Export of methyl parathion hydrolase to the periplasm by the twin-arginine translocation pathway in escherichia coli

Article abstract of DOI:10.1021/jf901739g

The uptake of organophosphates (OPs) is a rate-limiting factor in whole-cell biocatalysis systems. Here, we report the periplasmic secretion of methyl parathion hydrolase (MPH) by employing the twinarginine translocation (Tat) pathway in Escherichia coli. The twin-arginine signal peptide of trimethy-lamine N-oxide reductase (TorA) from E. coli was used for exporting MPH to the periplasm of E. coli, alleviating the substrate uptake limitation. A periplasmic expression vector, pUTM18, coding for TorA-MPH was constructed, and the periplasmic secretion and functionality of MPH were demonstrated by cell fractionation, immunoblotting, and enzyme activity assays. The strain expressing periplasmic MPH showed 3-fold higher whole-cell activity than the control strain expressing cytoplasmic MPH. Suspended cultures also exhibited good stability, retaining almost 100% activity over a period of 2 weeks. Owing to their high activity and superior stability, these "live biocatalysts" are ideal for large-scale detoxification of OPs.

Full text of DOI:10.1021/jf901739g

J. Agric. Food Chem. 2009, 57, 8901–8905 8901
DOI:10.1021/jf901739g
Export of Methyl Parathion Hydrolase to the Periplasm by the
Twin-Arginine Translocation Pathway in Escherichia coli
§
,†
*
C
HAO
Y
ANG
,
†,‡ ROLAND
F
REUDL
,
AND
C
HUANLING
Q
IAO
†State Key Laboratory of Integrated Management of Pest Insects & Rodents, Institute of Zoology,
Chinese Academy of Sciences, Beijing 100101, China, ‡Department of Microbiology, College of
::
Life Sciences, Nankai University, Tianjin 300071, China, and §Institut fur Biotechnologie 1,
::
::
Forschungszentrum Julich GmbH, 52425 Julich, Germany
The uptake of organophosphates (OPs) is a rate-limiting factor in whole-cell biocatalysis systems.
Here, we report the periplasmic secretion of methyl parathion hydrolase (MPH) by employing the twin-
arginine translocation (Tat) pathway in Escherichia coli. The twin-arginine signal peptide of trimethy-
lamine N-oxide reductase (TorA) from E. coli was used for exporting MPH to the periplasm of E. coli,
alleviating the substrate uptake limitation. A periplasmic expression vector, pUTM18, coding for
TorA-MPH was constructed, and the periplasmic secretion and functionality of MPH were demon-
strated by cell fractionation, immunoblotting, and enzyme activity assays. The strain expressing
periplasmic MPH showed 3-fold higher whole-cell activity than the control strain expressing cyto-
plasmic MPH. Suspended cultures also exhibited good stability, retaining almost 100% activity over a
period of 2 weeks. Owing to their high activity and superior stability, these “live biocatalysts” are ideal
for large-scale detoxification of OPs.
KEYWORDS: Tat pathway; twin-arginine signal peptide; periplasmic secretion; methyl parathion
hydrolase
INTRODUCTION
Periplasmic secretion of target proteins can be an alternative
strategy for reducing the substrate diffusion barrier in whole-cell
biocatalysis systems (7). The twin-arginine translocation (Tat)
system is a bacterial protein export pathway with the remarkable
ability to transport folded proteins across the cytoplasmic
membrane (8-10). Proteins are targeted to a membrane-em-
bedded Tat translocase by specialized N-terminal twin-arginine
signal peptides bearing a consensus motif of SRRxFLK. The
nearly invariant twin-arginine dipeptide is essential for efficient
Tat targeting (9, 11, 12). Tat signal peptides consist of three
domains: a positively charged N-terminal domain (n-region), a
hydrophobic domain (h-region), and a C-terminal domain
(c-region) (11, 13). In E. coli, the Tat translocase consists of the
TatA, TatB, and TatC proteins. These three classes of membrane
proteins form two types of high-molecular-weight complexes,
including the TatBC signal recognition complex and TatA trans-
port channel complex (14-16). The TatBC complex binds a Tat
substrate by the specific recognition for the twin-arginine motif.
The TatA complex forms a channel through which substrates are
translocated across the cytoplasmic membrane.
Recently, an OP degradation gene (mpd) encoding methyl para-
thion hydrolase (MPH) was isolated from a methyl parathion-
degrading bacterium Plesiomonas sp. strain M6, but it showed only
12% identity to opd gene at the amino acid level (17), suggesting
significant novelty of the gene-enzyme system. More recently, we
cloned the mpd gene (GenBank accession no. DQ677027) from
a chlorpyrifos-degrading bacterium Stenotrophomonas sp. strain
YC-1 (18). In the present study, to enable secretion of MPH to
the periplasm of E. coli, we used the twin-arginine signal peptide of
trimethylamine N-oxide reductase (TorA) from E. coli (19).
Synthetic organophosphates (OPs) are a group of highly toxic
chemicals widely used to control various agriculture pests, ac-
counting for ∼38% of total pesticides used globally (1). Over
40 million kilograms of OP pesticides are used annually in the
U.S., with another 20 million kilograms produced for export (2).
OP pesticides are acetylcholinesterase (AChE) inhibitors, and
various clinical effects can occur from OP poisoning in hu-
mans (3). The growing public concern about their safety and
the widespread use of OPs in modern agriculture has stimulated
the development of effective and safe remediation strategies for
detoxification of OPs.
Organophosphorus hydrolase (OPH), encoded by the opd gene
of Pseudomonas diminuta MG and Flavobacterium sp. strain
ATCC27551, is a homodimeric phosphotriesterase that can
hydrolyze a wide range of OPs (4, 5). Hydrolysis of OPs by
OPH reduces their toxicity by several orders of magnitude (3).
Practical applications of large-scale enzymatic degradation have
always been limited by the cost of purification and stability of
OPH. Although the use of whole cell as biocatalysts is an
alternative strategy for treatment of OPs, the inaccessibility of
the pesticides across the cell membrane reduces the overall
catalytic efficiency (2, 6). This barrier of substrate transport can
be overcome by displaying OPH on the cell surface. However,
surface expression of OPH resulted in instability of the cell
membrane and growth inhibition of the cells, arising from
increased metabolic burden placed on the cell (2, 6).
*Corresponding author. Phone: 86-10-64807191. Fax: 86-10-64807099.
E-mail: qiaocl@ioz.ac.cn.
© 2009 American Chemical Society
Published on Web 09/15/2009
pubs.acs.org/JAFC

8902 J. Agric. Food Chem., Vol. 57, No. 19, 2009
Yang et al.
Table 1. Strains, Plasmids and Primers Used in This Study
strain, plasmid, or primer
descriptiona
source or literature
strains
E. coli DH5R
E. coli MC4100
B0D
supE44 4lacU169(j80 lacZ4M15) recA1 endA1 hsdR17(rK- mKþ) thi-1 gyrA relA1 F- 4(lacZYA-argF)
- 4lacU169 araD139 rpsL150 relA1 ptsF rbs flb B5301
Tiangen
20
F
like MC4100, 4tatB
like MC4100, 4tatC
20
B1LK0
plasmids
20
pSCTorA-GFP
pMDQ
pUC18
gene source of TorA signal peptide
19
source of mpd gene
18
vector for construction of torA-mpd fusion gene, lac promoter, Apr
pUC18 derivative, periplasmic expression vector coding for TorA-MPH fusion
pUC18 derivative, cytoplasmic expression vector coding for mature MPH
TaKaRa
this study
this study
pUTM18
pUM18
primers
P1
P2
P3
P4
P5
GAATTCCTCTAGAGGGTATTAATAATGAACAATAACGATCTCTTT
GGATCCCGCCGCTTGCGCCGCAGTCGC
ggATCCGCCGCACCGCAGGTGcgc
this study
this study
this study
this study
this study
AAGCTTTCACTTGGGGTTGACGAC
GAATTCCGCCGCACCGCAGGTGcgc
a The restriction sites in the primers (50 f 30) are underlined.
MATERIALS AND METHODS
serum at a 1:500 dilution in TBST buffer. Subsequently, the membrane
was incubated with alkaline phosphatase-conjugated goat antirabbit IgG
antibody (Promega, Madison, WI) at a 1:1000 dilution. The membrane
was then stained with nitroblue tetrazolium (NBT) and 5-bromo-4-chloro-
3-indolylphosphate (BCIP) in alkaline phosphatase buffer (100 mM Tris-
HCl, pH 9.0, 100 mM NaCl) for visualizing antigen-antibody conjugates.
MPH Activity Assay. Transformed cells were harvested and resus-
pended (OD600=1.0) in 100 mM phosphate buffer (pH 7.4). MPH activity
assay mixtures (1 mL, 3% methanol) contained 50 μg/mL methyl para-
thion (added from a 10 mg/mL methanol stock solution), 870 μL of
100 mM phosphate buffer (pH 7.4), and 100 μL of cells. The enzyme
activity was measured using a Beckman DU800 spectrophotometer at
30 °C by monitoring the increases of linear optical density over time
Strains, Plasmids, Primers, and Culture Conditions. The strains,
plasmids, and primers used in this study are described in Table 1. E. coli
DH5R was used for constructing recombinant plasmids. E. coli MC4100 and
its tat mutant strains (20) were used for recombinant MPH expression. E. coli
strains bearing plasmids were grown in Luria-Bertani (LB) medium (21)
supplemented with 100 μg/mL ampicillin. Expression of recombinant
proteins was induced with 1 mM isopropyl-β-D-thiogalactopyranoside
(IPTG) for 12 h at 30 °C when cells were grown to an OD600 of 0.5.
Plasmid Construction. The torA gene fragment encoding the signal
peptide and the first four amino acid residues of the mature TorA was
amplified by polymerase chain reaction (PCR) from plasmid pSCTorA-
GFP using primers P1 and P2. The PCR products were digested with
EcoRI and BamHI, and then ligated into similarly digested pUC18 to
generate pUT18. The mpd gene was amplified by PCR from plasmid
pMDQ using primers P3 and P4. The PCR products were digested with
BamHI and HindIII, and then ligated into similarly digested pUT18 to
generate pUTM18. To construct a control plasmid expressing cytoplasmic
MPH, the mpd gene was amplified by PCR from plasmid pMDQ using
primers P5 and P4. The PCR products were digested with EcoRI and
HindIII, and then ligated into similarly digested pUC18 to generate
pUM18. All plasmid constructions were verified by DNA sequence
analysis. Transformation of the plasmid into E. coli was carried out by
using the CaCl2 method (21).
at 405 nm as methyl parathion was hydrolyzed to p-nitrophenol (ε405
=
17,700 M-1 cm-1). Activities were expressed as units (1 μmol of p-nitro-
phenol formed per minute) per OD600 whole cells.
Stability Study of Resting Cultures. Cells harboring pUTM18 were
grown in 50 mL of LB medium supplemented with 1 mM IPTG and
100 μg/mL ampicillin for 24 h, washed twice with 50 mL of 150 mM NaCl
solution, resuspended in 5 mL of 100 mM phosphate buffer (pH 7.4), and
incubated in a shaker at 30 °C. Over a 2-week duration, 0.1 mL of sample
was removed each day. Samples were centrifuged and resuspended in
0.1 mL of 100 mM phosphate buffer (pH 7.4). MPH activity assays were
conducted as described above.
Biodegradation of Organophosphorus Pesticides by Periplasmic
Expression Strain. For expression of recombinant proteins, E. coli
MC4100 cells carrying pUTM18 or pUM18 were induced with 1 mM
IPTG for 12 h at 30 °C. The induced MC4100 cells were harvested,
followed by washing with 100 mM phosphate buffer (pH 7.4), and
resuspended (OD600 = 1.0) in the same buffer. Subsequently, 0.4 mM
methyl parathion, fenitrothion, parathion, or chlorpyrifos was added to
the cell suspensions. Samples were incubated for 2 h at 30 °C with shaking
and measured for the residual pesticides by gas chromatography as
described previously (18).
Cell Fractionation. Cells were fractionated to yield cytoplasmic
and periplasmic samples by the cold osmotic shock procedure as follows
(8, 22). Cells expressing TorA-MPH were harvested, resuspended in
5 mL of TES buffer (30mM Tris-HCl, pH 8.0, 1 mM EDTA, 20% sucrose)
and incubated at room temperature for 10 min. Cells were harvested by
centrifugationat 10,000 rpm for 10 min at 4 °C, resuspended in 2 mL of ice-
cold 5 mM MgSO4 and incubated on ice for 10 min to generate shocked
cells. Shocked cells were collected by centrifugation as above, and the
supernatant was retained as the periplasmic fraction. Shocked cells were
resuspended in 2 mL of ice-cold 5 mM MgSO4 and sonicated for 5 ꢀ 20 s
bursts, with 20 s cooling in between, at an amplitude of 15 microns. Cell
debris was removed by centrifugation at 10,000 rpm for 5 min at 4 °C.
Membranes were pelleted by centrifugation at 50,000 rpm for 1 h at 4 °C,
and the supernatant was retained as the cytoplasmic fraction.
RESULTS AND DISCUSSION
Construction and Expression of a TorA-MPH Chimera. The
Tat pathway has been widely used for the export of heterologous
proteins, such as green fluorescent protein (GFP) (22), fluore-
scent chimeras (23), OPH (24), and scFv antibody (8), to the
periplasm of E. coli. To test whether MPH could be exported by
the Tat pathway, we used the twin-arginine signal peptide of
trimethylamine N-oxide reductase (TorA) from E. coli, a moly-
bdopterin-containing protein that is known to be exported by the
Tat pathway in E. coli (9, 25). A schematic diagram of the
TorA-MPH fusion protein is shown in Figure 1. A 0.15 kb
fragment of torA gene encoding the entire signal sequence and the
Western Blot Analysis. Samples of total cell lysate and cytoplasmic
and periplasmic fractions were analyzed by sodium dodecyl sulfate-
polyacyrlamide gel electrophoresis (SDS-PAGE) with 12% (w/v) acry-
lamide (21). After electrophoresis, the separated proteins were electro-
blotted overnight at 40 V to the nitrocellulose membrane (Millipore,
Billerica, MA) with a tank transfer system (Bio-Rad, Hercules, CA)
containing a transfer buffer (25 mM Tris, 192 mM glycine, 10%
methanol). After blocking nonspecific binding sites with 3% bovine serum
albumin (BSA) in TBST buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl,
0.05% Tween-20), the membrane was incubated with rabbit anti-MPH

Article
J. Agric. Food Chem., Vol. 57, No. 19, 2009 8903
Figure 1. Schematic diagram of the TorA-MPH fusion protein. The torA-mpd fusion in pUC18 was constructed as detailed in Materials and Methods. The
coding sequence is inserted downstream of a Shine-Dalgarno sequence, and expression is driven from an IPTG-inducible lac promoter. The TorA signal
peptide is followed by four amino acid residues of the mature TorA protein fused directly to the MPH domain. The twin-arginine motif of “SRRRFLA” is
underlined, and the recognition site for type I signal peptidases is indicated by an arrow.
Figure 2. Export of MPH to the periplasm by the Tat pathway in E. coli
Figure 3. Specific MPH activities of periplasmic fraction, total cell lysate,
MC4100 transformed with pUTM18. Expression and localization of TorA-
and whole cell. WT-PE, MC4100 expressing periplasmic MPH; WT-CE,
MC4100 expressing cytoplasmic MPH; B0D, ΔtatB MC4100; B1LK0,
ΔtatC MC4100. Cells carrying pUTM18 or pUM18 were incubated at 30 °C
for 12 h after induction with 1 mM IPTG. Data are mean values ( standard
deviations from three replicates.
MPH were analyzed in transformed MC4100, B0D (like MC4100, 4tatB) and
B1LK0 (like MC4100, 4tatC) cells after induction with 1 mM IPTG. Cells
were fractionated to yield cytoplasmic and periplasmic samples (C and P)
and immunoblotted using anti-MPH serum. Mobilities of TorA-MPH and
mature-sized MPH are indicated by arrow. Prestained molecular weight
markers (M) were used to estimate protein weights. Total cell lysate (T) of
MC4100 transformed with pUC18 was used as a negative control.
TorA-MPH was present as two forms of precursor (37 kDa)
and mature-sized MPH (32 kDa) in the cytoplasmic fraction
(Figure 2). A part of this protein was present as mature-sized
MPH in the cytoplasm, which probably reflected the degradation
of the chimeric protein. It was reported that the TorA signal
peptide may be easily accessible to proteases (9, 10). In E. coli,
three genes encoding Tat components have been identified as the
tatA, tatB and tatC (25-27). Deletion of tatB or tatC results in a
total block in the export of proteins with twin-arginine signal
peptides (26, 27), which indicates that the tatB and tatC genes
are essential Tat pathway components. In this study, the near-
complete block in export of the MPH in the tatB and tatC
deletion strains indicated that the export of TorA-MPH was
mediated primarily by the Tat system.
The cell lysate activity of E. coli MC4100 expressing cyto-
plasmic MPH was 6.7-fold higher than the whole-cell activity,
while the cell lysate activity of MC4100 expressing periplasmic
MPH was 1.8-fold higher than the whole-cell activity (Figure 3).
Even though the cell lysate activity of the cytoplasmic-expressing
strain was 1.2-fold higher than that of the periplasmic-expressing
strain, the periplasmic-expressing strain showed 3-fold higher
whole-cell activity than the control strain expressing cyto-
plasmic MPH (Figure 3). These results indicated that periplasmic
secretion of MPH reduced the mass transport limitation of OP
pesticides across the cell membrane.
first four amino acid residues of the mature TorA was fused in
frame with the coding region of MPH. The torA-mpd fusion gene
was cloned into the pUC18 vector containing the IPTG-inducible
lac promoter, resulting in the final TorA-MPH construct,
pUTM18. The TorA signal peptide contains a conserved AxA
motif within the c-region as the recognition site for type I signal
peptidases (10, 11). During the release of TorA-MPH into
periplasm via membrane-embedded Tat translocase, the precur-
sor was processed to mature-sized MPH by cleaving N-terminal
TorA signal peptide.
Export of MPH by the Tat Pathway. Expression of TorA-
MPH was induced with 1 mM IPTG, and the localization of
MPH was determined by immunoblotting of cytoplasmic and
periplasmic fractions from MC4100 cells transformed with
pUTM18. This mature-sized MPH (32 kDa) was found predo-
minantly in the periplasmic fraction (Figure 2), which indicated
that MPH was successfully translocated into the periplasmic
space. A considerable amount of this mature-sized MPH was
also found in the cytoplasm, possibly resulting from the proteo-
lysis of TorA-MPH. The proteolysis of TorA fusion proteins
was observed in previous reports using the Tat pathway for
the periplasmic secretion of other proteins (22, 24). To check
whether the fractionation was properly performed, Western blot
assays were carried out on the same samples using antibodies to
β-lactamase, a periplasmic marker and GroEL, a cytoplasmic
marker. The data showed that β-lactamase and GroEL were
recovered predominantly in the periplasmic and cytoplasmic
fractions, respectively, demonstrating that the fractionation pro-
tocol was effective (data not shown).
Over 80% of cell lysate activity was detected in the periplasmic
fraction of E. coli MC4100 cells expressing TorA-MPH
(Figure 3). In 4tatB and 4tatC cells, very little activity was
detected in the periplasmic fraction (4% and 5% of cell lysate
activity respectively). Only 2% of cell lysate activity was detected
in the periplasmic fraction of MC4100 cells transformed with
pUM18. These results indicated that MPH was efficiently and
functionally exported to the periplasmic space of transformed
MC4100 cells.
Similar samples were processed from B0D (like MC4100,
4tatB) and B1LK0 (like MC4100, 4tatC) cells expressing TorA-
MPH. As shown by immunoblotting assays, the expressed

8904 J. Agric. Food Chem., Vol. 57, No. 19, 2009
Yang et al.
Figure 4. Whole-cell MPH activity in suspended E. coli MC4100 cultures
expressing periplasmic MPH. The activity was assayed with methyl
parathion as substrate. Data are mean values ( standard deviations from
three replicates.
Figure 5. Biodegradation of organophosphorus pesticides by E. coli
MC4100 cells expressing periplasmic or cytoplasmic MPH. All substrates
were added at an initial concentration of 0.4 mM. Data are mean values (
standard deviations from three replicates.
To monitor the stability of suspended cultures, whole-cell
activity was determined periodically over a 2-week period. As
shown in Figure 4, whole-cell activity of MC4100 carrying
pUTM18 remained at essentially the original level over the
2-week period. The stability of the cells observed here is in line
with a previous report using the Tat system for the periplasmic
secretion of OPH (24). All of these results collectively suggest that
the strain expressing periplasmic MPH can be used as a whole-cell
biocatalyst for detoxification of OPs.
In Gram-positive bacteria, cells do not possess an additional
outer membrane, and cytoplasmic membrane is surrounded by a
cell wall. Proteins of up to 25-50 kDa can diffuse freely through
the cell wall (28). While the proteins are exported across the
cytoplasmic membrane, they can be released directly into the
culture medium. Extracellular secretion of MPH is advantageous
over intracellular production, as it allows the enzymes to freely
bind the extracellular substrates. Bacillus subtilis, an efficient and
safe host for recombinant protein secretion, has been found to
possess two distinct Tat translocases (29). This strategy of fusing
MPH to twin-arginine signal peptide has enormous potential for
the extracellular secretion of MPH in Bacillus subtilis. This work
is currently under investigation.
chlorpyrifos (18). OPH activity is dependent on divalent cation,
while MPH requires no cofactor for maintaining its activity. There-
fore, MPH-based biocatalysis systems are advantageous over OPH-
based systems for large-scale detoxification of specific OPs.
ACKNOWLEDGMENT
We thank Prof. George Georgiou (University of Texas,
Austin) and Prof. Tracy Palmer (University of East Anglia,
U.K.) for providing E. coli MC4100 and its tat mutant strains.
LITERATURE CITED
(1) Singh, B. K.; Walker, A. Microbial degradation of organophos-
phorus compounds. FEMS Microbiol. Rev. 2006, 30, 428–471.
(2) Shimazu, M.; Mulchandani, A.; Chen, W. Simultaneous degrada-
tion of organophosphorus pesticides and p-nitrophenol by a geneti-
cally engineered Moraxella sp. with surface-expressed organophos-
phorus hydrolase. Biotechnol. Bioeng. 2001, 76, 318–324.
(3) Sogorb, M. A.; Vilanova, E.; Carrera, V. Future application of phos-
photriesterases in the prophylaxis and treatment of organophos-
phorus insecticide and nerve agent poisoning. Toxicol. Lett. 2004,
151, 219–233.
Biodegradation of Organophosphorus Pesticides by Periplasmic
Expression Strain. The degradation rates for four different
pesticides were measured using the periplasmic- and cytoplasmic-
expressing strains. As shown in Figure 5, the periplasmic expres-
sion strain carrying pUTM18 degraded these pesticides 3-fold
faster than the cytoplasmic expression strain carrying pUM18,
which indicated that periplasmic secretion of MPH in E. coli
improved whole-cell biocatalytic efficiency by reducing the sub-
strate diffusion barrier. E. coli is still the most commonly used
host for recombinant protein expression because of its fast
growth, ease of transformation, and known genetic background.
Recombinant E. coli strains overexpressing atrazine chloro-
hydrolase have been applied for in situ bioremediation of
atrazine-contaminated soil (30). We are currently investigating
the degradation oforganophosphorus compounds in a bioreactor
with the E. coli strain expressing periplasmic MPH.
At present, OPH-based biocatalysis systems have been devel-
oped for detoxification of OPs (2, 6, 7, 24). To date, 26
organophosphorus pesticides, which contain dimethyl alkyl
groups, are available commercially (31). OPH has been shown
to lack any hydrolytic activity toward numerous dimethyl
OPs (32). In contrast, MPH has shown its capability for hydro-
lyzing numerous dimethyl OPs (17). In the U.S., chlorpyrifos
accounts for 11% of total pesticide use (1). However, chlorpyrifos
is hydrolyzed by OPH ∼1200-fold less efficiently than para-
oxon (33). Recently, MPH has shown its ability to hydrolyze
(4) Mulbry, W. W.; Hams, J. F.; Kearney, P. C.; Nelson, J. O.;
McDaniel, C. S.; Wild, J. R. Identification of a plasmid-borne
parathion hydrolase gene from Flavobacterium sp. by Southern
hybridization with opd from Pseudomonas diminuta. Appl. Environ.
Microbiol. 1986, 51, 926–930.
(5) Serdar, C. M.; Gibson, D. T. Enzymatic hydrolysis of organopho-
sphates: cloning and expression of a parathion hydrolase gene from
Pseudomonas diminuta. Bio/Technology 1985, 3, 567–571.
(6) Richins, R. D.; Kaneva, I.; Mulchandani, A.; Chen, W. Biodegrada-
tion of organophosphorus pesticides by surface-expressed organo-
phosphorus hydrolase. Nat. Biotechnol. 1997, 15, 984–987.
(7) Kang, D. G.; Choi, S. S.; Cha, H. J. Enhanced biodegradation of
toxic organophosphate compounds using recombinant Escherichia
coli with Sec pathway-driven periplasmic secretion of organophos-
phorus hydrolase. Biotechnol. Prog. 2006, 22, 406–410.
(8) DeLisa, M. P.; Tullman, D.; Georgiou, G. Folding quality control in
the export of proteins by the bacterial twin-arginine translocation
pathway. Proc. Natl. Acad. Sci. U.S.A. 2003, 100, 6115–6120.
(9) Lee, P. A.; Tullman-Ercek, D.; Georgiou, G. The bacterial twin-arginine
translocation pathway. Annu. Rev. Microbiol. 2006, 60, 373–395.
(10) Sargent, F.; Berks, B. C.; Palmer, T. Pathfinders and trailblazers: a
prokaryotic targeting system for transport of folded proteins. FEMS
Microbiol. Lett. 2006, 254, 198–207.
(11) Berks, B. C. A common export pathway for proteins binding
complex redox cofactors? Mol. Microbiol. 1996, 22, 393–404.
(12) Chaddock, A. M.; Mant, A.; Karnauchov, I.; Brink, S.; Herrmann,
::
R. G.; Klosgen, R. B.; Robinson, C. A new type of signal peptide:
central role of a twin-arginine motif in transfer signals for the

Article
J. Agric. Food Chem., Vol. 57, No. 19, 2009 8905
ΔpH-dependent thylakoidal protein translocase. EMBO J. 1995, 14,
2715–2722.
enterotoxins produced by use of the twin arginine translocation
system. Infect. Immun. 2005, 73, 3627–3635.
(13) Cristo
´
bal, S.; de Gier, J.-W.; Nielsen, H.; von Heijne, G. Competi-
(24) Kang, D. G.; Lim, G.-B.; Cha, H. J. Functional periplasmic secretion
of organophosphorous hydrolase using the twin-arginine transloca-
tion pathway in Escherichia coli. J. Biotechnol. 2005, 118, 379–385.
(25) Sargent, F.; Bogsch, E. G.; Stanley, N. R.; Wexler, M.; Robinson, C.;
Berks, B. C.; Palmer, T. Overlapping functions of components of a
bacterial Sec-independent protein export pathway. EMBO J. 1998,
17, 3640–3650.
(26) Bogsch, E.; Sargent, F.; Stanley, N. R.; Berks, B. C.; Robinson, C.;
Palmer, T. An essential component of a novel bacterial protein
export system with homologues in plastids and mitochondria. J. Biol.
Chem. 1998, 273, 18003–18006.
tion between Sec- and TAT-dependent protein translocation in
Escherichia coli. EMBO J. 1999, 18, 2982–2990.
(14) Gohlke, U.; Pullan, L.; McDevitt, C. A.; Porcelli, I.; de Leeuw, E.;
Palmer, T.; Saibil, H. R.; Berks, B. C. The TatA component of the twin-
arginine protein transport system forms channel complexes of variable
diameter. Proc. Natl. Acad. Sci. U.S.A. 2005, 102, 10482–10486.
(15) Alami, M.; Luke, I.; Deitermann, S.; Eisner, G.; Koch, H. G.;
::
::
Brunner, J.; Muller, M. Differential interactions between a twin-
arginine signal peptide and its translocase in Escherichia coli. Mol.
Cell 2003, 12, 937–946.
(16) Bolhuis, A.; Mathers, J. E.; Thomas, J. D.; Barrett, C. M.; Robinson,
C. TatB and TatC form a functional and structural unit of the twin-
arginine translocase from Escherichia coli. J. Biol. Chem. 2001, 276,
20213–20219.
(17) Cui, Z. L.; Li, S. P.; Fu, G. P. Isolation of methyl parathion-
degrading strain M6 and cloning of the methyl parathion hydrolase
gene. Appl. Environ. Microbiol. 2001, 67, 4922–4925.
(18) Yang, C.; Liu, N.; Guo, X. M.; Qiao, C. L. Cloning of mpd gene from
a chlorpyrifos-degrading bacterium and use of this strain in bio-
remediation of contaminated soil. FEMS Microbiol. Lett. 2006, 265,
118–125.
(19) Meissner, D.; Vollstedt, A.; van Dijl, J. M.; Freudl, R. Comparative
analysis of twin-arginine (Tat)-dependent protein secretion of a
heterologous model protein (GFP) in three different Gram-positive
bacteria. Appl. Microbiol. Biotechnol. 2007, 76, 633–642.
(20) Bolhuis, A.; Bogsch, E. G.; Robinson, C. Subunit interactions in the
twin-arginine translocase complex of Escherichia coli. FEBS Lett.
2000, 472, 88–92.
(27) Sargent, F.; Stanley, N. R.; Berks, B. C.; Palmer, T. Sec-independent
protein translocation in Escherichia coli: a distinct and pivotal role
for the TatB protein. J. Biol. Chem. 1999, 274, 36073–36082.
(28) Demchick, P.; Koch, A. L. The permeability of the wall fabric of
Escherichia coli and Bacillus subtilis. J. Bacteriol. 1996, 178, 768–773.
(29) Jongbloed, J. D. H.; Grieger, U.; Antelmann, H.; Hecker, M.;
Nijland, R.; Bron, S.; van Dijl, J. M. Two minimal Tat translocases
in Bacillus. Mol. Microbiol. 2004, 54, 1319–1325.
(30) Strong, L. C.; McTavish, H.; Sadowsky, M. J.; Wackett, L. P. Field-
scale remediation of atrazine-contaminated soil using recombinant
Escherichia coli expressing atrazine chlorohydrolase. Environ. Mi-
crobiol. 2000, 2, 91–98.
(31) Tomlin, C. The Pesticide Manual, 13th ed.; BCPC Publications:
Hampshire, U.K., 2003.
(32) Horne, I.; Sutherland, T. D.; Harcourt, R. L.; Russell, R. J.;
Oakeshott, J. G. Identification of an opd (organophosphate
degradation) gene in an Agrobacterium isolate. Appl. Environ.
Microbiol. 2002, 68, 3371–3376.
(21) Sambrook, J.; Russel, D. W. Molecular Cloning: A Laboratory
Manual, 3rd ed.; Cold Spring Harbor Laboratory Press: Cold Spring
Harbor, NY, 2001.
(33) Cho, C. M.; Mulchandani, A.; Chen, W. Altering the substrate
specificity of organophosphorus hydrolase for enhanced hydrolysis
of chlorpyrifos. Appl. Environ. Microbiol. 2004, 70, 4681–4685.
(22) Thomas, J. D.; Daniel, R. A.; Errington, J.; Robinson, C. Export of
active green fluorescent protein to the periplasm by the twin-arginine
translocase (Tat) pathway in Escherichia coli. Mol. Microbiol. 2001,
39, 47–53.
Received May 23, 2009. Revised manuscript received August 12, 2009.
Accepted August 28, 2009. This work was financially supported by the
863 Hi-Tech Research and Development Program of the People’s
Republic of China (Nos. 2007AA06Z335 and 2007AA061101).
(23) Tinker, J. K.; Erbe, J. L.; Holmes, R. K. Characterization of
fluorescent chimeras of cholera toxin and Escherichia coli heat-labile