), 2725–2729.

7. Zuckerkandl, E., & Pauling, L. (1965). Evolutionary divergence and convergence in proteins. In V. Bryson

&

H. J. Vogel (Eds.), Evolving genes and proteins (pp. 97–166). New York: Academic.

8. Toonkool, P., Metheenukul, P., Sujiwattanarat, P., Paiboon, P., Tongtubtim, N., Ketudat-Cairns, M., Ketudat-

Cairns, J., & Svasti, J. (2006). Expression and purification of dalcochinase, a β-glucosidase from Dalbergia

cochinchinensis Pierre, in yeast and bacterial hosts. Protein Expression and Purification, 48(2), 195–204.

9. Svasti, J., Phongsak, T., & Sarnthima, R. (2003). Transglucosylation of tertiary alcohols using cassava β-

glucosidase. Biochemical and Biophysical Research Communications, 305(3), 470–475.

0. Jeng, W.-Y., Wang, N.-C., Lin, C.-T., Chang, W.-J., Liu, C.-I., & Wang, A. H. J. (2012). High-resolution

structures of Neotermes koshunensis β-glucosidase mutants provide insights into the catalytic mechanism

and the synthesis of glucoconjugates. Acta Crystallographica Section D, 68(7), 829–838.

4

5

1. Zhang, D., Lax, A. R., Henrissat, B., Coutinho, P., Katiya, N., Nierman, W. C., & Fedorova, N. (2012).

Carbohydrate-active enzymes revealed in Coptotermes formosanus (Isoptera: Rhinotermitidae) tran-

scriptome. Insect Molecular Biology, 21(2), 235–245.

2. Kouame, L. P., Kouame, F. A., Niamke, S. L., Faulet, B. M., & Kamenan, A. (2005). Biochemical and

catalytic properties of two β-glycosidases purified from workers of the termite Macrotermes subhyalinus

(

Isoptera: Termitidae). International Journal of Tropical Insect Science, 25, 103–113.

3. Ni, J., Tokuda, G., Takehara, M., & Watanabe, H. (2007). Heterologous expression and enzymatic

characterization of β-glucosidase from the drywood-eating termite, Neotermes koshunensis. Applied

Entomology and Zoology, 42(3), 457–463.

4. Tokuda, G., Saito, H., & Watanabe, H. (2002). A digestive β-glucosidase from the salivary glands of the

termite, Neotermes koshunensis (Shiraki): distribution, characterization and isolation of its precursor cDNA

by 5′- and 3′-RACE amplifications with degenerate primers. Insect Biochemistry and Molecular Biology,

32(12), 1681–1689.

5

5. Tokuda, G., Miyagi, M., Makiya, H., Watanabe, H., & Arakawa, G. (2009). Digestive β-glucosidases from

the wood-feeding higher termite, Nasutitermes takasagoensis: intestinal distribution, molecular characteri-

zation, and alteration in sites of expression. Insect Biochemistry and Molecular Biology, 39(12), 931–937.

6. Shikita, M., Fahey, J. W., Golden, T. R., Holtzclaw, W. D., & Talalay, P. (1999). An unusual case of

‘uncompetitive activation’ by ascorbic acid: purification and kinetic properties of a myrosinase from

Raphanus sativus seedlings. Biochemical Journal, 341, 725–732.

7. Cornette, R., Farine, J.-P., Abed-Viellard, D., Quennedey, B., & Brossut, R. (2003). Molecular character-

ization of a male-specific glycosyl hydrolase, Lma-p72, secreted on to the abdominal surface of the Madeira

cockroach Leucophaea maderae (Blaberidae, Oxyhaloinae). Biochemical Journal, 372(2), 535–541.

Appl Biochem Biotechnol

5

6

8. Pengthaisong, S., Chen, C.-F., Withers, S. G., Kuaprasert, B., & Ketudat Cairns, J. R. (2012). Rice BGlu1

glycosynthase and wild type transglycosylation activities distinguished by cyclophellitol inhibition.

Carbohydrate Research, 352, 51–59.

9. McMahon, L. G., Nakano, H., Levy, M. D., & Gregory, J. F. (1997). Cytosolic pyridoxine-β-D-glucoside

hydrolase from porcine jejunal mucosa: purification, properties, and comparison with broad specificity β-

glucosidase. Journal of Biological Chemistry, 272(51), 32025–32033.

0. Xu, J., Zhao, G., Kou, Y., Zhang, W., Zhou, Q., Chen, G., & Liu, W. (2014). Intracellular β-glucosidases

CEL1a and CEL1b are essential for cellulase induction on lactose in Trichoderma reesei. Eukaryotic Cell,

13(8), 1001–1013.

1. Chen, M., Qin, Y., Cao, Q., Liu, G., Li, J., Li, Z., Zhao, J., & Qu, Y. (2013). Promotion of extracellular

lignocellulolytic enzymes production by restraining the intracellular β-glucosidase in Penicillium

decumbens. Bioresource Technology, 137, 33–40.

6

2. Vabulas, R. M., Raychaudhuri, S., Hayer-Hartl, M., & Hartl, F. U. (2010). Protein folding in the cytoplasm

and the heat shock response. Cold Spring Harbor Perspectives in Biology, 2, a004390–a004390.

3. Seidle, H. F., & Huber, R. E. (2005). Transglucosidic reactions of the Aspergillus niger family 3 β-

glucosidase: qualitative and quantitative analyses and evidence that the transglucosidic rate is independent

of pH. Archives of Biochemistry and Biophysics, 436(2), 254–264.

6

4. Thongpoo, P., Srisomsap, C., Chokchaichamnankit, D., Kitpreechavanich, V., Svasti, J., & Kongsaeree, P. T.

(2014). Purification and characterization of three β-glycosidases exhibiting high glucose tolerance from

Aspergillus niger ASKU28. Bioscience, Biotechnology, and Biochemistry, 78(7), 1167–1176.

5. Uchiyama, T., Miyazaki, K., & Yaoi, K. (2013). Characterization of a novel β-glucosidase from a compost

microbial metagenome with strong transglycosylation activity. Journal of Biological Chemistry, 288(25),

18325–18334.

6. Hommalai, G., Chaiyen, P., & Svasti, J. (2005). Studies on the transglucosylation reactions of cassava and

Thai rosewood β-glucosidases using 2-deoxy-2-fluoro-glycosyl-enzyme intermediates. Archives of

Biochemistry and Biophysics, 442(1), 11–20.

7. Guo, D., Xu, Y., Kang, Y., Han, S., & Zheng, S. (2016). Synthesis of octyl-β-d-glucopyranoside catalyzed

by Thai rosewood β-glucosidase-displaying Pichia pastoris in an aqueous/organic two-phase system.

Enzyme and Microbial Technology, 85, 90–97.

8. Mladenoska, I. (2016). Synthesis of octyl-β-glucoside catalyzed by almond β-glucosidase in unconven-

tional reaction media. Food Technology and Biotechnology, 54(2), 211–216.

Article Doi

Molecular Characterization and Potential Synthetic Applications of GH1 β-Glucosidase from Higher Termite Microcerotermes annandalei

DOI: 10.1007/s12010-018-2781-8

Source and publish data:

Authors:

Article abstract of DOI:10.1007/s12010-018-2781-8

Full text of DOI:10.1007/s12010-018-2781-8

Products guided by the article

Relevant to this article

Hot Product