Characterization of a recombinant β-xylosidase of GH43 family from Bacteroides ovatus strain ATCC 8483

Article abstract of DOI:10.1080/10242422.2019.1631813

A novel β-1,4-xylosidase was identified from the genome of Bacteroides ovatus strain ATCC 8483 and overexpressed in Escherichia coli BL21 (DE3) cells. The molecular weight of recombinant enzyme named BoXyl43A was calculated to be 37.1 kDa. Using p-nitrophenyl-β-D-xylopyranoside (pNPβXyl) as substrate, BoXyl43A was most active at pH 7.0 and 35 °C. The enzyme could be activated by Mg²⁺ and Mn²⁺. The K_m and V_max of BoXyl43A against pNPβXyl were 1.71 ± 0.21 mM, 7.41 ± 0.81 μmol/min/mg, respectively. BoXyl43A hydrolyzed xylooligosaccharide to produce D-xylose as main product, indicating that BoXyl43A acted as an exo-β-1,4-xylosidase. The mixture of BoXyl43A and PoAbf62A (α-L-arabinofuranosidase) exhibited significant synergistic effects on the degradation of arabinoxylan. Therefore, BoXyl43A would be a useful tool to degrade hemicellulose.

Full text of DOI:10.1080/10242422.2019.1631813

Biocatalysis and Biotransformation
ISSN: 1024-2422 (Print) 1029-2446 (Online) Journal homepage: https://tandfonline.com/loi/ibab20
Characterization of a recombinant β-xylosidase of
GH43 family from Bacteroides ovatus strain ATCC
8483
Andong Zhou, Yanbo Hu, Jingjing Li, Weiyang Wang, Mengshan Zhang &
Shuwen Guan
To cite this article: Andong Zhou, Yanbo Hu, Jingjing Li, Weiyang Wang, Mengshan
Zhang & Shuwen Guan (2019): Characterization of a recombinant β-xylosidase of GH43
family from Bacteroidesꢀovatus strain ATCC 8483, Biocatalysis and Biotransformation, DOI:
10.1080/10242422.2019.1631813
To link to this article: https://doi.org/10.1080/10242422.2019.1631813
View supplementary material
Published online: 28 Jun 2019.
Submit your article to this journal
Article views: 3
View Crossmark data
Full Terms & Conditions of access and use can be found at
https://tandfonline.com/action/journalInformation?journalCode=ibab20

BIOCATALYSIS AND BIOTRANSFORMATION
https://doi.org/10.1080/10242422.2019.1631813
RESEARCH ARTICLE
Characterization of a recombinant b-xylosidase of GH43 family from
Bacteroides ovatus strain ATCC 8483
a#
b#
c
b
b
a
Andong Zhou , Yanbo Hu , Jingjing Li , Weiyang Wang , Mengshan Zhang and Shuwen Guan
a
b
School of Life Sciences, Jilin University, Changchun, China; School of Life Sciences, Northeast Normal University, Changchun, P. R.
c
China; Beijing Institute of Metrology, Beijing, China
ABSTRACT
ARTICLE HISTORY
A novel b-1,4-xylosidase was identified from the genome of Bacteroides ovatus strain ATCC 8483
and overexpressed in Escherichia coli BL21 (DE3) cells. The molecular weight of recombinant
Received 29 August 2018
Accepted 3 June 2019
enzyme named BoXyl43A was calculated to be 37.1 kDa. Using p-nitrophenyl-b-D-xylopyranoside
ꢀ
KEYWORDS
Bacteroides ovatus; b-1,4-
xylosidase; GH family 43
(
pNPbXyl) as substrate, BoXyl43A was most active at pH 7.0 and 35 C. The enzyme could be
2þ
2þ
activated by Mg
and Mn . The Km and Vmax of BoXyl43A against pNPbXyl were
1.71 ± 0.21 mM, 7.41 ± 0.81 lmol/min/mg, respectively. BoXyl43A hydrolyzed xylooligosaccharide
to produce D-xylose as main product, indicating that BoXyl43A acted as an exo-b-1,4-xylosidase.
The mixture of BoXyl43A and PoAbf62A (a-L-arabinofuranosidase) exhibited significant synergis-
tic effects on the degradation of arabinoxylan. Therefore, BoXyl43A would be a useful tool to
degrade hemicellulose.
Introduction
et al. 2010). The enzymes of GH43 family mainly include
b-xylosidase and a-L-arabinofuranosidase. Some
enzymes of GH43 family have both b-xylosidase and
a-L-arabinofuranosidase functions (Jordan et al. 2013),
which enable them to hydrolyze a diverse range of fiber
substrates (Khandeparker and Numan 2008; Carvalho
et al. 2018). Identification and utilization of novel hemi-
cellulolytic enzymes is of potential use for the structure
analysis of hemicellulose and conversion of hemicellulo-
sic biomass into biofuels.
Bacteroides ovatus is a common human gut bacter-
ium capable of degrading and growing on several
plant cell wall polysaccharides with complex structure.
Genomic analysis indicated that B. ovatus possesses
several unique polysaccharide utilization loci (PULs)
that enable degradation of hemicellulosic polysacchar-
ides (Martens et al. 2011; Zhang et al. 2014). In this
manuscript, a novel b-xylosidase belonging to GH43
family was identified from B. ovatus.
Lignocellulosic biomass is the most abundant renew-
able resource in the world; it shows great potential in
production of biofuels and valuable chemicals by
using lignocellulose (G ꢀı rio et al. 2010). Lignocellulose
is mainly composed of cellulose, hemicellulose and lig-
nin (Isikgor and Becer 2015). b-1,4-D-xylan makes up
over 50% of the total content of hemicellulose. Xylan
backbones are substituted at O-2/O-3 sites by different
substituents, including a-L-arabinofuranose, glucuronic
acid and/or 4-O-methyl-glucuronic acid, ferulic acid
and acetyl groups (Scheller and Ulvskov 2010; Juturu
and Wu 2012; Cintra et al. 2017).
Due to structural diversity, degradation of hemicellu-
lose requires many different hemicellulases synergistic-
ally acting on the backbone and branched chains of
xylan (Saha 2003; Lagaert et al. 2014), including endoxy-
lanase, b-xylosidase, a-L-arabinofuranosidase, a-glucur-
onidase and acetylxylan esterase (Cragg et al. 2015;
Mendis and Simsek 2015). b-Xylosidases are important
enzymes for hydrolyzing xylooligosaccharides and xylo-
biose to release xylose. They are used in many biotech-
nological processes. b-Xylosidases are classified into
families GH1, 3, 5, 30, 39, 43, 51, 52, 54, 116 and 120
based on their amino acid sequence similarity (Knob
Materials and methods
Strains and reagents
Bacteroides ovatus strain ATCC 8483 was purchased
from China General Microbiological Culture Collection
CONTACT Mengshan Zhang
zhangms253@nenu.edu.cn
School of Life Sciences, Northeast Normal University, Changchun 130024, China
#
These authors contributed equally to this work.
Supplemental data for this article can be accessed here.
ß 2019 Informa UK Limited, trading as Taylor & Francis Group

2
A. ZHOU ET AL.
Center. E. coli BL21 (DE3) and pET-28a (þ) were used
as host and expression vector, respectively (Novagen,
Madison, WI, USA). p-Nitrophenyl-b-glucopyranoside
(20 mM phosphate buffer, pH 7.0, 0.1 M NaCl, 250 mM
imidazole). The active fractions were pooled and dia-
lyzed against 20 mM phosphate buffer, pH 7.0. The
purified protein was analyzed by sodium dodecyl sul-
fate-polyacrylamide gel electrophoresis (SDS-PAGE) on
10% separating gel. Protein concentrations were deter-
mined by the method of Bradford using bovine serum
albumin (BSA) as a standard.
(pNPbGlc), pNP-a-glucopyranoside (pNPaGlc), pNP-
b-galactopyranoside (pNPbGal), pNP-a-galactopyrano-
side (pNPaGal), pNP-b-mannopyranoside (pNPbMan),
pNP-a-mannopyranoside (pNPaMan), pNP-b-xylopyra-
noside
(pNPbXyl),
pNP-a-L-arabinofuranoside
(pNPaAraf) were from Sigma (St. Louis, MO). Genomic
DNA isolation, DNA purification, and plasmid isolation
kits were from Tian gen Biotech (Beijing, China).
Characterization of recombinant BoXyl43A
Assay of the specific activity of BoXyl43A was carried
out in 200 lL of 20 mM phosphate buffer (pH 7.0) con-
taining 5 mM substrate and 2 lg recombinant
Cloning and expression of boxyl43a gene
ꢀ
Genomic DNA of B. ovatus was isolated using Tian gen
BoXyl43A. After incubating at 30 C for 5 min, the reac-
genomic DNA isolation kit. The primers having restric-
tion was stopped by adding 50 lL Na CO (0.5 M), and
2
3
0
tion sites for EcoRI (5 - CGGAATTCATGAAAAAAGAAA
the released p-nitrophenol was measured at 405 nm
by BioTek ELx808 microplate reader (Winooski, VT,
USA). The reaction mixture without enzyme was used
0
0
TGAGATACC-3 ) and XhoI (5 - CCGCTCGAGTTACTA
0
CGCTCCTCCATCTAT-3 ) were used for gene boxyl43a
ꢀ
amplification. PCR was performed using DreamTaq
Green PCR Master Mix (Thermo Scientific) and the pro-
as the control. At assay conditions of pH 7.0, 30 C,
the amount of enzyme releasing 1 lmol/min of p-
nitrophenyl was defined as one unit (U).
ꢀ
gram was as follows: 95 C for 5 min, 30 cycles of
ꢀ
ꢀ
ꢀ
9
5 C for 30 s, 63 C for 45 s, 72 C for 1 min, and final
Effect of pH on BoXyl43A activity was determined
at pH 2.0-11.0 using pNPbXyl (5 mM) as substrate. The
pH stability was determined under standard assay con-
ditions after incubation of the purified BoXyl43A for
ꢀ
extension at 72 C for 10 min. The PCR product and
pET-28a (þ) were digested with EcoRI and XhoI,
respectively. Then boxyl43a gene was ligated with
pET-28a (þ) to generate the recombinant plasmid
pET28a-boxyl43a. Obtained recombinant amplicon was
analyzed by Comate Bioscience Co. Ltd. (Changchun,
China) with T7 and T7-ter as sequencing primers. For
BoXyl43A expression, E. coli BL21 (DE3) cells harboring
pET28a-boxyl43a were grown in 200 mL of LB culture
ꢀ
24 h at 4 C in the buffers without substrate. The effect
of temperature on BoXyl43A activity was investigated
by measuring the BoXyl43A activity at temperatures
ꢀ
ꢀ
ranging from 30 C to 50 C. Thermostability was
determined by incubating the enzyme at the tempera-
ꢀ
ꢀ
tures from 30 C to 50 C for 1 h 30 min. Residual activ-
ities were measured as described before. The initial
activity without incubation was set as 100%.
ꢀ
with 50 lg/mL kanamycin at 37 C, 160 rpm. After the
OD600 nm of bacteria reached 0.6, the culture was
induced with 0.5 mM IPTG and grown overnight at
The effects of metal ions and chemicals on the
activity of BoXyl43A were determined by incubating
ꢀ
2
5 C for expression of BoXyl43A.
purified enzyme with each metal ion or chemical (5 or
ꢀ
5
0 mM) for 24 h at 4 C. The reaction mixture without
Purification of recombinant BoXyl43A
enzyme was used as the control. The activity of
BoXyl43 assayed in the absence of metal ions or
chemical was taken as 100%, and then the residual
activity was determined using pNPbXyl as substrate.
Recombinant cells were harvested by centrifugation at
8
000 rpm for 10 min and suspended in 20 mL of lysis
buffer (20 mM phosphate buffer, pH 7.0, 0.1 M NaCl)
and then disrupted by sonication on ice (3 s pulses
with 6 s interval for 10 min). Cell debris was removed
Determination of kinetic parameters
ꢀ
by centrifugation at 4 C and 13,000 rpm for 45 min,
and crude protein was obtained in supernatant.
Recombinant BoXyl43A carrying His-tag was loaded
To determine the kinetic parameters for pNPbXyl, the
buffer used was identical to that stated above and
five substrate concentrations ranging from 0.2 mM to
1 mM were used. Reactions were initiated with 20 lL
BoXyl43A (0.1 mg/mL) and production of pNP was
monitored at 405 nm every 15 s. The time courses
were linear for the first 2 min, and the rate was
2
þ
onto Ni
affinity column (GE healthcare). The 2 mL
2
þ
Ni
column was pre-equilibrated with the binding
buffer, washed with 20 mL washing buffer (20 mM
phosphate buffer, pH 7.0, 0.1 M NaCl, 20 mM imid-
azole) and then eluted with 20 mL eluting buffer

BIOCATALYSIS AND BIOTRANSFORMATION
3
determined from a tangent to a curve measured. The
Km and Vmax values were calculated from GraphPad
Prism V5.
Nucleotide sequence accession number
The sequence of BoXyl43A gene from B. ovatus strain
ATCC 8483 was deposited in Genbank under accession
numbers MK726378.
Substrate specificity
Results and discussion
Substrate specificity was determined using various
pNP-glycosides as substrates, and the reaction was car-
ried out in 200 lL of 20 mM phosphate buffer (pH 7.0)
containing 5 mM substrates and 2 lg BoXyl43A. The
reaction mixture without enzyme was used as the con-
trol. Hydrolytic activity towards polysaccharides was
Cloning, expression and purification of
recombinant BoXyl43A
BoXyl43A was obtained from genome sequence of B.
ovatus strain ATCC 8483 and contains 324 amino
acids, and the molecular weight of BoXyl43A was cal-
culated to be 37.1 kDa (https://web.expasy.org/prot-
param/). According to the amino acid sequence of
BoXyl43A from 15 to 319, it probably belongs to the
GH43 family (CAZy database: http://www.cazy.org/
CAZY). Amino acids of N-terminal from 1 to 12 were
predicted to be a signal peptide. According to nucleic
acid sequence, the gene was cloned into pET-28a(þ)
ꢀ
determined at 37 C in phosphate buffer (pH 7.0), with
0.5% (wt/vol) polysaccharides as substrates and 5 lg
BoXyl43A. After incubation for 1 h or 12 h, liberated
reducing sugars were measured by the method of
Somogyi (1952). To determine hydrolyzates of differ-
ent polysaccharides, a reaction mixture containing
50 lL of a 4 mg/ml substrate solution, 140 lL of 20 mM
(EcoRI/XhoI), and E.coli BL21 (DE3) was chosen as host
phosphate buffer (pH 7.0), and 10 lL of BoXyl43A
cell of BoXyl43A. The nucleic acid sequence of
BoXyl43A is shown in Supplementary Figure S1.
BoXyl43A was expressed as soluble protein in E.coli
BL21 (DE3). The enzyme activity was determined by
measuring the increase in absorbance of the reaction
mixture at 405 nm using pNPbXyl as the substrate. As
shown in Table 1, BoXyl43A was highly expressed and
the concentration of total protein was 390 mg/L cul-
ꢀ
(
100 lg/mL) was incubated for 12 h at 37 C. The
enzymatic products were analyzed by using high-per-
formance anion-exchange chromatography (HPAEC)
using
3 ꢁ 250 mm) as described in our previous work (Hu
et al. 2018).
a
CarboPac PA-200 analytical column
(
2
þ
ture. BoXyl43A was purified by Ni
affinity column
with a yield of 45.3%, and a specific activity of 4.9 U/
mg. The purified BoXyl43A was analyzed by SDS-PAGE
gel and almost no other protein bands were observed
on the gel (Figure 1).
Synergistic action of BoXyl43A with
a-L-arabinofuranosidase in degradation
of arabinoxylan
Hydrolysis of arabinoxylan was determined by incubat-
ing arabinoxylan (10 mg/mL) with a-L-arabinofuranosi-
dase (PoAbf62A, final concentration 10 lg/mL), or
Biochemical characterization of
recombinant BoXyl43A
10 lg/mL BoXyl43A, or both. In reactions with both
enzymes, arabinoxylan was incubated with a-L-arabi-
nofuranosidase for 12 h at 37 C, pH 4.5, and then
The enzymatic activity of BoXyl43A was examined
over a pH range from 2.0 to 11.0 with pNPbXyl as the
substrate. Our results showed that BoXyl43A exhibited
the maximum activity at pH 7.5, and it was stable
within the pH range from 6.0 to 7.0 (Figure 2). The
effect of temperature on the enzyme activity was
investigated at optimal pH, and BoXyl43A exhibited
ꢀ
BoXyl43A was added to the reaction for 12 h after
adjusting in buffer to pH 7.0. To identify the hydrolysis
products, reducing sugars released from the reaction
were analyzed by the HPAEC method men-
tioned above.
Table 1. Summary of purification of recombinant BoXyl43A.
a
b
Purification step
Volume (ml)
Total protein (mg)
Activity (U)
Sp act (U/mg)
Purification (fold)
Yield (%)
Crude enzyme extract
Ni sepharose fast flow column
15.0
3.00
78.0
19.5
210
94.5
2.70
4.90
1.00
1.80
100
45.3
a
Protein was quantified according to the Bradford Method using bovine serum albumin (BSA) as standard.
The activity was reported as activity on pNPbXyl.
b

4
A. ZHOU ET AL.
ꢀ
the maximum activity at 35 C. The thermostability of
Regarding the effect of metal ions and chemicals
ꢀ
2þ
2þ
BoXyl43A was investigated ranging from 30 to 50 C
on BoXyl43A, Mg and Mn
at a concentration of
at a constant pH of 7.0. As shown in Figure 3, approxi-
mately 80% of its activity remained after the treatment
5 mM increased its activity more than 70% (Table 2).
2
þ
2þ
The results indicated that Mg
and Mn
might
ꢀ
of 35 C for 90 min. However, the activity significantly
affect the activity of b-xylosidases, consistent with
ꢀ
decreased above 40 C. Therefore, pH 7.0 and tem-
those results in the literature (Kim and Yoon 2010; Lee
ꢀ
þ
þ
perature of 35 C were chose as optimum conditions
et al. 2013). Na , K and DTT did not affect the activ-
ity of BoXyl43A significantly, but the activity of
in degradation of hemicellulose .
2
þ
2þ
BoXyl43A was strongly inhibited by 5 mM Ca , Ba
Hg , Cu , Fe , SDS and DTT.
,
2
þ
2þ
3þ
To get information regarding the active site resi-
dues of BoXyl43A, we compared the amino acid
sequences to four b-xylosidases from GH 43 family,
RS233BX
(Genbank
AFP23142.1),
RUM630-BX
(Genbank AFE48532.1), CoXyl (Genbank BAS02080.1)
and BoXA (Genbank AAB08024) (Jordan et al. 2015;
Jordan et al. 2016; Matsuzawa et al. 2017; Jordan
et al. 2017), respectively. Knowing the residue num-
bers of the active site residues of RS223-BX from
the X-ray structure (PDB ID 4MLG), we could do a
linear alignment of the primary structures to find
amino acid residues in the active-site pocket of the
other b-xylosidases. The multiple amino acid
sequence alignment indicated BoXyl43A had 75, 59,
5
4, and 80% identity to RS233BX, RUM630-BX, CoXyl
and BoXA, respectively. It is obvious that the active-
site residues D16 (catalytic base), D137 (transition-
state stabilizer) and E224 (catalytic acid) are con-
served in all of these sequences (Supplementary
Figure S2), and amino acid residues D86 and H275
are related to combination of divalent metal.
Besides, there were 17 other amino acid residues in
the active site pocket, most of which are conserved,
except the sites of 86, 110, 136 and 244. And the
amino acid residues in the active-site pocket of
Figure 1. SDS-PAGE analysis of recombinant BoXyl43A on
10% resolving gel. Lane 1, culture lysate of E. coli BL21-
pET28a-boxyl43a before IPTG induction; lane 2, supernatant of
the culture lysate of E. coli BL21-pET28a-boxyl43a after IPTG
2þ
induction; lane 3, BoXyl43A purified from Ni sepharose fast-
flow column which showed target band; M, molecular weight
marker (PageRuler Prestained Protein Ladder, Genestar).
Figure 2. Effect of pH on activity (a) and stability (b) of BoXyl43A using pNPbXyl as substrate. The activity of BoXyl43A without
pre-incubating was defined as 100%. Results are presented as means ± standard deviations (n ¼ 3).

BIOCATALYSIS AND BIOTRANSFORMATION
5
Figure 3. Effect of temperature on activity (a) and stability (b) of BoXyl43A using pNPbXyl as substrate. The optimal temperature
ꢀ
was determined at different temperatures ranging from 20 to 80 C. The maximum activity obtained was defined as 100% activity.
Thermal stability was determined by incubating the enzyme for 1 h 30 min at different temperatures. The activity of the enzyme
before incubation was defined as 100%. Results are presented as means ± standard deviations (n ¼ 3).
Table 2. Effects of metal ions and chemical agents on the
activity of BoXyl43A.
Table 3. Relative activity of BoXyl43A on different substrates.
a
Substrate
Relative activity (%)
Relative activity
pNPaAraf
pNPaArap
pNPbXyl
pNPaGal
pNPbGal
pNPaGlc
pNPbGlc
a
51.3 ± 2.3
4.70 ± 0.3
100
—
29.2 ± 2.2
—
Metal ions or reagents
5 mM
50 mM
EDTA
DTT
NaCl
27.7 ± 2.4
98.9 ± 2.4
88.9 ± 1.6
2.80 ± 0.1
178 ± 3.2
92.6 ± 0.7
22.5 ± 0.9
17.5 ± 1.0
4.80 ± 0.5
9.30 ± 0.1
216 ± 4.1
31.4 ± 1.1
2.70 ± 0.0
79.8 ± 1.2
76.0 ± 2.6
2.50 ± 0.0
198 ± 0.6
85.6 ± 4.2
—
SDS
13.1 ± 1.6
MgCl
KCl
2
The activity of BoXyl43A on pNPbXyl was defined as 100%.
CaCl
2
BaCl
2
—
—
HgCl
CuCl
MnCl
FeCl
2
2
—
—
Substrate specificity of recombinant BoXyl43A
2
3
10.9 ± 0.3
Activity of BoXyl43A was examined by using aryl-gly-
cosides. The results showed that BoXyl43A exhibited
activity towards pNPbXyl and pNPaAraf. In addition, it
also had little activity on pNPaGal, pNPbGlc and
pNPaArap (Table 3). The results indicated that
BoXyl43A from the GH43 family is a multifunctional
BoXyl43A had 88, 88, 81 and 94% identical residues
to those of RS233BX, RUM630-BX, CoXyl and BoXA.
Further, it was found that the amino acid
sequence of BoXA had 81% identity to RS233BX.
However, they exhibited different activity toward
divalent metal. BoXyl43A and RS233BX exhibit same
response to divalent metal ions. Although BoXyl43A
and BoXA belong to the same family and display
over 70% identity of amino acid sequences, they
exhibit different responses to divalent metal ions.
BoXyl43A was activated by divalent metal, while
BoXA was not. Comparing the amino acid sequences
in the active-site pocket between BoXyl43A and
BoXA, it was found that the R110 in active-site
pocket of BoXA was replaced by H110 of BoXyl43A.
The differences of amino acids in the active-sites
pockets might result in differences of BoXyl43A and
BoXA which were both from B. ovatus.
b-xylosidase/a-L-arabinofuranosidase. The kinetic val-
ꢀ
ues K
, Vmax, and kcat for pNPbXyl at 25 C and pH 7.0
m
were 1.71 ± 0.21 mM, 7.41 ± 0.81 lmol/min/mg and
ꢂ 1
4.58 ± 0.49 s
, respectively. The kcat/K (catalytic effi-
m
ꢂ 1
ꢂ1
ciency) was calculated to be 2.68 ± 0.08 s
mM .
In order to analyze the selectivity of BoXyl43A to
different substrates, carbohydrates mainly composed
of arabinose or xylose were chosen to be hydrolyzed
and released sugar could be detected by DNS
Colorimetry. The results showed that BoXyl43A could
hydrolyze xylooligosaccharide to release 126 ± 4 lg/mg
of reducing sugar in 1 h and 141 ± 4 lg/mg in 12 h.
However, when incubated with sugar beet arabinan or
linear-1,5-a-L-arabinan for 12 h, BoXyl43A released
negligible amounts of reducing sugars.

6
A. ZHOU ET AL.
Figure 4. HPAEC analysis results of degradation products of wheat arabinoxylan (a) and xylooligosaccharide (b) by BoXyl43A. The
ꢀ
substrates were incubated with BoXyl43A at 37 C for 12 h.
of PoAbf62A, we used it to successfully remove the
arabinose side chains of arabinoxylan and release ara-
ꢀ
binose after 12 h of the reaction system at 37 C and
pH 4.5 (Figure 5). Next, we adjusted pH of reaction
system to 7.0 and added BoXyl43A to the reaction sys-
ꢀ
tem. The reaction was performed for 12 hours at 37 C
and xylose was released (Figure 5). Based on these
results we could conclude that combination of
BoXyl43A and PoAbf62A could degrade arabinoxylan
and produce arabinose and xylose simultaneously.
Figure 5. HPAEC analysis of the hydrolyzed products of arabi-
noxylan by the combination of recombinant BoXyl43A and
PoAbf62A (a-L-arabinofuranosidase).
Conclusion
To verify the products of wheat arabinoxylan and
xylooligosaccharide hydrolyzed by BoXyl43A, we moni-
tored the release of monosaccharide or oligosacchar-
ide using HPAEC. As shown in Figure 4, BoXyl43A
could hydrolyze xylooligosaccharide and release xylose
BoXyl43A identified from the B. ovatus strain ATCC
8
483 was overexpressed and characterized. BoXyl43A
ꢀ
showed stability at pH 7.0 and temperature 35 C. It
exhibited an exo-type mode of action towards xylooli-
gosaccharide and showed synergistic effect with a-L-
arabinofuranosidase on degradation of arabinoxylan.
BoXyl43A would have potential for application in
hemicellulose degradation.
(Figure 4(b)), whereas it did not work on wheat arabi-
noxylan (Figure 4(a)). Therefore, we concluded that
BoXyl43A was an exo-b-1,4-xylosidase.
Synergistic reaction of BoXyl43A and
a-L-arabinofuranosidase in the degradation
of arabinoxylan
Disclosure statement
The authors report no conflict of interest. The authors alone
are responsible for the content and writing of the paper.
Arabinoxylan consists of b-1,4-D-xylan as main chains
and arabinose side chains. The side chains are linked
to O-2/O-3 sites of xylan (Kormelink et al. 1993). Our
experimental results showed that BoXyl43A could not
hydrolyze arabinoxylan to release xylose. This might
be caused by the arabinose in branches which prohib-
ited BoXyl43A from degrading b-1,4-D-xylan. To verify
this assumption, PoAbf62A cloned from Pencillium oxa-
licum, an a-L-arabinofuranosidase reported in our pre-
vious work, was used with BoXyl43A together to
degrade arabinoxylan. It was known that PoAbf62A
could specifically hydrolyze the arabinose in branches
of arabinoxylan (Hu et al. 2018). Utilizing this property
Funding
This work was supported by the Key Scientific Program of
Changchun City (No. 16CX20).
References
Carvalho DR, Carli S, Meleiro LP, Rosa JC, Arthur Oliveira HC,
Jorge JA, Furriel R. 2018. A halotolerant bifunctional
b-xylosidase/a-L-arabinofuranosidase from Colletotrichum
graminicola: purification and biochemical characterization.
Int J Biol Macromol. 114:741–750.

BIOCATALYSIS AND BIOTRANSFORMATION
7
Cintra LC, Fernandes AG, Oliveira ICM, Siqueira SJL, Costa
IGO, Colussi F, Jesu ꢀı no RSA, Ulhoa CJ, Faria FP. 2017.
Characterization of a recombinant xylose tolerant b-xylosi-
dase from Humicola grisea var. thermoidea and its use in
sugarcane bagasse hydrolysis. Int J Biol Macromol. 105:
produced by recombinant Escherichia coli. J Microbiol
Biotechnol. 20:1711–1716.
Knob A, Terrasa CRF, Carmona EC. 2010. b-Xylosidases from
filamentous fungi: an overview. World
J Microbiol
Biotechnol. 26:389–407.
262–271.
Kormelink FJM, Gruppen H, Voragen AGJ. 1993. Mode of
action of (1-4)-beta-D-arabinoxylan arabinofuranohydro-
lase (AXH) and a-L-arabinofuranosidases on alkali-extract-
able wheat-flour arabinoxylan. Carbohydr Res. 249:
Cragg SM, Beckham GT, Bruce NC, Bugg TD, Distel DL,
Dupree P, Etxabe AG, Goodell BS, Jellison J, McGeehan JE,
et al. 2015. Lignocellulose degradation mechanisms across
the Tree of Life. Curr Opin Chem Biol. 29:108–119.
G ꢀı rio FM, Fonseca C, Carvalheiro F, Duarte LC, Marques S,
Bogel-Łukasik R. 2010. Hemicelluloses for fuel ethanol: a
review. Bioresour Technol. 101:4775–4800.
Hu YB, Yan XC, Zhang H, Liu JQ, Luo F, Cui YY, Wang WW,
Zhou YF. 2018. Cloning and expression of a novel a-1,3-
arabinofuranosidase from Penicillium oxalicum sp. 68. AMB
Express. 8:51.
Isikgor FH, Becer CR. 2015. Lignocellulosic biomass: a sustain-
able platform for the production of bio-based chemicals
and polymers. Polym Chem. 6:4497–4559.
Jordan DB, Braker JD, Wagschal K, Lee CC, Chan VJ,
Dubrovska I, Anderson S, Wawrzak Z. 2015. X-ray crystal
structure of divalent metal-activated b-xylosidase,
RS223BX. Appl Biochem Biotechnol. 177:637–648.
3
45–353.
Lagaert S, Pollet A, Courtin CM, Volckaert G. 2014.
b-Xylosidases and a-l-arabinofuranosidases: accessory
enzymes for arabinoxylan degradation. Biotechnol Adv.
3
2:316–332.
Lee CC, Braker JD, Grigorescu AA, Wagschal K, Jordan DB.
013. Divalent metal activation of a GH43 b-xylosidase.
2
Enzyme Microb Tech. 52:84–90.
Martens EC, Lowe EC, Chiang H, Pudlo NA, Wu M, McNulty
NP, Abbott DW, Henrissat B, Gilbert HJ, Bolam DN, et al.
2011. Recognition and degradation of plant cell wall poly-
saccharides by two human gut symbionts. PLoS Biol. 9:
e1001221.
Matsuzawa T, Kaneko S, Kishine N, Fujimoto Z, Yaoi K. 2017.
Crystal structure of metagenomic b-xylosidase/ a-l-arabi-
nofuranosidase activated by calcium. J Biochem. 162:
Jordan DB, Braker JD, Wagschal K, Stoller JR, Lee CC. 2016.
Isolation and divalent-metal activation of a b-xylosidase,
RUM630-BX. Enzyme Microb Technol. 82:158–163.
Jordan DB, Stoller JR, Lee CC, Chan VJ, Wagschal K. 2017.
Biochemical characterization of a GH43 b-xylosidase from
Bacteroides ovatus. Appl Biochem Biotechnol. 182:
1
73–181.
Mendis M, Simsek S. 2015. Production of structurally diverse
wheat arabinoxylan hydrolyzates using combinations of
xylanase and arabinofuranosidase. Carbohydr Polym. 132:
250–260.
4
52–459.
Jordan DB, Wagschal K, Grigorescu AA, Braker JD. 2013.
Saha BC. 2003. Hemicellulose bioconversion. J Ind Microbiol
Biotechnol. 30:279–291.
Scheller HV, Ulvskov P. 2010. Hemicelluloses. Annu Rev Plant
Biol. 61:263–289.
Somogyi M. 1952. Notes on sugar determination. J Biol
Chem. 195:19–23.
Highly active b-xylosidases of glycoside hydrolase family
43 operating on natural and artificial substrates. Appl
Microbiol Biotechnol. 97:4415–4428.
Juturu V, Wu JC. 2012. Microbial xylanases: engineering, pro-
duction and industrial applications. Biotechnol Adv. 30:
1219–1227.
Zhang M, Chekan JR, Dodd D, Hong PY, Radlinski L,
Revindran V, Nair SK, Mackie RI, Cann I. 2014. Xylan utiliza-
tion in human gut commensal bacteria is orchestrated by
unique modular organization of polysaccharide-degrading
enzymes. Proc Natl Acad. 111:3708–3717.
Khandeparker R, Numan MT. 2008. Bifunctional xylanases
and their potential use in biotechnology. J Ind Microbiol
Biotechnol. 35:635–644.
Kim YA, Yoon KH. 2010. Characterization of a Paenibacillus
woosongensis beta-xylosidase/alpha-arabinofuranosidase